Vitellogenin2: spermatozoon specificity and immunoprotection in mud crabs

in Reproduction
Correspondence should be addressed to H Ye; Email: haihuiye@xmu.edu.cn

As the precursor of vitellin (Vn), vitellogenin (Vg) has initially been considered as a female-specific protein involved in vitellogenesis, while it was also present in males induced by hormones or organs manipulation. Distinct from vtg1 we previously found in female mud crab Scylla paramamosain, vtg2 was intriguingly detected in male testis under normal physiological conditions in this study. Sequence analysis showed that vtg2 and vtg1 were actually two isoforms of Vg caused by different types of alternative splicing. PCR and in situ hybridization analysis revealed that vtg2 was localized only in the testicular spermatozoa, while Vn was detected in both the spermatozoa of the testis and seminal vesicle. Therefore, we speculated that Vn was initially translated in testicular spermatozoa, then migrated with spermatozoa, and finally stored in the seminal vesicle, where spermatozoa gradually accomplished maturation. We presumed that vtg2/Vn might act as an immune-relevant molecule in the male reproduction system. In the subsequent experiment, the expression of vtg2/Vn in testis was significantly induced in response to lipopolysaccharide (LPS) and lipoteichoic acid (LTA) injection at both transcriptional and translational levels. In the light of the results presented above, we deemed that vtg2/Vn is a novel candidate of immune-relevant molecules involved in immunoprotection during the spermatozoon maturation, and this research helps to open a new avenue for further exploring the role of Vg.

Abstract

As the precursor of vitellin (Vn), vitellogenin (Vg) has initially been considered as a female-specific protein involved in vitellogenesis, while it was also present in males induced by hormones or organs manipulation. Distinct from vtg1 we previously found in female mud crab Scylla paramamosain, vtg2 was intriguingly detected in male testis under normal physiological conditions in this study. Sequence analysis showed that vtg2 and vtg1 were actually two isoforms of Vg caused by different types of alternative splicing. PCR and in situ hybridization analysis revealed that vtg2 was localized only in the testicular spermatozoa, while Vn was detected in both the spermatozoa of the testis and seminal vesicle. Therefore, we speculated that Vn was initially translated in testicular spermatozoa, then migrated with spermatozoa, and finally stored in the seminal vesicle, where spermatozoa gradually accomplished maturation. We presumed that vtg2/Vn might act as an immune-relevant molecule in the male reproduction system. In the subsequent experiment, the expression of vtg2/Vn in testis was significantly induced in response to lipopolysaccharide (LPS) and lipoteichoic acid (LTA) injection at both transcriptional and translational levels. In the light of the results presented above, we deemed that vtg2/Vn is a novel candidate of immune-relevant molecules involved in immunoprotection during the spermatozoon maturation, and this research helps to open a new avenue for further exploring the role of Vg.

Introduction

Vitellogenin (Vg) is the precursor of vitellin (Vn) in egg yolk, and expressed in the females of nearly all oviparous species, including fish, amphibians, reptiles, birds, most invertebrates, and monotremes (Robinson 2008). Vg is usually produced in an extraovarian tissue and then transported by the circulation system into ovary, where it is internalized into growing oocytes via receptor-mediated endocytosis (Arukwe & Goksory 2003, Finn & Fyhn 2010). Thereafter Vg undergoes several modifications, such as specific proteolytic cleavage, to become Vn providing nutrients and energy to the embryos development (Avarre et al. 2003, Subramoniam 2011, Zhang et al. 2016). It is well known that the sites of Vg synthesis include the liver of vertebrate species (Gerber-Huber et al. 1987, Pousis et al. 2011), the intestine of nematode (Sharrock 1983), the fat body of insects (Chen & Hillen 1983, Giorgi et al. 1989), and the hepatopancreas and ovary of crustaceans (Tsutsui et al. 2000, Jia et al. 2013).

Vg was initially regarded as one of a female-specific protein (Pan et al. 1969); however, it was also reported to be synthesized in some males. Under the induction of some environmental hormones, Vg was synthesized in male fish by the estrogen (Del Giudice et al. 2012), and in male crab by the 4-nonylphenol (Ricciardi et al. 2008). Certain manipulations could also induce the synthesis of Vg, such as in andrectomized male terrestrial isopod Armadillidium vulgare (Suzuki et al. 1990) and male giant freshwater prawn Macrobrachium rosenbergii with X-organ sinus gland (XO-SG) complex removed (Wilder et al. 1994). Intriguingly, even under normal physiological conditions without any induction or treatment, Vg/Vn has also been reported in a few male species such as fish (Goodwin et al. 1992), sea urchins (Shyu et al. 1986, Unuma et al. 2010), insects (Bebas et al. 2008, Majewska et al. 2014) and crustaceans (Avarre et al. 2003, Niksirat et al. 2014, 2015, Liu et al. 2015). This suggests that, besides involving in yolk protein formation, Vg/Vn may play other roles independent of gender. In recent years, accumulating data have demonstrated that Vg fulfills important roles in innate immune responses in different species (Raikhel et al. 2002, Tong et al. 2010, Wu et al. 2015). Vg in fish acts as a multivalent pattern recognition receptor (PRR), a bactericidal molecule or an acute-phase protein in innate immunity. For instance, Vg has multiple specificities capable of identifying bacterium, virus and an antimicrobial effector, as well as causing damage to the microbes and enhancing phagocytosis (Zhang et al. 2011a).

During the last decade, molecular methods have been used to investigate the function of Vg/Vn in many crustaceans (Tsukimura et al. 2001, Avarre et al. 2003). Most studies have been focused on the mechanism of Vg/Vn involved in the vitellogenesis and its hormonal control (Subramoniam 2011). On the other hand, partial Vg genes are detected in male marine shrimp Penaeus semisulcatus and Chinese mitten crab Eriocheir sinensis (Avarre et al. 2003, Liu et al. 2015) without any induction or treatment. This suggests that Vg may also exist in male crustacean under normal physiological condition. By far, little is known about whether the Vg in male has the same structure and/or physiological function with that in female. This study attempts to investigate the above issues.

The mud crab, Scylla paramamosain, is a gonochoristic species with distinct sexual dimorphism. The male reproductive system includes testis, vas deferens (including anterior vas deferens, seminal vesicle and posterior vas deferens) and ejaculatory duct (Xu et al. 2011). Spermatozoa in S. paramamosain lack a true flagellum and are nonmotile (Zhang et al. 2010) as described in other crustacean (Kouba et al. 2015). In testis, the mature spermatozoa are agglutinated by the testicular secretion, and then transferred to the vas deferens, which are packaged inside spermatophore. During mating, the spermatophore is transferred to the seminal receptacle of the female and is stored there until the beginning of fertilization process (Guan et al. 2003).

We have previously found vtg1 (GenBank: KC734559) in female ovary and hepatopancreas of the mud crab S. paramamosain. In this study, we detected a novel Vg in the testis of the male mud crab, and obtained a full-length cDNA encoding Vg of S. paramamosain (vtg2). Genome sequence verified the male vtg2 and female vtg1 were two isoforms of Vg, caused by alternative splicing. Finally, we demonstrated the potential role of vtg2/Vn in the gonad of male mud crab might act as an immunoprotection factor in the process of spermatozoon maturation.

Materials and methods

Animals

All experimental and surgical procedures were approved by an Institutional Animal Care and Use Committee. Adult male crabs S. paramamosain (120~200g, with carapace width of 8.0~10.0cm) were obtained from the local aquatic market in Xiamen, Fujian Province, China. Before dissection, crabs were reared in rectangular tanks with seawater at a temperature of 25–29°C and a salinity of 26ppm for a week, fed with the live clam Ruditapes philippinarum. All crabs used in experiments were under normal physiological conditions without any induction or treatment. For tissues sampling, crabs were placed on ice for anesthetization before tissues dissection.

Animals at intermolt stage were used for the immune challenges with injection of lipopolysaccharide (LPS) and lipoteichoic acid (LTA) (Sigma) at a dose of 1μg suspended directly in 20μL crustacean saline (440mM NaCl, 11.3mM KCl, 13.3mM CaCl2, 26mM MgCl2, 23mM Na2SO4, 10mM HEPES, pH 7.4) for the test group and 20μL saline for the control, similar to that described in the blue crab Callinectes sapidus (Tsutsui & Chung 2012). In each group, four crabs were sampled at 0, 0.5, 1, 2, 4, 8 and 16h after injection (hpi) respectively, and testis and seminal vesicle were withdrawn for RNA and protein preparation. The control and experimental crabs were separately maintained in 75L plastic aquarium tanks and cared following the protocols of previous research (Yang et al. 2014).

RNA extraction and cDNA synthesis

All tissues were removed immediately and flash frozen in liquid nitrogen. Total RNA was extracted using TRIzol RNA isolation reagent (Invitrogen) according to the manufacturer’s instructions and the total RNA concentration, quality and integrity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Genomic DNA was removed by DNase I (Thermo Scientific) digestion and the first-strand cDNA was synthesized from 1μg total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturer’s instructions.

Cloning the full-length cDNA and gDNA of vtg2

According to the nucleotide sequence of vtg1 cDNA, five pairs of specific primers and two 3′ RACE primers (Table 1) were designed to clone the vtg2 cDNA. The PCR was performed in a 25μL reaction volume containing 2.0μL testis cDNA template, 0.5mM each of primers and 0.2U of Taq DNA polymerase (Takara Bio), using a thermal cycling profile of 3min at 94°C for 1 cycle, 30s at 94°C, 30s at 50°C, 3min at 72°C for 42 cycles; 10min at 72°C and finally held at 10°C. PCR products were analyzed by 1.0 % agarose gel and sequenced.

Table 1

Primers used in this study.

NameSequence (5′–3′)PositionPurpose
F1TGGCGAGTGCGAAGCC1Gene cloning
R1TTCCACCAGTTCTTTGACCATC1600Gene cloning and in situ hybridization
F2CAGGAGCCTCCGTTACGACTA1291Gene cloning and in situ hybridization
R2GCACATCTTGATACCGAACACTG3335Gene cloning
F3TTGGCTACGACGCCTACATTT3045Gene cloning
R3AGCAGGAATGGCACCACTACTT4974Gene cloning
F4GCTTTTATCTTTAGAGGGCAACG4588Gene cloning
R4TCGATACCGATGAGGGAGAT6417Gene cloning
F5TCGTCACCAGAATCGCTCAA6044Gene cloning
R5GCGTTCCTGCCATTGCTC7869Gene cloning
F6GGAGAGCCAAGTGACGCAGA71713′ RACE
F7GCGGGCCAACGACAGAATG78313′ RACE
F8GAGCGAGAAATCGTTCGTGACInternal control
R8GGAAGGAAGGCTGGAAGAGAGInternal control
F9CAAAGTGCTGGTGAAGAAGGAA985Real-time PCR
R9ACACGACTGAAGAGATGATGCC1148Real-time PCR

The 3′ terminal of vtg2 cDNA was obtained by the rapid amplification of cDNA ends (RACE) methods with 3′-Full RACE Kit (Takara Bio) according to the manufacturer’s instructions. Specific primers F6 and F7 are shown in Table 1. Finally, five fragments and 3′ terminal sequences of vtg2 were linked to form the full-length cDNA based on the overlapping sequences.

High-molecular-mass genomic DNA was isolated from four samples. In order to determine whether the vtg2 and vtg1 is the alternative splicing of the same mRNA, PCR was performed with five pairs of gene-specific primers F1 and R1, F2 and R2, F3 and R3, F4 and R4, F5 and R5 (Table 1) designed according to the full-length cDNA of vtg2. The PCR protocol was performed as described above.

Tissue distribution and expression profile of vtg2

Total RNA was isolated from various tissues including gill, stomach, hepatopancreas, thoracic ganglion, cerebral ganglion, testis, seminal vesicle, heart, muscle and hemocytes of four adult male crabs. The vtg2 mRNA distribution in male tissues was carried out by PCR (protocol was described above) using primer F2 and R1 (Table 1). In order to compare the relative levels of expression of vtg2 in the samples, the housekeeping gene β-actin (GenBank: GU992421) was also amplified with the same cDNA samples using the primers F8 and R8 (Table 1). The products were assessed by 1% agarose gel electrophoresis.

The fluorescent quantitative real-time PCR (qRT-PCR) was used to investigate the response of vtg2 gene to LPS and LTA at mRNA level. Gene-specific primers, F9 and R9 (Table 1) for vtg2 and F8 and R8 for β-actin, were used to amplify the corresponding products. The qRT-PCR was carried out with 2×SYBR Select Master Mix (Applied Biosystems) as per the manufacturer’s instructions in a 7500 Fast Real-time PCR System (Applied Biosystems). All experiments were performed in triplicate.

Sequence analysis and statistics

The obtained vtg2 cDNA and gDNA sequences were compared with other known Vg sequences in NCBI database using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The deduced amino acid sequence was obtained using DNAStar BioEdit software. The molecular mass and theoretical isoelectric point were predicted using the compute pI/Mw tool (http://www.expasy.org/tools/pi_tool.html). The amino acid sequences were aligned using ClustalW software. The signal peptide and other characteristic structures of Vtg2 were predicted by the UniProt program (http://www.uniprot.org/uniprot/A0A0G2ST52).

Each expression levels of gene were assayed and the cycle time (Ct) values were accessed from the PCR cycler software (7500 software v2.0.5). Fold change for the gene expression relative to control was determined by the 2−ΔΔCt method. All data were given in terms of relative mRNA expressed as mean±s.d. Statistical analysis was performed using IBM SPSS 20. The data obtained from qRT-PCR analysis were subjected to One-way Analysis of Variance (ANOVA) followed by Dunnett’s two-sided post hoc test to determine the differences in the mean values among the treatments. Significance was set at P<0.05.

Western blotting analysis

Western blotting technique was used to detect Vtg2 protein (Vn) in testis and seminal vesicle (the position was described previously (Xu et al. 2011)) and to investigate the response of Vn in seminal vesicle to LPS and LTA at protein level. Total proteins from four samples were extracted with RIPA (Solarbio, Beijing, China), then centrifuged at 5000g at 4°C for 10min, the supernatant was collected and stored at −80°C before use. Protein concentrations were determined using the BCA Protein Assay Kit (Solarbio, Beijing, China).

Each protein sample was homogenized at 50μg and subjected to 8% SDS-PAGE, and then transferred to a PVDF membrane at 100V for 1h in transfer buffer (192mM glycine, 25mM Tris, 20% methanol). After blocking with 5% BSA in PBS (137mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.4mM KH2PO4, pH 7.4) for 2h at room temperature, the membrane was incubated with rabbit anti-Vn serum (1: 5000) of the swimming crab Portunus trituberculatus (a gift from Professor Yongxu Cheng, Shanghai Ocean University, China. The preparation of antibody was presented in the reference (Zhang et al. 2011b)) overnight at 4°C. After washing in TBST (10mM Tris, 150mM NaCl, 0.2% Tween 20, pH 7.8) for three times, the membrane was incubated with HRP-conjugated goat anti-rabbit IgG (H+L) (1:5000, Multisciences, Hangzhou, China) for 1h at room temperature. For the control group, the first antibody was Rb a beta-actin (1:2000, Bioss, Beijing, China). Finally, the membrane was washed and then the signal was developed using a SuperEnhanced Chemiluminescence Detection Kit (Applygen, Beijing, China), and the protein bands were visualized by a gel imaging and analysis system (ChemiDoc XRS) (Bio-Rad).

Histology

Histological staining

Testis and seminal vesicle were dissected from adult male crabs. They were fixed in Bouin’s fixative for 12h at 4°C, dehydrated, and embedded in paraffin. Sections of 7μm thicknesses were deparaffinized, rehydrated and then stained with hematoxylin and eosin.

In situ hybridization

A 310bp fragment of vtg2 was amplified by PCR using primer F2 and R1 (Table 1) and cloned into pGEM-T vector (Promega) used as probe templates. The antisense and sense riboprobes were synthesized using a DIG-RNA Labeling Kit (Roche). The probes were stored at −80°C until used.

Testis and seminal vesicle of adult male crab were quickly dissected out and then immediately fixed in 4% paraformaldehyde (Solarbio, Beijing, China) in PBS overnight at 4°C. Tissues were dehydrated, embedded in paraffin, and then sectioned at 7μm thickness and sections were mounted on glass slides coated with poly-l-lysine (Solarbio, Beijing, China). Sections were deparaffinized, rehydrated and rinsed in PBS. Then the following protocols were carried out according to our previous description (Yang et al. 2014).

Immunohistochemistry

Sections were incubated with 3% H2O2 in PBS for 10min at room temperature to deplete endogenous peroxidase activity. After washing in PBS (3×5min), sections and smears were blocked in 5% BSA (Solarbio, Beijing, China) for 20min at room temperature, and incubated with Vn antibody diluted 1:1000 for 2h at 37°C. Meanwhile, at control groups, anti-Vn serum was replaced by PBS. After washing in PBS for another three times, sections and smears were incubated with HRP-conjugated goat anti-rabbit IgG (Maixin, Fuzhou, China) for 15min at room temperature. Sections and smears were washed with PBS and then colored with 3,3′-diaminobenzidine (Solarbio, Beijing, China). Images were taken using an Olympus BX51 microscope (Olympus) equipped with an UPlanFL 20×/0.5 numeric aperture and UPlanFL 40×/0.75 numeric aperture objective lens. Images were captured using an Olympus DP71 digital camera system and processed using Image-Pro Plus software.

Results

Cloning and sequence analysis of vtg2 cDNA and gDNA

According to the specific primers (Table 1) designed based on the vtg1 cDNA, the full-length cDNA of vtg2 was cloned from testis template (GenBank: KJ923433). The total length vtg2 cDNA is 8316bp, 5′-UTR is 1069bp (Fig. 1A), and 3′-UTR is 176bp containing two polyadenylation signals AATAAA and a poly(A) tail (Fig. 1B). The predicted ORF encoded a protein of 2356 amino acids with a deduced molecular mass of 265.68kDa and a theoretical isoelectric point (PI) of 6.81, while it had no signal peptide. Blast of the Vtg2 with other sequences from NCBI revealed that it shared high scoring amino acid identities to Vg in other crab species, i.e. 96% to S. paramamosain, 81% to C. sapidus and 80% to P. trituberculatus. One surprising result is that in different crabs, the 5′-UTR of vtg2 matched with the gDNA rather than the cDNA.

Figure 1
Figure 1

Deduced amino acid sequence and 5′ and 3′ UTRs of vtg2 of male S. paramamosain. (A) 5′ UTR (nt 1-1069) of vtg2 cDNA. Underlined sequences were identical with the first three intron of vtg1 gDNA. (B) 3′ UTR (nt 8141-8316) of vtg2 cDNA. The polyadenylation signals were underlined.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

In order to explore the structure of Vtg2, a 10.329kb gDNA (GenBank: KU987908) was obtained by PCR, and it turned out that the vtg2 gDNA sequence was the same with the vtg1 gDNA. Unlike 14 introns in the vtg1, vtg2 only contains 11 introns (I1–I11) and 12 exons (Fig. 2A). These two genes share a common gDNA sequence. Compared to vtg2 cDNA, the gDNA intron sequences are 106, 93, 124, 352, 244, 137, 380, 78, 160, 246 and 114bp respectively. These introns are in the nucleotide positions of 1601, 1747, 3472, 3724 3882, 4470, 4846, 5520, 6047, 6422 and 6701 in vtg2 cDNA respectively. BLAST search of the Vtg2 found that it has four structural domains typical of vitellogenin: the lipoprotein N-terminal domain (LPD-N), the domain of unknown function 1943 (DUF1943), the domain of unknown function 1801 (DUF1801) and the von Willebrand factor type D domain (VWD) (Khalil et al. 2011) (Fig. 2B).

Figure 2
Figure 2

Genome structure of vtg2 in S. paramamosain. (A) Exon-intron organization of vtg2 gene. Blue boxes represent exons and joining lines introns. Red and green lines indicate start and stop codons respectively. Intron number (I1–I11) and size (78–380bp) are indicated at the top and bottom of the figure. (B) Localization of predicted protein structural domains: LPD-N (vitellogenin), DUF1943, DUF1081 and VWD.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Localization of vtg2 mRNA

The expression of vtg2 mRNA in different tissues (gill, stomach, hepatopancreas, thoracic ganglion, cerebral ganglion, testis, seminal vesicle, heart, muscle and hemocytes) of male crabs was detected using PCR. As a result, the distribution was observed exclusively in the testis (Fig. 3).

Figure 3
Figure 3

Distribution of vtg2 mRNA in different tissues of male S. paramamosain.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Then, in situ hybridization was employed to investigate the specific distribution of vtg2 mRNA in male reproductive system, including testis and seminal vesicle, which is an accessory gland closely linked to testis. The positive signals were localized in the testicular spermatozoa when an antisense probe was used (Fig. 4B), while no signals was observed when a sense probe was used (Fig. 4C). However, no transcript in the spermatophore of seminal vesicle was detected whatsoever (Fig. 4E and F). Hematoxylin–eosin staining indicated the morphology of spermatogenic cells in testis (Fig. 4A) and spermatophore in seminal vesicle (Fig. 4D).

Figure 4
Figure 4

Localization of vtg2 mRNA by in situ hybridization in testis (A, B and C) and seminal vesicle (D, E and F) of male S. paramamosain. A and D: hematoxylin-eosin staining; B and E: antisense probe; C and F: sense probe. Arrows in A and B indicated spermatozoa. SG, seminal granule; SP, spermatophore.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Detection of Vn

We also detected the distribution of Vn in the male reproductive system, including the testis and the seminal vesicle. The result revealed that there was a weak band of ~250kDa visualized in the total protein of seminal vesicle, while no band was observed in testis (Fig. 5).

Figure 5
Figure 5

Detection of Vn in male reproductive system of S. paramamosain. Lanes 1: total protein of testis; Lanes 2: total protein of seminal vesicle. Molecular mass markers were indicated on the left.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Then we further explored the localization of Vn in both testis and seminal vesicle. Immunohistochemical study showed that the positive signals were localized in the testicular spermatozoa and the spermatophore of seminal vesicle in adult male crab (Fig. 6).

Figure 6
Figure 6

Localization of Vn by immunohistochemistry in testis (A, B and E) and seminal vesicle (C, D and E) of S. paramamosain. A and C: hematoxylin-eosin staining; B and D: positive immunohistochemistry; E and F: negative immunohistochemistry. SC, spermatocyte; SD, seminiferous duct; SG, seminal granule; SP, spermatophore; SZ, spermatozoa.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Expression profile of vtg2 by LPS and LTA

In order to study the immune function of vtg2, the expression of vtg2 in testis was investigated by qRT-PCR after LPS and LTA injection in S. paramamosain. Injection of LPS resulted in a significant downregulation of vtg2 expression at 0.5hpi (Fig. 7). However, its expression level reached a peak at 2dpi, then decreased at 4dpi, and recovered to normal level at 8 and 16dpi. Unlike the LPS group, injection of LTA induced a marked increase in vtg2 expression, and the expression rapidly reached a significant expression level at 0.5dpi. The maximum expression (2.5-fold) was observed at 1dpi, followed by a decrease (Fig. 7).

Figure 7
Figure 7

Expression of vtg2 in testis at different time intervals in response to LPS and LTA in S. paramamosain. Each bar represents the mean value from four determinations with standard error. The testes were collected at 0, 0.5, 1, 2, 4, 8 and 16h post-injection. Statistically significant differences (n=3; *P<0.05; #P<0.05) between the treated groups and controls are indicated by * at LPS group, # at LTA group respectively.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

The effect of injection of LPS and LTA on the expression of Vn in seminal vesicle was then investigated. Results showed that injection of LPS induced a little increase of Vn at 1hpi, and then a significant one at 8 and 16hpi respectively (Fig. 8). In contrast, injection of LTA caused a rapid and significant increase at 1 and 16hpi (Fig. 8). These results demonstrated that both LPS and LTA were able to trigger a significant increase in seminal vesicle Vn, agreeing with our above-mentioned observation of the vtg2 mRNA in testis.

Figure 8
Figure 8

Western bolt detected Vn in seminal vesicle at different time intervals in response to LPS and LTA in S. paramamosain. The protein of C, P and T groups were collected at 0, 0.5, 1, 2, 4, 8 and 16h post-injection. C, control group; P, LPS injection; T, LTA injection.

Citation: Reproduction 152, 3; 10.1530/REP-16-0188

Discussion

This study is the first to report that Vg/Vn is present in spermatozoon of the mud crab S. paramamosain, under normal physiological conditions. Vg/Vn had spermatozoa specificity and could be induced after injection of LPS and LTA. Since, we presume that the Vtg2/Vn in spermatozoa probably acts as an immune factor involved in immunoprotection in S. paramamosain.

Molecular characterization of vtg2

In this study, a complete cDNA of vtg2 with 8316bp was cloned from male mud crab without any induction or treatment. Comparing the sequence of vtg2 from male with the vtg1 gDNA (GenBank: KU987908) from the female crab, we found that they were similar, but vtg2 cDNA had three more sequence fragments of 224, 88 and 117bp at 5′-UTR (Fig. 1A, underlined sequences). Subsequently, a 10.329kb gDNA of vtg2, containing 11 introns (I1–I11) and 12 exons (Fig. 2), was cloned. By analysis of vtg2 and vtg1 gDNA, we were surprised to find that vtg1 and vtg2 share a common gDNA sequence, and they were actually two isoforms of Vg caused by different types of alternative splicing in the mud crab S. paramamosain. This finding was confirmed in some reported species, in which Vg usually had several isoforms encoded by a multigene family. For instance, there were four isoforms of Vg in Africa frog Xenopus laevis (Wahli et al. 1979), seven in zebrafish Danio rerio (Wang et al. 2005), two in the harvester ant Pogonomyrmex barbatus (Corona et al. 2013) and two in the sand shrimp Metapenaeus ensis (Kung et al. 2004). As to vtg2 of mud crab S. paramamosain, the first three fragments composed one exon in vtg2 gDNA, but they were introns in vtg1 gDNA. This phenomenon is called intron retention, which is a type of alternative splicing (Kung et al. 2013). Intron retention had been reported in crustacean hyperglycemic hormone (CHH) gene of crayfish Procambarus clarkii, and the cDNA of CHH2 retained a truncated segment of intron II of CHH2 gene (Kung et al. 2013). Intron retention could regulate the expression of genes, such as the model plant Arabidopsis thaliana (Ner-Gaon et al. 2004) and human genome (Ge & Porse 2014). To date, many Vgs have been obtained from some vertebrates and invertebrates, and almost all Vgs encoded by multiple genes display a similar structure (Hayward et al. 2010, Sun et al. 2013). Usually, Vg contains three conserved domains: the lipoprotein N-terminal domain (LPD-N), the domain of unknown function 143 (DUF1943) and the von Willebrand factor type D domain (VWD) (Sun & Zhang 2015). In the mud crab, structure analysis revealed that the Vtg2 also contained these three domains, and displayed a similar structure to other species. Meanwhile, it possessed the fourth domain DUF1081 with unknown function.

Localization of vtg2/Vn

So far, little is known about Vg in male crustaceans. Vg mRNA fragment has been detected in male juveniles of Chinese mitten crab E. sinensis via whole-body transcriptome analysis (Liu et al. 2015). Although a partial Vg genome sequence was present in hepatopancreas, Vg mRNA was not found in male shrimp Penaeus semisulcatus (Avarre et al. 2003). In this study, vtg2 was detected in male, which was only transcribed in the testis by PCR. In situ hybridization further confirmed that vtg2 mRNA was uniquely presented in the testicular spermatozoa (Figs 2 and 3). In addition, the distribution of vtg2 mRNA showed some difference with other male invertebrates. In previous studies, Vg was transcribed in the testis and intestine of the male sea urchins Strongylocentrotus purpuratus (Unuma et al. 2010), and in the intestine, coelomocytes and testis of the male sea urchins Pseudocentrous depressus (Shyu et al. 1986). In insects, the Vg mRNA was only synthesized in testicular somatic cyst cells in male moth Spodoptera littoralis and fruit fly Drosophila melanogaster (Bebas et al. 2008, Majewska et al. 2014). As to Vn detected in male testis in this study, it was a single polypeptide component of ~250kDa (Fig. 4), approximating the deduced molecular mass of 265.68kDa of Vtg2, and was present only in seminal vesicle other than testis. This result was different from the detection of Vn in the female mud crab, which was composed of five polypeptides (unpublished). The composition difference of Vn in male and female mud crabs might be due to different cleavages. A similar phenomenon was also observed in the giant freshwater prawn M. rosenbergii (Wilder et al. 1994). Furthermore, the localization of Vn was in testis and seminal vesicle (Fig. 6) via immunohistochemistry, which differed from its exclusive presence in the seminal vesicle via the Western blotting (Fig. 5). One possible reason for this difference was that the testis also had numerous other types of cell in addition to spermatozoa (Fig. 6A), therefore the concentration of Vn in testis was too low to be detected by Western blotting. Taken together, both of the vtg2 mRNA and Vn were present in testicular spermatozoa in mud crabs.

Immunoprotection function of vtg2/Vn

In crayfish Astacus astacus, Vg/Vn was considered to be related to the cholesterol efflux in post-mating spermatophore, which is necessary for the spermatozoon capacitation (Niksirat et al. 2015). In the testis of some other male invertebrates, Vg/Vn were found in the somatic cyst cells of the moth S. littoralis and fruit fly D. melanogaster to provide nutrition to spermatozoon (Bebas et al. 2008, Majewska et al. 2014), and in the nutritive phagocytes of the sea urchins S. purpuratus acting as a zinc carrier (Unuma et al. 2010). However, unlike the distribution in the somatic cells of testis in these three species, Vg/Vn was observed in the testicular spermatozoa in the mud crab S. paramamosain. Hence, the specific localization of vtg2/Vn arouses the issue that it might perform other functions, probably as an immune-relevant molecule (Raikhel et al. 2002, Tong et al. 2010, Wu et al. 2015). In order to explore the potential immune function of vtg2 in male mud crab S. paramamosain, the vtg2/Vn expressions were investigated at both transcriptional and translational levels. As we observed, vtg2/Vn expression was inducible at both levels, after injection of LPS and LTA into male crabs (Figs 7 and 8). This result was similar to the previous study of Vg in male zebra fish D. rerio (Tong et al. 2010). In the innate immune system, Vgs have repeatedly been reported to act as multivalent PRR, a bactericidal molecule or an acute-phase protein (Zhang et al. 2011a). As specific pathogen-associated molecular patterns (PAMPs), both LPS and LTA can be recognized by PRRs to initiate immune responses (Akira et al. 2006, Kumar et al. 2009). LPS from Gram-negative bacteria and LTA from Gram-positive bacteria are elicitors, which can specifically activate immune-related genes in insect and fish (Altincicek et al. 2008, Tong et al. 2010). Both LPS and LTA can activate the prophenoloxidase and antimicrobial peptide expression in the tobacco hornworm Manduca sexta (Rao et al. 2010) as well as Vg in male zebra fish Danio rerio (Tong et al. 2010). Consequently, we presume that the Vtg2/Vn in spermatozoa probably act as an immune factor for protection instead of as a nutritional source in the somatic cells of testis (Unuma et al. 2010). In addition to Vtg2, another immune factor, scygonadin, has been isolated from the seminal plasma in the mud crab S. paramamosain (Xu et al. 2011). Hence, some immunoprotection factors are necessary for spermatozoon maturation.

In the light of the results presented here, we speculate that Vtg2/Vn is a novel candidate of immune-relevant molecules involved in immunoprotection in the process of spermatozoon maturation, and this viewpoint helps to open a new avenue for further exploring the role of Vg.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research was supported by the Natural Science Foundation of China (31272632, 41476119 and 31472261) and the China Postdoctoral Science Foundation funded project (2016M592091).

References

  • AkiraSUematsuSTakeuchiO2006Pathogen recognition and innate immunity. Cell124783801. (doi:10.1016/j.cell.2006.02.015)

  • AltincicekBKnorrEVilcinskasA2008Beetle immunity: identification of immune-inducible genes from the model insect Tribolium castaneum. Developmental and Comparative Immunology32585595. (doi:10.1016/j.dci.2007.09.005)

    • Search Google Scholar
    • Export Citation
  • ArukweAGoksoryA2003Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comparative Hepatology24. (doi:10.1186/1476-5926-2-4)

    • Search Google Scholar
    • Export Citation
  • AvarreJCMichelisRTietzALubzensE2003Relationship between vitellogenin and vitellin in a marine shrimp (Penaeus semisulcatus) and molecular characterization of vitellogenin complementary DNAs. Biology of Reproduction69355364. (doi:10.1095/biolreprod.102.011627)

    • Search Google Scholar
    • Export Citation
  • BebasPKotwicaJJoachimiakEGiebultowiczJM2008Yolk protein is expressed in the insect testis and interacts with sperm. BMC Developmental Biology8112. (doi:10.1186/1471-213X-8-1)

    • Search Google Scholar
    • Export Citation
  • ChenTTHillenLJ1983Expression of the vitellogenin genes in insects. Gamete Research7179196. (doi:10.1002/(ISSN)1554-3919)

  • CoronaMLibbrechtRWurmYRiba-GrognusOStuderRAKellerL2013Vitellogenin underwent subfunctionalization to acquire caste and behavioral specific expression in the harvester ant Pogonomyrmex barbatus. PLoS Genetics9e1003730. (doi:10.1371/journal.pgen.1003730)

    • Search Google Scholar
    • Export Citation
  • Del GiudiceGPriscoMAgneseMVerderameMRosatiLLimatolaEAndreuccettiP2012Effects of nonylphenol on vitellogenin synthesis in adult males of the spotted ray Torpedo marmorata. Journal of Fish Biology8021122121. (doi:10.1111/jfb.2012.80.issue-5)

    • Search Google Scholar
    • Export Citation
  • FinnRNFyhnHJ2010Requirement for amino acids in ontogeny of fish. Aquaculture Research41684716. (doi:10.1111/are.2010.41.issue-5)

  • GeYPorseBT2014The functional consequences of intron retention: alternative splicing coupled to NMD as a regulator of gene expression. BioEssays36236243. (doi:10.1002/bies.201300156)

    • Search Google Scholar
    • Export Citation
  • Gerber-HuberSNardelliDHaefligerJACooperDNGivelFGermondJEEngelJGreenNMWahliW1987Precursor-product relationship between vitellogenin and the yolk proteins as derived from the complete sequence of a Xenopus vitellogenin gene. Nucleic Acids Research1547374760. (doi:10.1093/nar/15.12.4737)

    • Search Google Scholar
    • Export Citation
  • GiorgiFBradleyJTVignaliRMazziniM1989An autoradiographic analysis of vitellogenin synthesis and secretion in the fat body of the stick insect Bacillus rossius. Tissue and Cell21543558. (doi:10.1016/0040-8166(89)90007-4)

    • Search Google Scholar
    • Export Citation
  • GoodwinAEGrizzleJMBradleyJTEstridgeBH1992Monoclonal antibody-based immunoassay of vitellogenin in the blood of male channel catfish (Ictalurus punctatus). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology101441446. (doi:10.1016/0305-0491(92)90025-M)

    • Search Google Scholar
    • Export Citation
  • GuanWBStudies on the structure and function of male and female reproductive system and spermatophore artificial transfer of the mud crab Scylla serrata (Forskål). Dissertation2003. Xiamen UniversityXiamen, China.

    • Search Google Scholar
    • Export Citation
  • HaywardATakahashiTBendenaWGTobeSSHuiJH2010Comparative genomic and phylogenetic analysis of vitellogenin and other large lipid transfer proteins in metazoans. FEBS Letters58412731278. (doi:10.1016/j.febslet.2010.02.056)

    • Search Google Scholar
    • Export Citation
  • JiaXChenYZouZLinPWangYZhangZ2013Characterization and expression profile of Vitellogenin gene from Scylla paramamosain. Gene520119130. (doi:10.1016/j.gene.2013.02.035)

    • Search Google Scholar
    • Export Citation
  • KhalilSMSDonohueKVThompsonDMJeffersLAAnanthapadmanabanUSonenshineDEMitchellRDRoeRM2011Full-length sequence, regulation and developmental studies of a second vitellogenin gene from the American dog tick, Dermacentor variabilis. Journal of Insect Physiology57400408. (doi:10.1016/j.jinsphys.2010.12.008)

    • Search Google Scholar
    • Export Citation
  • KoubaANiksiratHBláhaM2015Comparative ultrastructure of spermatozoa of the redclaw Cherax quadricarinatus and the yabby Cherax destructor (Decapoda, Parastacidae). Micron695661. (doi:10.1016/j.micron.2014.11.002)

    • Search Google Scholar
    • Export Citation
  • KumarHKawaiTAkiraS2009Pathogen recognition in the innate immune response. Biochemical Journal420116. (doi:10.1042/BJ20090272)

  • KungSYChanSMHuiJHLTsangWSMakAHeJG2004Vitellogenesis in the sand shrimp, Metapenaeus ensis: the contribution from the hepatopancreas-specific vitellogenin gene (MeVtg2). Biology of Reproduction71863870. (doi:10.1095/biolreprod.103.022905)

    • Search Google Scholar
    • Export Citation
  • KungPCWuSHNagarajuGPCTsaiWSLeeCY2013Crustacean hyperglycemic hormone precursor transcripts in the hemocytes of the crayfish Procambarus clarkii: novel sequence characteristics relating to gene splicing pattern and transcript stability. General and Comparative Endocrinology1868084. (doi:10.1016/j.ygcen.2013.03.010)

    • Search Google Scholar
    • Export Citation
  • LiuYHuiMCuiZLuoDSongCLiYLiuL2015Comparative transcriptome analysis reveals sex-biased gene expression in juvenile Chinese mitten crab Eriocheir sinensis. PLoS ONE10e0133068. (doi:10.1371/journal.pone.0133068)

    • Search Google Scholar
    • Export Citation
  • MajewskaMMSuszczynskaAKotwica-RolinskaJCzerwikTPaterczykBPolanskaMABernatowiczPBebasP2014Yolk proteins in the male reproductive system of the fruit fly Drosophila melanogaster: spatial and temporal patterns of expression. Insect Biochemistry and Molecular Biology472335. (doi:10.1016/j.ibmb.2014.02.001)

    • Search Google Scholar
    • Export Citation
  • Ner-GaonHHalachmiRSavaldi-GoldsteinSRubinEOphirRFluhrR2004Intron retention is a major phenomenon in alternative splicing in Arabidopsis. Plant Journal39877885. (doi:10.1111/j.1365-313x.2004.02172.x)

    • Search Google Scholar
    • Export Citation
  • NiksiratHAnderssonLJamesPKoubaAKozákP2014Proteomic profiling of the signal crayfish Pacifastacus leniusculus egg and spermatophore. Animal Reproduction Science149335344. (doi:10.1016/j.anireprosci.2014.07.024)

    • Search Google Scholar
    • Export Citation
  • NiksiratHJamesPAnderssonLKoubaAKozákP2015Label-free protein quantification in freshly ejaculated versus post-mating spermatophores of the noble crayfish Astacus astacus. Journal of Proteomics1237077. (doi:10.1016/j.jprot.2015.04.004)

    • Search Google Scholar
    • Export Citation
  • PanMLBellWJTellerWH1969Vitellogenic blood protein synthesis by insect fat body. Science165393394. (doi:10.1126/science.165.3891.393)

  • PousisCDe GiorgiCMylonasCCBridgesCRZupaRVassallo-AgiusRde la GandaraFDileoCDe MetrioGCorrieroA2011Comparative study of liver vitellogenin gene expression and oocyte yolk accumulation in wild and captive Atlantic bluefin tuna (Thunnus thynnus L.). Animal Reproduction Science12398105. (doi:10.1016/j.anireprosci.2010.10.005)

    • Search Google Scholar
    • Export Citation
  • RaikhelASKokozaVAZhuJSMartinDWangSFLiCSunGQAhmedADittmerNAttardoG2002Molecular biology of mosquito vitellogenesis: from basic studies to genetic engineering of antipathogen immunity. Insect Biochemistry and Molecular Biology3212751286. (doi:10.1016/S0965-1748(02)00090-5)

    • Search Google Scholar
    • Export Citation
  • RaoXJYuXQ2010Lipoteichoic acid and lipopolysaccharide can activate antimicrobial peptide expression in the tobacco hornworm Manduca sexta. Developmental and Comparative Immunology3411191128. (doi:10.1016/j.dci.2010.06.007)

    • Search Google Scholar
    • Export Citation
  • RicciardiFMatozzoVMarinMG2008Effects of 4-nonylphenol exposure in mussels (Mytilus galloprovincialis) and crabs (Carcinus aestuarii) with particular emphasis on vitellogenin induction. Marine Pollution Bulletin57365372. (doi:10.1016/j.marpolbul.2008.02.023)

    • Search Google Scholar
    • Export Citation
  • RobinsonR2008For mammals, loss of yolk and gain of milk went hand in hand. PLoS Biology6e77. (doi:10.1371/journal.pbio.0060077)

  • SharrockWJ1983Yolk proteins of Caenorhabditis elegans. Developmental Biology96182188. (doi:10.1016/0012-1606(83)90321-4)

  • ShyuABRaffRABlumenthalT1986Expression of the vitellogenin gene in female and male sea urchin. PNAS8338653869. (doi:10.1073/pnas.83.11.3865)

    • Search Google Scholar
    • Export Citation
  • SubramoniamT2011Mechanisms and control of vitellogenesis in crustaceans. Fisheries Science77121. (doi:10.1007/s12562-010-0301-z)

  • SunCZhangS2015Immune-relevant and antioxidant activities of vitellogenin and yolk proteins in fish. Nutrients788188829. (doi:10.3390/nu7105432)

    • Search Google Scholar
    • Export Citation
  • SunCHuLLiuSGaoZZhangS2013Functional analysis of domain of unknown function (DUF) 1943, DUF1944 and von Willebrand factor type D domain (VWD) in vitellogenin 2 in zebrafish. Developmental and Comparative Immunology41469476. (doi:10.1016/j.dci.2013.07.005)

    • Search Google Scholar
    • Export Citation
  • SuzukiSYamasakiKKatakuraY1990Vitellogenin synthesis in andrectomized males of the terrestrial isopod, Armadillidium vulgare (Malacostracan Crustacea). General and Comparative Endocrinology77283291. (doi:10.1016/0016-6480(90)90312-A)

    • Search Google Scholar
    • Export Citation
  • TongZLiLPawarRZhangS2010Vitellogenin is an acute phase protein with bacterial-binding and inhibiting activities. Immunobiology215898902. (doi:10.1016/j.imbio.2009.10.001)

    • Search Google Scholar
    • Export Citation
  • TsukimuraB2001Crustacean vitellogenesis: its role in oocyte development. American Zoologist41465467. (doi:10.1093/icb/41.3.465)

  • TsutsuiNChungJS2012A novel putative lipoprotein receptor (CasLpR) in the hemocytes of the blue crab, Callinectes sapidus: cloning and up-regulated expression after the injection of LPS and LTA. Fish and Shellfish Immunology32469475. (doi:10.1016/j.fsi.2011.11.013)

    • Search Google Scholar
    • Export Citation
  • TsutsuiNKawazoeIOhiraTJasmaniSYangWJWilderMNAidaK2000Molecular characterization of a cDNA encoding vitellogenin and its expression in the hepatopancreas and ovary during vitellogenesis in the kuruma prawn, Penaeus japonicus. Zoological Science17651660. (doi:10.2108/zsj.17.651)

    • Search Google Scholar
    • Export Citation
  • UnumaTNakamuraAYamanoKYokotaY2010The sea urchin major yolk protein is synthesized mainly in the gut inner epithelium and the gonadal nutritive phagocytes before and during gametogenesis. Molecular Reproduction and Development775968. (doi:10.1002/mrd.21103)

    • Search Google Scholar
    • Export Citation
  • WahliWDawidIBWylerTJaggiRBWeberRRyffelGU1979Vitellogenin in Xenopus laevis is encoded in a small family of genes. Cell16535549. (doi:10.1016/0092-8674(79)90028-X)

    • Search Google Scholar
    • Export Citation
  • WangHTanJTEmelyanovAKorzhVGongZ2005Hepatic and extrahepatic expression of vitellogenin genes in the zebrafish, Danio rerio. Gene35691100. (doi:10.1016/j.gene.2005.03.041)

    • Search Google Scholar
    • Export Citation
  • WilderMNOkumuraTSuzukiYFusetaniNAidaK1994Vitellogenin production induced by eyestalk ablation in juvenile giant fresh water prawn Macrobrachium rosenbergii and trial methyl farnesoate administration. Zoological Science114553.

    • Search Google Scholar
    • Export Citation
  • WuBLiuZZhouLJiGYangA2015Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity.Developmental and Comparative Immunology49249258. (doi:10.1016/j.dci.2014.12.004)

    • Search Google Scholar
    • Export Citation
  • XuWFQiaoKHuangSPPengHHuangWSChenBChenFYBoJWangKJ2011Quantitative gene expression and in situ localization of scygonadin potentially associated with reproductive immunity in tissues of male and female mud crabs, Scylla paramamosain. Fish and Shellfish Immunology31243251. (doi:10.1016/j.fsi.2011.05.009)

    • Search Google Scholar
    • Export Citation
  • YangYBaoCLiuAYeHHuangHLiS2014Immune responses of prophenoloxidase in the mud crab Scylla paramamosain against Vibrio alginolyticus infection: in vivo and in vitro gene silencing evidence. Fish and Shellfish Immunology39237244. (doi:10.1016/j.fsi.2014.05.014)

    • Search Google Scholar
    • Export Citation
  • ZhangZPChengHWangYLWangSHXieFJLiSJ2010Acrosome reaction of sperm in the mud crab Scylla serrata as a sensitive toxicity test for metal exposures. Archives of Environmental Contamination and Toxicology5896104. (doi:10.1007/s00244-009-9326-7)

    • Search Google Scholar
    • Export Citation
  • ZhangSWangSLiHLiL2011aVitellogenin, a multivalent sensor and an antimicrobial effector. International Journal of Biochemistry and Cell Biology43303305. (doi:10.1016/j.biocel.2010.11.003)

    • Search Google Scholar
    • Export Citation
  • ZhangYWuXGYangFLiuZJChengYX2011bPurification of vitellin and ELISA determination of vitellin of swimming crab (Portunus trituberculatus).Journal of Fisheries of China3511461157.

    • Search Google Scholar
    • Export Citation
  • ZhangQLuYZhengHLiuHLiS2016Differential immune response of vitellogenin gene to Vibrio anguillarum in noble scallop Chlamys nobilis and its correlation with total carotenoid content. Fish and Shellfish Immunology501115. (doi:10.1016/j.fsi.2016.01.001)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 321 287 12
PDF Downloads 81 77 6

Altmetrics

Figures

  • View in gallery

    Deduced amino acid sequence and 5′ and 3′ UTRs of vtg2 of male S. paramamosain. (A) 5′ UTR (nt 1-1069) of vtg2 cDNA. Underlined sequences were identical with the first three intron of vtg1 gDNA. (B) 3′ UTR (nt 8141-8316) of vtg2 cDNA. The polyadenylation signals were underlined.

  • View in gallery

    Genome structure of vtg2 in S. paramamosain. (A) Exon-intron organization of vtg2 gene. Blue boxes represent exons and joining lines introns. Red and green lines indicate start and stop codons respectively. Intron number (I1–I11) and size (78–380bp) are indicated at the top and bottom of the figure. (B) Localization of predicted protein structural domains: LPD-N (vitellogenin), DUF1943, DUF1081 and VWD.

  • View in gallery

    Distribution of vtg2 mRNA in different tissues of male S. paramamosain.

  • View in gallery

    Localization of vtg2 mRNA by in situ hybridization in testis (A, B and C) and seminal vesicle (D, E and F) of male S. paramamosain. A and D: hematoxylin-eosin staining; B and E: antisense probe; C and F: sense probe. Arrows in A and B indicated spermatozoa. SG, seminal granule; SP, spermatophore.

  • View in gallery

    Detection of Vn in male reproductive system of S. paramamosain. Lanes 1: total protein of testis; Lanes 2: total protein of seminal vesicle. Molecular mass markers were indicated on the left.

  • View in gallery

    Localization of Vn by immunohistochemistry in testis (A, B and E) and seminal vesicle (C, D and E) of S. paramamosain. A and C: hematoxylin-eosin staining; B and D: positive immunohistochemistry; E and F: negative immunohistochemistry. SC, spermatocyte; SD, seminiferous duct; SG, seminal granule; SP, spermatophore; SZ, spermatozoa.

  • View in gallery

    Expression of vtg2 in testis at different time intervals in response to LPS and LTA in S. paramamosain. Each bar represents the mean value from four determinations with standard error. The testes were collected at 0, 0.5, 1, 2, 4, 8 and 16h post-injection. Statistically significant differences (n=3; *P<0.05; #P<0.05) between the treated groups and controls are indicated by * at LPS group, # at LTA group respectively.

  • View in gallery

    Western bolt detected Vn in seminal vesicle at different time intervals in response to LPS and LTA in S. paramamosain. The protein of C, P and T groups were collected at 0, 0.5, 1, 2, 4, 8 and 16h post-injection. C, control group; P, LPS injection; T, LTA injection.

References

  • AkiraSUematsuSTakeuchiO2006Pathogen recognition and innate immunity. Cell124783801. (doi:10.1016/j.cell.2006.02.015)

  • AltincicekBKnorrEVilcinskasA2008Beetle immunity: identification of immune-inducible genes from the model insect Tribolium castaneum. Developmental and Comparative Immunology32585595. (doi:10.1016/j.dci.2007.09.005)

    • Search Google Scholar
    • Export Citation
  • ArukweAGoksoryA2003Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comparative Hepatology24. (doi:10.1186/1476-5926-2-4)

    • Search Google Scholar
    • Export Citation
  • AvarreJCMichelisRTietzALubzensE2003Relationship between vitellogenin and vitellin in a marine shrimp (Penaeus semisulcatus) and molecular characterization of vitellogenin complementary DNAs. Biology of Reproduction69355364. (doi:10.1095/biolreprod.102.011627)

    • Search Google Scholar
    • Export Citation
  • BebasPKotwicaJJoachimiakEGiebultowiczJM2008Yolk protein is expressed in the insect testis and interacts with sperm. BMC Developmental Biology8112. (doi:10.1186/1471-213X-8-1)

    • Search Google Scholar
    • Export Citation
  • ChenTTHillenLJ1983Expression of the vitellogenin genes in insects. Gamete Research7179196. (doi:10.1002/(ISSN)1554-3919)

  • CoronaMLibbrechtRWurmYRiba-GrognusOStuderRAKellerL2013Vitellogenin underwent subfunctionalization to acquire caste and behavioral specific expression in the harvester ant Pogonomyrmex barbatus. PLoS Genetics9e1003730. (doi:10.1371/journal.pgen.1003730)

    • Search Google Scholar
    • Export Citation
  • Del GiudiceGPriscoMAgneseMVerderameMRosatiLLimatolaEAndreuccettiP2012Effects of nonylphenol on vitellogenin synthesis in adult males of the spotted ray Torpedo marmorata. Journal of Fish Biology8021122121. (doi:10.1111/jfb.2012.80.issue-5)

    • Search Google Scholar
    • Export Citation
  • FinnRNFyhnHJ2010Requirement for amino acids in ontogeny of fish. Aquaculture Research41684716. (doi:10.1111/are.2010.41.issue-5)

  • GeYPorseBT2014The functional consequences of intron retention: alternative splicing coupled to NMD as a regulator of gene expression. BioEssays36236243. (doi:10.1002/bies.201300156)

    • Search Google Scholar
    • Export Citation
  • Gerber-HuberSNardelliDHaefligerJACooperDNGivelFGermondJEEngelJGreenNMWahliW1987Precursor-product relationship between vitellogenin and the yolk proteins as derived from the complete sequence of a Xenopus vitellogenin gene. Nucleic Acids Research1547374760. (doi:10.1093/nar/15.12.4737)

    • Search Google Scholar
    • Export Citation
  • GiorgiFBradleyJTVignaliRMazziniM1989An autoradiographic analysis of vitellogenin synthesis and secretion in the fat body of the stick insect Bacillus rossius. Tissue and Cell21543558. (doi:10.1016/0040-8166(89)90007-4)

    • Search Google Scholar
    • Export Citation
  • GoodwinAEGrizzleJMBradleyJTEstridgeBH1992Monoclonal antibody-based immunoassay of vitellogenin in the blood of male channel catfish (Ictalurus punctatus). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology101441446. (doi:10.1016/0305-0491(92)90025-M)

    • Search Google Scholar
    • Export Citation
  • GuanWBStudies on the structure and function of male and female reproductive system and spermatophore artificial transfer of the mud crab Scylla serrata (Forskål). Dissertation2003. Xiamen UniversityXiamen, China.

    • Search Google Scholar
    • Export Citation
  • HaywardATakahashiTBendenaWGTobeSSHuiJH2010Comparative genomic and phylogenetic analysis of vitellogenin and other large lipid transfer proteins in metazoans. FEBS Letters58412731278. (doi:10.1016/j.febslet.2010.02.056)

    • Search Google Scholar
    • Export Citation
  • JiaXChenYZouZLinPWangYZhangZ2013Characterization and expression profile of Vitellogenin gene from Scylla paramamosain. Gene520119130. (doi:10.1016/j.gene.2013.02.035)

    • Search Google Scholar
    • Export Citation
  • KhalilSMSDonohueKVThompsonDMJeffersLAAnanthapadmanabanUSonenshineDEMitchellRDRoeRM2011Full-length sequence, regulation and developmental studies of a second vitellogenin gene from the American dog tick, Dermacentor variabilis. Journal of Insect Physiology57400408. (doi:10.1016/j.jinsphys.2010.12.008)

    • Search Google Scholar
    • Export Citation
  • KoubaANiksiratHBláhaM2015Comparative ultrastructure of spermatozoa of the redclaw Cherax quadricarinatus and the yabby Cherax destructor (Decapoda, Parastacidae). Micron695661. (doi:10.1016/j.micron.2014.11.002)

    • Search Google Scholar
    • Export Citation
  • KumarHKawaiTAkiraS2009Pathogen recognition in the innate immune response. Biochemical Journal420116. (doi:10.1042/BJ20090272)

  • KungSYChanSMHuiJHLTsangWSMakAHeJG2004Vitellogenesis in the sand shrimp, Metapenaeus ensis: the contribution from the hepatopancreas-specific vitellogenin gene (MeVtg2). Biology of Reproduction71863870. (doi:10.1095/biolreprod.103.022905)

    • Search Google Scholar
    • Export Citation
  • KungPCWuSHNagarajuGPCTsaiWSLeeCY2013Crustacean hyperglycemic hormone precursor transcripts in the hemocytes of the crayfish Procambarus clarkii: novel sequence characteristics relating to gene splicing pattern and transcript stability. General and Comparative Endocrinology1868084. (doi:10.1016/j.ygcen.2013.03.010)

    • Search Google Scholar
    • Export Citation
  • LiuYHuiMCuiZLuoDSongCLiYLiuL2015Comparative transcriptome analysis reveals sex-biased gene expression in juvenile Chinese mitten crab Eriocheir sinensis. PLoS ONE10e0133068. (doi:10.1371/journal.pone.0133068)

    • Search Google Scholar
    • Export Citation
  • MajewskaMMSuszczynskaAKotwica-RolinskaJCzerwikTPaterczykBPolanskaMABernatowiczPBebasP2014Yolk proteins in the male reproductive system of the fruit fly Drosophila melanogaster: spatial and temporal patterns of expression. Insect Biochemistry and Molecular Biology472335. (doi:10.1016/j.ibmb.2014.02.001)

    • Search Google Scholar
    • Export Citation
  • Ner-GaonHHalachmiRSavaldi-GoldsteinSRubinEOphirRFluhrR2004Intron retention is a major phenomenon in alternative splicing in Arabidopsis. Plant Journal39877885. (doi:10.1111/j.1365-313x.2004.02172.x)

    • Search Google Scholar
    • Export Citation
  • NiksiratHAnderssonLJamesPKoubaAKozákP2014Proteomic profiling of the signal crayfish Pacifastacus leniusculus egg and spermatophore. Animal Reproduction Science149335344. (doi:10.1016/j.anireprosci.2014.07.024)

    • Search Google Scholar
    • Export Citation
  • NiksiratHJamesPAnderssonLKoubaAKozákP2015Label-free protein quantification in freshly ejaculated versus post-mating spermatophores of the noble crayfish Astacus astacus. Journal of Proteomics1237077. (doi:10.1016/j.jprot.2015.04.004)

    • Search Google Scholar
    • Export Citation
  • PanMLBellWJTellerWH1969Vitellogenic blood protein synthesis by insect fat body. Science165393394. (doi:10.1126/science.165.3891.393)

  • PousisCDe GiorgiCMylonasCCBridgesCRZupaRVassallo-AgiusRde la GandaraFDileoCDe MetrioGCorrieroA2011Comparative study of liver vitellogenin gene expression and oocyte yolk accumulation in wild and captive Atlantic bluefin tuna (Thunnus thynnus L.). Animal Reproduction Science12398105. (doi:10.1016/j.anireprosci.2010.10.005)

    • Search Google Scholar
    • Export Citation
  • RaikhelASKokozaVAZhuJSMartinDWangSFLiCSunGQAhmedADittmerNAttardoG2002Molecular biology of mosquito vitellogenesis: from basic studies to genetic engineering of antipathogen immunity. Insect Biochemistry and Molecular Biology3212751286. (doi:10.1016/S0965-1748(02)00090-5)

    • Search Google Scholar
    • Export Citation
  • RaoXJYuXQ2010Lipoteichoic acid and lipopolysaccharide can activate antimicrobial peptide expression in the tobacco hornworm Manduca sexta. Developmental and Comparative Immunology3411191128. (doi:10.1016/j.dci.2010.06.007)

    • Search Google Scholar
    • Export Citation
  • RicciardiFMatozzoVMarinMG2008Effects of 4-nonylphenol exposure in mussels (Mytilus galloprovincialis) and crabs (Carcinus aestuarii) with particular emphasis on vitellogenin induction. Marine Pollution Bulletin57365372. (doi:10.1016/j.marpolbul.2008.02.023)

    • Search Google Scholar
    • Export Citation
  • RobinsonR2008For mammals, loss of yolk and gain of milk went hand in hand. PLoS Biology6e77. (doi:10.1371/journal.pbio.0060077)

  • SharrockWJ1983Yolk proteins of Caenorhabditis elegans. Developmental Biology96182188. (doi:10.1016/0012-1606(83)90321-4)

  • ShyuABRaffRABlumenthalT1986Expression of the vitellogenin gene in female and male sea urchin. PNAS8338653869. (doi:10.1073/pnas.83.11.3865)

    • Search Google Scholar
    • Export Citation
  • SubramoniamT2011Mechanisms and control of vitellogenesis in crustaceans. Fisheries Science77121. (doi:10.1007/s12562-010-0301-z)

  • SunCZhangS2015Immune-relevant and antioxidant activities of vitellogenin and yolk proteins in fish. Nutrients788188829. (doi:10.3390/nu7105432)

    • Search Google Scholar
    • Export Citation
  • SunCHuLLiuSGaoZZhangS2013Functional analysis of domain of unknown function (DUF) 1943, DUF1944 and von Willebrand factor type D domain (VWD) in vitellogenin 2 in zebrafish. Developmental and Comparative Immunology41469476. (doi:10.1016/j.dci.2013.07.005)

    • Search Google Scholar
    • Export Citation
  • SuzukiSYamasakiKKatakuraY1990Vitellogenin synthesis in andrectomized males of the terrestrial isopod, Armadillidium vulgare (Malacostracan Crustacea). General and Comparative Endocrinology77283291. (doi:10.1016/0016-6480(90)90312-A)

    • Search Google Scholar
    • Export Citation
  • TongZLiLPawarRZhangS2010Vitellogenin is an acute phase protein with bacterial-binding and inhibiting activities. Immunobiology215898902. (doi:10.1016/j.imbio.2009.10.001)

    • Search Google Scholar
    • Export Citation
  • TsukimuraB2001Crustacean vitellogenesis: its role in oocyte development. American Zoologist41465467. (doi:10.1093/icb/41.3.465)

  • TsutsuiNChungJS2012A novel putative lipoprotein receptor (CasLpR) in the hemocytes of the blue crab, Callinectes sapidus: cloning and up-regulated expression after the injection of LPS and LTA. Fish and Shellfish Immunology32469475. (doi:10.1016/j.fsi.2011.11.013)

    • Search Google Scholar
    • Export Citation
  • TsutsuiNKawazoeIOhiraTJasmaniSYangWJWilderMNAidaK2000Molecular characterization of a cDNA encoding vitellogenin and its expression in the hepatopancreas and ovary during vitellogenesis in the kuruma prawn, Penaeus japonicus. Zoological Science17651660. (doi:10.2108/zsj.17.651)

    • Search Google Scholar
    • Export Citation
  • UnumaTNakamuraAYamanoKYokotaY2010The sea urchin major yolk protein is synthesized mainly in the gut inner epithelium and the gonadal nutritive phagocytes before and during gametogenesis. Molecular Reproduction and Development775968. (doi:10.1002/mrd.21103)

    • Search Google Scholar
    • Export Citation
  • WahliWDawidIBWylerTJaggiRBWeberRRyffelGU1979Vitellogenin in Xenopus laevis is encoded in a small family of genes. Cell16535549. (doi:10.1016/0092-8674(79)90028-X)

    • Search Google Scholar
    • Export Citation
  • WangHTanJTEmelyanovAKorzhVGongZ2005Hepatic and extrahepatic expression of vitellogenin genes in the zebrafish, Danio rerio. Gene35691100. (doi:10.1016/j.gene.2005.03.041)

    • Search Google Scholar
    • Export Citation
  • WilderMNOkumuraTSuzukiYFusetaniNAidaK1994Vitellogenin production induced by eyestalk ablation in juvenile giant fresh water prawn Macrobrachium rosenbergii and trial methyl farnesoate administration. Zoological Science114553.

    • Search Google Scholar
    • Export Citation
  • WuBLiuZZhouLJiGYangA2015Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity.Developmental and Comparative Immunology49249258. (doi:10.1016/j.dci.2014.12.004)

    • Search Google Scholar
    • Export Citation
  • XuWFQiaoKHuangSPPengHHuangWSChenBChenFYBoJWangKJ2011Quantitative gene expression and in situ localization of scygonadin potentially associated with reproductive immunity in tissues of male and female mud crabs, Scylla paramamosain. Fish and Shellfish Immunology31243251. (doi:10.1016/j.fsi.2011.05.009)

    • Search Google Scholar
    • Export Citation
  • YangYBaoCLiuAYeHHuangHLiS2014Immune responses of prophenoloxidase in the mud crab Scylla paramamosain against Vibrio alginolyticus infection: in vivo and in vitro gene silencing evidence. Fish and Shellfish Immunology39237244. (doi:10.1016/j.fsi.2014.05.014)

    • Search Google Scholar
    • Export Citation
  • ZhangZPChengHWangYLWangSHXieFJLiSJ2010Acrosome reaction of sperm in the mud crab Scylla serrata as a sensitive toxicity test for metal exposures. Archives of Environmental Contamination and Toxicology5896104. (doi:10.1007/s00244-009-9326-7)

    • Search Google Scholar
    • Export Citation
  • ZhangSWangSLiHLiL2011aVitellogenin, a multivalent sensor and an antimicrobial effector. International Journal of Biochemistry and Cell Biology43303305. (doi:10.1016/j.biocel.2010.11.003)

    • Search Google Scholar
    • Export Citation
  • ZhangYWuXGYangFLiuZJChengYX2011bPurification of vitellin and ELISA determination of vitellin of swimming crab (Portunus trituberculatus).Journal of Fisheries of China3511461157.

    • Search Google Scholar
    • Export Citation
  • ZhangQLuYZhengHLiuHLiS2016Differential immune response of vitellogenin gene to Vibrio anguillarum in noble scallop Chlamys nobilis and its correlation with total carotenoid content. Fish and Shellfish Immunology501115. (doi:10.1016/j.fsi.2016.01.001)

    • Search Google Scholar
    • Export Citation

Cited By

PubMed

Google Scholar