Effects of intravenous infusion of E. coli lipopolysaccharide in early pregnant cows

in Reproduction
View More View Less
  • 1 Clinic for Cattle, University of Veterinary Medicine Hannover, Hannover, Germany
  • 2 Department of Production Animal Health, University of Calgary, Calgary, Alberta, Canada
  • 3 ETH Zurich, Animal Physiology, Institute of Agricultural Sciences, Zurich, Switzerland
  • 4 Clinic of Reproductive Medicine, University of Zurich, Zurich, Switzerland

Correspondence should be addressed to K Herzog; Email: kathrin.herzog@laves.niedersachsen.de

*(K Herzog and L Debertolis contributed equally to this work)

(K Herzog is now at Lower Saxony State Office for Consumer Protection and Food Safety, Oldenburg, Germany)

The objective was to characterize effects of Escherichia coli LPS (given i.v.) on corpus luteum (CL) and embryonic viability in early pregnant cattle. Eight non-lactating German Holstein cows were given 0.5 µg/kg LPS on 35 ± 3 day (mean ± s.e.m.) of pregnancy, whereas seven heifers, 41 ± 6 day pregnant, were given 10 mL saline (control group). Transrectal B-mode examinations of the CL were done at −1, 3, 6, 12, 24, 48, 72 and 96 h relative to treatment. Blood samples were collected at −1, 0.5, 1, 2, 3, 4, 6, 9, 12, 24, 48, 72 and 96 h. At 12 and 48 h, the CL was biopsied. None of the cows still in the experiment 10 day after LPS (n = 7) had embryonic loss. In LPS-treated cows, luteal area decreased (from 4.1 to 3.1 cm2; P ≤ 0.05) within 6 h and until 48 h. Luteal blood flow decreased by 39% (P ≤ 0.05) within the first 6 h after LPS, but returned to pre-treatment values by 48 h. Plasma P4 decreased by 62% (P ≤ 0.05), reached a nadir (2.7 ± 0.6 ng/mL) at 12 h after LPS and was not restored to pre-treatment (P ≤ 0.05). In luteal tissue, mRNAs for STAR and for FGF1 were lower (P ≤ 0.05) in LPS than in saline-treated cattle at 12 h, with no difference between groups at 48 h. Levels of mRNAs for CASP3 and FGF2 were not different between groups (P > 0.05) at 12 or 48 h after treatment. In conclusion, LPS transiently suppressed CL function, but did not induce embryonic mortality.

Abstract

The objective was to characterize effects of Escherichia coli LPS (given i.v.) on corpus luteum (CL) and embryonic viability in early pregnant cattle. Eight non-lactating German Holstein cows were given 0.5 µg/kg LPS on 35 ± 3 day (mean ± s.e.m.) of pregnancy, whereas seven heifers, 41 ± 6 day pregnant, were given 10 mL saline (control group). Transrectal B-mode examinations of the CL were done at −1, 3, 6, 12, 24, 48, 72 and 96 h relative to treatment. Blood samples were collected at −1, 0.5, 1, 2, 3, 4, 6, 9, 12, 24, 48, 72 and 96 h. At 12 and 48 h, the CL was biopsied. None of the cows still in the experiment 10 day after LPS (n = 7) had embryonic loss. In LPS-treated cows, luteal area decreased (from 4.1 to 3.1 cm2; P ≤ 0.05) within 6 h and until 48 h. Luteal blood flow decreased by 39% (P ≤ 0.05) within the first 6 h after LPS, but returned to pre-treatment values by 48 h. Plasma P4 decreased by 62% (P ≤ 0.05), reached a nadir (2.7 ± 0.6 ng/mL) at 12 h after LPS and was not restored to pre-treatment (P ≤ 0.05). In luteal tissue, mRNAs for STAR and for FGF1 were lower (P ≤ 0.05) in LPS than in saline-treated cattle at 12 h, with no difference between groups at 48 h. Levels of mRNAs for CASP3 and FGF2 were not different between groups (P > 0.05) at 12 or 48 h after treatment. In conclusion, LPS transiently suppressed CL function, but did not induce embryonic mortality.

Introduction

Embryonic mortality is of cardinal importance in bovine reproduction (Zavy 1994, Lucy 2001). Embryonic mortality is usually classified into two categories, based on the time of return to estrus. In cattle with early embryonic mortality, estrus occurs before day 24 post insemination (p.i.), compatible with embryonic death before day 16 p.i., whereas in late embryonic mortality, cattle return to estrus after day 24 p.i., apparently due to death of the embryo after day 16 p.i. (Kastelic & Ginther 1989, Humblot 2001, Santos et al. 2004a). Early embryonic mortality affects ~30–40% of all inseminated cattle, substantially reducing fertility (Thatcher et al. 1994, Silke et al. 2002, Diskin & Morris 2008). Late embryonic mortality is less frequent (5–20% of inseminated cattle) but causes greater economic losses per affected animal, as it substantially prolongs calving to conception intervals (Diskin & Sreenan 1980, Sreenan & Diskin 1983, Santos et al. 2004a).

Inflammatory processes during early pregnancy have been associated with embryonic mortality in cattle (Hansen et al. 2004), attributed to production of prostaglandin F2alpha (PGF) causing luteolysis and pregnancy loss (Manns et al. 1985, Stewart et al. 2003, Inskeep 2004). In cows given Escherichia coli lipopolysaccharides (E. coli LPS) during the first, second and third trimesters of pregnancy, 6 of 10 cows aborted (three, one and two in the first, second and third trimesters, respectively). Abortions were attributed to a prolonged release of PGF (Giri et al. 1990) causing reductions in progesterone (P4), especially during the first trimester (in the absence of an extraluteal source of P4).

In a recent in vivo study, intravenous administration of E. coli LPS (model for inflammation) temporarily decreased CL size and function in diestrus cows (Herzog et al. 2012). Luteal blood flow, plasma P4 concentration and CL size decreased within 3, 9 and 24 h, respectively, after LPS. However, oestrous cycle length was unchanged. Therefore, premature luteolysis did not occur.

The aim of the present study was to investigate effects of LPS exposure on the CL and on embryonic viability in early pregnant cattle. For this purpose, peripheral P4 was used as main assessment of luteal secretory activity (Sartori et al. 2004, Lüttgenau et al. 2011). Furthermore, the relationship between endotoxin exposure and luteal function was evaluated at a subcellular level in biopsies of luteal tissue. Molecular parameters known to yield information regarding key cellular functions of the CL were selected (Niswender et al. 2000). Specifically, STAR is responsible for transportation of cholesterol to the inner mitochondrial membrane, a rate-limiting step in P4 synthesis (Stocco & Clark 1996). Furthermore, fibroblast growth factors (FGFs) participate in regulation of development and regression of the CL. In that regard, acidic and basic FGFs (FGF1 and FGF2, respectively) are increased during functional luteolysis (Doraiswamy et al. 1998, Neuvians et al. 2004); FGF2 is also involved in CL formation and controls P4 secretion (Yamashita et al. 2008); and during luteolysis, Caspase-3 (CASP3) has a pivotal role in selective destruction of key structural and functional cellular proteins (Casciola-Rosen et al. 1996, Thornberry 1998).

Materials and methods

Cattle

This study was conducted (between April 2011 and May 2012) at the Clinic for Cattle, University of Veterinary Medicine, Hannover, Germany. The experimental protocol was reviewed and approved (Lower Saxony Federal State Office for Consumer Protection and Food Safety, 33.9-42502 – 04-11/0515) and the research was conducted in accordance with German legislation on animal welfare. Eight non-lactating German Holstein cows, clinically healthy and 35 ± 3 days (mean ± s.e.m.) after insemination, were used for the LPS trial. These cows were 3.7 ± 0.8 years old.

In addition, seven German Holstein heifers from the FLI (Friedrich Loeffer Institut – Federal Research Institute for Animal Health) in Mariensee, Germany were used as a control group (Saline group; n = 7). They were 41 ± 6 days pregnant and 2.2 ± 0.3 years old, younger than the LPS-treated group (P ≤ 0.05). All cattle were tethered in stalls and given ad libitum access to hay and water.

Study design

The LPS group were subjected to an OvSynch protocol (Pursley et al. 1995), bred by timed artificial insemination, with pregnancy diagnosis (transrectal ultrasongraphy) done ~25 days after breeding. On day 35 ± 3 of pregnancy, a polyethylene catheter was inserted into a jugular vein. At 09:00 the following day, an LPS solution (0.5 µg/kg body weight of E. coli, O55:B5; L2880, Sigma Aldrich) in 10 mL sterile water (B. Braun, Melsungen) was given i.v. (over an interval of ~1 min). After administration of LPS, the jugular catheter was flushed with 25 mL 0.9% saline solution. Control heifers were bred following detection of estrus and given 10 mL of 0.9% saline solution instead of LPS on day 41 ± 6 of pregnancy.

Ultrasonography for assessment of the CL and pregnancy

Transrectal B-mode ultrasonographic examinations were done at −1, 3, 6, 12, 24, 48, 72 and 96 h relative to treatment (saline or LPS) to assess luteal size and luteal blood flow. A Logiq Book XP ultrasound scanner (General Electrics Medical Systems, Jiangsu, P.R. China), equipped with a 10.0-MHz linear-array transducer (General Electrics Yokogawa Medical Systems), was used. For luteal size, three cross-sectional images with maximal areas of the CL were recorded (using B-mode sonography) and luteal areas were measured offline (PixelFlux, version 1.0, Chameleon Software, Leipzig, Germany). If the CL had a cavity, the area of the cavity was measured and subtracted from total area (Kastelic et al. 1990). Means of the cross-sectional areas of the three images were calculated and used for statistical analyses. For luteal blood flow, power-flow Doppler was used for color blood flow mapping of the CL in various transverse sections, as described (Herzog et al. 2012).

To assess embryo/fetal viability, heartbeat was assessed with B-mode transrectal ultrasonography at 6, 12, 24, 48, 72, 96 h and at 10 days after infusion.

Blood samples and determination of plasma P4 and prostaglandin metabolites concentrations

At 1.0 h before administration of LPS or saline solution, blood samples were collected to characterize concentrations of P4 and PGFM. In addition, blood samples were collected (via the catheter) at 0.5, 1, 2, 3, 4, 6, 9, 12, 24, 48, 72 and 96 h after treatment. Samples were stored on ice (0°–4°C), centrifuged (3000 g, 15 min at 4°C) within 30 min after collection and plasma removed stored at −20°C pending analyses.

Serum P4 concentrations were determined with a commercial chemiluminescence immunoassay (Immulite, Siemens Healthcare Diagnostics). The lower detection limit was 0.5 ng/mL, and intra- and inter-assay coefficients of variation were <10%. Plasma PGFM concentrations were determined with a competitive enzyme immunoassay (Mishra et al. 2003). The PGFM-horseradish peroxidase conjugate and antiserum were supplied by Prof. Meyer (Physiology Weihenstephan, Technische Universitaet Muenchen, Freising, Germany), whereas PGFM used for the standard curve was purchased from Sigma. The antiserum had minimal (<0.01%) cross reactions with PGE2, PGEM, PGA2, PGAM and PGF (Guven & Ozsar 1993). The lowest detection limit for PGFM was 25 pg/mL. Intra- and inter-assay CVs were 3.5 and 11.4%, respectively.

CL biopsy

CL biopsies were done as described (Herzog et al. 2012) at 12 and 48 h after treatment. At each time of sampling, at least two tissue samples per animal were recovered and immediately placed in a sterile DNase- and RNase-free cryotube (Fa. Brand, Wertheim, Germany), frozen in liquid nitrogen and stored at −80°C. This enabled repeated biopsy sampling from a single CL without impairing its function, as described (Tsai et al. 2001).

RNA extraction, cDNA synthesis and real-time qPCR

Total RNA was isolated from biopsy samples using QIAzol Lysis Reagent (QIAGEN), followed by two-step quantitative real-time RT-PCR (Pistek et al. 2013). A Bioanalyzer 2100 (Agilent Technologies) and RNA 6000 Nano Kit (Agilent) were used to assess RNA Quality. Mean RIN values were 6.5 (range: 5.5–8.0). The qPCR was done with a CFX384TM Real-Time PCR Detection System (Bio-Rad) and PCR Mix SensiFast SYBR and Fluorescein Kit (Bioline, London, UK). Primers used are shown in Table 1. The cycle of quantification (Cq) was calculated after baseline subtracted curve fitting using the single threshold method (Bio-Rad CFX Manager V1.5.534.0511 software). Relative quantification of qPCR products was done as described (Livak & Schmittgen 2001). Geometric means of reference genes H3F3A, UBK3 and YWHAZ were used for normalizing mRNA expression of target genes FGF1, FGF2, STAR and CASP3, according to the BestKeeper method (Pfaffl et al. 2004).

Table 1

Sequences and accession numbers of the PCR primers for assayed genes and length, annealing temperature (AT), fluorescence acquisition (FA), and melting point (MP) temperature of the PCR products.

GeneGene symbolReference (accession no.)Forward primer (5′–3′)Reverse primer (3′–5′)PCR-product (bp)AT (°C)FA (°C)MP (°C)
PolyubiquitinUBQ3NM_174133AGATCCAGGATAAGGAAGGCATGCTCCACCTCCAGGGTGAT198608388
HistoneH3F3ANM_174133AGATCCAGGATAAGGAAGGCATGCTCCACCTCCAGGGTGAT233608087
Tyrosine 3-monooxygenaseYWHAZXM_001927228AGGCTGAGCGATATGATGACGACCCTCCAAGATGACCTAC141608187
Fibroblast growth factor 1 (acidic)FGF1NM_174055GCTGAAGGAGAAACCAGCACGTTTTCCTCCAACCTTTCCA108607582
Fibroblast growth factor 2 (basic)FGF2NM_174056TCAAAGGAGTGTGTGTGAACCAGGGCCACATACCAACTG288607582
Toll-like receptor 2TLR2NM_174197CCATGTGGAGAGGGTGTTGGGGACACAAAACAGCACTT140608185
Toll-like receptor 4TLR4NM_174198GACCCTTGCGTACAGTTGTGGTCCAGCATCTTGGTTGAT103608388
Caspase-3CASP3NM_214131AAC CTC CGT GGA TTC AAA ATCTTC AGG RTA ATC CAT TTT GTA AC114607581
Steroidogenic acute regulatorySTARXR_083945GGATTAACCAGGTTCGGCGCTCTCCTTCTTCCAGCCCTC157608489

Statistical analyses

For age, luteal size and blood flow, uterine blood flow parameters, and concentrations of P4 and PGFM, residuals within groups were visually examined for normal distribution (PROC CHART) and analyzed with a Shapiro–Wilk test (PROC UNIVARIATE). All statistical analyses were done with SAS (version 9.1, Statistical Analysis Institute Inc.).

Residuals within groups for the variable age did not differ significantly from a normal distribution. Hence, an independent two-sample Student’s t-test (PROC TTEST) was used for comparison of the mean ages of the two groups.

Residuals within groups for variables luteal blood flow (LBF), FGF1, FGF2, STAR and CASP3 also did not differ significantly from a normal distribution. Hence, these variables were submitted to a two-factorial variance analysis for repeated measurements (PROC GLM). The influence of various time points within groups was tested using repeated measurements variance analysis (PROC GLM). A Tukey’s HSD test was used to locate differences between groups. A Student’s t-test for paired samples (PROC MEANS) was used to compare measurement times within a group. Since variables P4, PGFM and luteal size (LS) did not have a normal distribution, nonparametric tests were used. Effects of measurement time on P4 and LS were submitted to a Friedman’s test (PROC SORT) and differences between groups were located using Wilcoxon’s rank-sum test (PROC NPAR1WAY). Differences between time points within a group were tested using a Wilcoxon’s signed rank test (PROC UNIVARIATE). For all statistical tests, a significance level of P ≤ 0.05 was specified. Values for LBF, FGF1, FGF2, STAR and CASP3 are expressed in text, figures and tables as mean ± standard deviation (s.d.). For P4, PGFM and LS, median and median absolute deviation (MAD) were used.

Results

Clinical response

Treatment with LPS induced various toxemia-related clinical signs, including tachycardia, tachypnoea, dyspnea, epiphora and mild diarrhea, as well as a slight increase of body temperature (maximal 39.7°C). However, all but one of the cattle were clinically normal by 12 h after treatment (Table 2). One cow was found dead 24 h after LPS treatment, with death attributed to cardiovascular failure. There were ~5 L of clotted blood in the abdominal cavity, likely due to hemorrhage from the CL biopsy site, which certainly contributed to her demise. There was no pregnancy loss during or up to 10 days after LPS treatments (≤12 h: n = 8; >12 h: n = 7) and control heifers did not have any clinical manifestations of toxemia.

Table 2

Clinical symptoms of each LPS-treated cow.

12345678
Time in relation to LPS (hh:mm)
 −01:00T 38.6°CHR 76/min RR 24/minNo abnormal clinical signs T 38.4°CHR 56/min RR 36/minNo abnormal clinical signs T 38.7°CHR 56/min RR 24/minNo abnormal clinical signsT 38.5°CHR 64/min RR 24/minNo abnormal clinical signsT 38.5°CHR 72/min RR 32/minNo abnormal clinical signsT 38.6°CHR 60/min RR 24/minNo abnormal clinical signsT 38.8°CHR 72/min RR 40/minNo abnormal clinical signsT 38.7°CHR 56/min RR 24/minNo abnormal clinical signs
 00:00–00:15TachycardiaRR to 60/min, eupneic tachypneaStanding, bright, sudden interruption of feed intakeTachycardiaRR to a maximum of 90/minMild to severe dyspnea, coughing, grunting, stridorStanding, brightPolyuriaEpiphoraStanding, brightTachycardiaRR to 52/minModerate dyspnea, coughing, mild stridorRR to 36/minMild dyspnea, coughingStanding, brightTachycardiaRR to 54/minMild dyspnea, dilated nostrils, coughingStanding, bright, sudden interruption of feed intakeStanding, brightTachycardiaRR to 56/minModerate dyspnea, coughingRR 40/minStanding, bright, nervousTachycardiaRR 90/minModerate dyspnea, coughingStanding, becomes less responsive, sudden interruption of feed intake
 00:15–00:30TachycardiaRR to a maximum of 104/minModerate dyspnea with stridor, sporadic gruntingStanding, becomes less responsive, head downTachycardiaRR 90/min, irregularModerate to severe dyspnea, frequent and deep gruntingStanding, eupneic position (head down and forward, abducted front limbs), anxious, less responsiveEructation 1–2 times per minuteStandingTachycardiaRR to 52/minModerate dyspnea, coughing, stridorTachycardiaRR 60–80/minModerate dyspnea with stridor, coughingStanding, becomes less responsive, nervous, head downPtyalismEpiphoraTachycardiaRR 54–104/minModerate to severe dyspnea with coughing, mouth breathingStanding, eupneic position (holds head forward), nervous, becomes less responsivePtyalismMild diarrheaStanding, brightTachycardiaRR to 100/minModerate to severe dyspnea with stridor, coughing, mouth breathingTachycardiaRR to 54/minModerate dyspnea, coughing Standing, bright, anxiousStanding, bright, anxiousTachycardiaRR 90/minModerate to severe dyspnea with stridor, grunting, coughing, mouth breathingMild to moderate diarrhea
 00:30–01:00TachycardiaRR to 80/minModerate dyspnea with stridor, frequent grunting, sporadic coughingUnsteadiness, alternates weight bearing on left vs right rear limbsPtyalismTachycardiaRR to 58/minSevere dyspnea with stridor, grunting, coughingUnsteady, alternates weight between rear limbsPtyalism, epiphora and seromucous nasal dischargeStanding, anxious, unresponsive, holds head downTachycardiaRR to a maximum of 60/minSevere dyspnea with stridor, grunting, coughingPtyalismModerate diarrheaTachycardiaRR 80/minModerate dyspnea with stridor, grunting, coughingStanding, anxious, unresponsive, ears coldPtyalismEpiphora and injected ESVMild diarrheaTachycardiaRR to 92/minSevere dyspnea with grunting, coughingStanding, nervous, unsteadiness, alternates weight on rear limbs,unresponsive, head downPtyalismMild diarrheaTachycardiaRR to 68/minModerate dyspnea with stridor, gruntingStanding, less responsive, unsteady, alternated weight on rear limbsPtyalismModerate diarrheaTachycardiaRR to 54/minMild dyspnea, coughingStanding, becomes less responsive, anxious Moderate diarrheaTachycardiaRR 90/minModerate to severe dyspnea with dilated nostrils, stridor, grunting, coughing, epistaxisStanding, eupneic position (head down and forward, abducted front limbs), anxious, unsteady, alternates weight between rear limbs, becomes unresponsive
 01:00–02:00T 39.4°CTachycardiaRR 52–80/minModerate dyspnea with stridorFrequent gruntingAnxious, drinks repeatedly, UnresponsivePtyalismT 38.4°CTachycardiaRR from 24 to 48/minSevere dyspnea with stridor, frequent gruntingAnxious, searches repeatedly for water but does not drink, Unresponsive, up and downPtyalism, epiphora and seromucous nasal dischargeEars cold (only apical)Injected ESVMild diarrheaT 38.8°CTachycardiaRR to 48/minModerate dyspnea with stridor, grunting, coughingStanding, is calm, but still unresponsiveInjected ESVMild diarrheaT 38.5°CTachycardiaRR 64–72/minSevere dyspnea with stridor, grunting, coughing, mouth breathingUp and down, anxious, unresponsivePtyalismEpiphora and injected ESVMild diarrhea T 39.4°CTachycardiaRR 78–88/minModerate dyspnea, stridor, gruntingStanding, eupneic position (holds head forward), anxious, unresponsive, alternates weight on rear limbsPtyalismInjected ESVTremorsT 38.6°CTachycardiaRR to 64/minModerate dyspnea, gruntingMostly standing, unresponsiveBristled hairInjected ESVT 39.3°CRR 60/minMild dyspnea, coughingUp and down anxious, unsteadiness, alternates weight between rear limbs, unresponsive, tremorsInjected ESVModerate diarrheaPtyalismInjected ESVT 38.8°CRR 90/minSevere dyspneaRecumbentModerate diarrheaTachycardiaInjected ESVHyperemic nasal mucosa
 02:00–03:00 T 39.3°CTachycardiaRR 56–60/minModerate dyspnea with stridor, frequent grunting and coughingUp and downCalm, but unresponsivePtyalismInjected ESVT 39.0°CRR 32–24/minSevere to moderate dyspnea, stridor, grunting sporadicallyMostly recumbent, frequently shifted between lying on left vs rightUnresponsiveInjected ESVModerate diarrheaOther signs tend to disappearT 38.8°CTachycardiaRR 44–36/minModerate to mild dyspnea with stridorStanding, is calm, but still unresponsive, drinks repeatedlyPtyalism disappearsInjected ESVMild diarrheaT 38.5°CTachycardiaRR 64–54/minModerate dyspnea with gruntingUp and down, calm, but unresponsivePtyalismEpiphora and injected ESVMild diarrheaT 39.0°CTachycardiaRR to 80/minModerate dyspnea, gruntingStanding, calm, but unresponsive, drinks repeatedlyInjected ESVT 38.5°CRR to 64/minMild dyspnea, gruntingMostly standing, unresponsiveInjected ESVT 39.7°CRR to 60/minMild dyspnea, stridor, grunting, coughingRecumbent, nervous, unresponsiveModerate diarrheaPtyalismInjected ESVTremorsT 38.8°CRR 90/minSevere to mild dyspneaRecumbentModerate diarrheaTachycardiaInjected ESV
 03:00–06:00 T 38.6°CTachycardia gradually decreasesRR slowed from 56 to 36/min (03:00–05:00)Moderate to mild dyspnea with gurgling and stridor; grunting and cough disappear gradually05:00 becomes calm and responsivePtyalismInjected ESV05:00–06:00 polyuriaT 38.5°CRR 27/minMild dyspnea tends to decrease, slight stridor, grunting sporadicallyMostly standing, is calm, but still unresponsiveInjected to normal ESVMild diarrheaT 38.4°bib3:00 No tachycardiaRR 36–20/minMild dyspnea tends to disappearUp and down, becomes calm and responsiveTremorsInjected ESVMild diarrheaT 38.2°CTachycardia gradually decreasesRR 40–48/minModerate to severe to mild dyspnea with stridor, grunting, coughing, gradually decreasingUp and down, head down, unresponsiveTremorsPtyalismInjected ESVMild diarrhea T 37.5°C (04:17) to 38.0°C (05:00)No tachycardia (04:17)RR to 56/minMild dyspnea, coughing, gruntingUp and down, still unresponsiveMild dehydrationTremorsInjected ESVT 39.3°CRR to 56/minMild dyspnea, gruntingMostly standing, becomes calm and responsive (4:53)Injected ESVT 39.4°C (03:06) to 39.0 (04:08)RR to 44/minMostly recumbent, becomes calm and responsiveAll signs progressively disappearT 38.8°CTachycardiaRR 90/minModerate dyspnea decreases to disappearing (03:53)Mostly standing, becomes calm and bright (03:53)Moderate diarrheaTremorsAll signs tend to disappear05:50 T, HR and RR in normal range, no abnormal clinical signs
 06:00–12:00 T 38.4°CRR 36/minMild dyspnea and stridor gradually disappeared06:00, feed and water intake restored07:50 all signs disappeared T 38.5°bib8:51 HR and RR in normal range, no abnormal clinical signsT 38.6°CMostly recumbent, calm, brightRR 24/min07:25 no abnormal clinical signsT 38.3°CRR 40/minNo dyspneaMostly recumbenbib7:15 becomes calm and responsive, feed and water intake restoredAll other signs gradually disappear09:45 no abnormal clinical signsT 38.7°CRR 44–58/minMild dyspnea only when recumbent, coughMostly recumbent, unresponsive, feed and water intake restoredInjected ESVAll other signs disappear (11:17)T 39.3°CRR to 40/minMild dyspnea, then decreasedMostly recumbent, bright, feed and water intake restored (06:00)09:03 no abnormal clinical signsT 38.8°CMostly recumbent, brighbib6:06 HR and RR in normal range, no abnormal clinical signsT 38.8°CHR and RR in normal range, no abnormal clinical signsUp and down, bright
 12:00–24:00 (end)12:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T, HR and RR in normal range, no abnormal clinical signs21:00 found dead (apparently died between 15:00 and 20:00)12:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T 38.4°CRR 40/minNo dyspneaStanding, slightly unresponsiveInjected ESV24:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T, HR and RR in normal range, no abnormal clinical signs12:00 T, HR and RR in normal range, no abnormal clinical signs

ESV, episcleral vessels; HR, heart rate; RR, respiratory rate; T, rectal temperature.

Luteal area and LBF

LS was 12% smaller (P ≤ 0.05) at 6 h after LPS treatment, reached a nadir (3.1 ± 0.3 cm2) at 12 h, remained low until 24 h, and then returned to pre-treatment values by 48 and thereafter remained unchanged (Fig. 1). For LBF, there were effects of treatment, time and a treatment by time interaction (P ≤ 0.05; Fig. 1). In LPS-treated cows, LBF decreased by 39% (P ≤ 0.05) at 6 h, reached a nadir (0.9 ± 0.2 cm2) at 12 h, and then rebounded to pre-treatment values by 48 h (Fig. 1). In control heifers, LS and LBF remained relatively stable.

Figure 1
Figure 1

Median ± MAD of luteal tissue area (panel A) and mean ± s.e.m. of luteal blood flow (panel B) in early pregnant cattle treated with E. coli lipopolysaccharide (LPS; −1 to 12 h: n = 8, 24–96 h: n = 7) or Saline (n = 7), respectively. *Values differed between LPS- and Saline-treated cattle (P ≤ 0.05). a,bWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

Citation: Reproduction 157, 1; 10.1530/REP-18-0174

Plasma P4 and PGFM concentrations

For plasma P4 concentrations, there were effects of time (P ≤ 0.05) and a treatment by time interaction (P ≤ 0.05; Fig. 2). Plasma P4 concentrations increased from 7.1 ± 0.7 to 10.3 ± 2.7 ng/mL (median ± MAD; P ≤ 0.05) within the first 30 min after administration. Thereafter, P4 decreased between consecutive measurements (P ≤ 0.05) beginning 4 h after infusion, reached a nadir (2.7 ± 0.6 ng/mL) 12 h after infusion, increased again between 24 and 48 h (P ≤ 0.05), but was not restored to pre-treatment values. In control heifers, P4 concentrations did not vary significantly between consecutive measurements during the first 12 h (P > 0.05). Progesterone concentrations decreased (P ≤ 0.05) between 12 and 24 h after saline infusion, increased again between 24 and 48 h (P ≤ 0.05) and thereafter remained constant. Plasma P4 concentrations were higher in LPS-treated than control cattle within the first 30 min after treatment (P ≤ 0.05), lower (P ≤ 0.05) in LPS-treated cattle between 9 and 12 h after treatment and higher (P ≤ 0.05) in LPS-treated cattle at 48 h.

Figure 2
Figure 2

Median ± MAD of serum progesterone (panel A) and PGFM concentration (panel B) in early pregnant cattle treated with E. coli lipopolysaccharide (LPS;−1 to 12 h: n = 8, 24–96 h: n = 7) or Saline (n = 7), respectively. *Values differed between LPS- and Saline-treated cattle (P ≤ 0.05). a,b,A,BWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

Citation: Reproduction 157, 1; 10.1530/REP-18-0174

For PGFM, there were effects of time, and a treatment by time interaction (P ≤ 0.5; Fig. 2). Plasma PGFM concentrations increased almost by an order of magnitude within the first 30 min after infusion of LPS, but had returned to baseline by 4 h and remained there. In control heifers, PGFM did not change significantly over time. Concentrations of PGFM were higher (P > 0.05) in LPS vs control cattle for the first 4 h after infusion.

Gene expression

In cows given LPS, transcript abundance of mRNA encoding CASP3 was higher at 12 vs 24 h after treatment (P ≤ 0.5, Fig. 3), whereas expression of STAR mRNA was lower (P ≤ 0.5, Fig. 3) at 12 vs 48 h. There was no difference within the LPS group for FGF2 (P > 0.05), whereas FGF1 was lower (P ≤ 0.05, Fig. 3) at 12 vs 48 h after LPS infusion. Within the control group, expression of mRNA did not vary between time points (P > 0.05) for any parameter. Levels of mRNA encoding STAR and FGF1 were lower in LPS- than in saline-treated cattle at 12 h after treatment (P ≤ 0.05; Fig. 3) but not at 48 h. There were no differences between treatment groups for CASP3 or FGF2 (P > 0.05).

Figure 3
Figure 3

Mean ± s.e.m. levels of mRNA for STAR (panel A), CASP3 (panel B), FGF1 (panel C) and FGF2 (panel D) 12 and 48 h after infusion of E. coli lipopolysaccharide (LPS; dark bars) or Saline (NaCl; gray bars) in early pregnant cattle. *Values differed between LPS- and Saline-treated cattle within a sampling period (i.e. 12 or 48 h) (P ≤ 0.05). a,bWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

Citation: Reproduction 157, 1; 10.1530/REP-18-0174

Discussion

In early pregnant cows in the present study, iv administration of LPS endotoxin temporarily suppressed CL function and structure. LS, LBF and P4 decreased within 12 h after LPS treatment, but complete luteal regression did not occur. Similarly, in a previous study, administration of LPS to diestrous cows reduced LS, LBF and P4 during the first 24 h after treatment (Herzog et al. 2012), but did not cause luteal regression.

In the present study, all fetuses still in the experiment at the time (n = 7) had a heart beat 10 days after treatment. Progesterone is essential for maintenance of pregnancy in cattle (Estergreen et al. 1967). In the first trimester of gestation, removal of the CL causes abortion. Progesterone of placental origin can support pregnancy at ~150–250 days of gestation in the absence of a CL. However, removal of the CL after 250-day results in calving in 1 or 2 days (Stabenfeldt et al. 1970, Mann & Lamming 1999, Taverne 2001, Breukelman et al. 2005). Furthermore, pregnancy is maintained by exogenous P4 in cattle in absence of endogenous P4, for example, with the CL removed by ovariectomy (Kesler 1997) or administration of luteolytic doses of PGF (Ferguson et al. 2014). In particular, based on a recent report (Ferguson et al. 2014) the sooner P4 supplementation starts after PGF, the more likely the pregnancy will be maintained, with a positive outcome most likely if exogenous P4 is given within 12 h after PGF. Furthermore, those authors observed that P4 decreased fastest between 12 and 24 h after PGF and was below 2 ng/mL by 30 h post PGF. In this study, P4 in LPS-treated cows was also supressed for more than 12 h in a similar pattern, but consistently exceeded 2 ng/mL. Luteal regression and declines in plasma P4 to <2 ng/mL after administration of exogenous PGF are well established (Lauderdale 1975, Sioan 1977, Wright & Kiracofe 1988). We concluded that the LPS-induced release of endogenous PGF impaired luteolytic function but did not cause luteolysis, thereby reducing P4 production, but not getting systemic P4 concentrations low enough to terminate pregnancy.

Administering viable bacteria or prolonged infusions of LPS activate the immunological cascade, disrupt neuroendocrine activity (mainly by blocking or delaying the LH surge), and can shorten the estrous cycle in postpartum cattle (Williams et al. 2008). Also, studies using mastitis as a model of inflammation instead of experimentally LPS administration have implicated infectious diseases as causing embryonic loss (Soto et al. 2003, Santos et al. 2004b). However, in the present study, LPS was administered over a short interval (~1 min). Therefore, the insult was short-lived. Consequently, only one PGFM peak was detected; although it clearly suppressed P4, it did not cause luteolysis and the CL subsequently recovered. In heifers, intrauterine infusions of exogenous PGF caused a PGFM pattern with several pulses, similar to spontaneous luteolysis (Ginther et al. 2009). That the single PGFM peak detected in the present study did not induce luteolysis was further evidence that sequential PGF pulses are crucial for complete luteolysis in cattle (Ginther et al. 2009, 2010).

In third-trimester cows (n = 3, 190–200 days of gestation) given LPS (0.5 µg Salmonella typhimurium, LPS/kg) intravenously, the LPS was rapidly cleared, and there were no indications that it crossed the placenta. However, all three cows aborted within 10 days after LPS treatment (Foley et al. 1993). In the present study, none of the cows aborted. Perhaps the third-trimester fetus is more susceptible to LPS than cattle at ~6 weeks of pregnancy. Also, differences in source and dose of LPS could have contributed to disparate outcomes. Effects of two doses of LPS (1.0 or 2.5 μg E. coli LPS/kg) in cows at various stages of pregnancy have been reported (Giri et al. 1990). In that study, LPS was infused over 6 h (which better represented exposure to LPS in natural infection), in contrast to the single bolus injection given in the present study. Furthermore, magnitudes of changes in P4, PGFM, cortisol and other metabolites, as well as severity of clinical signs, were all dose dependent. Although the type of LPS used was the same as in the present work, both doses were higher. Intensity of systemic responses to LPS in cattle is dose dependent and can considerably vary from cow to cow (Jacobsen et al. 2005).

Progesterone concentrations after LPS treatment in the present study were similar to those in cyclic cows (Herzog et al. 2012). In both experiments, P4 peaked 30 min after LPS exposure. This was attributed to an acute release of P4 from the adrenal gland, as in the study by Battaglia et al. (1997), with a nadir in P4 after 12 h. However, P4 concentrations in cyclic LPS-treated cows remained decreased for up to 48 h after LPS exposure (Herzog et al. 2012), whereas the difference between early pregnant LPS and control cattle had disappeared by 24 h after LPS administration. Progesterone concentrations also recovered much faster in pregnant cows of the present study than in cyclic cows (Herzog et al. 2012). Furthermore, P4 concentrations were higher 48 h after treatment in LPS-treated cows compared to controls. Similarly, for LBF, there was no difference between LPS and saline-treated pregnant cattle in LBF 24 h after LPS administration, and LBF was higher in LPS-treated cows 48 and 72 h after treatment, consistent with a robust association between P4 and LBF, as reported (Herzog et al. 2010). Changes in LS caused by LPS infusion were less prominent in pregnant than in cyclic cows. Luteal size sharply decreased in pregnant cows, reached a nadir at 12 h and returned to initial values by 48 h after infusion, whereas in cyclic cows, the nadir occurred after 24 h and LS never regained pre-treatment baseline (Herzog et al. 2012).

Luteal gene expression confirmed that the CL of LPS-treated cows in the present study underwent partial luteolysis. As in cyclic cows (Herzog et al. 2012), StAR was reduced 12 h after LPS administration in pregnant cows. Already at 48 h, however, there were no differences between LPS and control cattle in expression of StAR mRNA. Unfortunately, in the previous experiment, expression of mRNA in cyclic cows was not assessed 48 h after infusion. Regardless, it is noteworthy that plasma P4 concentrations differed between groups for only a short interval.

There were no significant differences between LPS-treated vs control cows for mRNA expression of CASP3. Conversely, in cyclic cows (Herzog et al. 2012), expression of this protein was increased 12 h after administration in LPS-treated cows compared to controls, in accordance with decreased LS. Perhaps CASP3 has an important role in apoptosis and/or subsequent regeneration of cycling, but not in CL of pregnant cows, where it may have a lesser effect. Observations in laboratory animals support this assertion. In that regard, CASP3 can be dispensable or nonspecific in mice (Kuida et al. 1996, Jänicke et al. 1998). Furthermore, in postpartum rats, CASP3 only regulated regression of the CL generated after parturition, but had no apparent role in luteolysis of a CL formed during pregnancy (Takiguchi et al. 2004). Further investigation is needed to determine the relevance of these findings for the bovine CL. In addition, we evaluated CASP3 only at mRNA level. Assessing the presence of the CASP3 protein would provide further information (Johnson & Bridgham 2000, Fenwick & Hurst 2002); therefore, it should be considered in future studies.

There were significant differences in expression of FGF1 but not FGF2 after LPS exposure. Similarly, in a previous study, FGF1 was reduced in cyclic LPS-treated cows 12 h after exposure (Lüttgenau et al. 2016). Both FGF1 and FGF2 are regarded as cellular ‘survival factors’ (Renaud et al. 1994), conferring protection against apoptosis. They promote angiogenesis in the developing CL, as well as support pre-existing vasculature in the mature and gravid CL (Zheng et al. 1993, Schams 1994). Therefore, reductions in FGF1 and a corresponding decrease in LBF at 12 h after LPS infusion were expected. In cyclic cows, both FGF1 and FGF2 were increased at 12 h after induction of luteolysis (Neuvians et al. 2004). In contrast, in the present study, FGF2 expression did not change over time and FGF1 expression was lower 12 h after LPS infusion. Furthermore, FGF2 was increased in diestrous cows given LPS (Lüttgenau et al. 2016). Since the cited experiments were done in cyclic cattle, apparent differences may have been due to pregnancy status. There may be luteoprotective mechanisms in the CL of pregnant cattle that make them less susceptible to endogenous PGF, consistent with the ‘rebound’ in CL function in LPS-treated cows in the present study.

The LPS-treated cows underwent an OvSynch protocol and timed artificial insemination, whereas heifers in the control group were inseminated after estrus detection. This difference was due to organizational reasons, but is potentially relevant. Timed artificial insemination is a potential risk factor for late embryonic loss, although direct evidence is missing (Santos et al. 2004a). However, rather than luteal or uterine events, follicular development seems to play a relevant part in the mechanism by which timed artificial insemination affects pregnancy rate (Jordan et al. 2009, Bollwein et al. 2010). Fortunately, none of the LPS-cows in our study underwent embryonic loss.

Due to organizational reasons, there was also a difference in parity number and age between LPS and control group (primiparous cows vs nulliparous heifers). However, none of the parameters measured (LS, LBF, P4 and PGFM) differed between the two groups before LPS infusion. Furthermore, the minimal reaction to the NaCl infusion of the heifers in this study resembled that of cycling cows (Herzog et al. 2012). In addition, the control group was mainly designed to exclude any influence of stressors (e.g. manipulations related to treatment, sonography and other examinations), since, in general, stress impairs reproductive function (Sheldon et al. 2014, Endo et al. 2017). In this regard, there is evidence that heifers might be even less stress-resistant than cows. When cattle are repeatedly exposed to stressors such as painless restraint, transport and manipulation, their reaction to those stimuli progressively decreases. This applies to behavioral alterations as well as to hormonal response, for example, cortisol level (Boissy & Bouissou 1988, Lay Jr et al. 1996, Grandin 1997, Rushen et al. 2001). Because of their younger age, nulliparous heifers are obviously less accustomed to human contact and manipulations than cows. Thus, they are likely more stress sensitive than older cows (Lay Jr et al. 1996). An inverse relation between parity number and intensity of reaction to stressors has been reported in other species, including gestating sows (Zhang et al. 2017).

One cow died between 12 and 24 h after LPS infusion. At necropsy, there were approximately 5 L of clotted blood in the abdomen, apparently derived from luteal biopsy sites. The ultrasound-guided technique described by Tsai et al. (2001) allows repeated biopsies from a CL, without apparent effect on its function. To our knowledge, this is the first case reporting hemorrhage from the biopsy site after using this technique. It is known from human medicine that leukopenia and thrombocytopenia develop in immunocompetent patients during septic shock (Stephan et al. 1997). In a healthy cow, the loss of 5 L of blood would not cause death (Radostits et al. 2007). However, in an animal that was already compromised, this may have acted in a synergistic manner with acute phase symptoms, resulting in death.

In summary, administration of LPS to early pregnant cows caused a temporary depression of luteal function, but all pregnancies were preserved. Furthermore, the impact on CL was less pronounced than in a similar study involving diestrous cows. In particular, analysis of molecular parameters suggested differences in luteolytic mechanisms between the CL of the cycle and the CL of pregnancy, consistent with luteoprotective changes in the latter.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research did not receive any specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Acknowledgements

The authors thank the Friedrich-Löffler-Institute in Mariensee for generously providing access to pregnant heifers.

References

  • Battaglia DF, Bowen JM, Krasa HB, Thrun LA, Viguie C & Karsch FJ 1997 Endotoxin inhibits the reproductive neuroendocrine axis while stimulating adrenal steroids: a simultaneous view from hypophyseal portal and peripheral blood. Endocrinology 138 42734281. (https://doi.org/10.1210/endo.138.10.5449)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Boissy A & Bouissou M-F 1988 Effects of early handling on heifers' subsequent reactivity to humans and to unfamiliar situations. Applied Animal Behaviour Science 20 259273. (https://doi.org/10.1016/0168-1591(88)90051-2)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bollwein H, Prost D, Ulbrich SE, Niemann H & Honnens A 2010 Effects of a shortened preovulatory follicular phase on genital blood flow and endometrial hormone receptor concentrations in Holstein-Friesian cows. Theriogenology 73 242249. (https://doi.org/10.1016/j.theriogenology.2009.08.014)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Breukelman SP, Szenci O, Beckers J-F, Kindahl H, Mulder EJ, Jonker FH, van der Weijden B, Revy D, Pogany K & Sulon J 2005 Ultrasonographic appearance of the conceptus, fetal heart rate and profiles of pregnancy-associated glycoproteins (PAG) and prostaglandin F 2α-metabolite (PGF 2α-metabolite) after induction of fetal death with aglepristone during early gestation in cattle. Theriogenology 64 917933. (https://doi.org/10.1016/j.theriogenology.2004.12.016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Casciola-Rosen L, Nicholson DW, Chong T, Rowan KR, Thornberry NA, Miller DK & Rosen A 1996 Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. Journal of Experimental Medicine 183 19571964. (https://doi.org/10.1084/jem.183.5.1957)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Diskin MG & Morris DG 2008 Embryonic and early foetal losses in cattle and other ruminants. Reproduction in Domestic Animals 43 (Supplement 2) 260267. (https://doi.org/10.1111/j.1439-0531.2008.01171.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Diskin MG & Sreenan JM 1980 Fertilization and embryonic mortality rates in beef heifers after artificial insemination. Journal of Reproduction and Fertility 59 463468. (https://doi.org/10.1530/jrf.0.0590463)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Doraiswamy V, Knutson DL, Grazul-Bilska AT, Redmer DA & Reynolds LP 1998 Fibroblast growth factor receptor (FGFR)-1 and -2 in the ovine corpus luteum throughout the estrous cycle. Growth Factors 16 125135. (https://doi.org/10.3109/08977199809002123)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Endo N, Kuroki R & Tanaka T 2017 Comparison of productive and reproductive performance and hair cortisol levels between Brown Swiss cross‐bred and Holstein cows housed in the same barn. Animal Science Journal 88 15061512. (https://doi.org/10.1111/asj.12828)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Estergreen VL, Frost OL, Gomes WR, Erb RE & Bullard JF 1967 Effect of ovariectomy on pregnancy maintenance and parturition in dairy cows. Journal of Dairy Science 50 12931295. (https://doi.org/10.3168/jds.S0022-0302(67)87615-X)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fenwick M & Hurst P 2002 Immunohistochemical localization of active caspase-3 in the mouse ovary: growth and atresia of small follicles. Reproduction 124 659665. (https://doi.org/10.1530/rep.0.1240659)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ferguson EC, Kesler DJ & Godke RA 2014 Maintenance of pregnancy in beef cattle after a luteolytic dose of prostaglandin F2α. Veterinary Medicine and Animal Sciences 2 14. (https://doi.org/10.7243/2054-3425-2-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Foley GL, Schlafer DH, Elsasser TH & Mitchell M 1993 Endotoxemia in pregnant cows: comparisons of maternal and fetal effects utilizing the chronically catheterized fetus. Theriogenology 39 739762. (https://doi.org/10.1016/0093-691X(93)90258-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ginther OJ, Araujo RR, Palhão MP, Rodrigues BL & Beg MA 2009 Necessity of sequential pulses of prostaglandin F2alpha for complete physiologic luteolysis in cattle. Biology of Reproduction 80 641648. (https://doi.org/10.1095/biolreprod.108.072769)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ginther OJ, Shrestha HK, Fuenzalida MJ, Shahiduzzaman AKM, Hannan MA & Beg MA 2010 Intrapulse temporality between pulses of a metabolite of prostaglandin F2α and circulating concentrations of progesterone before, during, and after spontaneous luteolysis in heifers. Theriogenology 74 11791186. (https://doi.org/10.1016/j.theriogenology.2010.05.018)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Giri SN, Emau P, Cullor JS, Stabenfeldt GH, Bruss ML, Bondurant RH & Osburn BI 1990 Effects of endotoxin infusion on circulating levels of eicosanoids, progesterone, cortisol, glucose and lactic acid, and abortion in pregnant cows. Veterinary Microbiology 21 211231. (https://doi.org/10.1016/0378-1135(90)90033-R)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Grandin T 1997 Assessment of stress during handling and transport. Journal of Animal Science 75 249257. (https://doi.org/10.2527/1997.751249x)

  • Guven B & Ozsar S 1993 Set up an enzymimmunoassay for PGFM and its release during the estrous cycle in the Angora goat. In Proceedings of the World Congress on Animal Production, Edmonton, Canada, p 289.

    • Search Google Scholar
    • Export Citation
  • Hansen PJ, Soto P & Natzke RP 2004 Mastitis and fertility in cattle – possible involvement of inflammation or immune activation in embryonic mortality. American Journal of Reproductive Immunology 51 294301. (https://doi.org/10.1111/j.1600-0897.2004.00160.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Herzog K, Brockhan-Ludemann M, Kaske M, Beindorff N, Paul V, Niemann H & Bollwein H 2010 Luteal blood flow is a more appropriate indicator for luteal function during the bovine estrous cycle than luteal size. Theriogenology 73 691697. (https://doi.org/10.1016/j.theriogenology.2009.11.016)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Herzog K, Struve K, Kastelic JP, Piechotta M, Ulbrich SE, Pfarrer C, Shirasuna K, Shimizu T, Miyamoto A & Bollwein H 2012 Escherichia coli lipopolysaccharide administration transiently suppresses luteal structure and function in diestrous cows. Reproduction 144 467476. (https://doi.org/10.1530/REP-12-0138)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Humblot P 2001 Use of pregnancy specific proteins and progesterone assays to monitor pregnancy and determine the timing, frequencies and sources of embryonic mortality in ruminants. Theriogenology 56 14171433. (https://doi.org/10.1016/S0093-691X(01)00644-6)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Inskeep EK 2004 Preovulatory, postovulatory, and postmaternal recognition effects of concentrations of progesterone on embryonic survival in the cow. Journal of Animal Science 82 (Supplement E) E24E39. (https://doi.org/10.2527/2004.8213_supplE24x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Jacobsen S, Toelboell T & Andersen PH 2005 Dose dependency and individual variability in selected clinical, haematological and blood biochemical responses after systemic lipopolysaccharide challenge in cattle. Veterinary Research 36 167178. (https://doi.org/10.1051/vetres:2004062)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jänicke RU, Sprengart ML, Wati MR & Porter AG 1998 Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. Journal of Biological Chemistry 273 93579360.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Johnson A & Bridgham J 2000 Caspase-3 and-6 expression and enzyme activity in hen granulosa cells. Biology of Reproduction 62 589598. (https://doi.org/10.1095/biolreprod62.3.589)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jordan A, Herzog K, Ulbrich SE, Beindorff N, Honnens A, Krueger L, Miyamoto A & Bollwein H 2009 Genital blood flow and endometrial gene expression during the preovulatory period after prostaglandin F2alpha-induced luteolysis in different luteal phases in cows. Journal of Reproduction and Development 55 309315. (https://doi.org/10.1262/jrd.20140)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kastelic JP & Ginther OJ 1989 Fate of conceptus and corpus luteum after induced embryonic loss in heifers. Journal of the American Veterinary Medical Association 194 922928.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kastelic JP, Pierson RA & Ginther OJ 1990 Ultrasonic morphology of corpora lutea and central luteal cavities during the estrous cycle and early pregnancy in heifers. Theriogenology 34 487498. (https://doi.org/10.1016/0093-691X(90)90006-F)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kesler DJ 1997 Norgestomet implants maintain pregnancy in ovariectomized heifers. Theriogenology 48 8998. (https://doi.org/10.1016/S0093-691X(97)00193-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kuida K, Zheng TS, Na S, Kuan C-Y, Yang D, Karasuyama H, Rakic P & Flavell RA 1996 Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384 368372. (https://doi.org/10.1038/384368a0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lauderdale J. 1975 The use of prostaglandins in cattle. Annales de Biologie Animale Biochimie Biophysique 2 419425. (https://doi.org/10.1051/rnd:19750231)

    • Search Google Scholar
    • Export Citation
  • Lay D Jr, Friend T, Randel R, Jenkins O, Neuendorff D, Kapp G & Bushong D 1996 Adrenocorticotropic hormone dose response and some physiological effects of transporation on pregnant Brahman cattle. Journal of Animal Science 74 18061811. (https://doi.org/10.2527/1996.7481806x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25 402408. (https://doi.org/10.1006/meth.2001.1262)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lucy MC 2001 Reproductive loss in high-producing dairy cattle: where will it end? Journal of Dairy Science 84 12771293. (https://doi.org/10.3168/jds.S0022-0302(01)70158-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lüttgenau J, Beindorff N, Ulbrich SE, Kastelic JP & Bollwein H 2011 Low plasma progesterone concentrations are accompanied by reduced luteal blood flow and increased size of the dominant follicle in dairy cows. Theriogenology 76 1222. (https://doi.org/10.1016/j.theriogenology.2010.12.025)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lüttgenau J, Herzog K, Strüve K, Latter S, Boos A, Bruckmaier RM, Bollwein H & Kowalewski MP 2016 LPS-mediated effects and spatio-temporal expression of TLR2 and TLR4 in the bovine corpus luteum. Reproduction 151 391399. (https://doi.org/10.1530/REP-15-0520)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mann GE & Lamming GE 1999 The influence of progesterone during early pregnancy in cattle. Reproduction in Domestic Animals 34 269274. (https://doi.org/10.1111/j.1439-0531.1999.tb01250.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Manns JG, Nkuuhe JR & Bristol F 1985 Prostaglandin concentrations in uterine fluid of cows with pyometra. Canadian Journal of Comparative Medicine 49 436438.

    • Search Google Scholar
    • Export Citation
  • Mishra DP, Meyer HH & Prakash BS 2003 Validation of a sensitive enzymeimmunoassay for 13,14-dihydro-15-keto-PGF2alpha in buffalo plasma and its application for reproductive health status monitoring. Animal Reproduction Science 78 3346. (https://doi.org/10.1016/S0378-4320(03)00047-2)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Neuvians TP, Berisha B & Schams D 2004 Vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) expression during induced luteolysis in the bovine corpus luteum. Molecular Reproduction and Development 67 389395. (https://doi.org/10.1002/mrd.20032)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Niswender GD, Juengel JL, Silva PJ, Rollyson MK & McIntush EW 2000 Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews 80 129. (https://doi.org/10.1152/physrev.2000.80.1.1)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pfaffl MW, Tichopad A, Prgomet C & Neuvians TP 2004 Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – excel-based tool using pair-wise correlations. Biotechnology Letters 26 509515. (https://doi.org/10.1023/B:BILE.0000019559.84305.47)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pistek VL, Furst RW, Kliem H, Bauersachs S, Meyer HH & Ulbrich SE 2013 HOXA10 mRNA expression and promoter DNA methylation in female pig offspring after in utero estradiol-17beta exposure. Journal of Steroid Biochemistry and Molecular Biology 138 435444. (https://doi.org/10.1016/j.jsbmb.2013.09.006)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Pursley JR, Mee MO & Wiltbank MC 1995 Synchronization of ovulation in dairy cows using PGF2alpha and GnRH. Theriogenology 44 915923. (https://doi.org/10.1016/0093-691X(95)00279-H)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Radostits OM, Gay CC, Hinchcliff KW & Constable PD 2007 Diseases of the blood and blood-forming organs. In Veterinary Medicine. A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. Elsevier Saunders: Edinburgh, UK.

    • Search Google Scholar
    • Export Citation
  • Renaud F, Oliver L, Desset S, Tassin J, Romquin N, Courtois Y & Laurent M 1994 Up-regulation of aFGF expression in quiescent cells is related to cell survival. Journal of Cellular Physiology 158 435443. (https://doi.org/10.1002/jcp.1041580307)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rushen J, Munksgaard L, Marnet P & DePassillé A 2001 Human contact and the effects of acute stress on cows at milking. Applied Animal Behaviour Science 73 114. (https://doi.org/10.1016/S0168-1591(01)00105-8)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Santos JE, Thatcher WW, Chebel RC, Cerri RL & Galvao KN 2004a The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Animal Reproduction Science 82–83 513535. (https://doi.org/10.1016/j.anireprosci.2004.04.015)

    • Search Google Scholar
    • Export Citation
  • Santos JEP, Cerri RLA, Ballou MA, Higginbotham GE & Kirk JH 2004b Effect of timing of first clinical mastitis occurrence on lactational and reproductive performance of Holstein dairy cows. Animal Reproduction Science 80 3145. (https://doi.org/10.1016/S0378-4320(03)00133-7)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sartori R, Haughian JM, Shaver RD, Rosa GJM & Wiltbank MC 2004 Comparison of ovarian function and circulating steroids in estrous cycles of Holstein heifers and lactating cows. Journal of Dairy Science 87 905920. (https://doi.org/10.3168/jds.S0022-0302(04)73235-X)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schams D 1994 Growth factors in milk. Endocrine Regulations 28 38.

  • Sheldon IM, Cronin JG, Healey GD, Gabler C, Heuwieser W, Streyl D, Bromfield J, Miyamoto A, Fergani C & Dobson H 2014 Innate immunity and inflammation of the bovine female reproductive tract in health and disease. Reproduction 148 R41-R51. (https://doi.org/10.1530/REP-14-0163)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Silke V, Diskin MG, Kenny DA, Boland MP, Dillon P, Mee JF & Sreenan JM 2002 Extent, pattern and factors associated with late embryonic loss in dairy cows. Animal Reproduction Science 71 112. (https://doi.org/10.1016/S0378-4320(02)00016-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sioan C 1977 Induced abortion in cattle. Theriogenology 7 4351. (https://doi.org/10.1016/S0093-691X(77)80002-2)

  • Soto P, Natzke RP & Hansen PJ 2003 Identification of possible mediators of embryonic mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on oocyte maturation and embryonic development in cattle. American Journal of Reproductive Immunology 50 263272. (https://doi.org/10.1034/j.1600-0897.2003.00085.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sreenan JM & Diskin MG 1983 Early embryonic mortality in the cow: its relationship with progesterone concentration. Veterinary record 112 517521. (https://doi.org/10.1136/vr.112.22.517)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Stabenfeldt GH, Osburn BI & Ewing LL 1970 Peripheral plasma progesterone levels in the cow during pregnancy and parturition. American Journal of Physiology 218 571575. (https://doi.org/10.1152/ajplegacy.1970.218.2.571)

    • Search Google Scholar
    • Export Citation
  • Stephan F, Thioliere B, Verdy E & Tulliez M 1997 Role of hemophagocytic histiocytosis in the etiology of thrombocytopenia in patients with sepsis syndrome or septic shock. Clinical infectious diseases 25 11591164. (https://doi.org/10.1086/516086)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Stewart AB, Inskeep EK, Townsend EC & Dailey RA 2003 Effects of Gram-positive bacterial pathogens in ewes: peptidoglycan as a potential mediator of interruption of early pregnancy. Reproduction 125 295299. (https://doi.org/10.1530/rep.0.1250295)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stocco DM & Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocrine Reviews 17 221244. (https://doi.org/10.1210/edrv-17-3-221)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Takiguchi S, Sugino N, Esato K, Karube-Harada A, Sakata A, Nakamura Y, Ishikawa H & Kato H 2004 Differential regulation of apoptosis in the corpus luteum of pregnancy and newly formed corpus luteum after parturition in rats. Biology of Reproduction 70 313318. (https://doi.org/10.1095/biolreprod.103.018853)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Taverne MAM 2001 Corpus luteum function and parturition in cattle and pigs. Archiv fur Tierzucht 44 3750.

  • Thatcher WW, Staple CR, Danet-Desnoyers G, Oldick B & Schmitt EP 1994 Embryo health and mortality in sheep and cattle. Journal of Animal Science 72 (Supplement 3) 1630. (https://doi.org/10.2527/1994.72suppl_316x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Thornberry NA 1998 Caspases: key mediators of apoptosis. Chemistry and Biology 5 R97R103. (https://doi.org/10.1016/S1074-5521(98)90615-9)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsai SJ, Kot K, Ginther OJ & Wiltbank MC 2001 Temporal gene expression in bovine corpora lutea after treatment with PGF2alpha based on serial biopsies in vivo. Reproduction 121 905913. (https://doi.org/10.1530/rep.0.1210905)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Williams EJ, Herath S, England GWC, Dobson H, Bryant CE & Sheldon IM 2008 Effect of Escheria coli infection of the bovine uterus from the whole animal to the cell. Animal 2 11531157. (https://doi.org/10.1017/S1751731108002413)

    • Search Google Scholar
    • Export Citation
  • Wright JM & Kiracofe GH 1988 Short estrous cycles and associated progesterone in serum of beef heifers aborted at various stages of gestation. Theriogenology 29 497504. (https://doi.org/10.1016/0093-691X(88)90251-8)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamashita H, Kamada D, Shirasuna K, Matsui M, Shimizu T, Kida K, Berisha B, Schams D & Miyamoto A 2008 Effect of local neutralization of basic fibroblast growth factor or vascular endothelial growth factor by a specific antibody on the development of the corpus luteum in the cow. Molecular Reproduction and Development 75 14491456. (https://doi.org/10.1002/mrd.20878)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zavy MT 1994 Embryonic mortality in cattle. In Embryonic Mortality in Domestic Species. CRC Press: Boca Raton, USA.

  • Zhang M-y, Li X, Zhang X-h, Liu H-g, Li J-h & Bao J 2017 Effects of confinement duration and parity on behavioural responses and the degree of psychological fear in pregnant sows. Applied Animal Behaviour Science 193 2128. (https://doi.org/10.1016/j.applanim.2017.03.016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Zheng J, Redmer DA & Reynolds LP 1993 Vascular development and heparin-binding growth factors in the bovine corpus luteum at several stages of the estrous cycle. Biology of Reproduction 49 11771189. (https://doi.org/10.1095/biolreprod49.6.1177)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation

 

     An official journal of

    Society for Reproduction and Fertility

 

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 515 0 0
Full Text Views 637 430 10
PDF Downloads 174 86 7
  • View in gallery

    Median ± MAD of luteal tissue area (panel A) and mean ± s.e.m. of luteal blood flow (panel B) in early pregnant cattle treated with E. coli lipopolysaccharide (LPS; −1 to 12 h: n = 8, 24–96 h: n = 7) or Saline (n = 7), respectively. *Values differed between LPS- and Saline-treated cattle (P ≤ 0.05). a,bWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

  • View in gallery

    Median ± MAD of serum progesterone (panel A) and PGFM concentration (panel B) in early pregnant cattle treated with E. coli lipopolysaccharide (LPS;−1 to 12 h: n = 8, 24–96 h: n = 7) or Saline (n = 7), respectively. *Values differed between LPS- and Saline-treated cattle (P ≤ 0.05). a,b,A,BWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

  • View in gallery

    Mean ± s.e.m. levels of mRNA for STAR (panel A), CASP3 (panel B), FGF1 (panel C) and FGF2 (panel D) 12 and 48 h after infusion of E. coli lipopolysaccharide (LPS; dark bars) or Saline (NaCl; gray bars) in early pregnant cattle. *Values differed between LPS- and Saline-treated cattle within a sampling period (i.e. 12 or 48 h) (P ≤ 0.05). a,bWithin LPS-treated cattle, values without a common superscript differed (P ≤ 0.05).

  • Battaglia DF, Bowen JM, Krasa HB, Thrun LA, Viguie C & Karsch FJ 1997 Endotoxin inhibits the reproductive neuroendocrine axis while stimulating adrenal steroids: a simultaneous view from hypophyseal portal and peripheral blood. Endocrinology 138 42734281. (https://doi.org/10.1210/endo.138.10.5449)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Boissy A & Bouissou M-F 1988 Effects of early handling on heifers' subsequent reactivity to humans and to unfamiliar situations. Applied Animal Behaviour Science 20 259273. (https://doi.org/10.1016/0168-1591(88)90051-2)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bollwein H, Prost D, Ulbrich SE, Niemann H & Honnens A 2010 Effects of a shortened preovulatory follicular phase on genital blood flow and endometrial hormone receptor concentrations in Holstein-Friesian cows. Theriogenology 73 242249. (https://doi.org/10.1016/j.theriogenology.2009.08.014)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Breukelman SP, Szenci O, Beckers J-F, Kindahl H, Mulder EJ, Jonker FH, van der Weijden B, Revy D, Pogany K & Sulon J 2005 Ultrasonographic appearance of the conceptus, fetal heart rate and profiles of pregnancy-associated glycoproteins (PAG) and prostaglandin F 2α-metabolite (PGF 2α-metabolite) after induction of fetal death with aglepristone during early gestation in cattle. Theriogenology 64 917933. (https://doi.org/10.1016/j.theriogenology.2004.12.016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Casciola-Rosen L, Nicholson DW, Chong T, Rowan KR, Thornberry NA, Miller DK & Rosen A 1996 Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. Journal of Experimental Medicine 183 19571964. (https://doi.org/10.1084/jem.183.5.1957)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Diskin MG & Morris DG 2008 Embryonic and early foetal losses in cattle and other ruminants. Reproduction in Domestic Animals 43 (Supplement 2) 260267. (https://doi.org/10.1111/j.1439-0531.2008.01171.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Diskin MG & Sreenan JM 1980 Fertilization and embryonic mortality rates in beef heifers after artificial insemination. Journal of Reproduction and Fertility 59 463468. (https://doi.org/10.1530/jrf.0.0590463)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Doraiswamy V, Knutson DL, Grazul-Bilska AT, Redmer DA & Reynolds LP 1998 Fibroblast growth factor receptor (FGFR)-1 and -2 in the ovine corpus luteum throughout the estrous cycle. Growth Factors 16 125135. (https://doi.org/10.3109/08977199809002123)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Endo N, Kuroki R & Tanaka T 2017 Comparison of productive and reproductive performance and hair cortisol levels between Brown Swiss cross‐bred and Holstein cows housed in the same barn. Animal Science Journal 88 15061512. (https://doi.org/10.1111/asj.12828)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Estergreen VL, Frost OL, Gomes WR, Erb RE & Bullard JF 1967 Effect of ovariectomy on pregnancy maintenance and parturition in dairy cows. Journal of Dairy Science 50 12931295. (https://doi.org/10.3168/jds.S0022-0302(67)87615-X)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fenwick M & Hurst P 2002 Immunohistochemical localization of active caspase-3 in the mouse ovary: growth and atresia of small follicles. Reproduction 124 659665. (https://doi.org/10.1530/rep.0.1240659)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ferguson EC, Kesler DJ & Godke RA 2014 Maintenance of pregnancy in beef cattle after a luteolytic dose of prostaglandin F2α. Veterinary Medicine and Animal Sciences 2 14. (https://doi.org/10.7243/2054-3425-2-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Foley GL, Schlafer DH, Elsasser TH & Mitchell M 1993 Endotoxemia in pregnant cows: comparisons of maternal and fetal effects utilizing the chronically catheterized fetus. Theriogenology 39 739762. (https://doi.org/10.1016/0093-691X(93)90258-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ginther OJ, Araujo RR, Palhão MP, Rodrigues BL & Beg MA 2009 Necessity of sequential pulses of prostaglandin F2alpha for complete physiologic luteolysis in cattle. Biology of Reproduction 80 641648. (https://doi.org/10.1095/biolreprod.108.072769)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ginther OJ, Shrestha HK, Fuenzalida MJ, Shahiduzzaman AKM, Hannan MA & Beg MA 2010 Intrapulse temporality between pulses of a metabolite of prostaglandin F2α and circulating concentrations of progesterone before, during, and after spontaneous luteolysis in heifers. Theriogenology 74 11791186. (https://doi.org/10.1016/j.theriogenology.2010.05.018)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Giri SN, Emau P, Cullor JS, Stabenfeldt GH, Bruss ML, Bondurant RH & Osburn BI 1990 Effects of endotoxin infusion on circulating levels of eicosanoids, progesterone, cortisol, glucose and lactic acid, and abortion in pregnant cows. Veterinary Microbiology 21 211231. (https://doi.org/10.1016/0378-1135(90)90033-R)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Grandin T 1997 Assessment of stress during handling and transport. Journal of Animal Science 75 249257. (https://doi.org/10.2527/1997.751249x)

  • Guven B & Ozsar S 1993 Set up an enzymimmunoassay for PGFM and its release during the estrous cycle in the Angora goat. In Proceedings of the World Congress on Animal Production, Edmonton, Canada, p 289.

    • Search Google Scholar
    • Export Citation
  • Hansen PJ, Soto P & Natzke RP 2004 Mastitis and fertility in cattle – possible involvement of inflammation or immune activation in embryonic mortality. American Journal of Reproductive Immunology 51 294301. (https://doi.org/10.1111/j.1600-0897.2004.00160.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Herzog K, Brockhan-Ludemann M, Kaske M, Beindorff N, Paul V, Niemann H & Bollwein H 2010 Luteal blood flow is a more appropriate indicator for luteal function during the bovine estrous cycle than luteal size. Theriogenology 73 691697. (https://doi.org/10.1016/j.theriogenology.2009.11.016)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Herzog K, Struve K, Kastelic JP, Piechotta M, Ulbrich SE, Pfarrer C, Shirasuna K, Shimizu T, Miyamoto A & Bollwein H 2012 Escherichia coli lipopolysaccharide administration transiently suppresses luteal structure and function in diestrous cows. Reproduction 144 467476. (https://doi.org/10.1530/REP-12-0138)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Humblot P 2001 Use of pregnancy specific proteins and progesterone assays to monitor pregnancy and determine the timing, frequencies and sources of embryonic mortality in ruminants. Theriogenology 56 14171433. (https://doi.org/10.1016/S0093-691X(01)00644-6)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Inskeep EK 2004 Preovulatory, postovulatory, and postmaternal recognition effects of concentrations of progesterone on embryonic survival in the cow. Journal of Animal Science 82 (Supplement E) E24E39. (https://doi.org/10.2527/2004.8213_supplE24x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Jacobsen S, Toelboell T & Andersen PH 2005 Dose dependency and individual variability in selected clinical, haematological and blood biochemical responses after systemic lipopolysaccharide challenge in cattle. Veterinary Research 36 167178. (https://doi.org/10.1051/vetres:2004062)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jänicke RU, Sprengart ML, Wati MR & Porter AG 1998 Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. Journal of Biological Chemistry 273 93579360.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Johnson A & Bridgham J 2000 Caspase-3 and-6 expression and enzyme activity in hen granulosa cells. Biology of Reproduction 62 589598. (https://doi.org/10.1095/biolreprod62.3.589)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jordan A, Herzog K, Ulbrich SE, Beindorff N, Honnens A, Krueger L, Miyamoto A & Bollwein H 2009 Genital blood flow and endometrial gene expression during the preovulatory period after prostaglandin F2alpha-induced luteolysis in different luteal phases in cows. Journal of Reproduction and Development 55 309315. (https://doi.org/10.1262/jrd.20140)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kastelic JP & Ginther OJ 1989 Fate of conceptus and corpus luteum after induced embryonic loss in heifers. Journal of the American Veterinary Medical Association 194 922928.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kastelic JP, Pierson RA & Ginther OJ 1990 Ultrasonic morphology of corpora lutea and central luteal cavities during the estrous cycle and early pregnancy in heifers. Theriogenology 34 487498. (https://doi.org/10.1016/0093-691X(90)90006-F)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kesler DJ 1997 Norgestomet implants maintain pregnancy in ovariectomized heifers. Theriogenology 48 8998. (https://doi.org/10.1016/S0093-691X(97)00193-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kuida K, Zheng TS, Na S, Kuan C-Y, Yang D, Karasuyama H, Rakic P & Flavell RA 1996 Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384 368372. (https://doi.org/10.1038/384368a0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lauderdale J. 1975 The use of prostaglandins in cattle. Annales de Biologie Animale Biochimie Biophysique 2 419425. (https://doi.org/10.1051/rnd:19750231)

    • Search Google Scholar
    • Export Citation
  • Lay D Jr, Friend T, Randel R, Jenkins O, Neuendorff D, Kapp G & Bushong D 1996 Adrenocorticotropic hormone dose response and some physiological effects of transporation on pregnant Brahman cattle. Journal of Animal Science 74 18061811. (https://doi.org/10.2527/1996.7481806x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25 402408. (https://doi.org/10.1006/meth.2001.1262)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lucy MC 2001 Reproductive loss in high-producing dairy cattle: where will it end? Journal of Dairy Science 84 12771293. (https://doi.org/10.3168/jds.S0022-0302(01)70158-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lüttgenau J, Beindorff N, Ulbrich SE, Kastelic JP & Bollwein H 2011 Low plasma progesterone concentrations are accompanied by reduced luteal blood flow and increased size of the dominant follicle in dairy cows. Theriogenology 76 1222. (https://doi.org/10.1016/j.theriogenology.2010.12.025)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lüttgenau J, Herzog K, Strüve K, Latter S, Boos A, Bruckmaier RM, Bollwein H & Kowalewski MP 2016 LPS-mediated effects and spatio-temporal expression of TLR2 and TLR4 in the bovine corpus luteum. Reproduction 151 391399. (https://doi.org/10.1530/REP-15-0520)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mann GE & Lamming GE 1999 The influence of progesterone during early pregnancy in cattle. Reproduction in Domestic Animals 34 269274. (https://doi.org/10.1111/j.1439-0531.1999.tb01250.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Manns JG, Nkuuhe JR & Bristol F 1985 Prostaglandin concentrations in uterine fluid of cows with pyometra. Canadian Journal of Comparative Medicine 49 436438.

    • Search Google Scholar
    • Export Citation
  • Mishra DP, Meyer HH & Prakash BS 2003 Validation of a sensitive enzymeimmunoassay for 13,14-dihydro-15-keto-PGF2alpha in buffalo plasma and its application for reproductive health status monitoring. Animal Reproduction Science 78 3346. (https://doi.org/10.1016/S0378-4320(03)00047-2)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Neuvians TP, Berisha B & Schams D 2004 Vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) expression during induced luteolysis in the bovine corpus luteum. Molecular Reproduction and Development 67 389395. (https://doi.org/10.1002/mrd.20032)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Niswender GD, Juengel JL, Silva PJ, Rollyson MK & McIntush EW 2000 Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews 80 129. (https://doi.org/10.1152/physrev.2000.80.1.1)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pfaffl MW, Tichopad A, Prgomet C & Neuvians TP 2004 Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – excel-based tool using pair-wise correlations. Biotechnology Letters 26 509515. (https://doi.org/10.1023/B:BILE.0000019559.84305.47)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pistek VL, Furst RW, Kliem H, Bauersachs S, Meyer HH & Ulbrich SE 2013 HOXA10 mRNA expression and promoter DNA methylation in female pig offspring after in utero estradiol-17beta exposure. Journal of Steroid Biochemistry and Molecular Biology 138 435444. (https://doi.org/10.1016/j.jsbmb.2013.09.006)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Pursley JR, Mee MO & Wiltbank MC 1995 Synchronization of ovulation in dairy cows using PGF2alpha and GnRH. Theriogenology 44 915923. (https://doi.org/10.1016/0093-691X(95)00279-H)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Radostits OM, Gay CC, Hinchcliff KW & Constable PD 2007 Diseases of the blood and blood-forming organs. In Veterinary Medicine. A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. Elsevier Saunders: Edinburgh, UK.

    • Search Google Scholar
    • Export Citation
  • Renaud F, Oliver L, Desset S, Tassin J, Romquin N, Courtois Y & Laurent M 1994 Up-regulation of aFGF expression in quiescent cells is related to cell survival. Journal of Cellular Physiology 158 435443. (https://doi.org/10.1002/jcp.1041580307)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rushen J, Munksgaard L, Marnet P & DePassillé A 2001 Human contact and the effects of acute stress on cows at milking. Applied Animal Behaviour Science 73 114. (https://doi.org/10.1016/S0168-1591(01)00105-8)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Santos JE, Thatcher WW, Chebel RC, Cerri RL & Galvao KN 2004a The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Animal Reproduction Science 82–83 513535. (https://doi.org/10.1016/j.anireprosci.2004.04.015)

    • Search Google Scholar
    • Export Citation
  • Santos JEP, Cerri RLA, Ballou MA, Higginbotham GE & Kirk JH 2004b Effect of timing of first clinical mastitis occurrence on lactational and reproductive performance of Holstein dairy cows. Animal Reproduction Science 80 3145. (https://doi.org/10.1016/S0378-4320(03)00133-7)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sartori R, Haughian JM, Shaver RD, Rosa GJM & Wiltbank MC 2004 Comparison of ovarian function and circulating steroids in estrous cycles of Holstein heifers and lactating cows. Journal of Dairy Science 87 905920. (https://doi.org/10.3168/jds.S0022-0302(04)73235-X)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schams D 1994 Growth factors in milk. Endocrine Regulations 28 38.

  • Sheldon IM, Cronin JG, Healey GD, Gabler C, Heuwieser W, Streyl D, Bromfield J, Miyamoto A, Fergani C & Dobson H 2014 Innate immunity and inflammation of the bovine female reproductive tract in health and disease. Reproduction 148 R41-R51. (https://doi.org/10.1530/REP-14-0163)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Silke V, Diskin MG, Kenny DA, Boland MP, Dillon P, Mee JF & Sreenan JM 2002 Extent, pattern and factors associated with late embryonic loss in dairy cows. Animal Reproduction Science 71 112. (https://doi.org/10.1016/S0378-4320(02)00016-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sioan C 1977 Induced abortion in cattle. Theriogenology 7 4351. (https://doi.org/10.1016/S0093-691X(77)80002-2)

  • Soto P, Natzke RP & Hansen PJ 2003 Identification of possible mediators of embryonic mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin F2alpha, and the nitric oxide generator, sodium nitroprusside dihydrate, on oocyte maturation and embryonic development in cattle. American Journal of Reproductive Immunology 50 263272. (https://doi.org/10.1034/j.1600-0897.2003.00085.x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sreenan JM & Diskin MG 1983 Early embryonic mortality in the cow: its relationship with progesterone concentration. Veterinary record 112 517521. (https://doi.org/10.1136/vr.112.22.517)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Stabenfeldt GH, Osburn BI & Ewing LL 1970 Peripheral plasma progesterone levels in the cow during pregnancy and parturition. American Journal of Physiology 218 571575. (https://doi.org/10.1152/ajplegacy.1970.218.2.571)

    • Search Google Scholar
    • Export Citation
  • Stephan F, Thioliere B, Verdy E & Tulliez M 1997 Role of hemophagocytic histiocytosis in the etiology of thrombocytopenia in patients with sepsis syndrome or septic shock. Clinical infectious diseases 25 11591164. (https://doi.org/10.1086/516086)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Stewart AB, Inskeep EK, Townsend EC & Dailey RA 2003 Effects of Gram-positive bacterial pathogens in ewes: peptidoglycan as a potential mediator of interruption of early pregnancy. Reproduction 125 295299. (https://doi.org/10.1530/rep.0.1250295)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stocco DM & Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocrine Reviews 17 221244. (https://doi.org/10.1210/edrv-17-3-221)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Takiguchi S, Sugino N, Esato K, Karube-Harada A, Sakata A, Nakamura Y, Ishikawa H & Kato H 2004 Differential regulation of apoptosis in the corpus luteum of pregnancy and newly formed corpus luteum after parturition in rats. Biology of Reproduction 70 313318. (https://doi.org/10.1095/biolreprod.103.018853)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Taverne MAM 2001 Corpus luteum function and parturition in cattle and pigs. Archiv fur Tierzucht 44 3750.

  • Thatcher WW, Staple CR, Danet-Desnoyers G, Oldick B & Schmitt EP 1994 Embryo health and mortality in sheep and cattle. Journal of Animal Science 72 (Supplement 3) 1630. (https://doi.org/10.2527/1994.72suppl_316x)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Thornberry NA 1998 Caspases: key mediators of apoptosis. Chemistry and Biology 5 R97R103. (https://doi.org/10.1016/S1074-5521(98)90615-9)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsai SJ, Kot K, Ginther OJ & Wiltbank MC 2001 Temporal gene expression in bovine corpora lutea after treatment with PGF2alpha based on serial biopsies in vivo. Reproduction 121 905913. (https://doi.org/10.1530/rep.0.1210905)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Williams EJ, Herath S, England GWC, Dobson H, Bryant CE & Sheldon IM 2008 Effect of Escheria coli infection of the bovine uterus from the whole animal to the cell. Animal 2 11531157. (https://doi.org/10.1017/S1751731108002413)

    • Search Google Scholar
    • Export Citation
  • Wright JM & Kiracofe GH 1988 Short estrous cycles and associated progesterone in serum of beef heifers aborted at various stages of gestation. Theriogenology 29 497504. (https://doi.org/10.1016/0093-691X(88)90251-8)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamashita H, Kamada D, Shirasuna K, Matsui M, Shimizu T, Kida K, Berisha B, Schams D & Miyamoto A 2008 Effect of local neutralization of basic fibroblast growth factor or vascular endothelial growth factor by a specific antibody on the development of the corpus luteum in the cow. Molecular Reproduction and Development 75 14491456. (https://doi.org/10.1002/mrd.20878)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zavy MT 1994 Embryonic mortality in cattle. In Embryonic Mortality in Domestic Species. CRC Press: Boca Raton, USA.

  • Zhang M-y, Li X, Zhang X-h, Liu H-g, Li J-h & Bao J 2017 Effects of confinement duration and parity on behavioural responses and the degree of psychological fear in pregnant sows. Applied Animal Behaviour Science 193 2128. (https://doi.org/10.1016/j.applanim.2017.03.016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Zheng J, Redmer DA & Reynolds LP 1993 Vascular development and heparin-binding growth factors in the bovine corpus luteum at several stages of the estrous cycle. Biology of Reproduction 49 11771189. (https://doi.org/10.1095/biolreprod49.6.1177)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation