Abstract
The release of arachidonic acid from membrane glycerophospholipids through the action of phospholipases (PLs) is the first step in the biosynthesis of prostaglandins (PGs). In reproductive tissues, the most important PLs are cytosolic PLA2 (cPLA2) and types IIA and V of the secretory isoform (sPLA2). The aim of this work was to investigate the role of ovarian steroid hormones and oxytocin (OT) in the regulation of rat uterine PLA2 activity and expression during pregnancy and labor. The activity of sPLA2 increased near labor, whereas cPLA2 activity augmented towards the end of gestation. The levels of sPLA2 IIA and cPLA2 mRNA showed an increase before labor (P<0.05, day 21), whereas sPLA2 V mRNA was not regulated during pregnancy. The administration of atosiban (synthetic OT antagonist) together with tamoxifen (antagonist of estrogen receptors) was able to decrease cytosolic and secretory PLA2 activities, diminish the expression of sPLA2 IIA and cPLA2, as well as decrease PGF2α production before the onset of labor (P<0.01). The ovarian steroid did not affect PLA2 during pregnancy. Collectively, these findings indicate that in the rat uterus, both 17β-estradiol and OT could be regulating the activity and the expression of the secretory and the cytosolic isoforms of PLA2, thus controlling PGF2α synthesis prior to the onset of labor.
Introduction
Phospholipase A2 (PLA2) has long been recognized as a family of enzymes that hydrolyze the sn-2 acyl ester bond of cell membrane phospholipids, thus releasing free fatty acids, and lysophospholipids. Their most significant function is to initiate the arachidonic acid (AA) cascade by liberating these acids from membrane phospholipids leading to production of prostaglandins (PGs). These lipid mediators have been implicated in the development of pregnancy and the onset of parturition (Olson et al. 1992, Lopez Bernal et al. 1993). As pregnancy advances, PG increase in the rat uterus leads to enhanced contractility (Ribeiro et al. 2003, Farina et al. 2004). Then, the regulation of PG synthesis in the uterus could be a key factor to control the length of pregnancy.
Multiple isoforms of PLA2 have been identified in a range of tissues. These isoforms include the secretory and the non-secretory cytosolic isozymes (Rice 1995a). The secretory types of the PLA2 (sPLA2) are low-molecular-weight enzymes that require millimolar concentrations of Ca2+ to be active. Up to now, five mammalian sPLA2 isoforms (types I, IIA, IIC, V, and X) have been identified. Group IIA sPLA2 is induced in many cell types (Nakano et al. 1990, Arbibe et al. 1997). Abundant messages for type V sPLA2 were detected in macrophages (Balboa et al. 1996) and in a few cells sPLA2 V appears to substitute sPLA2 IIA (Murakami et al. 1998). The high-molecular-weight cytosolic PLA2 (cPLA2) needs micromolar concentrations of Ca2+ to translocate to the cell membrane and contains no disulphide bonds. Current evidence suggests that two sPLA2 isozymes, types IIA and V, and cPLA2 type IV are functionally coupled with cyclooxygenase (COX). COX converts AA to the intermediate PG precursor PGH2. Liberation of AA by means of the PL and conversion of this lipid into PGs represent the two crucial rate-limiting steps in the PG biosynthetic pathway (Murakami et al. 1998, 1999).
Recently, Brant et al.(2006) observed that sPLA2 and cPLA2 proteins are expressed in the rat uterus at mid (day 10) and late (day 20) pregnancy. Further evidence suggests that this enzyme could play a role in membrane remodeling but not in AA release (Murakami et al. 1998). Although sPLA2 types IIA and Vand cPLA2 were identified in human gestational tissues (Lappas & Rice 2004), it is still unknown which of these enzymes are responsible for the increase in PG synthesis observed at the onset of labor.
During pregnancy, uterine PGF2α production is suppressed to maintain uterus quiescence and in some species to prevent luteal regression (Horton & Poyser 1976). Uterine PGF2α production increases abruptly in rat uterus at day 22 of pregnancy, immediately before the onset of labor (Farina et al. 2004). We have previously reported that during pregnancy, COX-1 and COX-2 expression is augmented at the end of gestation. The exogenous administration of progesterone (P) at the end of pregnancy significantly inhibits uterine PGF2α production as well as COX-2 protein expression. Furthermore, it increases the activity of PG dehydrogenase, the enzyme responsible for initial inactivation of several PGs.
Increased PLA2 activity during late gestation could be due to unidentified factors that augment at this time (Rice 1995b). One possible candidate is estrogen, an ovarian hormone whose concentration is elevated in late gestation (day 21). Besides, it has been shown that estrogen exposure enhances PLA2 production (Dey et al. 1982, Bonney 1985).
Oxytocin (OT) is another potential factor that could be contributing to modulating PLA level. OT is the most potent uterotonic agent known so far and is currently used to induce labor (Chard 1989). Lefebvre et al.(1992) showed that during gestation OT mRNA increases at term in the rat uterus and may act primarily as a local mediator rather than as a circulating hormone. OT binds to a cell-surface membrane receptor that activates a complex intracellular signaling pathway that ultimately leads to the activation of PLA2 (Lee & Silvia 1994). The OT receptor (OTR) has been cloned, and the levels of OTR mRNA increase abruptly in the rat myometrium during labor (Rozen et al. 1995). Nevertheless, the precise mechanism underlying the progressive increase in PLA2 activity and expression in the pregnant uterus before the onset of labor is still unknown. In this context, we hypothesized that steroid hormones and OT would affect the activity of uterine PLA2 involved in the liberation of AA at the time of labor. To examine this possibility, we will consider the effect of 1) RU-486, a selective antagonist of P receptors (PRs); 2) tamoxifen, an inhibitor of estrogen receptors; and 3) atosiban, a synthetic antagonist that blocks OT receptors, on the activity and the mRNA expression of sPLA IIA and Vand cPLA in the uterus.
Materials and Methods
Drugs and chemicals
Progesterone, PGF2α and PGF2α antiserum were purchased from Sigma Chemical. Estradiol antiserum and mifepristone (RU-486) were kindlyprovidedbyG D Niswender(Colorado State University, Fort Collins, CO, USA). Tamoxifen was kindly provided by Gador Laboratory (Buenos Aires, Argentina). Atosiban was purchased from Ferring Pharmaceuticals (Ferring AB). (5,6,8,9,11,12,14,15(n)-3H)-PGF2α (160 Ci/mmol, 200 μCi/ml) was obtained from Amersham Corporation. RNA extraction, RT and PCR reagents were obtained from Invitrogen Life Technology. All other chemicals were of analytical grade.
Animals
Time-mated pregnant rats of the Wistar strain (200–230 g body weight) were used. Rats were maintained on a 14 h light:10 h darkness schedule and received a supply of animal chow and water ad libitum. The experimental procedures reported here were approved by the Animal Care Committee of the Center Pharmacological and Botanical Studies of the National Research Council (CEFYBO – CONICET) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals (US National Research Council 1996). Rats were treated as previously described (Farina et al. 2004). Briefly, pregnant animals (n = 6 for each state) were killed on different days of gestation (5, 13, 17, 21, and 22) as well as one day post partum. Spontaneous term labor occurs on the night of the 22nd day (day 1: day sperm plug was observed).
Time-mated rats were divided into five groups:
-
Rats on day 12 of gestation (when the levels of serum progesterone are high) were injected i.p. with 300 μl RU-486 (antagonist of progesterone, 2.5 mg/rat) or vehicle (ethanol 30% v/v) and were killed 24 h after the injection (day 13 of pregnancy).
-
Rats on days 20 and 21 (when the serum progesterone levels are low) were injected s.c. with 200 μl progesterone (2 mg/rat) or vehicle (sesame oil) every 12 h and were killed on day 22, before the onset of labor.
-
Rats on day 16 of pregnancy were primed with 100 μl of 17β-estradiol (E2, 1 μg/rat i.p.) or vehicle (ethanol 30% v/v). On day 17 of gestation, animals received 50 μl E2 (5 μg/rat i.p.) or vehicle and were killed 6 h later.
-
Rats from day 15 to 20 or 21 of gestation were treated with 200 μl tamoxifen (200 μg/rat per day) or vehicle (sesame oil) every 24 h and were killed on day 21 or 22 respectively.
-
Rats on day 21 of pregnancy were treated with atosiban (a synthetic OT antagonist, 75 μg/rat, 100 μl) or vehicle (NaCl 0.9%), and were injected every 3 h (four doses in all) and killed 12 h after the first dose at 10 pm (day 21.5 of pregnancy).
All animals were anesthetized with ether and the blood was drawn from the heart. The serum was stored (−20 °C) for steroid analysis. The uterus, containing both myometrium and endometrium, was cleaned of fat, placenta, fetuses, and blood vessels. Then, tissues were stored (−70 °C) for PLA2 activity assays or extracted for PCR analysis.
Estradiol RIA
E2 was measured in serum samples. Briefly, blood was allowed to clot and centrifuged at 3000 g for 10 min. Serum was extracted twice with 2 ml diethyl ether and estradiol concentrations were determined by RIA. Estradiol antiserum showed low cross-reactivity: 1% for progesterone and testosterone, <5% for17α estradiol and estriol, and 10% for estrone. Antiserum was provided by Dr G D Niswender (Colorado State University, Fort Collins, CO, USA). The sensitivity was 5–10 pg per tube and 2–5 μl serum were assayed routinely. Results were expressed as serum estradiol (ng/ml).
Measurement of sPLA2 and cPLA2 activity
Secretory and cytosolic PLA2 activities measurements were performed with a commercially available assay system (Cayman Chemical Company, Ellsworth Rd, Ann Arbor, MI, USA) exactly as recommended by the manufacturer. 1,2-dithio analog of diheptanoyl phosphatidylcholine was the substrate used for sPLA2 activity, as it serves as a substrate for most PLA2 except cPLA2 type V. Substrate hydrolysis was quantified by measuring the absorbance at 405 nm at different time points and sPLA2 activity was calculated.
Cytosolic PLA2 activity was measured in tissue homogenates using arachidonoyl thio-PC as substrate. To avoid any measurement corresponding to iPLA2 activity, bromoenol lactone (an iPLA2 specific inhibitor) was added to the samples prior to assaying according to the manufacturer. The data were expressed asnmol/min per ml.
cDNA synthesis and RT-PCR
Total RNA was isolated from rat uteri on different days of pregnancy using Trizol reagent (Invitrogen Life Technologies). RNA was quantified by measuring the absorbance at 260 nm. According to the manufacturer’s instructions, first-strand cDNA was synthesized from 2 μg total RNA, using Moloney murine leukemia virus reverse transcriptase and random primers (Invitrogen) in the presence of recombinant RNase inhibitor. After first-strand synthesis, PCR was performed with specific intron-spanning primers (Invitrogen Custom Primers; Table 1) based on the sequences of PLA2 and β-actin reported previously (Ohara et al. 1986, Dieter et al. 2002). Except for the amplification of sPLA2 type V that requires Platinum Taq DNA polymerase (Invitrogen), all other amplifications were performed using Taq DNA polymerase (Invitrogen). The amplification parameters were as follows: 94 °C for 5 min (initial denaturation), and 30 cycles of 94 °C for 40 s, 52 °C 2 min, 72 °C 1 min, 72 °C 5 min for β-actin; 94 °C for 1 min (initial denaturation), and 34 cycles of 94 °C for 30 s, 57 °C 40 s, 72 °C 2 min for sPLA2 type IIA; 94 °C for 2 min (initial denaturation), and 34 cycles of 94 °C for 1 min, 62 °C 45 s (touchdown −0.1 °C/cycle), 72 °C 1 min for sPLA2 type V; and 96 °C for 5 min (initial denaturation), and 29 cycles of 95 °C for 30 s, 60 °C 1 min (touchdown −0.1 °C/cycle), 72 °C 1 min, 72 °C 5 min for cPLA2 type IV.
Aliquots of 10μl of the PCR were loaded onto a 2% agarose gel. After ethidium bromide staining, bands were visualized on a transiluminator and image analysis was performed by densitometric scanning of the gels using an Image J (National Institutes of Health) Program. Data were expressed as the relative amount of PLA2 isoforms versus β-actin mRNA (control).
PGF2α determination
PGF2α was quantified as previously described (Farina et al. 2004) using rabbit antiserum (Sigma Chemical Co). Briefly, uteri were removed and then rinsed thoroughly in cold Krebs–Ringer bicarbonate (KRB) buffer before PGF2α determination by RIA. Tissues were incubated in a KRB buffer for 60 min at 37 °C. Total protein content was determined by the Bradford (1976) method. Supernatants were acidified to pH 3 with 1 M HCl and PGs were extracted twice with 2 ml ethyl acetate. Sensitivity of the assay was 5–10 pg/ml and cross-reactivity was less than 0.1% with other PGs. Intra- and inter-assay variations were each <8.0%. Results were expressed as ng PGF2α/h per mg protein.
Statistical analysis
Statistical analysis was performed using the Instat Program (Graph Pad Software, San Diego, CA, USA). Comparisons between values of groups were performed using one-way ANOVA. Significance was determined using Tukey’s multiple comparison tests for unequal replicates.
All values presented in this study are mean ± s.e.m. Differences between means were considered significant at P<0.05.
Results
Uterine PLA2 activity
We measured sPLA2 and cPLA2 activities in the rat uterus during pregnancy (day 5, 13, 17, 21, and 22) and one day after parturition. These studies showed that uterine sPLA2 activity remained low at early and mid gestation. On day 21 (end of gestation), sPLA2 activity increased sharply and declined towards day 22 of pregnancy, just before the onset of labor (Fig. 1A). We wanted to determine if there was a temporal relationship between uterine PLA2 activity and steroid hormone serum levels. We have previously reported that progesterone peaked on day 13 of gestation and diminished at the end of pregnancy (Farina et al. 2004). Thus, in the present study, we measured E2 serum levels at different days of pregnancy (5, 13, 21, and 22) and post partum. Figure 1A shows that serum estradiol concentration remained low through early and mid gestation, increased at day 21 of gestation, and began to decline at day 22 until 24 h after parturition. On the other hand, cPLA2 activity rose at mid gestation and remained high until one day after parturition (Fig. 1B).
Expression of uterine PLA2 isoforms during pregnancy
RT-PCR analysis was conducted to determine the expression patterns of rat uterine PLA2 enzymes at early, mid, and late gestation. Figure 2 shows that sPLA2 types IIA and V, as well as cPLA2 enzyme, were clearly detected on all the analyzed days. sPLA2 type IIA changed its expression along gestation and was significantly increased on days 21 (P<0.001) and 22 (P<0.05) of pregnancy, before the onset of labor (Fig. 2B). Similar results were found when cPLA2 mRNA was determined which was significantly increased on day 21 (P<0.05). On the other hand, sPLA2 type V mRNA was detected as a worthless band of 172 bases (Table 1). No changes in sPLA2 type V mRNA expression were observed in all the analyzed days during pregnancy or post partum.
Effects of steroid hormones on uterine PLA2 activity and expression
The temporal association between the increase in sPLA2 type IIA expression and activity with the augmentation in estradiol and the decrease in progesterone levels suggested that the ovarian steroids (estrogen and progesterone) could be modulating PLA2 activity and/or expression in the rat uterus during pregnancy. To further ascertain the role of steroid hormones on the modulation of PLA2 during pregnancy, rats were treated as follows: 1) administration of mifepristone (RU-486, an antiprogestogen) or E2 at mid gestation and 2) administration of progesterone or tamoxifen (an antiestrogen) at late gestation. Neither of these treatments was able to modify uterine mRNA expression of types IIA and V sPLA2 and cPLA2 (Fig. 3). Additionally, these treatments did not modulate sPLA2 (Fig. 4A and C) and cPLA2 (Fig. 4B and D) activities in the rat uterus.
Effect of atosiban and tamoxifen on PLA2 expression and activity in rat uterus
Although the precise factors that participate in the onset of labor have not been fully described, it is well recognized that OT and ovarian steroids play a major role. The presence of sPLA2 types IIA and V and cPLA2 mRNA was detected in the uterus on the night of day 21 of gestation (day 21.5). The administration of separate tamoxifen or atosiban did not provoke any significant difference in the mRNA expression of the analyzed isoforms (Fig. 5). However, the administration of tamoxifen together with atosiban significantly inhibited mRNA expression of sPLA2 IIA (Fig. 5) and the sPLA2 activity (Fig. 6A P,<0.01).
Moreover, cPLA2 activity was significantly decreased following the treatment with atosiban (P<0.01) or tamoxifen together with atosiban (Fig. 6B P,<0.001). The mRNA expression of cPLA2 was inhibited (P<0.05) only when we administrated atosiban together with tamoxifen (Fig. 5B).
Effect of atosiban and tamoxifen on PGF2α synthesis in rat uterus
PGs are the main mediators of uterine contractility prior to the onset of labor. Besides the regulation of PLA2 activity, we wanted to study if estradiol or OT were regulating the synthesis of PGs before the onset of labor. Thus, rats were treated with the specific inhibitors tamoxifen, atosiban, or both, and PGF2α synthesis was determined in the uterine strips. Figure 7 shows that PGF2α synthesis was markedly diminished (P<0.01) only in the uterine tissue from rats treated with tamoxifen together with atosiban on day 21 of pregnancy. There was no significant difference between the controls and the groups treated with tamoxifen or atosiban.
Discussion
The role of the PGs (catabolic products of glycerophospholipids) as second messengers has been studied extensively over recent decades. The formation of these second messengers is mediated through the action of specific PL, including PLA1, A2, C, and D. PLA2 isozymes have been identified in human gestational tissues (Freed et al. 1997), and there is differential expression of these enzymes in tissues obtained at preterm and term labor (Lappas & Rice 2004). This work is the first to identify the presence of two secretory PLA2 isoenzymes (type IIA and V) and cPLA2 mRNA in the rat uterus at early (day 5), mid (day 13), and late (days 21 and 22) gestation, as well as one day after parturition. Consistent with the possible involvement of these isoenzymes in the onset and/or progression of labor and delivery, we demonstrated that sPLA2 IIA and cPLA2 gene expression are developmentally regulated, with mRNA levels increasing significantly on day 21, just before the onset of labor. This result suggests that these enzymes might be some of the factors associated with increased PG synthesis near the onset of labor. In contrast, we were unable to detect any changes in the expression of sPLA2 V mRNA with the progress of gestation or in association with labor. Although some authors did not find any association between delivery and changes in group IIA sPLA2 expression (Bennet et al. 1994, Aitken et al. 1996, Freed et al. 1997), others have identified an increase in sPLA2 protein expression in rat uterus (Murakami et al. 1999) and human myometrium (Slater et al. 2004) in late gestation.
Several years ago, Dey et al.(1982) showed that in hypophysectomized rats uterine PLA2 activity is under the influence of steroids hormones and Cox et al.(1982) showed that PLA2 activity was markedly increased in the rat uterus by E2 treatment during early pregnancy. Such assays estimate the effect of steroid hormones on net enzymatic activity and do not discriminate between individual PLA2 isoenzymes. A decade passed by and Farrugia et al.(1993) showed that type IIPLA2 is responsible for up to 80% of the total PLA2 enzymatic activity present in placental tissues and that it represents the major component of PLA2 activity in human fetal membranes at term (Aitken et al. 1993). Recently, Brant et al.(2006) showed a significant increase in rat uterine calcium-independent PLA2 activity with the progression of labor. In the present work, we demonstrated a gestation-related increase of both the secretory and the cytosolic PLA2 activities in the rat uterus. Secretory PLA2 increased at late pregnancy similar to E2 levels. These data suggest that endogenous estradiol could be modulating the expression and/or activity of sPLA2 during pregnancy. A substantial augmentation of cPLA2 activity was observed at mid gestation and this activity remained increased until labor. A possible explanation for the increment in cPLA2 activity at mid gestation is an effect of a variety of cytokines and mitogens previously shown to induce activation and increase the synthesis of this enzyme in different cell types (Clark et al. 1995). Transforming growth factor-β1 is highly expressed in rat decidual cells at mid pregnancy (Shooner et al. 2005), and it has been shown that it increases the levels of cPLA2 protein and activity (Brown et al. 2000). It is well recognized that cPLA2 is a central regulator of stimulus-coupled cellular AA release, whereas the role of sPLA2 in the metabolism of AA has remained ambiguous. Nevertheless, different studies have suggested that sPLA2 IIA, or related sPLA2 isozymes, could participate in immediate and delayed phases of cellular AA release and PG generation (Pfeilschifter et al. 1993, Akiba et al. 2001). However, little is known regarding how the expression and the activity of uterine PLA2 enzymes change during pregnancy. The observed increases in PLA2 expression and activity prior to delivery might be the previous step for the increase of PG synthesis at the time of labor. This issue is relevant, particularly in the rat model as uterine-derived PGs are responsible for ovarian luteolysis, which initiates the sequence of biochemical events that lead to labor.
The uterus is one of the target organs of the steroid hormones, progesterone and estradiol. To ascertain whether endogenous estradiol and progesterone were involved in the increased expression and/or activity of uterine PLA2s, the effects of tamoxifen, an antiestrogenic agent, and RU-486, an antiprogestogen, were examined. Our observations suggest that steroid hormones do not regulate the expression and the activity of uterine PLA2s during pregnancy and labor.
Other groups obtained similar results. It has been reported that E2 has no effect on PLA2 expression in sheep (Di et al. 1999), rat (Ospina et al. 2002), and baboons (Rosenthal et al. 2001). In contrast, others found that estradiol or different combinations of steroid treatments promote an increase in PLA2 protein levels (Rupnow et al. 2002) and activity (Fayard et al. 1994, Periwal et al. 1996). These discrepancies could be due to differences in the strains of the rats used, differences in the dose and timetable of hormones administration, as well as differences in the tissue processing.
Several lines of evidence suggest a role for the OT/OTR system in the regulation of parturition. The concentration of OT in plasma and the expression of uterine OTR increase before parturition. Infusions of OT stimulate myometrial contractions to a magnitude indistinguishable from normal labor and the administration of antagonists of OTR can disrupt the pattern of normal labor (Mitchell & Schmid 2001). Finally, OT stimulates PGF2α synthesis possibly by increasing cPLA2 activity (Burns et al. 2000). Estrogen appears to be the major regulator of OT synthesis. In the rat, the administration of an estrogen receptor antagonist during late pregnancy reduced uterine OT mRNA and protein causing a significant delay in parturition (Fang et al. 1996). In addition, estrogen stimulates the synthesis of OTR (Soloff 1975). Thus, it is plausible that the expression and activity of uterine PLA2s was induced by both estradiol and OT. In this work, we have shown that plasma estradiol concentrations significantly increased on day 21 of gestation, but the administration of tamoxifen, an antiestrogen, did not modify the time-dependent-induced cPLA2 activity during gestation. On the other hand, a synthetic OT antagonist, atosiban, was able to diminish cPLA2 activity. We have also demonstrated that the co-administration of atosiban with tamoxifen during day 21 of pregnancy significantly inhibited sPLA2 and cPLA2 activities before the onset of labor and also diminished the mRNA expression of sPLA2 IIA and cPLA2.
Changes in uterine PGs production appear to be involved in the regulation of myometrial activity during pregnancy and labor. We have recently demonstrated that uterine PGF2α synthesis increased abruptly on day 22, just before the onset of labor (Farina et al. 2004).
Although the contribution of PLA2 isoenzymes in the progress of parturition has been previously demonstrated by other investigators, there are still no reports about which factors could be modulating the activity and/or the expression of these isoenzymes during gestation and at the time of labor. The primary stimulus to the onset of labor is believed to be an increase in E:P ratio in maternal circulation (Challis & Lye 1994). Our data suggest that this endocrine axis, while necessary, is not sufficient to bring about the increased activity of phospholipases A2. In the present study, we demonstrated for the first time that not only the E:P ratio modulates labor, but also the presence of OT together with E2 are crucial for the regulation of uterine PLA2 activity and expression prior to labor. In addition, we showed that this regulation over PLA2 isoenzymes was reflected in the synthesis of PFG2α, the ultimate and more potent mediator of myometrial contractions during delivery.
OT acting through its receptor is involved in the myometrial hyperactivity of preterm labor, and atosiban has now been registered in many countries for the treatment of preterm labor. The effect of this drug on uterine PLA2 activity and subsequently on PGF2 synthesis could be part of its mechanism of action (Akerlund 2006).
In conclusion, our results suggest that a specific modulation of both the secretory and non-secretory PLA2s by estradiol and OT might be implicated in the increase of PGs synthesis before the onset of labor. These observations reveal that both hormones are essential for the upregulation of uterine phospholipase expression and activity. More studies are necessary to elucidate if a combination of tamoxifen and atosiban could be used to prevent preterm delivery.
Oligonucleotide primers used for amplification of phospholipase A2 isoforms from rat uterus.
| Primers sequences 5′ 3′ | Product (pb) | |
|---|---|---|
| β-actin (21) | Sense: GTGGGGCGCCCCAGGCACCA Antisense: CTCCTTAATGTCACGCACGATTTC | 610 |
| sPLA2 type IIA (21) | Sense: GGGAATTCAGCCTTCTGGAGTTTGGGCAAA Antisense: CTGCTAAGCTTCAGCAACTGGGCGTCTT | 360 |
| sPLA2 type V (21) | Sense: CCCTAAGGATGGCACTGATTGG Antisense: CCGGTCACAAGCACAAAGCC | 172 |
| cPLA2 (22) | Sense: AAGGCCAAGTGACACCAGCC Antisense: GAAACAGAGCAACGAGATGGG | 452 |
(A) Uterine sPLA2 activity (bars) and serum estradiol concentration (solid triangles) during pregnancy (day 5, 13, 21, and 22) and 24 h post partum. Rat uterus was homogenized and sPLA2 activity was determined (see Materials and Methods). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. ‘a’ P<0.001 versus day 5, 13, and post labor (PL); ‘b’ P<0.01 versus day 5, 13, and post labor (PL). Blood was collected from gravis rat at specific gestational days during pregnancy (n = 4 rats per point). The lane represents the mean ± s.e.m. plasma estradiol concentration. (B) Uterine cPLA2 activity during pregnancy and 24 h post labor (PL). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. Significant differences, compared with day 5 of pregnancy, are represented (a: P<0.001, ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
(A) Uterine sPLA2 activity (bars) and serum estradiol concentration (solid triangles) during pregnancy (day 5, 13, 21, and 22) and 24 h post partum. Rat uterus was homogenized and sPLA2 activity was determined (see Materials and Methods). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. ‘a’ P<0.001 versus day 5, 13, and post labor (PL); ‘b’ P<0.01 versus day 5, 13, and post labor (PL). Blood was collected from gravis rat at specific gestational days during pregnancy (n = 4 rats per point). The lane represents the mean ± s.e.m. plasma estradiol concentration. (B) Uterine cPLA2 activity during pregnancy and 24 h post labor (PL). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. Significant differences, compared with day 5 of pregnancy, are represented (a: P<0.001, ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
(A) Uterine sPLA2 activity (bars) and serum estradiol concentration (solid triangles) during pregnancy (day 5, 13, 21, and 22) and 24 h post partum. Rat uterus was homogenized and sPLA2 activity was determined (see Materials and Methods). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. ‘a’ P<0.001 versus day 5, 13, and post labor (PL); ‘b’ P<0.01 versus day 5, 13, and post labor (PL). Blood was collected from gravis rat at specific gestational days during pregnancy (n = 4 rats per point). The lane represents the mean ± s.e.m. plasma estradiol concentration. (B) Uterine cPLA2 activity during pregnancy and 24 h post labor (PL). Each bar represents the mean ± s.e.m. from three different experiments with n = 3. Significant differences, compared with day 5 of pregnancy, are represented (a: P<0.001, ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Changes in relative sPLA2 types IIA and V and cPLA2 mRNA levels in the uterus during pregnancy and labor. Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative RT-PCR gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNA. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. Uterine sPLA2 type IIA: ‘a’ P<0.001 versus day 5, 13, and PL; ‘c’ P<0.05 versus day 22. Uterine cPLA2: ‘c’ P<0.05 versus all day analyzed.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Changes in relative sPLA2 types IIA and V and cPLA2 mRNA levels in the uterus during pregnancy and labor. Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative RT-PCR gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNA. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. Uterine sPLA2 type IIA: ‘a’ P<0.001 versus day 5, 13, and PL; ‘c’ P<0.05 versus day 22. Uterine cPLA2: ‘c’ P<0.05 versus all day analyzed.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Changes in relative sPLA2 types IIA and V and cPLA2 mRNA levels in the uterus during pregnancy and labor. Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative RT-PCR gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNA. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. Uterine sPLA2 type IIA: ‘a’ P<0.001 versus day 5, 13, and PL; ‘c’ P<0.05 versus day 22. Uterine cPLA2: ‘c’ P<0.05 versus all day analyzed.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of sPLA2 types IIA and V and cPLA2 mRNA from uterine ofrats treated with RU-486 (2.5 mg/rat), progesterone (P, 2 mg/rat), 17β-estradiol (E2, 5 μg/rat), or tamoxifen (TAM, 200 μg/rat). Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNAs. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. There is no significant difference in the expression of PLA2 mRNAs between each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of sPLA2 types IIA and V and cPLA2 mRNA from uterine ofrats treated with RU-486 (2.5 mg/rat), progesterone (P, 2 mg/rat), 17β-estradiol (E2, 5 μg/rat), or tamoxifen (TAM, 200 μg/rat). Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNAs. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. There is no significant difference in the expression of PLA2 mRNAs between each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of sPLA2 types IIA and V and cPLA2 mRNA from uterine ofrats treated with RU-486 (2.5 mg/rat), progesterone (P, 2 mg/rat), 17β-estradiol (E2, 5 μg/rat), or tamoxifen (TAM, 200 μg/rat). Total RNA was extracted and subjected to RT-PCR for sPLA2 II and V, cPLA2, and β-actin. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Densitometric analysis of uterine mRNAs. Each lane represents the mean ± s.e.m. of sPLA2 type IIA (open diamond), sPLA2 type V (open square), and cPLA2 (solid triangle) mRNAs normalized to β-actin from three separate experiments. There is no significant difference in the expression of PLA2 mRNAs between each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine sPLA2 and cPLA2 activities in rats treated with 1) mifepristone (RU-486) or 17β-estradiol (E2) at mid gestation (A and C) and 2) progesterone (P) or tamoxifen (TAM) at late gestation (B and D). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. There is no significant difference in the activities of secretory and cytosolic PLA2s according to each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine sPLA2 and cPLA2 activities in rats treated with 1) mifepristone (RU-486) or 17β-estradiol (E2) at mid gestation (A and C) and 2) progesterone (P) or tamoxifen (TAM) at late gestation (B and D). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. There is no significant difference in the activities of secretory and cytosolic PLA2s according to each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine sPLA2 and cPLA2 activities in rats treated with 1) mifepristone (RU-486) or 17β-estradiol (E2) at mid gestation (A and C) and 2) progesterone (P) or tamoxifen (TAM) at late gestation (B and D). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. There is no significant difference in the activities of secretory and cytosolic PLA2s according to each treatment (ANOVA).
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of RT-PCR products using specific primers for sPLA2 types IIA and V, cPLA2, and β-actin mRNAs. In all cases, experiments were repeated twice using cDNA from four different animals. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Each bar represents the mean ± s.e.m. of sPLA2 type IIA and cPLA2 mRNAs normalized to β-actin. ‘c’ P<0.05 versus day 21.5 (night of day 21). There is no significant difference in the expression of PLA2 type V mRNAs between each treatment.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of RT-PCR products using specific primers for sPLA2 types IIA and V, cPLA2, and β-actin mRNAs. In all cases, experiments were repeated twice using cDNA from four different animals. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Each bar represents the mean ± s.e.m. of sPLA2 type IIA and cPLA2 mRNAs normalized to β-actin. ‘c’ P<0.05 versus day 21.5 (night of day 21). There is no significant difference in the expression of PLA2 type V mRNAs between each treatment.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Expression of RT-PCR products using specific primers for sPLA2 types IIA and V, cPLA2, and β-actin mRNAs. In all cases, experiments were repeated twice using cDNA from four different animals. (A) Representative agarose gels were stained with ethidium bromide and exposed to u.v. (B) Each bar represents the mean ± s.e.m. of sPLA2 type IIA and cPLA2 mRNAs normalized to β-actin. ‘c’ P<0.05 versus day 21.5 (night of day 21). There is no significant difference in the expression of PLA2 type V mRNAs between each treatment.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine secretory (A) and cytosolic (B) PLA2 activities in rats treated with atosiban (AT), tamoxifen (TAM), or both on day 21 at night (21.5; see Materials and Methods). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. (A) ‘b’ P<0.01 versus day 21.5; (B) ‘a’ P<0.001 and ‘b’ P<0.01 versus day 21.5.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine secretory (A) and cytosolic (B) PLA2 activities in rats treated with atosiban (AT), tamoxifen (TAM), or both on day 21 at night (21.5; see Materials and Methods). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. (A) ‘b’ P<0.01 versus day 21.5; (B) ‘a’ P<0.001 and ‘b’ P<0.01 versus day 21.5.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Uterine secretory (A) and cytosolic (B) PLA2 activities in rats treated with atosiban (AT), tamoxifen (TAM), or both on day 21 at night (21.5; see Materials and Methods). Each bar represents the mean ± s.e.m. from two different experiments with n = 4. (A) ‘b’ P<0.01 versus day 21.5; (B) ‘a’ P<0.001 and ‘b’ P<0.01 versus day 21.5.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Effect of atosiban (AT), tamoxifen (TAM), or both on PGF2α synthesis in the rat uterus at late pregnancy. Each bar represents the mean ± s.e.m. of two experiments with n = 4. ‘b’ P<0.01 versus day 21.5 alone.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Effect of atosiban (AT), tamoxifen (TAM), or both on PGF2α synthesis in the rat uterus at late pregnancy. Each bar represents the mean ± s.e.m. of two experiments with n = 4. ‘b’ P<0.01 versus day 21.5 alone.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
Effect of atosiban (AT), tamoxifen (TAM), or both on PGF2α synthesis in the rat uterus at late pregnancy. Each bar represents the mean ± s.e.m. of two experiments with n = 4. ‘b’ P<0.01 versus day 21.5 alone.
Citation: Reproduction 134, 2; 10.1530/REP-07-0078
This work was supported by grants of FONCIT PICT-2002 (10901), PLACIRH PRE 055/2002, and Fundación Roemmers 2002. The authors would like to thank Mrs Ramona Morales and Ana Inés Casella for their technical support. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Aitken MA, Farrugia W, Wong MH, Scott KF, Brennecke SP & Rice GE1993 Type II phospholipase A2 in human gestational tissues-extractable immuno- and enzymatic activity in fetal membranes. Biochimica et Biophysica Acta 1170 314–320.
Aitken MA, Thomas T, Brennecke SP, Scott KF & Rice GE1996 Localization of type II phospholipase A2 messenger RNA and immunoactivity in human placenta and fetal membranes. Placenta 17 423–429.
Akerlund M2006 Targeting the oxytocin receptor to relax the myometrium. Expert Opinion on Therapeutic Targets 10 423–427.
Akiba S, Hatazawa R, Ono K, Kitatani K, Hayama M & Sato T2001 Secretory phospholipase A2 mediates cooperative prostaglandin generation by growth factor and cytokine independently of preceding cytosolic phospholipase A2 expression in rat gastric epithelial cells. Journal of Biological Chemistry 276 21854–21862.
Arbibe L, Vial D, Rosinski-Chupin I, Havet N, Huerre M, Vargaftig BB & Touqui L1997 Endotoxin induces expression of type II phospholipase A2 in macrophages during acute lung injury in guinea pigs: involvement of TNF-a in lipopolysaccharide- induced type II phospholipase A2 synthesis. Journal of Immunology 159 391–400.
Balboa MA, Balsinde J, Winstead MV, Tischfield JA & Dennis EA1996 Novel group V phospholipase A2 involved in arachidonic acid mobilization in murine P388D1 macrophages. Journal of Biological Chemistry 271 32381–32384.
Bennett PR, Slater DM & Moore G1994 Changes in the expression of phospholipase A2 and lipocortins (annexins) I, II, and V in placenta and fetal membranes at term. Prostaglandins 48 81–89.
Bonney RC1985 Measurement of phospholipase A2 activity in human endometrium during the menstrual cycle. Journal of Endocrinology 107 183–189.
Bradford MM1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254.
Brant K, Guan W, Tithof P & Caruso RL2006 Gestation age-related increase in 50-kDa rat uterine calcium-independent phospholipase A2 expression influences uterine sensitivity to polychlorinated biphenyl stimulation. Biology of Reproduction 74 874–880.
Brown NL, Alvi SA, Elder MG, Bennett PR & Sullivan MH2000 The regulation of prostaglandin output from term intact fetal membranes by anti-inflammatory cytokines. Immunology 99 124–133.
Burns PD, Graf GA, Hayes SH & Silvia WJ2000 Effect of oxytocin on expression of cytosolic phospholipase A2 mRNA and protein in ovine endometrial tissue in vivo.Domestic Animal Endocrinology 19 237–246.
Challis JRG & Lye SJ1994 In The Physiology of Reproduction, pp 985–1031. Eds E Knobil & JD Neill. New York: Raven Press.
Chard T1989 Fetal and maternal oxytocin in human parturition. American Journal of Perinatology 6 145–152.
Clark JD, Schievella AR, Nalefski EA & Lin LL1995 Cytosolic phospholipase A2. Journal of Lipid Mediators and Cell Signalling 12 83–117.
Cox C, Cheng HC & Dey SK1982 Phospholipase A2 activity in the rat uterus during early pregnancy. Prostaglandins, Leukotrienes, and Medicine 8 375–381.
Dey SK, Hoversland RC & Johnson DC1982 Phospholipase A2 activity in the rat uterus: modulation by steroid hormones. Prostaglandins 23 619–630.
Di T, Sullivan JA, Rupnow H.L., Magness RR & Bird IM1999 Pregnancy induces expression of cPLA2 but not systemic artery endothelium. Journal of the Society for Gynecologic Investigation 6 301–306.
Dieter P, Kolada A, Kamionka S, Schadow A & Kaszkin M2002 Lipopolysaccharide-induced release of arachidonic acid and prostaglandins in liver macrophages: regulation by Group IV cytosolic phospholipase A2, but not by Group V and Group IIA secretory phospholipase A2. Cellular Signalling 14 199–204.
Fang X, Wong S & Mitchell BF1996 Relationships among sex steroids, oxytocin, and their receptors in the rat uterus during late gestation and at parturition. Endocrinology 137 3213–3219.
Farina M, Ribeiro ML, Weissmann C, Estevez A, Billi S, Vercelli C & Franchi A2004 Biosynthesis and catabolism of prostaglandin F2α (PGF2α) are controlled by progesterone in the rat uterus during pregnancy. Journal of Steroid Biochemistry and Molecular Biology 91 211–218.
Farrugia W, Aitken MA, Van Dunne F, Wong MH, Brennecke SP, Scott KF & Rice GE1993 Type II phospholipase A2 in human gestational tissues-subcellular distribution of placental immunoactivity and catalytic activity. Biochimica et Biophysica Acta 1166 77–83.
Fayard JM, Chanal S, Felouati B, Macovschi O, Lagarde M, Pageaux JF & Laugier C1994 Regulation of quail oviduct phospholipase A2 activity by estradiol. European Journal of Endocrinology 131 205–212.
Freed KA, Moses EK, Brennecke SP & Rice GE1997 Differential expression of type II, IV and cytosolic PLA2 messenger RNA in human intrauterine tissues at term. Molecular Human Reproduction 3 493–499.
Horton EW & Poyser N1976 Uterine luteolytic hormone: a physiological role for prostaglandin F2α. Physiological Reviews 56 595–651.
Lappas M & Rice GE2004 Phospholipase A2 isozymes in pregnancy and parturition. Prostaglandins, Leukotrienes and Essential Fatty Acids 70 87–100.
Lee J-S & Silvia WJ1994 Cellular mechanisms mediating the stimulation of ovine endometrial secretion of prostaglandin F2a in response to oxytocin: role of phospholipase A2. Journal of Endocrinology 141 491–496.
Lefebvre DL, Giaid A, Bennett H, Lariviere R & Zingg HH1992 Oxytocin gene expression in rat uterus. Science 256 1553–1555.
Lopez Bernal A, Watson SP, Phaneuf S & Europe-Finner GN1993 Biochemistry and physiology of preterm labour and delivery. Balliere’s Clinical Obstetrics and Gynecology 7 523–552.
Mitchell BF & Schmid B2001 Oxytocin and its receptor in the process of parturition. Journal of the Society for Gynecologic Investigation 8 122–133.
Murakami M, Shimbara S, Kambe T, Kuwata H, Winstead MV, Tischfield JA & Kudo I1998 The functions of five distinct mammalian phospholipase A2s in regulating arachidonic acid release: type IIA and type V secretory phospholipase A2s are functionally redundant and act in concert with cytosolic phospholipase A2. Journal of Biological Chemistry 273 14411.
Murakami M, Kambe T, Shimbara S & Kudo I1999 Functional coupling between various phospholipase A2s and cyclooxygenases in immediate and delayed prostanoid biosynthetic pathways. Journal of Biological Chemistry 274 3103.
Nakano T, Ohara O, Teraoka H & Arita H1990 Group II phospholipase A2 mRNA synthesis is stimulated by two distinct mechanisms in rat vascular smooth muscle cells. FEBS Letters 261 171–174.
Ohara O, Tamaki M, Nakamura E, Tsuruta Y, Fujii Y, Shin M., Teraoka H & Okamoto M1986 Dog and rat pancreatic phospholipase A2: complete amino acid sequences deduced from complementary DNAs. Journal of Biochemistry 99 733–739.
Olson DM, Zakar T & Mitchell BF1992 Prostaglandin synthesis regulation by intrauterine tissues. In Molecular Aspects of Fetal Membrane Autacoids, pp 55–96. Eds GE Rice & SP Brennecke. Boca Raton, FL: CRC Press.
Ospina JA, Krause DN & Duckles SP2002 17β-estradiol increases rat cerebrovascular prostacyclin synthesis by elevating cyclooxygenase-1 and prostacyclin synthase. Stroke 33 600–605.
Periwal SB, Farooq A, Bhargava VL, Bhatla N, Vij U & Murugesan K1996 Effect of hormones and antihormones on phospholipase A2 activity in human endometrial stromal cells. Prostaglandins 51 191–201.
Pfeilschifter J, Schalkwijk C, Briner VA & van den Bosch H1993 Cytokine-stimulated secretion of group II phospholipase A2 by rat mesangial cells: its contribution to arachidonic acid release and prostaglandin synthesis by cultured rat glomerular cells. Journal of Clinical Investigation 92 2516.
Ribeiro ML, Farina M, Aisemberg J & Franchi A2003 Effects of in vivo administration of epidermal growth factor (EGF) on uterine contractility, prostaglandin production and timing of parturition in rats. Reproduction 126 459–468.
Rice G.E.1995a Glycerophospholipid metabolism and human labour. Reproduction, Fertility, and Development 7 613–622.
Rice GE1995b Secretory type II phospholipase A2 and the generation of intrauterine signals. Reproduction, Fertility and Development 7 1471–1479.
Rosenthal MD, Albrecht ED & Pepe GJ2001 Developmental maturation of primate placental trophoblast: placental cytosolic and secretory phospholipase A2 expression after estrogen suppression of baboons. Prostaglandins & Other Lipid Mediators 66 155–163.
Rozen F, Russo C, Banville D & Zingg HH1995 Structure, characterization, and expression of the rat oxytocin receptor gene. PNAS 92 200–204.
Rupnow HL, Phernetton TM, Modrick ML, Wiltbank MC, Bird IM & Magness RR2002 Endothelial vasodilator production by uterine and systemic arteries. VIII. Estrogen and progesterone effects on cPLA2, COX-1, and PGIS protein expression. Biology of Reproduction 66 468–474.
Shooner C, Caron PL, Frechette-Frigon G, Leblanc V, Dery MC & Asselin E2005 TGF-β expression during rat pregnancy and activity on decidual cell survival. Reproductive Biology and Endocrinology 3 20.
Slater DM, Astle S, Bennett PR & Thornton S2004 Labour is associated with increased expression of type-IIA secretory phospholipase A2 but not type-IV cytosolic phospholipase A2 in human myometrium. Molecular Human Reproduction 10 799–805.
Soloff MS1975 Uterine receptor for oxytocin: effects of estrogen. Biochemical and Biophysical Research Communications 65 205–212.
