Improvement of in vitro-produced bovine embryo treated with coagulansin-A under heat-stressed condition

in Reproduction

Heat stress has large effects on reproduction including conception rate in cattle. In this study, we examined the effects of coagulansin-A (coa-A), a steroidal lactone, on acquired thermo tolerance during in vitro production of bovine embryos. Oocytes were incubated in in vitro maturation (IVM) media with or without coa-A at two different temperatures, 40.5˚C and 42˚C, for 20 h. The treatment of coa-A significantly improved blastocyst development only at 40.5˚C (P < 0.05). Interestingly, immunofluorescence analysis demonstrated that coa-A induced heat shock protein 70 (HSP70) and phosphatidylinositol-3-kinase (PI3K), but significantly attenuated nuclear factor kappa B (NF-κB) and cyclooxygenase-2 (COX2). To determine the expression patterns of related genes at the transcription level, qRT-PCR was performed. Expression of HSP70 and PI3K was elevated, whereas expression of NF-κB, COX2 and inducible nitric oxide synthase (iNOS) was significantly (P < 0.05) downregulated in the coa-A-treated group compared with the control group. Moreover, pro-apoptotic genes were downregulated, and antiapoptic genes were upregulated in the coa-A group. We also counted the total cell number and apoptotic nuclei at the blastocyst and found that more cell numbers (143.1 ± 1.5) and less apoptotic damages (6.4 ± 0.5) in the coa-A treatment group comparing to control group (131.4 ± 2.0 and 10.8 ± 0.5), indicating the enhanced embryo quality. In conclusion, our results demonstrate that the coa-A not only improved the blastocyst development in vitro but also increased their resistance to heat stress condition through induction of HSP70/PI3K.

Abstract

Heat stress has large effects on reproduction including conception rate in cattle. In this study, we examined the effects of coagulansin-A (coa-A), a steroidal lactone, on acquired thermo tolerance during in vitro production of bovine embryos. Oocytes were incubated in in vitro maturation (IVM) media with or without coa-A at two different temperatures, 40.5˚C and 42˚C, for 20 h. The treatment of coa-A significantly improved blastocyst development only at 40.5˚C (P < 0.05). Interestingly, immunofluorescence analysis demonstrated that coa-A induced heat shock protein 70 (HSP70) and phosphatidylinositol-3-kinase (PI3K), but significantly attenuated nuclear factor kappa B (NF-κB) and cyclooxygenase-2 (COX2). To determine the expression patterns of related genes at the transcription level, qRT-PCR was performed. Expression of HSP70 and PI3K was elevated, whereas expression of NF-κB, COX2 and inducible nitric oxide synthase (iNOS) was significantly (P < 0.05) downregulated in the coa-A-treated group compared with the control group. Moreover, pro-apoptotic genes were downregulated, and antiapoptic genes were upregulated in the coa-A group. We also counted the total cell number and apoptotic nuclei at the blastocyst and found that more cell numbers (143.1 ± 1.5) and less apoptotic damages (6.4 ± 0.5) in the coa-A treatment group comparing to control group (131.4 ± 2.0 and 10.8 ± 0.5), indicating the enhanced embryo quality. In conclusion, our results demonstrate that the coa-A not only improved the blastocyst development in vitro but also increased their resistance to heat stress condition through induction of HSP70/PI3K.

Introduction

Bovine oocytes are used to generate in vitro-produced embryos throughout the world. Embryos are derived from immature oocytes and oocytes are obtained from slaughtered cattle, because they are easily available and inexpensive (Jeong et al. 2009). However, the efficiency of in vitro production (IVP) is poor, because the quality of the embryos produced is lower than that of in vivo (Lonergan et al. 2006). Exposure of embryos to oxidative stress (OS) has deleterious effects on their development during IVP (Guerin et al. 2001). The balance between OS and antioxidants is maintained in vivo, whereas the level of reactive oxygen species (ROS) exceeds the cellular antioxidant concentration and causes OS in vitro (Combelles et al. 2009). Withanolides obtained from Withania somnifera are widely used in India and Pakistan (Ihsan-Ul-Haq et al. 2013). Withanolides are steroidal lactones that have various pharmacological uses, have positive roles in hemoglobin improvement and weight gain and are antioxidants that scavenge ROS (Ziauddin et al. 1996). Withanolides also have a dynamic anticancer role, operating as anticancer agents in cancer cell lines by enhancing apoptosis, and are also used to treat Alzheimer’s disease, Parkinson’s disease and dementia (Wang et al. 2012). Coagulansin-A (coa-A) is a withanolide derivative, and we reported for the first time that it improves bovine embryo development in vitro in normal culture conditions (Khan et al. 2016). Various environmental factors affect the fertility of dairy animals. Of these, heat stress or heat shock is the most important, because it reduces the developmental competence of oocytes (Yadav et al. 2013). During the early stage of folliculogensis, heat stress damages the ovarian pool of oocytes (Roth et al. 2001). Heat stress also greatly affects the conception rate, and the conception rate is reduced to 20–30% during hot seasons (Cavestany et al. 1985, De Rensis et al. 2002). Heat stress reduces cytoplasmic and nuclear maturation, the functions of surrounding cumulus cells, and mitochondrial activity and induces apoptosis (Roth 2008, Hansen 2009, Nabenishi et al. 2012). Great economic losses are associated with livestock during hot seasons, because the temperature fluctuation causes heat stress that affects the fertility of cattle and other animals (Stott 1961). Special attention is needed to counterbalance the drastic effects of global warming and environmental changes on livestock by reducing losses due to heat stress.

The aim of this study was to examine the positive effect of coa-A on the development of bovine embryos in heat stress conditions in vitro.

Materials and methods

Regents and approval of experiments

All chemicals and reagents were obtained from Sigma-Aldrich. The care and use of laboratory animals as well as the experiments were performed following Gyeongsang National University guidelines and rules (approval no. GAR-110502-X0017).

Isolation and characterization of coagulansin-A

This method has been elaborated in detail in the Supplementary extended section. Briefly, the plant material was collected, sorted out for any foreign material, diseased or deteriorated parts. Then, it was shade dried with continuous agitation every 6 hourly and then crushed in a grinding mill. A total of 10-kg shade dried and crushed aerial parts without fruits (leaves and stems only) were taken and macerated in 30 L of solvent by occasional shaking for 3 days. Mixture of chloroform and methanol (1:1) was used as extraction solvent. Filtrate of extraction was dried by vacuum distillation. It was then subjected to solvent extraction and normal phase preparative chromatography to isolate 50 mg of coagulansin-A. The compound was characterized by performing 2D NMR and LC–MS experiments, and purity was 98.6% (Ihsan-Ul-Haq et al. 2013).

Experimental design

The goal of this study was to determine the protective effect of coa-A against heat stress in IVM media for blastocyst development. For this purpose, the optimal concentration of coa-A (5 μM) was selected based on our previous data (Khan et al. 2016). Oocytes treated with 5 μM coa-A were compared with the untreated control group. Both the coa-A-treated and control groups were exposed to heat stress at 42°C for 2, 5, 10 and 20 h. However, at this temperature, there was no significant difference in blastocyst development between the control and coa-A-treated group. Then, we exposed both groups to a heat stress at 40.5°C for 2, 5, 10, 20 and 24 h and then cultured at a normal temperature (38.5°C). At 40.5°C, we found the significant developmental competence to blastocyst between the control and coa-A-treated group after 2 h (26.6 and 36.1), 5 h (24.7 and 32.6), 10 h (21.8 and 29.2) and 20 h (18.6 and 24.6) except 24 h (14.2 and 15.2). We focused on blastocyst development at 40.5°C after 20-h heat stress, because it was the maximum time up to which the coa-A shows its activity for blastocyst development. The study was completed in six replications.

Recovery of cumulus-oocyte complexes (COCs)

Ovaries of Korean native cows (Hanwoo) were obtained from a local abattoir, placed in physiological saline (0.9% NaCl) at approximately 35˚C and transported to the laboratory within 2 h after slaughter. Ovaries were washed with Dulbecco’s phosphate-buffered saline (D-PBS), and COCs were recovered as described by Deb and coworkers (Deb et al. 2011). In brief, an 18-gauge needle attached to a vacuum pump was used to aspirate COCs from follicles with a diameter of 2–8 mm. The fluid obtained from follicles was expelled into ϕ 100 mm petri dishes containing TL-HEPES medium (114 mM sodium chloride, 3.2 mM potassium chloride, 2 mM sodium bicarbonate, 0.34 mM sodium biphosphate, 10 mM sodium lactate, 0.5 mM magnesium chloride, 2 mM calcium chloride, 10 mM HEPES, 1 µL/mL phenol red, 100 IU/mL penicillin and 0.1 mg/mL streptomycin) and imaged with a stereomicroscope. Good-quality oocytes with more than three layers of compact cumulus cells and homogenous cytoplasm were selected for maturation and then washed three times in TL-HEPES medium.

In vitro maturation (IVM) of oocytes

After selection, COCs were cultured in IVM medium as described by Deb and coworkers (Deb et al. 2011). In brief, the COCs were washed three times in IVM medium (TCM-199) supplemented with 10% (v/v) fetal bovine serum (FBS), 1 mg/mL estradiol-17β, 10 mg/mL follicle-stimulating hormone, 0.6 µM cysteine and 0.2 µM sodium pyruvate, and then transferred to a 4-well dish containing 600 µL of IVM media in a humidified atmosphere of 5% CO2 in air at 38.5˚C for 22–24 h.

In vitro fertilization (IVF) followed by in vitro culture

Matured COCs were fertilized as described by Deb and coworkers (Deb et al. 2011). Semen was thawed in water at 37˚C for 1 min, and sperm were washed and pelleted in D-PBS by centrifugation at 750 g, room temperature for 5 min. The pellet was resuspended in 500 µL of heparin (20 µg/mL) prepared in IVF medium (Tyrode’s lactate solution supplemented with 6 mg/mL bovine serum albumin (BSA), 22 mg/mL sodium pyruvate, 100 IU/mL penicillin and 0.1 mg/mL streptomycin) and incubated in a humidified atmosphere of 5% CO2 in air at 38.5˚C for 15 min (to facilitate capacitation). The sperm pellet was diluted in IVF medium (final density of 1–2 × 106 sperms/mL). Matured oocytes were transferred to IVF medium (600 µL) containing sperm for 18–20 h. After IVF, cumulus cells were removed by pipetting, and denuded presumed zygotes were placed in 600 µL of CR1-aa medium (Rosenkrans et al. 1993) supplemented with 44 µg/mL sodium pyruvate, 14.6 µg/mL glutamine, 10 µL/mL penicillin–streptomycin, 3 mg/mL BSA and 310 µg/mL glutathione for 3 days. After checking cleavage, 8-cell stage embryos were cultured until Day 8 of embryonic development (Day 0 = day of IVF) in medium of the same composition, except that FBS replaced BSA. Day 8 blastocysts were washed three times in TL-HEPES, transferred to fixative (4% (v/v) paraformaldehyde prepared in 1 M PBS) and stored at 4˚C until cells were counted.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining

TUNEL was performed using an In Situ Cell Death Detection Kit according to the manufacturer’s protocol (Roche Diagnostics Corp.). Fixed embryos were permeabilized (0.5% (v/v) Triton X-100 and 0.1% (w/v) sodium citrate) at room temperature for 30 min and then washed twice with 0.3% (w/v) polyvinyl alcohol prepared in 1 M PBS (PVA-PBS) (Deb et al. 2011). After permeabilization, embryos were washed twice with PVA-PBS and incubated in the dark with fluorescently conjugated TUNEL at 37˚C for 1 h. TUNEL-stained embryos were then washed with PVA-PBS and incubated in PVA-PBS containing 10 µg/mL Hoechst 33342 for 10 min. After washing, blastocysts were mounted on a glass slide, and their nuclear configuration was analyzed. An epifluorescence microscope (Olympus IX71) equipped with a mercury lamp was used to determine the number of cells per blastocyst by counting Hoechst-stained cells. Red cells (TUNEL positive) were apoptotic.

Confocal microscopy (immunofluorescence analysis)

Fixed embryos were washed twice with 1 M PBS for 10 min. Embryos were incubated in proteinase K solution at 37˚C for 5 min. Embryos were incubated in blocking solution (PBS containing 5% non-immune goat serum and 0.3% Triton X-100) for 1 h after washing with PBS. Embryos were incubated overnight with primary antibodies including mouse-derived anti-phosphatidylinositol-3-kinase (PI3K), anti-heat shock protein 70 (HSP70), anti-nuclear factor kappa B (NF-κB) (Santa Cruz Biotechnology) and anti-cyclooxygenase (COX2) (Millipore, Santa Cruz Biotechnology) antibodies, and then with secondary FITC- and TRITC-conjugated antibodies (diluted 1:50 in D-PBS; Santa Cruz Biotechnology) at room temperature for 90 min. DAPI was used as a counterstain for 5 min. Embryos were mounted on glass slides with Prolong anti-fade reagent (Molecular Probes). Stained embryos were examined using a confocal laser-scanning microscope (Flouview FV 1000, Olympus). Then, the integral optical density (IOD) has been analyzed using ImageJ software (https://imagej.nih.gov/ij/). Negative control was obtained by replacing the primary antibody with goat serum, whereas positive control was obtained by checking the expression of various proteins in cumulus cells (Supplementary Fig. 1, see section on supplementary data given at the end of this article).

mRNA extraction and cDNA formation

An Arcturus PicoPure RNA Isolation Kit (Arcturus, Foster, CA USA; Cat# 12204-01) was used to extract RNA. In brief, 100 µL of extraction buffer was added to the tube and incubated at 42°C for 30 min. After incubation, the tube was centrifuged at 3000 g for 2 min, and the supernatant was transferred to a new 1.5 mL RNA-free tube. Thereafter, 200 µL of conditioning buffer was added to a column tube, incubated at room temperature for 5 min and then centrifuged at 16,000 g for 1 min. Thereafter, 100 µL of 70% ethanol was added and pipetted thoroughly. Then, the mixture was added to a column tube, centrifuged at 100 g for 2 min, and then centrifuged at 16,000 g for 30 s to remove the flow-through. Thereafter, 100 µL of wash buffer 1 was added to the column and centrifuged at 8000 g for 1 min. DNase I solution (5 µL DNase added to 35 µL of buffer RDD) was prepared and mixed gently. Then, 40 µL of the DNase I mixture was added directly to the purification column membrane and incubated at room temperature for 15 min. Thereafter, 40 µL of wash buffer 1 was added to the column and centrifuged at 8000 g for 15 s. Then, 100 µL of wash buffer 2 was added to the column, centrifuged at 16,000 g for 2 min, and then centrifuged at 16,000 g for 1 min to completely remove the wash buffer. Finally, the purification column was transferred to a new 1.5 mL RNase-free tube. Thereafter, 20 µL of elution buffer was placed into the center of the column, incubated at room temperature for 1 min, centrifuged at 1000 g for 1 min and then centrifuged at 16,000 g for 1 min. RNA samples were used immediately or stored at −80°C until use.

The RNA concentration and purity were checked using a NANO DROP 2000c machine (Thermo Fisher Scientific). The mRNA samples were reverse-transcribed into first-strand cDNA using a kit from Bio-Rad Laboratories. The 15 µL mRNA samples were transferred to a 200-µL Eppendorf tube containing 4 µL of 5× iScript Reaction Mixture and 1 µL of iScript Reverse Transcriptase. The reactions was terminated by heating at 25°C for 5 min, 42°C for 30 min and 85°C for 5 min, and finally samples were held at 4°C.

Real-time PCR analysis of target genes

Selected genes of heat shock protein 70 (HSP70), phosphatidylinositol-3-kinase (PI3K), nuclear factor kappa B (NF-κB), cyclooxygenase-2 (COX2), inducible nitric oxide synthase (iNOS), bcl-2-associated X protein (BAX), B-cell lymphoma 2 (BCL-2), cyclin-dependent kinase inhibitor (P21), tumor protein (P53) and caspase 3 were analyzed by real-time PCR. Quantitative RT-PCR was performed in duplicate using a CFX98 instrument (Bio-Rad Laboratories) with a 10-µL reaction mixture containing 0.2 mM of each bovine-specific primer (Table 1), 1× iQ SYBR Green Supermix (iQ SYBR Green Supermix kit, Bio-Rad Laboratories) and 3 µL of diluted cDNA. All cDNA samples were subjected to real-time PCR using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers to detect any variation in expression of this internal control gene. After confirming that relative GAPDH expression did not significantly differ among the samples, all transcripts were quantified using independent real-time PCR analyses. The cycling conditions were as follows: 95˚C for 3 min, followed by 44 cycles of 95˚C for 15 s, 57˚C for 20 s and 72˚C for 30 s, and a final extension at 72˚C for 5 min. Amplification was followed by melting curve analysis using progressive denaturation, during which the temperature was increased from 65˚C to 95˚C at a rate of 0.2˚C per second. Fluorescence was continuously measured during this incremental heating. Quantitative analysis was performed using the ΔΔC(t) method. The results are reported as the relative expression or n-fold difference compared with the calibrator after normalization of the transcript to the average value of the endogenous control GAPDH. The coefficients of variation of the intra- and inter-assay variance were calculated according to the formula, s.d./mean × 100, for all genes profiled by real-time PCR.

Table 1

Primer list for RT-PCR.

GenePrimer sequenceAccession no.Product size (bp)
HSP70.1F: GAGTCGTACGCCTTCAACATU0986194
R: ACTTGTCCAGCACCTTCTTC
PI3KF: TCAACCATGACTGTGTGCCANM_174574.1234
R: CCATCAGCATCAAATTGGGCA
NF-κBF: TGGCGGAATTACCTTCCATACDQ464067110
R: CATCACTCTTGCCACAACTTTC
COX2F: CTGACCCATACAAGCACGATAGDQ347627.199
R: TCGTAAAGAAGGAAGAGCAATTAGA
iNOSF: CGAGCTTCTACCTCAAGCTATCDQ676956.184
R: CTGGCCAGATGTTCCTCTATTT
P53F: CTATGAGATGTTCCGAGAGCNM_174201.2153
R: CTCTCTCTTGAGCATTGGTT
P21F: GCAAATATGGGTCTGGGAGANM_001098958.2112
R: AAATAGTCCAGGCCAGGATG
BAXF: CACCAAGAAGCTGAGCGAGTGTNM_173894118
R: TCGGAAAAAGACCTCTCGGGGA
Caspase 3F: CCCAAGTGTGACCACTGAACNM_001077840169
R: CCATTAGGCCACACTCACTG
BCL-2F: TGGATGACCGAGTACCTGAANM_001166486.1123
R: GAGACAGCCAGGAGAAATCAAA
GAPDHF: CCCAGAATATCATCCCTGCTNM_001034034185
R: CTGCTTCACCACCTTCTTGA

Statistical analysis

Results are presented as percentages. Prism 5 was used to analyze the data and total cell numbers per blastocyst. The data are presented as the mean ± standard error of mean (s.e.m.). A simple t-test and one-way ANOVA were used to detect significant differences between groups. P < 0.05 was considered significant.

Results

Cleavage and developmental rates of embryos in heat stress conditions

The cleavage rate was determined on the third day of culture. The cleavage rate was not significantly higher in the 5 µM coa-A-treated group than that in the control group after exposure to heat shock for 2 h (82.3% and 80.2%), 5 h (79.3% and 78.5%), 10 h (77.3% and 78.1%), 20 h (76.2% and 75.7%) and after 24 h (53.7% and 52.1%), respectively, but this increase in cleavage between different groups was not statistically significant. However, the percentage of Day 8 blastocysts was significantly higher (P < 0.05) in the 5 µM coa-A-treated group than that in the control group after exposure to heat shock for 2 h (36.1% and 26.6%), 5 h (32.6% and 24.7%), 10 h (29.2% and 21.8%) and 20 h (24.6% and 18.6%) respectively, but for 24-h exposure to heat shock there was no significant difference between the coa-A-treated group and the control group (15.2% and 14.2%) (Table 2).

Table 2

Cleavage and developmental rates of bovine embryos generated from oocytes treated with 5 µM coagulansin-A at heat stress condition of 40.5˚C after various time intervals.

No. (%) of embryos developed to
Exposed time for heat shock (h)TreatmentsNo. of oocytesNo. of presumed zygoteCleavageBlastocyst
2Control195172138 (80.2)a46 (26.6)a
Coa-A195170140 (82.3)a60 (36.1)b
5Control195168131 (78.5)a41 (24.7)a
Coa-A195165130 (79.3)a53(32.6)b
10Control195167129 (77.3)a35 (21.8)a
Coa-A195165129 (78.1)a47 (29.2)b
20Control265227172 (75.7)a42 (18.6)a
Coa-A265231176(76.2)a57 (24.6)b
24Control19516184 (52.1)a23 (14.2)a
Coa-A19516488 (53.7)a25 (15.2)a

This study was completed in six replications.

Values with different superscripts are significantly different (P < 0.05).

Determination of the numbers of total cells and apoptotic cells per blastocyst

The total number of cells per Day 8 blastocyst was significantly higher (P < 0.05) in the 5 µM coa-A-treated group (143.1 ± 1.5) than that in the control group (131.4 ± 2.0) (Fig. 1 and Table 2). The number of apoptotic cells per Day 8 blastocyst was significantly lower (P < 0.05) in the 5 µM coa-A-treated group (6.4 ± 0.5) than that in the control group (10.8 ± 0.5) (Fig. 1 and Table 3).

Figure 1
Figure 1

Representative images of bovine embryos stained with Hoechst 33342. Apoptotic cells were identified by TUNEL. The corresponding images were merged. (A, B, C) Control group. (A′, B′, C′) Group treated with 5 µM coagulansin-A. Scale bar, 200 µm. Apoptotic cells are indicated by yellow arrows. The graph shows the number of apoptotic cells per embryo. The symbol a shows the significant difference (P < 0.05) between the control and treated group.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Table 3

Characteristics of Day 8 blastocysts in the two groups.*

TreatmentNo. of blastocysts examinedTotal no. of cells per blastocystNo. of apoptotic cells per blastocyst
Control17131.4 ± 2.05a10.80 ± 0.52b
5 µM coa-A17143.1 ± 1.51b6.400 ± 0.47a

This study was completed in four replications.

Total number of cells and number of apoptotic cells per blastocyst are shown (mean ± s.e.); a,bvalues with different superscripts in the same column are significantly different (P < 0.05).

Induction of HSP70 and PI3K through coa-A in heat stress conditions

The role of HSP70 in the development of blastocyst was analyzed through immunofluorescence analysis. The integral optical density (IOD) of HSP70 was significantly higher (P < 0.05) in the 5 µM coa-A-treated group than that in the control group (Fig. 2). In the same way, the expression of PI3K protein was analyzed and the IOD was higher (P < 0.05) in the 5 µM coa-A-treated group than that in the control group (Fig. 3).

Figure 2
Figure 2

Confocal microscopy, showing HSP70 expression at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 µm, whereas for B and D is 20 µm.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Figure 3
Figure 3

Confocal microscopy of bovine embryos in vitro showing PI3K expression in two groups at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 µm, whereas for B and D is 20 µm.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Coa-A attenuates NF-κB and COX2 expression

Immunofluorescence analysis revealed that the IOD of NF-κB protein was lower (P < 0.05) in the 5 µM coa-A-treated group than that in the control group (Fig. 4). Similarly, it was also confirmed through confocal microscopy that the COX2 expression was significantly attenuated (P < 0.05) in the 5 µM coa-A-treated group than that in the control group (Fig. 5).

Figure 4
Figure 4

Confocal microscopy of NF-κB in two groups at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. A and C have a scale bar of 10 µm, whereas B and D have a scale bar of 20 µm.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Figure 5
Figure 5

Confocal microscopy of COX2 in two groups at a magnification of 10×. (A, B) Control group; (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 μm, whereas for B and D is 20 μm.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Immunofluorescence analysis of HSP70 and ROS (8-OxoG) in oocytes

The immunofluorescence analysis shows that the IOD of HSP70 in oocytes is significantly higher in the 5 µM coa-A-treated group than that in the control group (Fig. 6A). Similarly, the IOD of ROS (8-OxoG) in oocytes is lower in the 5 µM coa-A-treated group than that in the control group (Fig. 6B).

Figure 6
Figure 6

Confocal microscopy of HSP70 and ROS in oocytes at a magnification of 40×. (A) ROS (8-OxoG) expression, (B) HSP70 expression. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated groups. The scale bar is 700 µm.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

mRNA expression of related genes

RT-PCR was performed to determine the expression levels of ten genes including heat stress-related gene HSP70, oxidative stress-related genes; NF-κB, COX2, iNOS, PI3K, pro-apoptotic genes; P53, P21, caspase 3, BAX and anti-apoptotic gene BCL-2 and normalized against the housekeeping gene GAPDH. Expression levels of HSP70, PI3K and BCL-2 were significantly higher (P < 0.05) in the 5 µM coa-A-treated group than that in the control group. However, the expression levels of NF-κB, COX2, iNOS, P53, P21, caspase 3 and BAX were significantly lower in the 5 µM coa-A-treated group than that in the control group (Fig. 7).

Figure 7
Figure 7

Relative mRNA expression profile of various genes (I–X) in control and coa-A treated blastocysts by real-time PCR. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Discussion

During summer, when the temperature increases from June to September, the fertility rate of cattle decreases (Hansen 1997). Heat stress reduces the developmental competence of oocytes, which leads to poor fertilization (Roth et al. 2001). Heat stress perturbs oocyte maturation, which leads to poor blastocyst development (Roth & Hansan 2004a). Here, we are reporting for the first time that 5 µM coa-A treatment in IVM stage improves blastocyst development in heat stress conditions of 40.5˚C for 20 h. The blastocyst formation rate at 40.5˚C after 20-h heat shock in the control group was 18.6% in the current study, which is in close agreement with a previous study (Roth & Hansan 2004b); however, addition of 5 µM coa-A to the IVM media significantly improved this rate to 24.6%.

The numbers of apoptotic and total cells are key factors for embryo quality; the higher the number of cells in an implanted embryo, the higher the chance of live offspring being delivered (van Soom et al. 2007). In the present study, coa-A treatment in IVM media at a heat stress of 40.5˚C for 20 h improved blastocyst quality by increasing the total number of cells and decreasing the apoptotic index compared with the control group, which is in agreement with our previous findings at a normal culture temperature (Khan et al. 2016).

Heat shock proteins counterbalance the detrimental effects of any type of stress (Lindquist & Craig 1988). Among the heat shock proteins, HSP70 is very important, because its production is higher in vitro than in vivo due to the high level of stress in vitro (Sharma et al. 2012). HSP70 also protects cells during heat stress condition (Hendrey & Kola 1991) and works as a molecular chaperone in normal physiology (Ellis & van der Vies 1991). Heat shock induces apoptosis, which is blocked at various points by HSP70 (Mosser et al. 1997). We previously reported that the coa-A induces HSP70 in bovine, which improves blastocyst quality and the blastocyst formation efficiency at normal culture condition (Khan et al. 2016). In the present study, at heat stress condition, we also confirmed that coa-A improves the blastocyst formation efficiency via induction of HSP70. This improvement of blastocyst through HSP70 induction is consistent with Matwee and coworkers (Matwee et al. 2001).

The PI3K lipid kinase pathway has a very important role in cell survival and is activated during mild oxidative stress (Datta et al. 1999, Sonoda et al. 1999). PI3K is also involved in growth factor-dependent survival of diverse types of cultured cells (Scheid et al. 1995, Ulrich et al. 1998, Fruman et al. 1999). In the current study, coa-A treatment increased the expression of PI3K compared with that in the control group, and this in turn improved the survival of blastocysts through the suppression of apoptosis, which is in agreement with a previous study (Yao & Cooper 1995).

NF-κB gene was first identified as a transcription factor in 1986 (Sen & Baltimore 1986). NF-κB has a critical role in all cellular processes (Hayden & Ghosh 2008). It is a multidirectional nuclear transcription factor that has roles in inflammation, oxidative stress and apoptosis (Brasier 2006, Gilmore 2006). NF-κB is activated in the nucleus, but can be inhibited by IκB inhibition in the cytoplasm. In the present study, coa-A improved blastocyst development in heat stress conditions by attenuating NF-κB expression, which is in agreement with previous studies (Heyninck et al. 2014, Khan et al. 2016).

Inflammation in mammals is mediated and enhanced by various pro-inflammatory mediators, among which COXs are very important (Matheus et al. 2007). The COX family comprises COX1, COX2 and COX3. COX2 is the most important COX, induced in the cytoplasm and is involved in inflammatory and neoplastic processes (Thorat et al. 2013). In the current study, COX2 expression was attenuated in the 5 µM coa-A-treated group compared with that in the control group. This decrease in COX2 expression is in agreement with a previous study (Yan et al. 2015).

All organisms respond to the environmental stress through heat shock proteins (Becker & Craig 1994). HSP70 is one of the most important heat shock protein, which is found on the acrosome of bovine spermatozoa and plays a role in oocyte and sperm interaction (Kamaruddin 1988). The mRNA microinjection of HSP70 gene to oocyte increased their resistance to heat stress (Hendrey & Kola 1991). In the present study, the coa-A protects the oocytes against the heat stress through the induction of HSP70 proteins, which is in agreement with a previous report (Hendrey & Kola 1991).

Reactive oxygen species (ROS) are very harmful in high concentration and damages the spermatozoa leading to male infertility (Iwasaki & Gagnon 1992). ROS and antioxidant should be balanced for normal embryo development (Patel et al. 2007). The 8-OxoG is a common marker for ROS detection (Floyd 1990). In the present study, we found that the 5 µM of coa-A supplementation in IVM significantly reduces the ROS concentration in oocytes compared to control group, which is parallel to our previous finding (Khan et al. 2016).

In the present study, the expression levels of HSP70, PI3K, NF-κB, COX2, iNOS and BAX genes were investigated in the control and 5 µM coa-A-treated groups. Supplementation of coa-A in heat stress conditions upregulated expression of HSP70, which is in agreement with a study by Wang and coworkers (Wang et al. 2012). The coa-A increased the expression of PI3K, and this improved the blastocyst quality by suppressing apoptosis, which is in agreement with a previous study (Yao & Cooper 1995). NF-κB, COX2 and iNOS are very important genes, which favor inflammation and play a main role in cancer and neoplastic anemia (Karin et al. 2002, Thorat et al. 2013). Our results are in agreement with our previous findings (Khan et al. 2016, Zhao et al. 2016) because coa-A suppresses the expression of NF-κB and COX2 as well as iNOS. The tumor suppressor P53 and cyclin-dependent kinase inhibitor P21 have main role in early apoptosis and cell cycle arrest (Ko & Prives 1996). Similarly, the BAX and caspase 3 are also very important and working as pro-apoptotic genes (Pang et al. 2016). In contrast, the BCL-2 is an anti-apoptotic gene that suppresses the apoptosis (Guénal et al. 1997). In the present study, we found that the 5 µM coa-A significantly suppresses the expression of P53, P21, BAX and caspase 3 while induces the expression of BCL-2 and hence reduces the apoptosis, which is in agreement with Guénal and coworkers (Guénal et al. 1997).

In conclusion, as shown in Fig. 8, our results demonstrated that the heat shock (at 40.5°C) increases the ROS concentration, which results in the inflammation due to the induction of NF-κB and their subsequent COX2 and iNOS, similarly the P53 and BAX are also induces by the ROS which compromise the blastocyst quality and efficiency. The 5 µM coa-A when supplemented in the IVM media after a heat shock of 20 h at 40.5˚C induced the HSP70 and PI3K while offset the ROS and block their subsequent pathway leading to improve the blastocyst development. Furthermore, although the current findings indicate the beneficial effect of coa-A against heat shock at 40.5°C, but we also observed that this effect of coa-A was completely diminished by the condition like high temperature (42°C). This shows that this beneficial effect of coa-A is limited specifically to heat shock 40.5°C.

Figure 8
Figure 8

Proposed pathway of coagulansin-A.

Citation: Reproduction 153, 4; 10.1530/REP-16-0530

Supplementary data

This is linked to the online version of the paper at http://dx.doi.org/10.1530/REP-16-0530.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was partly supported by a grant from the Next-Generation BioGreen 21 Program (No. PJ01107703). Imran Khan, Kyeong-lim Lee, Xu Lianguang, Mesalam Ayman, Muhammad Mustafizur Rahman Chowdhury and Myeong-Don Joo were supported by a scholarship from the BK21 Plus program. Mesalam Ayman was supported by the Korean Government Scholarship Program (KGSP), Ministry of Education, Republic of Korea.

Acknowledgements

The authors are grateful to Dr Shahid Ali Shah for his kind help with confocal microscopy and antibody treatments.

References

  • BeckerJCraigEA1994Heat shock proteins as a molecular chaperon. European Journal of Biochemistry2191123. (doi:10.1111/j.1432-1033.1994.tb19910.x)

    • Search Google Scholar
    • Export Citation
  • BrasierAR2006 The NF-κB regulatory network. Cardiovascular Toxicology6111130. (doi:10.1385/CT:6:2:111)

  • CavestanyDEl-WishyAFooteR1985Effect of season and high environmental temperature on fertility of Holstein cattle. Journal of Dairy Science6814711478. (doi:10.3168/jds.S0022-0302(85)80985-1)

    • Search Google Scholar
    • Export Citation
  • CombellesCMGuptaSAgarwalA2009Could oxidative stress influence the in-vitro maturation of oocytes?Reproductive Biomedicine Online18864880. (doi:10.1016/S1472-6483(10)60038-7)

    • Search Google Scholar
    • Export Citation
  • DattaSRBrunetAGreenbergME1999Cellular survival: a play in three Akts. Genes and Development1329052927. (doi:10.1101/gad.13.22.2905)

  • De RensisFMarconiPCapelliTGattiFFacciolongoFFranziniSScaramuzziR2002Fertility in postpartum dairy cows in winter or summer following estrus synchronization and fixed time AI after the induction of an LH surge with GnRH or hCG. Theriogenology5816751687. (doi:10.1016/S0093-691X(02)01075-0)

    • Search Google Scholar
    • Export Citation
  • DebGDeySBangJChoSParkHLeeJKongI20119-Retinoic acid improves developmental competence and embryo quality during in vitro maturation of bovine oocytes through the inhibition of oocyte tumor necrosis factor-α gene expression. Journal of Animal Science8927592767. (doi:10.2527/jas.2011-3848)

    • Search Google Scholar
    • Export Citation
  • EllisRJvan der ViesSM1991Molecular chaperones. Annual Review of Biochemistry60321347. (doi:10.1146/annurev.bi.60.070191.001541)

  • FloydRA1990The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis1114471450. (doi:10.1093/carcin/11.9.1447)

  • FrumanDASnapperSBClaudineMYDavidsonLYuJYAltFWCantleyLC1999Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85a. Science283393397. (doi:10.1126/science.283.5400.393)

    • Search Google Scholar
    • Export Citation
  • GilmoreTD2006Introduction to NF-κB: players, pathways, perspectives. Oncogene2566806684. (doi:10.1038/sj.onc.1209954)

  • GuénalISidoti-de FraisseCGaumerSMignotteB1997Bcl-2 and Hsp27 act at different levels to suppress programmed cell death. Oncogene15347360. (doi:10.1038/sj.onc.1201182)

    • Search Google Scholar
    • Export Citation
  • GuerinPEl MouatassimSMenezoY2001Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Human Reproduction Update7175189. (doi:10.1093/humupd/7.2.175)

    • Search Google Scholar
    • Export Citation
  • HansenPJ1997Strategies for enhancing reproduction of lactating dairy cows exposed to heat stress. In Proceedings of the 16th Annual Convention American Embryo Transfer Association Madison pp 6272.

    • Search Google Scholar
    • Export Citation
  • HansenPJ2009Effects of heat stress on mammalian reproduction. Philosophical Transactions of the Royal Society of London B: Biological Sciences36433413350. (doi:10.1098/rstb.2009.0131)

    • Search Google Scholar
    • Export Citation
  • HaydenMSGhoshS2008Shared principles in NF-κB signaling. Cell132344362. (doi:10.1016/j.cell.2008.01.020)

  • HendreyJKolaI1991Thermolability of mouse oocytes is due to the lack of expression and/or inducibility of Hsp70. Molecular Reproduction and Development2818. (doi:10.1002/mrd.1080280102)

    • Search Google Scholar
    • Export Citation
  • HeyninckKLahtela-KakkonenMVan der VekenPHaegemanGBergheWV2014Withaferin A inhibits NF-kappaB activation by targeting cysteine 179 in IKKβ. Biochemical Pharmacology91501509. (doi:10.1016/j.bcp.2014.08.004)

    • Search Google Scholar
    • Export Citation
  • Ihsan-ul-HaqYoun UJChaiXParkEJKondratyukTPSimmonsCJChangLC2013Biologically active withanolides from Withania coagulans. Journal of Natural Products762228. (doi:10.1021/np300534x)

    • Search Google Scholar
    • Export Citation
  • IwasakiAGagnonC1992Formation of reactive oxygen species in spermatozoa of infertile men. Fertility and Sterility57409418. (doi:10.1016/S0015-0282(16)54855-9)

    • Search Google Scholar
    • Export Citation
  • JeongWJChoSJLeeHSDebGKLeeYSKwonTHKongIK2009Effect of cytoplasmic lipid content on in vitro developmental efficiency of bovine IVP embryos. Theriogenology72584589. (doi:10.1016/j.theriogenology.2009.04.015)

    • Search Google Scholar
    • Export Citation
  • KamaruddinMB1988Heat shock protein 70 in Bovine spermatogenesis and fertilization. PhD ThesisUniversity of Guelph, Ontario, Canada.

  • KarinMCaoYGretenFRLiZW2002NF-kappaB in cancer: from innocent bystander to major culprit. Nature Reviews Cancer2301310. (doi:10.1038/nrc780)

    • Search Google Scholar
    • Export Citation
  • KhanILeeKLFakruzzamanMSongSHMirzaBYanCGKongIK2016Coagulansin-A has beneficial effects on the development of bovine embryos in vitro via HSP70 induction. Bioscience Reports36e00310. (doi:10.1042/BSR20150222)

    • Search Google Scholar
    • Export Citation
  • KoLJPrivasC1996p53: puzzle and paradigm. Genes and Development1010541072. (doi:10.1101/gad.10.9.1054)

  • LindquistSCraigE1988The heat-shock proteins. Annual Review of Genetics22631677. (doi:10.1146/annurev.ge.22.120188.003215)

  • LonerganPFairTCorcoranDEvansA2006Effect of culture environment on gene expression and developmental characteristics in IVF-derived embryos. Theriogenology65137152. (doi:10.1016/j.theriogenology.2005.09.028)

    • Search Google Scholar
    • Export Citation
  • MatheusASCoelhoAMariaMSampietreSPatzinaRJukemuraJCunhaJEMMachadoMC2007Effect of inhibition of prostaglandin E2 production on pancreatic infection in experimental acute pancreatitis. HPB9392397. (doi:10.1080/13651820701646214)

    • Search Google Scholar
    • Export Citation
  • MatweeCKamaruddinMBettsDHBasrurPKingWA2001The effects of antibodies to heat shock protein 70 in fertilization and embryo development. Molecular Human Reproduction7829837

    • Search Google Scholar
    • Export Citation
  • MosserDDCaronAWBourgetLDenis-LaroseCMassieB1997Role of the human heat shock protein hsp70 in protection against stress-induced apoptosis. Molecular and Cellular Biology1753175327. (doi:10.1128/MCB.17.9.5317)

    • Search Google Scholar
    • Export Citation
  • NabenishiHOhtaHNishimotoTMoritaTAshizawaKTsuzukiY2012The effects of cysteine addition during in vitro maturation on the developmental competence, ROS, GSH and apoptosis level of bovine oocytes exposed to heat stress. Zygote20249259. (doi:10.1017/S0967199411000220)

    • Search Google Scholar
    • Export Citation
  • PangYWSunYQSunWJDuWHHaoHSZhaoSJZhuHB2016Melatonin inhibits paraquat-induced cell death in bovine preimplantation embryos. Journal of Pineal Research60155166. (doi:10.1111/jpi.12297)

    • Search Google Scholar
    • Export Citation
  • PatelOVBettegowdaAIrelandJJCoussensPMLonerganPSmithGW2007Functional genomics studies of oocyte competence: evidence that reduced transcript abundance for follistatin is associated with poor developmental competence of bovine oocytes. Reproduction13395106. (doi:10.1530/rep.1.01123)

    • Search Google Scholar
    • Export Citation
  • RosenkransCFJrZengGQMCNamaraGTSchoffPKFirstNL1993Development of bovine embryos in vitro as affected by energy substrates. Biology of Reproduction49459462. (doi:10.1095/biolreprod49.3.459)

    • Search Google Scholar
    • Export Citation
  • RothZ2008Heat stress, the follicle, and its enclosed oocyte: mechanisms and potential strategies to improve fertility in dairy cows. Reproduction in Domestic Animals43238244. (doi:10.1111/j.1439-0531.2008.01168.x)

    • Search Google Scholar
    • Export Citation
  • RothZHansenP2004aInvolvement of apoptosis in disruption of developmental competence of bovine oocytes by heat shock during maturation. Biology of Reproduction7118981906. (doi:10.1095/biolreprod.104.031690)

    • Search Google Scholar
    • Export Citation
  • RothZHansenP2004bSphingosine 1-phosphate protects bovine oocytes from heat shock during maturation. Biology of Reproduction7120722078. (doi:10.1095/biolreprod.104.031989)

    • Search Google Scholar
    • Export Citation
  • RothZAravABorAZeronYBraw-TalRWolfensonD2001Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction122737744. (doi:10.1530/rep.0.1220737)

    • Search Google Scholar
    • Export Citation
  • ScheidMPLauenerRDuronioV1995Role of phosphatidylinositol 3-OH-kinase activity in the inhibition of apoptosis in haemopoietic cells: phosphatidylinositol 3-OH-kinase inhibitors reveal a difference in signalling between interleukin-3 and granulocyte-macrophage colony stimulating factor. Biochemical Journal312159162. (doi:10.1042/bj3120159)

    • Search Google Scholar
    • Export Citation
  • SenRBaltimoreD1986Inducibility of κ immunoglobulin enhancer-binding protein NF-κB by a posttranslational mechanism. Cell47921928. (doi:10.1016/0092-8674(86)90807-X)

    • Search Google Scholar
    • Export Citation
  • SharmaGNathAPrasadSSinghalSSinghNGadeNDubeyPSaikumarG2012Expression and characterization of constitutive heat shock protein 70.1 (HSPA‐1A) gene in in vitro produced and in vivo‐derived buffalo (Bubalus bubalis) embryos. Reproduction in Domestic Animals47975983. (doi:10.1111/j.1439-0531.2012.02002.x)

    • Search Google Scholar
    • Export Citation
  • SonodaYWatanabeSMatsumotoYAizu-YokotaEKasaharaT1999FAK is the upstream signal protein of the phosphatidylinositol 3-kinase-Akt survival pathway in hydrogen peroxide-induced apoptosis of a human glioblastoma cell line. Journal of Biological Chemistry2741056610570. (doi:10.1074/jbc.274.15.10566)

    • Search Google Scholar
    • Export Citation
  • StottG1961Female and breed associated with seasonal fertility variation in dairy cattle. Journal of Dairy Science4416981704. (doi:10.3168/jds.S0022-0302(61)89942-6)

    • Search Google Scholar
    • Export Citation
  • ThoratDSahuABeheraRLohiteKDeshmukhSManeAKarnikSDokeSKunduGC2013Association of osteopontin and cyclooxygenase-2 expression with breast cancer subtypes and their use as potential biomarkers. Oncology Letters615591564. (doi:10.3892/ol.2013.1600)

    • Search Google Scholar
    • Export Citation
  • UlrichEDuwelAKauffmann-ZehAGilbertCLyonDRudkinBEvanGMartin-ZancaD1998Specific TrkA survival signals interfere with different apoptotic pathways. Oncogene16825832. (doi:10.1038/sj.onc.1201842)

    • Search Google Scholar
    • Export Citation
  • Van SoomAVandaeleLGoossensKde KruifAPeelmanL2007Gamete origin in relation to early embryo development. Theriogenology68S131S137. (doi:10.1016/j.theriogenology.2007.03.019)

    • Search Google Scholar
    • Export Citation
  • WangH-CTsaiY-LWuY-CChangF-RLiuM-HChenW-YWuC-C2012Withanolides-induced breast cancer cell death is correlated with their ability to inhibit heat protein 90. PLoS ONE7e37764. (doi:10.1371/journal.pone.0037764)

    • Search Google Scholar
    • Export Citation
  • YadavASinghKSinghMSainiNPaltaPManikRSinglaSUpadhyayRChauhanM2013Effect of physiologically relevant heat shock on development, apoptosis and expression of some genes in buffalo (Bubalus bubalis) embryos produced in vitro.Reproduction in Domestic Animals48858865. (doi:10.1111/rda.12175)

    • Search Google Scholar
    • Export Citation
  • YanBCJeonYHParkJHKimIHChoJHAhnJHChenBHTaeHJLeeJCAhnJY2015Increased cyclooxygenase-2 and nuclear factor-kappaB/p65 expression in mouse hippocampi after systemic administration of tetanus toxin. Molecular Medicine Reports1278377844. (doi:10.3892/mmr.2015.4490)

    • Search Google Scholar
    • Export Citation
  • YaoRCooperGM1995Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science26720032006. (doi:10.1126/science.7701324)

    • Search Google Scholar
    • Export Citation
  • ZhaoXMHaoHSDuWHZhaoSJWangHYWangNWangDLiuYQinTZhuHB2016Melatonin inhibits apoptosis and improves the developmental potential of vitrified bovine oocytes. Journal of Pineal Research60132141. (doi:10.1111/jpi.12290)

    • Search Google Scholar
    • Export Citation
  • ZiauddinMPhansalkarNPatkiPDiwanaySPatwardhanB1996Studies on the immunomodulatory effects of Ashwagandha. Journal of Ethnopharmacology506976. (doi:10.1016/0378-8741(95)01318-0)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 511 511 10
PDF Downloads 444 444 11

Altmetrics

Figures

  • View in gallery

    Representative images of bovine embryos stained with Hoechst 33342. Apoptotic cells were identified by TUNEL. The corresponding images were merged. (A, B, C) Control group. (A′, B′, C′) Group treated with 5 µM coagulansin-A. Scale bar, 200 µm. Apoptotic cells are indicated by yellow arrows. The graph shows the number of apoptotic cells per embryo. The symbol a shows the significant difference (P < 0.05) between the control and treated group.

  • View in gallery

    Confocal microscopy, showing HSP70 expression at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 µm, whereas for B and D is 20 µm.

  • View in gallery

    Confocal microscopy of bovine embryos in vitro showing PI3K expression in two groups at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 µm, whereas for B and D is 20 µm.

  • View in gallery

    Confocal microscopy of NF-κB in two groups at a magnification of 10×. (A, B) Control group, (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. A and C have a scale bar of 10 µm, whereas B and D have a scale bar of 20 µm.

  • View in gallery

    Confocal microscopy of COX2 in two groups at a magnification of 10×. (A, B) Control group; (C, D) coa-A treated group. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group. The scale bar for A and C is 10 μm, whereas for B and D is 20 μm.

  • View in gallery

    Confocal microscopy of HSP70 and ROS in oocytes at a magnification of 40×. (A) ROS (8-OxoG) expression, (B) HSP70 expression. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated groups. The scale bar is 700 µm.

  • View in gallery

    Relative mRNA expression profile of various genes (I–X) in control and coa-A treated blastocysts by real-time PCR. The symbol a shows the significant difference (P < 0.05) between the control and coa-A treated group.

  • View in gallery

    Proposed pathway of coagulansin-A.

Cited By

PubMed

Google Scholar