The IGF system in the neonatal ovine uterus

in Reproduction

Correspondence should be addressed to T E Spencer; Email: tspencer@tamu.edu

Postnatal development of the ovine uterus primarily involves uterine gland morphogenesis or adenogenesis. Adenogenesis involves the budding differentiation of the glandular epithelium (GE) from the luminal epithelium (LE) and then GE proliferation and coiling/branching morphogenetic development within the stroma between birth (postnatal day or PND 0) and PND 56. Insulin-like growth factor (IGF)-I and IGF-II mRNAs were previously found to be expressed only in the endometrial stroma, whereas the IGF receptor (IGF-1R) mRNA was most abundant in epithelia and in stroma, suggesting that an intrinsic IGF system regulates postnatal development of the uterus. Given that the biological activities of IGFs are modulated by a family of six IGF binding proteins (IGFBPs) and specific proteases, the objective was to determine the effects of age and estrogen disruption on expression of IGFs, IGFBPs and pregnancy-associated plasma protein A (PAPP-A or IGFBP-4 protease) in the ovine uterus. In Study One, circulating levels of IGF-I and IGF-II in the serum of neonatal ewes did not change between PND 0 and PND 56. Levels of immunoreactive IGF-I, IGF-II and IGF-1R protein were most abundant on the apical surface of the endometrial LE and GE. RT-PCR analyses detected expression of IGFBPs (3, 4, 5 and 6) as well as PAPP-A mRNAs in the uterus, but not IGFBP-1 and IGFBP-2 mRNAs. IGFBP-3 and IGFBP-4 mRNAs were expressed specifically in the endometrial stroma and myometrium and increased after birth. PAPP-A mRNA was expressed specifically in the endometrial stroma and increased after birth. In Study Two, ewes were treated from birth with estradiol-17β valerate (EV), which reduces uterine growth and inhibits endometrial adenogenesis. On PNDs 14 and 56, IGFBP-3 mRNA was decreased in the uterus of EV-treated ewes, but IGF-1R and IGFBP-4 mRNAs were not affected. PAPP-A mRNA was increased by EV treatment on PND 14, but decreased on PND 56. These results support the hypothesis that an intrinsic IGF system in the uterus regulates epithelial–stromal interactions important for postnatal uterine growth and endometrial gland morphogenesis in the sheep.

Abstract

Postnatal development of the ovine uterus primarily involves uterine gland morphogenesis or adenogenesis. Adenogenesis involves the budding differentiation of the glandular epithelium (GE) from the luminal epithelium (LE) and then GE proliferation and coiling/branching morphogenetic development within the stroma between birth (postnatal day or PND 0) and PND 56. Insulin-like growth factor (IGF)-I and IGF-II mRNAs were previously found to be expressed only in the endometrial stroma, whereas the IGF receptor (IGF-1R) mRNA was most abundant in epithelia and in stroma, suggesting that an intrinsic IGF system regulates postnatal development of the uterus. Given that the biological activities of IGFs are modulated by a family of six IGF binding proteins (IGFBPs) and specific proteases, the objective was to determine the effects of age and estrogen disruption on expression of IGFs, IGFBPs and pregnancy-associated plasma protein A (PAPP-A or IGFBP-4 protease) in the ovine uterus. In Study One, circulating levels of IGF-I and IGF-II in the serum of neonatal ewes did not change between PND 0 and PND 56. Levels of immunoreactive IGF-I, IGF-II and IGF-1R protein were most abundant on the apical surface of the endometrial LE and GE. RT-PCR analyses detected expression of IGFBPs (3, 4, 5 and 6) as well as PAPP-A mRNAs in the uterus, but not IGFBP-1 and IGFBP-2 mRNAs. IGFBP-3 and IGFBP-4 mRNAs were expressed specifically in the endometrial stroma and myometrium and increased after birth. PAPP-A mRNA was expressed specifically in the endometrial stroma and increased after birth. In Study Two, ewes were treated from birth with estradiol-17β valerate (EV), which reduces uterine growth and inhibits endometrial adenogenesis. On PNDs 14 and 56, IGFBP-3 mRNA was decreased in the uterus of EV-treated ewes, but IGF-1R and IGFBP-4 mRNAs were not affected. PAPP-A mRNA was increased by EV treatment on PND 14, but decreased on PND 56. These results support the hypothesis that an intrinsic IGF system in the uterus regulates epithelial–stromal interactions important for postnatal uterine growth and endometrial gland morphogenesis in the sheep.

Introduction

Postnatal development of the ovine uterus involves the emergence, proliferation and differentiation of endometrial glands, specification of intercaruncular stroma, development of endometrial folds and, to a lesser extent, growth of endometrial caruncular areas and the myometrium (Taylor et al. 2000, Gray et al. 2001a). Uterine gland development or adenogenesis is initiated between postnatal days (PNDs) 1 and 7 when shallow epithelial invaginations appear along the luminal epithelium (LE) in presumptive intercaruncular areas. Between PNDs 7 and 14, the nascent glandular epithelia (GE) bud and invaginate into the stroma and then proliferate to form tubules or ducts that begin to coil and branch at the tips by PND 21. After PND 14, endometrial adenogenesis primarily involves coiling and slight branching morphogenetic growth of tubular endometrial glands from the upper stroma (e.g. stratum compactum) underneath the LE into the lower stroma (e.g. stratum spongiosum) adjacent to the inner circular layer of the myometrium. By PND 56, uterine morphogenesis is essentially complete, as the aglandular caruncular and glandular intercaruncular endometrial areas appear histoarchitecturally similar to that of the adult uterus (Taylor et al. 2000). The success of uterine development in the neonate directly impacts on the embryotrophic capacity of the adult uterus. Inappropriate exposure to progestins from birth to PND 56 permanently ablates endometrial gland development and results in a uterine gland knockout (UGKO) phenotype in the adult (Gray et al. 2001b). Adult UGKO ewes are infertile and exhibit a defect in peri-implantation conceptus survival and growth (Gray et al. 2001a, 2002). Therefore, it is important to understand the hormonal, cellular and molecular mechanisms governing postnatal uterine development (Bartol et al. 1999).

Insulin-like growth factors (IGF-I and IGF-II) function as endocrine and paracrine/autocrine hormones that stimulate proliferation and differentiation of many diverse cell types (Jones & Clemmons 1995, Baxter 2000). Established components of the IGF system include IGF-I and IGF-II, type I and type II IGF receptors (IGF-1R and IGF-2R), six high affinity IGF binding proteins (IGFBP-1 to -6), and IGFBP proteases (Clemmons 1997, Hwa et al. 1999). In the neonatal ovine uterus, IGF-I and IGF-II mRNAs are expressed only in the endometrial stroma, whereas IGF-1R mRNA is expressed in all uterine cell types with the highest levels in the GE (Taylor et al. 2001). IGF-2R was not detected in the neonatal ovine uterus (Taylor et al. 2001). Interestingly, IGF-I and IGF-II mRNAs were most abundant in the stroma surrounding the developing glands in the intercaruncular areas of the endometrium (Taylor et al. 2001). Recently, estrogen disruption of uterine growth and endometrial adenogenesis was correlated with alterations in normal patterns of IGF-I, IGF-II and IGF-1R expression in the neonatal ewe (Carpenter et al. 2003a, Hayashi et al. 2004), supporting the idea that this intrinsic growth factor system regulates uterine development after birth. The IGF system is also implicated in postnatal rodent uterine development (Adesanya et al. 1999, Gu et al. 1999), and adult IGF-I null female mice have severe reductions in uterine weight and size (Baker et al. 1996). In mice, locally produced IGF-I can maintain normal growth and development in the absence of circulating IGF-I (Yakar et al. 1999). However, estrogen-induced uterine growth appears to require systemic IGF-I in mice (Sato et al. 2002). Collectively, available studies support the hypothesis that IGFs of local stromal origin are important mitogens that act in a classical epithelial–stromal manner on epithelial IGF-1R to regulate uterine growth and endometrial adenogenesis in the neonatal ewe. The systemic levels of IGFs in the neonatal ewe have not been reported in detail.

Six distinct yet structurally homologous IGF binding proteins, designated IGFBP-1 through IGFBP-6, function as regulators of the biological activities of IGF-I and IGF-II (Jones & Clemmons 1995, Firth & Baxter 2002). IGFBPs can either inhibit or enhance IGF activity and can also act independently of the IGFs. One IGFBP-4 protease is pregnancy-associated plasma protein A (PAPP-A) (Jones & Clemmons 1995), which is a metalloproteinase in the metzincin superfamily that includes astacins, serralysins, adamalysins, and matrix metalloproteinases (MMPs) (Overgaard et al. 2000). Although IGFBP mRNA distribution has been reported in the adult ovine uterus during gestation (Wathes et al. 1998b, Nayak & Giudice 2003), the IGFBP system has not been investigated in the developing neonatal ovine uterus. Our working hypothesis is that an intrinsic IGF system regulates postnatal uterine development and, in particular, endometrial adenogenesis in the neonatal ewe. Therefore, one objective of the present studies was to determine the effects of postnatal age on (1) systemic levels of IGF-I and IGF-II, (2) expression of IGF-I, IGF-II and IGF-1R protein in the uterus, and (3) expression of IGFBPs and PAPP-A in the uterus. The second objective was to determine the effects of estrogen-induced developmental disruption on expression of IGFBPs and PAPP-A in the neonatal ovine uterus.

Materials and methods

Experimental design and tissue collection

All experimental and surgical procedures were approved by the University Laboratory Animal Care and Use Committee of Texas A&M University.

Study One

Crossbred Suffolk ewes were mated to Suffolk rams between November and December 2002. Ewes included in the following experiment were born between February and March 2003. All lambs were suckling their dams throughout the experiment. Crossbred, spring-born Suffolk ewes (n = 45) were assigned randomly at birth (PND 0) to be hysterectomized on PND 0 (n = 6), 7 (n = 4), 14 (n = 5), 21 (n = 5), 28 (n = 5), 35 (n = 5), 42 (n = 5), 49 (n = 5), or 56 (n = 5). Before surgery, blood samples were collected by jugular venipuncture, and serum was obtained by centrifugation after coagulation. At hysterectomy, the entire reproductive tract was excised, and the uterus was trimmed free of the broad ligament, oviduct, and cervix. Each uterine horn and ovary was fixed in 4% (w/v) paraformaldehyde in PBS (pH 7.2). After 24 h, fixed tissues were changed to 70% ethanol and then embedded in Paraplast Plus (Oxford Labware, St Louis, MO, USA). Several sections from the middle of each uterine horn were snap-frozen in Tissue-Tek OCT compound (SAKURA Finetek USA Inc., Torrance, CA, USA). The remainder of the uterus was frozen in liquid nitrogen and stored at −80 °C.

Study Two

Crossbred Suffolk ewes were mated to Suffolk rams between July and October 2003. Ewes included in the following experiment were born between October 2003 and January 2004, and lambs were suckling their dams throughout the experiment. As described previously (Carpenter et al. 2003a), ewes (n = 14) were assigned randomly at birth (PND 0) to receive daily i.m. injections from PND 0 to PND 55 of: (1) corn oil vehicle as a control (CX) or (2) estradiol-17β valerate (EV; Sigma) in corn oil at a dose of 50 μg per kg body weight. Ewes were weighed and the EV dose adjusted every 7 days. On PND 14, the right ovarian pedicle was ligated with a suture, and the ovary and oviduct were removed. The right uterine horn was ligated with a suture above the intercornual ligament, and the anterior portion of the right uterine horn above the ligature was removed, fixed in 4% (w/v) paraformaldehyde in PBS (pH 7.2), and processed for histology. On PND 56, all ewes were killed and necropsied. The entire left uterine horn was dissected from the remaining portion of the right uterine horn, fixed in 4% (w/v) paraformaldehyde in PBS (pH 7.2), and processed for histology. The remainder of the uterus was frozen in liquid nitrogen and stored at −80 °C.

IGF-I radioimmunoassay (RIA)

Blood samples for serum were allowed to clot for 1 h at room temperature. Serum was then collected by centrifugation (3000 × g for 30 min at 4 °C), removed, and stored at −20 °C. Serum concentrations of IGF-I were determined by a double-antibody RIA procedure (Bilby et al. 1999) with all the samples processed in a single assay. The primary antibody was obtained from Dr A F Parlow, National Hormone and Pituitary Program (UCLA Medical Center, Torrance, CA, USA). The standard curve, ranging from 2 pg to 1000 pg/tube, was constructed using recombinant IGF-I from Peninsula Labs (Belmont, CA, USA). Iodinated IGF-I (Cat# H-5406) tracer was from Peninsula Labs. Normal rabbit serum and goat anti-rabbit antibody were from Antibodies, Inc. (Davis, CA, USA). Briefly, serum samples (10 μl) were incubated with 500 μl assay buffer (0.02% protamine sulfate, 30 mM sodium phosphate, 0.05% Tween 20, 0.02% sodium azide, and 0.01 M EDTA, pH 7.5) and 400 μl 1 M glycine (pH 3.2) for 48 h at 37 °C. After incubation, the acidified samples were neutralized with 90 μl 0.05 M NaOH. Duplicate 50 μl aliquots of the acidified samples were assayed. The RIA tubes (polypropylene, 12 × 75 mm) were incubated at 4 °C in the presence of primary antibody for a 24-h period, after which iodinated IGF-I (20 000 c.p.m./100 μl) was added for an additional incubation period of 18 h at 4 °C. The assay was terminated by addition of 50 μl normal rabbit serum (1:100 dilution), 50 μl goat anti-rabbit antibody (1:60) and 300 μl of a polyethylene glycol solution (12.5% w/v; 8000 Da molecular mass; Sigma). The RIA tubes were incubated for 30 min before centrifugation at 4 °C. The supernatant was discarded and radioactivity associated with the pellet (bound fraction) was determined by counting for 2 min on a gamma counter. Acidified serum samples representing high, medium and low concentrations of IGF-I were assayed to represent internal quality control pools. The mean intra-assay coefficient of variation was 4.6%, and the assay sensitivity was 3.6 pg/ml.

IGF-II RIA

Concentrations of IGF-II in serum were determined by double antibody RIA in one assay as previously described (Spicer et al. 1995) with the following modifications. The tracer and standard were recombinant human IGF-II, and the extraction was performed using acid ethanol (16 h at 4°C) as previously described (Echternkamp et al. 1990). The assay sensitivity, defined as 95% of total binding, was 14 ng/ml and the intra-assay CV was 2.8%.

RT-PCR analyses

Partial cDNAs for IGF-1R, IGFBP-1 through IGFBP-6, and PAPP-A mRNAs were generated by RT-PCR using total RNA, isolated from the neonatal ovary, neonatal uterus or endometrium from gestational day (GD) 16, as described previously (Taylor et al. 2000, 2001, Hayashi et al. 2003). Primer and annealing temperatures used for PCR are summarized in Table 1. The amplified PCR products were sub-cloned into the pCRII cloning vector using a T/A Cloning Kit (Invitrogen Life Technologies, Carlsbad, CA, USA) and sequenced in both directions using an ABI PRISM Dye Terminator Cycle Sequencing Kit and ABI PRISM automated DNA sequencer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA) to confirm identity.

In-situ hybridization

Expression of mRNAs in uterine tissues was determined by in-situ hybridization using methods described previously (Spencer et al. 1999). Briefly, deparaffinized, rehydrated, and deproteinated cross-sections (5 μm) of the uterus and ovary from each ewe were hybridized with radiolabeled sense or antisense cRNA probes generated from linearized plasmid templates using in vitro transcription with [α-35S]UTP. After hybridization, washing and ribonuclease A digestion, slides were dipped in NTB-2 liquid photographic emulsion (Kodak, Rochester, NY, USA), stored at 4 °C for 7 to 28 days, and developed in Kodak D-19 developer. Slides were then counterstained with Gill’s modified hematoxylin (Stat Lab, Lewisville, TX, USA), dehydrated through a graded series of alcohol to xylene, and protected with a coverslip. Images of representative fields were recorded using a Nikon Eclipse 1000 photomicroscope (Nikon Instruments Inc., Lewisville, TX, USA) fitted with a Nikon DXM1200 digital camera.

Immunofluorescence analyses

Rabbit anti-human IGF-I (H-70), IGF-II (H-103) and IGF-1R (H-78) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Normal rabbit IgG was from Santa Cruz, and fluorescein-conjugated goat antibody against rabbit IgG was from Chemicon International (Temecula, CA, USA). Proteins were localized in frozen uterine cross-sections (8 μm) using methods previously described (Johnson et al. 1999). Briefly, tissues were fixed in −20 °C methanol, permeabilized with 0.3% Tween 20 in PBS, blocked in 10% normal goat serum, incubated overnight at 4 °C with 2 to 10 μg/ml primary antibody, and detected with fluorescein-conjugated secondary antibodies. Slides were then overlaid with a coverglass. Photomicrographs of representative fields of immunofluorescence were evaluated using a Zeiss Axioplan2 microscope interfaced with a AxioCam high resolution digital camera and AxioVision 3.1 software (AxioVision, Thornwool, NY, USA). Representative fluorescence images of cross-section for each antibody and for each ewe were recorded digitally.

As described previously (Taylor et al. 2001, Hayashi et al. 2003), relative hybridization signal intensity for staining intensity for immunoreactive protein expression was assessed visually in uterine sections from each ewe by two independent observers and scored as follows: absent i.e. no staining above IgG control (−), weak (+), moderate (++), or strong (+++). Intercaruncular endometrial tissues, including LE, stroma, GE, and myometrium were scored. The GE was separated into stratum compactum and stratum spongiosum.

Statistical analyses

All quantitative data were subjected to least-squares ANOVA using General Linear Models procedures of the Statistical Analysis System (Cary, NC, USA). Data are presented as least-square means with overall standard errors (s.e.).

Results

Systemic levels of IGF-I and IGF-II

Circulating levels of IGF-I and IGF-II in the serum of neonatal ewes did not change (P > 0.10) between birth and PND 56 (Fig. 1).

Expression of IGF-I, IGF-II and IGF-1R protein in the neonatal uterus

Immunofluorescence analyses were performed to localize immunoreactive IGF-I, IGF-II and IGF-1R protein in the neonatal uterus (Fig. 2). Results of immunofluorescence analyses were quantified and are summarized in Table 2. Low levels of immunoreactive IGF-I protein were observed on the apical surface of the endometrial LE and GE between birth and PND 56. Immunoreactive IGF-II protein was detected in all endometrial cell types; however, abundant IGF-II protein was detected on the apical surface of the endometrial LE and GE. Similarly, immunoreactive IGF-1R protein was detected predominantly on the apical surface of the endometrial LE and GE and at much lower abundance in the stroma and myometrium. The abundance of immunoreactive IGF-1R protein increased in the endometrial GE after PND 21.

Expression of IGFBPs and PAPP-A in the neonatal uterus

In order to determine which of the six IGFBP family members was expressed in the neonatal ovine uterus, RT-PCR analysis was performed using total RNA isolated from the neonatal uterus. Total RNA isolated from ovine endometrium from day 16 of gestation (GD 16) and a PND 42 ovary were used as positive controls (data not shown). IGFBP-1 mRNA was not detected in either the neonatal ovine uterus or ovary, but was detected in the endometrium from GD 16. IGFBP-2 mRNA was detected in GD 16 endometrium and PND 42 ovary, but not in the neonatal uterus. IGFBP-3, -4, -5 and -6 mRNAs were detected in the neonatal ovine uterus and ovary as well as GD 16 endometrium. PAPP-A mRNA was detected in the uterus on all PNDs (data not shown).

In-situ hybridization analyses were conducted to localize expression of IGFBP mRNAs in the neonatal ovine uterus (Fig. 3). Consistent with the results of RT-PCR analyses, expression of IGFBP-1 and IGFBP-2 mRNA was not detected in the neonatal ovine uterus (data not shown). IGFBP-3 and IGFBP-4 mRNAs were detected only in the endometrial stroma and myometrium. The overall abundance of both IGFBP-3 and IGFBP-4 mRNAs was low or undetectable in the endometrial stroma and myometrium on PND 0 and increased thereafter. Although IGFBP-5 and IGFBP-6 mRNAs were detected in the neonatal ovine uterus by RT-PCR, the overall abundance was below the detectable limits of in-situ hybridization analysis (data not shown). PAPP-A mRNA was detected specifically in the stratum compactum stroma in both caruncular and inter-caruncular endometrial areas, and increased between PND 0 and PND 56 (Fig. 4). PAPP-A mRNA was not observed in the endometrial LE or GE nor myometrium. Groups of pigmented melanocytes also produce a prominent signal in darkfield microscopy even though they do not express IGFBP or PAPP-A mRNAs.

Expression of IGF-IR, IGFBPs and PAPP-A in the EV-treated neonatal uterus

In Study Two, treatment of ewes from birth with EV affected uterine development and endometrial adenogenesis (Fig. 5). The endometrium from uteri of EV-treated ewes on both PND 14 and PND 56 did not contain any histologically discernable endometrial glands. Expression of IGF-1R mRNA was observed abundantly in the endometrial LE and GE with lower levels in the stroma in CX ewes on PNDs 14 and 56 and was not affected by exposure to EV (Fig. 5a). IGFBP-3 mRNA was detected in the stroma and myometrium on PND 14, and expression was markedly increased on PND 56 in CX ewes (Fig. 5b). Treatment with EV decreased IGFBP-3 mRNA in the myometrium on PND 14 and predominantly in the stroma on PND 56 (Fig. 5b). In contrast, EV did not affect expression of IGFBP-4 mRNA in the stroma on PND 14 or PND 56 (Fig. 5c). On the other hand, PAPP-A mRNA was increased in the stroma of EV-treated ewes on PND 14, but was reduced on PND 56 as compared with CX ewes (Fig. 5d).

Discussion

In the present study, circulating levels of IGF-I and IGF-II were not different between birth and PND 56. The levels of circulating IGF-I and IGF-II observed in the present study were within the range of values previously reported for neonatal lambs (Mesiano et al. 1987, 1989). Plasma IGF-I increased in ram lambs between birth and PNDs 4 to 9 and was dependent on suckling (Greenwood et al. 2002). Furthermore, IGF-I and IGF-II increased between PNDs 0 and 20 in suckling ram and ewe lambs, and the increase between PNDs 1 and 16 was greater in ram lambs than in ewe lambs (Gatford et al. 1997). Overall, circulating IGF levels in ewes in the present study were not substantially different from previous reports. Therefore, systemic IGFs could play a regulatory role in postnatal uterine development. The importance of local and systemic IGFs in normal growth and development of tissues remains a subject of some debate. In mice, locally produced IGF-I can maintain normal growth and development in the absence of circulating IGF-I (Yakar et al. 1999), whereas estrogen-induced uterine growth appears to require systemic IGF-I (Sato et al. 2002). In the neonatal ewe, circulating levels of estradiol-17β are below detectable limits after birth to at least PND 56 (Carpenter et al. 2003a,c), suggesting that circulating IGF-I and IGF-II are not regulated by ovarian steroids in the neonatal ewe.

Previous studies found that IGF-I and IGF-II mRNAs were expressed in the endometrial stroma of the neonatal ovine uterus surrounding the developing glands (Taylor et al. 2001, Carpenter et al. 2003a). IGF-1R mRNA was expressed by all uterine cell types, but was particularly abundant in the endometrial epithelia. The same pattern of IGF-I, IGF-II and IGF-1R mRNA expression was observed in the adult ovine uterus (Stevenson et al. 1994). The present study is the first to localize the expression of immunoreactive IGF-I, IGF-II and IGF-1R protein in the ovine uterus. Immunoreactive IGF-I protein was detected at fairly low levels on the endometrial LE and, to some extent, GE. In contrast, immunoreactive IGF-II protein was localized in relative abundance on the apical surface of the endometrial LE and GE. The biological effects of IGF-I and IGF-II are mediated by the IGF-1R in most tissue and cell systems (Jones & Clemmons 1995). Although immunoreactive IGF-1R protein was observed in all uterine cell types, the most abundant expression was detected on the apical surfaces of endometrial LE and GE during postnatal development. Collectively, available results strongly support the idea that local IGF-I and IGF-II of stromal origin act on IGF-1R in the epithelium and stroma to regulate uterine growth and endometrial adenogenesis in the neonatal ewe (Taylor et al. 2001, Carpenter et al. 2003a, Hayashi et al. 2004). Although IGF-II plays a fundamental role in embryonic and fetal development, its role during the postnatal period is generally thought to be less important since it is substituted by IGF-I (DeChiara et al. 1990). Interestingly, IGF-II gene expression was not observed in the neonatal mouse uterus (Gu et al. 1999), but was detected in the neonatal ovine uterus in the present study, and in the adult ovine and human uterus (Wathes et al. 1998a, Nayak & Giudice 2003). Given the lack of IGF-II in the neonatal mouse uterus, the precise role of IGF-II in uterine development and function remains to be determined using other models such as domestic ruminants.

The activities of both IGF-I and IGF-II are modulated by their association with six IGFBPs (Jones & Clemmons 1995). By binding IGF-I and IGF-II, IGFBPs have growth-inhibitory effects by restricting the availability of these ligands for binding to IGF-1R (Rechler & Brown 1992, Jones & Clemmons 1995). On the contrary, the IGFBPs also regulate IGF bioavailability by maintaining a circulating reservoir of IGFs and prolonging their half-life (Ferry et al. 1999). At the tissue level, IGFBPs interact with either extracellular matrix constituents (IGFBP-2 and IGFBP-5) (Arai et al. 1996) or directly with cell membranes (IGFBP-1 and IGFBP-3) (Delbe et al. 1991). In the present study, RT-PCR analyses of the neonatal ovine uterus detected expression of only IGFBP-3, -4, -5 and -6 mRNAs. In-situ hybridization localized expression of IGFBP-3 and IGFBP-4 mRNAs only in the endometrial stroma and myometrium of the neonatal ovine uterus, whereas IGFBP-5 and IGFBP-6 mRNAs were below detectable limits of the in-situ hybridization procedure. Overall, expression of IGFBP-3 and IGFBP-4 mRNAs increased after birth and was highest in the stroma during the period of endometrial gland morphogenesis. Potentiation and inhibition of IGF actions by IGFBP-3 has been demonstrated in many cell culture systems (Firth & Baxter 2002). Interestingly, IGFBP-3 has IGF-1R-independent actions to inhibit cell growth (Valentinis et al. 1995). Moreover, IGFBP-3 interacts with and modifies the biological activities of a number of other growth factors, including transforming growth factor beta and retinoids (Firth & Baxter 2002).

The action of IGFBP-4 appears to be purely inhibitory with respect to both IGF-I and IGF-II (Jones & Clemmons 1995). IGFBP-4 availability in the microenvironment is determined not only by specific gene expression, but also through limited proteolysis by specific proteases such as PAPP-A (Fowlkes 1997). Enzymatic cleavage of IGFBP-4 by PAPP-A markedly reduces its binding of IGFs and potentiates the effectiveness of exogenous IGF-I in stimulating receptor-mediated growth responses in cultured cells (Qin et al. 1999). In the present study, PAPP-A mRNA was expressed specifically in the compact stroma of the endometrium in the neonatal ovine uterus. Expression of PAPP-A increased from birth to PND 56 in association with uterine growth and endometrial gland morphogenesis. Thus, bioavailability of local IGF-I and IGF-II in the uterine microenvironment may be regulated through controlled IGFBP-4 proteolysis by PAPP-A. Similarly, PAPP-A, IGFBP-4, and IGF appear to function together in the ovary and uterus in other species (Conover et al. 2001, Giudice et al. 2002, Mazerbourg et al. 2004).

In the present study, expression of IGFBP-1 and IGFBP-2 was not detected in the neonatal uterus by RT-PCR. Furthermore, expression of IGFBP-5 and IGFBP-6 mRNA was only detectable using very high cycles of amplification (30–35 cycles) in the RT-PCR analyses (K Hayashi and T E Spencer, unpublished results), and expression of these IGFBPs was below detectable limits of the in-situ hybridization analysis. In adult ewes, these IGFBPs are expressed in the uterus during the estrous cycle and pregnancy (Reynolds et al. 1997, Osgerby et al. 1999, Gadd et al. 2000). IGFBP-1 mRNA is expressed by the LE during early pregnancy and then declines to undetectable levels during later stages of gestation (Osgerby et al. 1999). IGFBP-2 mRNA is undetectable in the uterus during the estrous cycle, but is abundant in the dense stroma of the placentomal capsule after GD 29, which also expresses IGFBP-4 (Reynolds et al. 1997). In cyclic ewes, IGFBP-5 mRNA is present in the caruncular endometrium and in the inter-caruncular endometrial LE (Gadd et al. 2000). During pregnancy, IGFBP-5 is also present in the endometrial LE and GE as well as in caruncular stroma surrounding the chorionic villi. Available studies indicate that the expression of the genes encoding IGFBP-1 through IGFBP-6 are regulated by steroid hormones during the estrous cycle and potential conceptus factors during pregnancy (Wathes et al. 1998a, Nayak & Giudice 2003). In the present study, IGFBP-3 and IGFBP-4 mRNAs were observed only in the endometrial stroma and not in the endometrial LE as in the adult ovine uterus. Therefore, factors from the ovary, e.g. estrogen and progesterone, and from the conceptus appear to act on the ovine endometrium to regulate IGFBP gene expression after puberty in a tissue- and cell type-specific manner.

Available results strongly support the hypothesis that the intrinsic IGF system (IGF-I, IGF-II, IGFBP-3, IGFBP-4, and PAPP-A) is an important regulator of endometrial gland morphogenesis and uterine growth in the developing neonatal ewe. In Study Two, exposure of neonatal ewes to EV from birth did not affect epithelial IGF-1R or stromal IGFBP-4 mRNA, but did decrease IGFBP-3 mRNA in the stroma. In the EV-treated ewes, PAPP-A mRNA in the stroma was increased initially on PND 14, but was decreased by PND 56. The negative effects of EV exposure to decrease IGFBP-3 and increase PAPP-A would be predicted to modify biological activities of IGFs in the endometrium. However, stromal IGF-I and IGF-II expression is substantially decreased in the endometrium of EV-treated ewes (Carpenter et al. 2003a). Similarly, disruption of uterine growth and endometrial adenogenesis by inappropriate exposure of the neonatal ewe to estradiol-17β benzoate from PNDs 14 to 28 or PNDs 42 to 56 negatively affected expression of IGF-I, IGF-II and IGF-1R in the endometrium (Hayashi et al. 2004). Collectively, these results support the hypothesis that IGFs of local and perhaps systemic origin regulate critical interactions between the stroma and epithelium that are crucial for development of the uterus and other female reproductive tract organs (Cunha & Lung 1979, Cunha et al. 1989). Studies to determine the effects of modulating systemic and intrinsic IGF-I and IGF-II levels on postnatal ovine uterine development need to be conducted, but could be an effective tool for optimizing post-natal uterine development and perhaps adult uterine capacity and fertility in domestic ruminants as well as in humans (Carpenter et al. 2003b).

Table 1

Summary of PCR primer sequences and expected cDNA sizes.

PrimerSequences of forward and reverse primers (5′-3′)GenBank (species)Annealing temperature (°C)cDNA size (bp)
IGF-IRGAGATTGCAGATGGCATGG 
 GCTGATGATCTCCAGGAACGX54980 (bovine)56441
IGFBP-1GATGACCGAGTCCAGTGAGG 
 CCATTCTTGTTGCAGTTTGGAF327650 (ovine)54210
IGFBP-2AGCAGGTTGCAGACAATGG 
 ACAGTTGGGGATGTGTAGGGS44612 (ovine)54353
IGFBP-3CAGAACTTCTCCTCCGAGTCC 
 CCACACACCAGCAGAAACCAF327651 (ovine)54205
IGFBP-4CTTGGCCAAAATTCGAGACC
 AAGCTTCACTCCCGTCTTCCS77394 (ovine)54286
IGFBP-5GCGGCGTCTACACTGAGC
 GAAGATCTTGGGCGAGTAGGS52657 (bovine)54212
IGFBP-6AAGGAGAGTAAGCCCCAAGC
 GGCACGTAGAGTGTATGAGACCAF327653 (ovine)54212
PAPP-AACACATGTGGCTTCAACAGC
 AGACAAAGGTCACCCAGACGAF421140 (ovine)54552
Table 2

Distribution and relative abundance of immunoreactive IGF-I, IGF-II and IGF-1R protein in the neonatal uterus.

GE
PNDLEStr. comp.St. spons.StromaMyometrium
PND, postnatal day; LE, luminal epithelium; GE, glandular epithelium (shallow or stratum compactum and deep or stratum spongiosum); NP, not present.
− , no staining above IgG control; +, weak staining; ++, moderate staining; +++, strong staining.
IGF-I
0+++NPNP+/−+/−
7+++++NP+/−+/−
14+++NP+/−+/−
21++++/−
28+/−+/−+/−+/−
42+/−+/−+/−+/−
56+/−+/−+/−+/−
IGF-II
0+++NPNP+++
7+++++NP+++
14+++++NP+++
21+++++++/++++
28+++++++/++++
42+++++++/++++
56+++++++/++++
IGF-1R
0+NPNP−/+
7++NP−/+
14++NP−/+
21++++++
28+++++++++
42+++++++++
56+++++++++
Figure 1
Figure 1

Systemic levels of IGF-I and IGF-II in the serum of neonatal ewes between postnatal day (PND) 0 and PND 56 (n = 4–6 ewes per day). Levels of both IGFs were not affected by postnatal age (P > 0.10).

Citation: Reproduction 129, 3; 10.1530/rep.1.00342

Figure 2
Figure 2

Distribution of immunoreactive IGF-I, IGF-II and IGF-1R in the neonatal ovine uterus on postnatal days (PND) 0, 7, 14, 21, 28, 42 and 56. GE, glandular epithelium; LE, luminal epithelium; S, stroma; sc, stratum compactum; ss, stratum spongiosum. Scale bar, 100 μm.

Citation: Reproduction 129, 3; 10.1530/rep.1.00342

Figure 3
Figure 3

In-situ localization of (a) IGFBP-3 and (b) IGFBP-4 mRNA in the neonatal ovine uterus on postnatal days (PND) 0, 14 and 56. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; M, myometrium; S, stroma. Scale bar, 100 μm.

Citation: Reproduction 129, 3; 10.1530/rep.1.00342

Figure 4
Figure 4

In-situ localization of PAPP-A mRNA in the neonatal ovine uterus. Left two columns (A) focus on endometrium, right (B) focus on myometrium. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; Mel, melanocyte; M, myometrium; S, stroma. Scale bar, 100 μm.

Citation: Reproduction 129, 3; 10.1530/rep.1.00342

Figure 5
Figure 5

Expression of (a) IGF-1R, (b) IGFBP-3, (c) IGFBP-4 and (d) PAPP-A mRNAs in uteri from control (CX) and estradiol valerate (EV)-treated ewes on PNDs 14 and 56. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; M, myometrium; S, stroma. Scale bar, 100 μm.

Citation: Reproduction 129, 3; 10.1530/rep.1.00342

Received 1 June 2004
 First decision 13 August 2004
 Revised manuscript received 6 October 2004
 Accepted 12 November 2004

The authors thank Mr Kendrick LeBlanc for assistance with animal husbandry and surgery. This study was supported by NIH Grants HD38274 and P30 ES09106. Kanako Hayashi is a Lalor Foundation Fellow. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

References

  • Adesanya OOZhou JSamathanam CPowell-Braxton L & Bondy CA1999 Insulin-like growth factor 1 is required for G2 progression in the estradiol-induced mitotic cycle. PNAS963287–3291.

    • Search Google Scholar
    • Export Citation
  • Arai TBusby W Jr & Clemmons DR1996 Binding of insulin-like growth factor (IGF) I or II to IGF-binding protein-2 enables it to bind to heparin and extracellular matrix. Endocrinology1374571–4575.

    • Search Google Scholar
    • Export Citation
  • Baker JHardy MPZhou JBondy CLupu FBellve AR & Efstratiadis A1996 Effects of an Igf1 gene null mutation on mouse reproduction. Molecular Endocrinology10903–918.

    • Search Google Scholar
    • Export Citation
  • Bartol FFWiley AAFloyd JGOtt TLBazer FWGray CA & Spencer TE1999 Uterine differentiation as a foundation for subsequent fertility. Journal of Reproduction and Fertility Supplement54287–302.

    • Search Google Scholar
    • Export Citation
  • Baxter RC2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. American Journal of Physiology. Endocrinology and Metabolism278E967–E976.

    • Search Google Scholar
    • Export Citation
  • Bilby CRBader JFSalfen BEYoungquist RSMurphy CNGarverick HACrooker BA & Lucy MC1999 Plasma GH IGF-I and conception rate in cattle treated with low doses of recombinant bovine GH. Theriogenology511285–1296.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDGray CABryan TMWelsh TH Jr & Spencer TE2003a Estrogen and antiestrogen effects on neonatal ovine uterine development. Biology of Reproduction69708–717.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDGray CANoel SGertler ABazer FW & Spencer TE2003b Prolactin regulation of neonatal ovine uterine gland morphogenesis. Endocrinology144110–120.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDHayashi K & Spencer TE2003c Ovarian regulation of endometrial gland morphogenesis and activin-follistatin system in the neonatal ovine uterus. Biology of Reproduction69851–860.

    • Search Google Scholar
    • Export Citation
  • Clemmons DR1997 Insulin-like growth factor binding proteins and their role in controlling IGF actions. Cytokine and Growth Factor Reviews845–62.

    • Search Google Scholar
    • Export Citation
  • Conover CAFaessen GFIlg KEChandrasekher YAChristiansen MOvergaard MTOxvig C & Giudice LC2001 Pregnancy-associated plasma protein-a is the insulin-like growth factor binding protein-4 protease secreted by human ovarian granulosa cells and is a marker of dominant follicle selection and the corpus luteum. Endocrinology1422155–2158.

    • Search Google Scholar
    • Export Citation
  • Cunha GR & Lung B1979 The importance of stroma in morphogenesis and functional activity of urogenital epithelium. In Vitro1550–71.

  • Cunha GRYoung P & Brody JR1989 Role of uterine epithelium in the development of myometrial smooth muscle cells. Biology of Reproduction40861–871.

    • Search Google Scholar
    • Export Citation
  • DeChiara TMEfstratiadis A & Robertson EJ1990 A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature34578–80.

    • Search Google Scholar
    • Export Citation
  • Delbe JBlat CDesauty G & Harel L1991 Presence of IDF45 (mIGFBP-3) binding sites on chick embryo fibroblasts. Biochemical and Biophysical Research Communications179495–501.

    • Search Google Scholar
    • Export Citation
  • Echternkamp SESpicer LJGregory KECanning SF & Hammond JM1990 Concentrations of insulin-like growth factor-I in blood and ovarian follicular fluid of cattle selected for twins. Biology of Reproduction438–14.

    • Search Google Scholar
    • Export Citation
  • Ferry RJ JrKatz LEGrimberg ACohen P & Weinzimer SA1999 Cellular actions of insulin-like growth factor binding proteins. Hormone and Metabolic Research31192–202.

    • Search Google Scholar
    • Export Citation
  • Firth SM & Baxter RC2002 Cellular actions of the insulin-like growth factor binding proteins. Endocrine Reviews23824–854.

  • Fowlkes JL1997 Insulin-like growth factor-binding protein proteolysis: an emerging paradigm in insulin-like growth factor physiology. Trends in Endocrinology and Metabolism8299–306.

    • Search Google Scholar
    • Export Citation
  • Gadd TSOsgerby JC & Wathes DC2000 Regulation and localization of insulin-like growth factor binding protein-5 gene expression in the uterus and placenta of the cyclic and early pregnant ewe. Biology of Reproduction621415–1421.

    • Search Google Scholar
    • Export Citation
  • Gatford KLQuinn KJWalton PEGrant PAHosking BJEgan AR & Owens PC1997 Ontogenic and nutritional changes in circulating insulin-like growth factor (IGF)-I IGF-II and IGF-binding proteins in growing ewe and ram lambs. Journal of Endocrinology15547–54.

    • Search Google Scholar
    • Export Citation
  • Giudice LCConover CABale LFaessen GHIlg KSun IImani BSuen LFIrwin JCChristiansen MOvergaard MT & Oxvig C2002 Identification and regulation of the IGFBP-4 protease and its physiological inhibitor in human trophoblasts and endometrial stroma: evidence for paracrine regulation of IGF-II bioavailability in the placental bed during human implantation. Journal of Clinical Endocrinology and Metabolism872359–2366.

    • Search Google Scholar
    • Export Citation
  • Gray CABartol FFTarleton BJWiley AAJohnson GABazer FW & Spencer TE2001a Developmental biology of uterine glands. Biology of Reproduction651311–1323.

    • Search Google Scholar
    • Export Citation
  • Gray CABazer FW & Spencer TE2001b Effects of neonatal progestin exposure on female reproductive tract structure and function in the adult ewe. Biology of Reproduction64797–804.

    • Search Google Scholar
    • Export Citation
  • Gray CABurghardt RCJohnson GABazer FW & Spencer TE2002 Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction124289–300.

    • Search Google Scholar
    • Export Citation
  • Greenwood PLHunt ASSlepetis RMFinnerty KDAlston CBeermann DH & Bell AW2002 Effects of birth weight and postnatal nutrition on neonatal sheep: III. Regulation of energy metabolism. Journal of Animal Science802850–2861.

    • Search Google Scholar
    • Export Citation
  • Gu YBranham WSSheehan DMWebb PJMoland CL & Streck RD1999 Tissue-specific expression of messenger ribonucleic acids for insulin-like growth factors and insulin-like growth factor-binding proteins during perinatal development of the rat uterus. Biology of Reproduction601172–1182.

    • Search Google Scholar
    • Export Citation
  • Hayashi KCarpenter KDGray CA & Spencer TE2003 The activin-follistatin system in the neonatal ovine uterus. Biology of Reproduction69843–850.

    • Search Google Scholar
    • Export Citation
  • Hayashi KCarpenter K & Spencer T2004 Neonatal estrogen exposure disrupts uterine development in the postnatal sheep. Endocrinology1453247–3257.

    • Search Google Scholar
    • Export Citation
  • Hwa VOh Y & Rosenfeld RG1999 The insulin-like growth factor-binding protein (IGFBP) superfamily. Endocrine Reviews20761–787.

  • Johnson GABurghardt RCSpencer TENewton GROtt TL & Bazer FW1999 Ovine osteopontin: II. Osteopontin and alpha(v)-beta(3) integrin expression in the uterus and conceptus during the periimplantation period. Biology of Reproduction61892–899.

    • Search Google Scholar
    • Export Citation
  • Jones JI & Clemmons DR1995 Insulin-like growth factors and their binding proteins: biological actions. Endocrine Reviews163–34.

  • Mazerbourg SCallebaut IZapf JMohan SOvergaard M & Monget P2004 Up date on IGFBP-4: regulation of IGFBP-4 levels and functions in vitro and in vivo.Growth Hormone and IGF Research1471–84.

    • Search Google Scholar
    • Export Citation
  • Mesiano SYoung IRBaxter RCHintz RLBrowne CA & Thorburn GD1987 Effect of hypophysectomy with and without thyroxine replacement on growth and circulating concentrations of insulin-like growth factors I and II in the fetal lamb. Endocrinology1201821–1830.

    • Search Google Scholar
    • Export Citation
  • Mesiano SYoung IRHey AWBrowne CA & Thorburn GD1989 Hypophysectomy of the fetal lamb leads to a fall in the plasma concentration of insulin-like growth factor I (IGF-I) but not IGF-II. Endocrinology1241485–1491.

    • Search Google Scholar
    • Export Citation
  • Nayak NR & Giudice LC2003 Comparative biology of the IGF system in endometrium decidua and placenta and clinical implications for foetal growth and implantation disorders. Placenta24281–296.

    • Search Google Scholar
    • Export Citation
  • Osgerby JCGadd TS & Wathes DC1999 Expression of insulin-like growth factor binding protein-1 (IGFBP-1) mRNA in the ovine uterus throughout the oestrous cycle and early pregnancy. Journal of Endocrinology162279–287.

    • Search Google Scholar
    • Export Citation
  • Overgaard MTHaaning JBoldt HBOlsen IMLaursen LSChristiansen MGleich GJSottrup-Jensen LConover CA & Oxvig C2000 Expression of recombinant human pregnancy-associated plasma protein-A and identification of the proform of eosinophil major basic protein as its physiological inhibitor. Journal of Biological Chemistry27531128–31133.

    • Search Google Scholar
    • Export Citation
  • Qin XByun DStrong DDBaylink DJ & Mohan S1999 Studies on the role of human insulin-like growth factor-II (IGF-II)-dependent IGF binding protein (hIGFBP)-4 protease in human osteoblasts using protease-resistant IGFBP-4 analogs. Journal of Bone and Mineral Research142079–2088.

    • Search Google Scholar
    • Export Citation
  • Rechler MM & Brown AL1992 Insulin-like growth factor binding proteins: gene structure and expression. Growth Regulation255–68.

  • Reynolds TSStevenson KR & Wathes DC1997 Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early placental development in the ewe. Endocrinology138886–897.

    • Search Google Scholar
    • Export Citation
  • Sato TWang GHardy MPKurita TCunha GR & Cooke PS2002 Role of systemic and local IGF-I in the effects of estrogen on growth and epithelial proliferation of mouse uterus. Endocrinology1432673–2679.

    • Search Google Scholar
    • Export Citation
  • Spencer TEStagg AGJoyce MMJenster GWood CGBazer FWWiley AA & Bartol FF1999 Discovery and characterization of endometrial epithelial messenger ribonucleic acids using the ovine uterine gland knockout model. Endocrinology1404070–4080.

    • Search Google Scholar
    • Export Citation
  • Spicer LJEchternkamp SEWong EAHamilton DT & Vernon RK1995 Serum hormones follicular fluid steroids insulin-like growth factors and their binding proteins and ovarian IGF mRNA in sheep with different ovulation rates. Journal of Animal Science731152–1163.

    • Search Google Scholar
    • Export Citation
  • Stevenson KRGilmour RS & Wathes DC1994 Localization of insulin-like growth factor-I (IGF-I) and -II messenger ribonucleic acid and type 1 IGF receptors in the ovine uterus during the estrous cycle and early pregnancy. Endocrinology1341655–1664.

    • Search Google Scholar
    • Export Citation
  • Taylor KMGray CAJoyce MMStewart MDBazer FW & Spencer TE2000 Neonatal ovine uterine development involves alterations in expression of receptors for estrogen progesterone and prolactin. Biology of Reproduction631192–1204.

    • Search Google Scholar
    • Export Citation
  • Taylor KMChen CGray CABazer FW & Spencer TE2001 Expression of messenger ribonucleic acids for fibroblast growth factors 7 and 10 hepatocyte growth factor and insulin-like growth factors and their receptors in the neonatal ovine uterus. Biology of Reproduction641236–1246.

    • Search Google Scholar
    • Export Citation
  • Valentinis BBhala ADeAngelis TBaserga R & Cohen P1995 The human insulin-like growth factor (IGF) binding protein-3 inhibits the growth of fibroblasts with a targeted disruption of the IGF-I receptor gene. Molecular Endocrinology9361–367.

    • Search Google Scholar
    • Export Citation
  • Wathes DCReynolds TSRobinson RS & Stevenson KR1998aa Role of the insulin-like growth factor system in uterine function and placental development in ruminants. Journal of Dairy Science811778–1789.

    • Search Google Scholar
    • Export Citation
  • Wathes DCReynolds TSRobinson RS & Stevenson KR1998bb Role of the insulin-like growth factor system in uterine function and placental development in ruminants. Journal of Dairy Science811778–1789.

    • Search Google Scholar
    • Export Citation
  • Yakar SLiu JLStannard BButler AAccili DSauer B & LeRoith D1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. PNAS967324–7329.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

     An official journal of

    Society for Reproduction and Fertility

 

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 300 53 6
PDF Downloads 136 53 3
  • View in gallery

    Systemic levels of IGF-I and IGF-II in the serum of neonatal ewes between postnatal day (PND) 0 and PND 56 (n = 4–6 ewes per day). Levels of both IGFs were not affected by postnatal age (P > 0.10).

  • View in gallery

    Distribution of immunoreactive IGF-I, IGF-II and IGF-1R in the neonatal ovine uterus on postnatal days (PND) 0, 7, 14, 21, 28, 42 and 56. GE, glandular epithelium; LE, luminal epithelium; S, stroma; sc, stratum compactum; ss, stratum spongiosum. Scale bar, 100 μm.

  • View in gallery

    In-situ localization of (a) IGFBP-3 and (b) IGFBP-4 mRNA in the neonatal ovine uterus on postnatal days (PND) 0, 14 and 56. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; M, myometrium; S, stroma. Scale bar, 100 μm.

  • View in gallery

    In-situ localization of PAPP-A mRNA in the neonatal ovine uterus. Left two columns (A) focus on endometrium, right (B) focus on myometrium. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; Mel, melanocyte; M, myometrium; S, stroma. Scale bar, 100 μm.

  • View in gallery

    Expression of (a) IGF-1R, (b) IGFBP-3, (c) IGFBP-4 and (d) PAPP-A mRNAs in uteri from control (CX) and estradiol valerate (EV)-treated ewes on PNDs 14 and 56. The photomicrographs are presented in brightfield (left) and darkfield (right) illumination. GE, glandular epithelium; LE, luminal epithelium; M, myometrium; S, stroma. Scale bar, 100 μm.

  • Adesanya OOZhou JSamathanam CPowell-Braxton L & Bondy CA1999 Insulin-like growth factor 1 is required for G2 progression in the estradiol-induced mitotic cycle. PNAS963287–3291.

    • Search Google Scholar
    • Export Citation
  • Arai TBusby W Jr & Clemmons DR1996 Binding of insulin-like growth factor (IGF) I or II to IGF-binding protein-2 enables it to bind to heparin and extracellular matrix. Endocrinology1374571–4575.

    • Search Google Scholar
    • Export Citation
  • Baker JHardy MPZhou JBondy CLupu FBellve AR & Efstratiadis A1996 Effects of an Igf1 gene null mutation on mouse reproduction. Molecular Endocrinology10903–918.

    • Search Google Scholar
    • Export Citation
  • Bartol FFWiley AAFloyd JGOtt TLBazer FWGray CA & Spencer TE1999 Uterine differentiation as a foundation for subsequent fertility. Journal of Reproduction and Fertility Supplement54287–302.

    • Search Google Scholar
    • Export Citation
  • Baxter RC2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. American Journal of Physiology. Endocrinology and Metabolism278E967–E976.

    • Search Google Scholar
    • Export Citation
  • Bilby CRBader JFSalfen BEYoungquist RSMurphy CNGarverick HACrooker BA & Lucy MC1999 Plasma GH IGF-I and conception rate in cattle treated with low doses of recombinant bovine GH. Theriogenology511285–1296.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDGray CABryan TMWelsh TH Jr & Spencer TE2003a Estrogen and antiestrogen effects on neonatal ovine uterine development. Biology of Reproduction69708–717.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDGray CANoel SGertler ABazer FW & Spencer TE2003b Prolactin regulation of neonatal ovine uterine gland morphogenesis. Endocrinology144110–120.

    • Search Google Scholar
    • Export Citation
  • Carpenter KDHayashi K & Spencer TE2003c Ovarian regulation of endometrial gland morphogenesis and activin-follistatin system in the neonatal ovine uterus. Biology of Reproduction69851–860.

    • Search Google Scholar
    • Export Citation
  • Clemmons DR1997 Insulin-like growth factor binding proteins and their role in controlling IGF actions. Cytokine and Growth Factor Reviews845–62.

    • Search Google Scholar
    • Export Citation
  • Conover CAFaessen GFIlg KEChandrasekher YAChristiansen MOvergaard MTOxvig C & Giudice LC2001 Pregnancy-associated plasma protein-a is the insulin-like growth factor binding protein-4 protease secreted by human ovarian granulosa cells and is a marker of dominant follicle selection and the corpus luteum. Endocrinology1422155–2158.

    • Search Google Scholar
    • Export Citation
  • Cunha GR & Lung B1979 The importance of stroma in morphogenesis and functional activity of urogenital epithelium. In Vitro1550–71.

  • Cunha GRYoung P & Brody JR1989 Role of uterine epithelium in the development of myometrial smooth muscle cells. Biology of Reproduction40861–871.

    • Search Google Scholar
    • Export Citation
  • DeChiara TMEfstratiadis A & Robertson EJ1990 A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature34578–80.

    • Search Google Scholar
    • Export Citation
  • Delbe JBlat CDesauty G & Harel L1991 Presence of IDF45 (mIGFBP-3) binding sites on chick embryo fibroblasts. Biochemical and Biophysical Research Communications179495–501.

    • Search Google Scholar
    • Export Citation
  • Echternkamp SESpicer LJGregory KECanning SF & Hammond JM1990 Concentrations of insulin-like growth factor-I in blood and ovarian follicular fluid of cattle selected for twins. Biology of Reproduction438–14.

    • Search Google Scholar
    • Export Citation
  • Ferry RJ JrKatz LEGrimberg ACohen P & Weinzimer SA1999 Cellular actions of insulin-like growth factor binding proteins. Hormone and Metabolic Research31192–202.

    • Search Google Scholar
    • Export Citation
  • Firth SM & Baxter RC2002 Cellular actions of the insulin-like growth factor binding proteins. Endocrine Reviews23824–854.

  • Fowlkes JL1997 Insulin-like growth factor-binding protein proteolysis: an emerging paradigm in insulin-like growth factor physiology. Trends in Endocrinology and Metabolism8299–306.

    • Search Google Scholar
    • Export Citation
  • Gadd TSOsgerby JC & Wathes DC2000 Regulation and localization of insulin-like growth factor binding protein-5 gene expression in the uterus and placenta of the cyclic and early pregnant ewe. Biology of Reproduction621415–1421.

    • Search Google Scholar
    • Export Citation
  • Gatford KLQuinn KJWalton PEGrant PAHosking BJEgan AR & Owens PC1997 Ontogenic and nutritional changes in circulating insulin-like growth factor (IGF)-I IGF-II and IGF-binding proteins in growing ewe and ram lambs. Journal of Endocrinology15547–54.

    • Search Google Scholar
    • Export Citation
  • Giudice LCConover CABale LFaessen GHIlg KSun IImani BSuen LFIrwin JCChristiansen MOvergaard MT & Oxvig C2002 Identification and regulation of the IGFBP-4 protease and its physiological inhibitor in human trophoblasts and endometrial stroma: evidence for paracrine regulation of IGF-II bioavailability in the placental bed during human implantation. Journal of Clinical Endocrinology and Metabolism872359–2366.

    • Search Google Scholar
    • Export Citation
  • Gray CABartol FFTarleton BJWiley AAJohnson GABazer FW & Spencer TE2001a Developmental biology of uterine glands. Biology of Reproduction651311–1323.

    • Search Google Scholar
    • Export Citation
  • Gray CABazer FW & Spencer TE2001b Effects of neonatal progestin exposure on female reproductive tract structure and function in the adult ewe. Biology of Reproduction64797–804.

    • Search Google Scholar
    • Export Citation
  • Gray CABurghardt RCJohnson GABazer FW & Spencer TE2002 Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction124289–300.

    • Search Google Scholar
    • Export Citation
  • Greenwood PLHunt ASSlepetis RMFinnerty KDAlston CBeermann DH & Bell AW2002 Effects of birth weight and postnatal nutrition on neonatal sheep: III. Regulation of energy metabolism. Journal of Animal Science802850–2861.

    • Search Google Scholar
    • Export Citation
  • Gu YBranham WSSheehan DMWebb PJMoland CL & Streck RD1999 Tissue-specific expression of messenger ribonucleic acids for insulin-like growth factors and insulin-like growth factor-binding proteins during perinatal development of the rat uterus. Biology of Reproduction601172–1182.

    • Search Google Scholar
    • Export Citation
  • Hayashi KCarpenter KDGray CA & Spencer TE2003 The activin-follistatin system in the neonatal ovine uterus. Biology of Reproduction69843–850.

    • Search Google Scholar
    • Export Citation
  • Hayashi KCarpenter K & Spencer T2004 Neonatal estrogen exposure disrupts uterine development in the postnatal sheep. Endocrinology1453247–3257.

    • Search Google Scholar
    • Export Citation
  • Hwa VOh Y & Rosenfeld RG1999 The insulin-like growth factor-binding protein (IGFBP) superfamily. Endocrine Reviews20761–787.

  • Johnson GABurghardt RCSpencer TENewton GROtt TL & Bazer FW1999 Ovine osteopontin: II. Osteopontin and alpha(v)-beta(3) integrin expression in the uterus and conceptus during the periimplantation period. Biology of Reproduction61892–899.

    • Search Google Scholar
    • Export Citation
  • Jones JI & Clemmons DR1995 Insulin-like growth factors and their binding proteins: biological actions. Endocrine Reviews163–34.

  • Mazerbourg SCallebaut IZapf JMohan SOvergaard M & Monget P2004 Up date on IGFBP-4: regulation of IGFBP-4 levels and functions in vitro and in vivo.Growth Hormone and IGF Research1471–84.

    • Search Google Scholar
    • Export Citation
  • Mesiano SYoung IRBaxter RCHintz RLBrowne CA & Thorburn GD1987 Effect of hypophysectomy with and without thyroxine replacement on growth and circulating concentrations of insulin-like growth factors I and II in the fetal lamb. Endocrinology1201821–1830.

    • Search Google Scholar
    • Export Citation
  • Mesiano SYoung IRHey AWBrowne CA & Thorburn GD1989 Hypophysectomy of the fetal lamb leads to a fall in the plasma concentration of insulin-like growth factor I (IGF-I) but not IGF-II. Endocrinology1241485–1491.

    • Search Google Scholar
    • Export Citation
  • Nayak NR & Giudice LC2003 Comparative biology of the IGF system in endometrium decidua and placenta and clinical implications for foetal growth and implantation disorders. Placenta24281–296.

    • Search Google Scholar
    • Export Citation
  • Osgerby JCGadd TS & Wathes DC1999 Expression of insulin-like growth factor binding protein-1 (IGFBP-1) mRNA in the ovine uterus throughout the oestrous cycle and early pregnancy. Journal of Endocrinology162279–287.

    • Search Google Scholar
    • Export Citation
  • Overgaard MTHaaning JBoldt HBOlsen IMLaursen LSChristiansen MGleich GJSottrup-Jensen LConover CA & Oxvig C2000 Expression of recombinant human pregnancy-associated plasma protein-A and identification of the proform of eosinophil major basic protein as its physiological inhibitor. Journal of Biological Chemistry27531128–31133.

    • Search Google Scholar
    • Export Citation
  • Qin XByun DStrong DDBaylink DJ & Mohan S1999 Studies on the role of human insulin-like growth factor-II (IGF-II)-dependent IGF binding protein (hIGFBP)-4 protease in human osteoblasts using protease-resistant IGFBP-4 analogs. Journal of Bone and Mineral Research142079–2088.

    • Search Google Scholar
    • Export Citation
  • Rechler MM & Brown AL1992 Insulin-like growth factor binding proteins: gene structure and expression. Growth Regulation255–68.

  • Reynolds TSStevenson KR & Wathes DC1997 Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early placental development in the ewe. Endocrinology138886–897.

    • Search Google Scholar
    • Export Citation
  • Sato TWang GHardy MPKurita TCunha GR & Cooke PS2002 Role of systemic and local IGF-I in the effects of estrogen on growth and epithelial proliferation of mouse uterus. Endocrinology1432673–2679.

    • Search Google Scholar
    • Export Citation
  • Spencer TEStagg AGJoyce MMJenster GWood CGBazer FWWiley AA & Bartol FF1999 Discovery and characterization of endometrial epithelial messenger ribonucleic acids using the ovine uterine gland knockout model. Endocrinology1404070–4080.

    • Search Google Scholar
    • Export Citation
  • Spicer LJEchternkamp SEWong EAHamilton DT & Vernon RK1995 Serum hormones follicular fluid steroids insulin-like growth factors and their binding proteins and ovarian IGF mRNA in sheep with different ovulation rates. Journal of Animal Science731152–1163.

    • Search Google Scholar
    • Export Citation
  • Stevenson KRGilmour RS & Wathes DC1994 Localization of insulin-like growth factor-I (IGF-I) and -II messenger ribonucleic acid and type 1 IGF receptors in the ovine uterus during the estrous cycle and early pregnancy. Endocrinology1341655–1664.

    • Search Google Scholar
    • Export Citation
  • Taylor KMGray CAJoyce MMStewart MDBazer FW & Spencer TE2000 Neonatal ovine uterine development involves alterations in expression of receptors for estrogen progesterone and prolactin. Biology of Reproduction631192–1204.

    • Search Google Scholar
    • Export Citation
  • Taylor KMChen CGray CABazer FW & Spencer TE2001 Expression of messenger ribonucleic acids for fibroblast growth factors 7 and 10 hepatocyte growth factor and insulin-like growth factors and their receptors in the neonatal ovine uterus. Biology of Reproduction641236–1246.

    • Search Google Scholar
    • Export Citation
  • Valentinis BBhala ADeAngelis TBaserga R & Cohen P1995 The human insulin-like growth factor (IGF) binding protein-3 inhibits the growth of fibroblasts with a targeted disruption of the IGF-I receptor gene. Molecular Endocrinology9361–367.

    • Search Google Scholar
    • Export Citation
  • Wathes DCReynolds TSRobinson RS & Stevenson KR1998aa Role of the insulin-like growth factor system in uterine function and placental development in ruminants. Journal of Dairy Science811778–1789.

    • Search Google Scholar
    • Export Citation
  • Wathes DCReynolds TSRobinson RS & Stevenson KR1998bb Role of the insulin-like growth factor system in uterine function and placental development in ruminants. Journal of Dairy Science811778–1789.

    • Search Google Scholar
    • Export Citation
  • Yakar SLiu JLStannard BButler AAccili DSauer B & LeRoith D1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. PNAS967324–7329.

    • Search Google Scholar
    • Export Citation