MicroRNA (miRNA) cloning analysis reveals sex differences in miRNA expression profiles between adult mouse testis and ovary

in Reproduction

MicroRNAs (miRNAs) are endogenous non-coding small RNAs that can regulate the expression of complementary mRNA targets. Identifying tissue-specific miRNAs is the first step toward understanding the biological functions of miRNAs, which include the regulation of tissue differentiation and the maintenance of tissue identity. In this study, we performed small RNA library sequencing in adult mouse testis and ovary to reveal their characteristic organ- and gender-specific profiles and to elucidate the characteristics of the miRNAs expressed in the reproductive system. We obtained 10 852 and 11 744 small RNA clones from mouse testis and ovary respectively (greater than 10 000 clones per organ), which included 6630 (159 genes) and 10 192 (154 genes) known miRNAs. A high level of efficiency of miRNA library sequencing was achieved: 61% (6630 miRNA clones/10 852 small RNA clones) and 87% (10 192/11 744) for adult mouse testis and ovary respectively. We obtained characteristic miRNA signatures in testis and ovary; 55 miRNAs were detected highly, exclusively, or predominantly in adult mouse testis and ovary, and discovered two novel miRNAs. Male-biased expression of miRNAs occurred on the X-chromosome. Our data provide important information on sex differences in miRNA expression that should facilitate studies of the reproductive organ-specific roles of miRNAs.

Abstract

MicroRNAs (miRNAs) are endogenous non-coding small RNAs that can regulate the expression of complementary mRNA targets. Identifying tissue-specific miRNAs is the first step toward understanding the biological functions of miRNAs, which include the regulation of tissue differentiation and the maintenance of tissue identity. In this study, we performed small RNA library sequencing in adult mouse testis and ovary to reveal their characteristic organ- and gender-specific profiles and to elucidate the characteristics of the miRNAs expressed in the reproductive system. We obtained 10 852 and 11 744 small RNA clones from mouse testis and ovary respectively (greater than 10 000 clones per organ), which included 6630 (159 genes) and 10 192 (154 genes) known miRNAs. A high level of efficiency of miRNA library sequencing was achieved: 61% (6630 miRNA clones/10 852 small RNA clones) and 87% (10 192/11 744) for adult mouse testis and ovary respectively. We obtained characteristic miRNA signatures in testis and ovary; 55 miRNAs were detected highly, exclusively, or predominantly in adult mouse testis and ovary, and discovered two novel miRNAs. Male-biased expression of miRNAs occurred on the X-chromosome. Our data provide important information on sex differences in miRNA expression that should facilitate studies of the reproductive organ-specific roles of miRNAs.

Introduction

MicroRNAs (miRNAs) are endogenous non-coding small RNAs ∼22 nucleotides (nt) in length that can regulate the expression of complementary mRNA targets (Bartel 2004, Meister & Tuschl 2004). Since the first miRNA, Lin-4, was identified (Lee et al. 1993, Wightman et al. 1993), more than 800 miRNAs have been discovered in animals by using various experimental approaches (e.g., forward genetic methods and sequencing of small RNA libraries), computational predictions, or combined strategies (Berezikov et al. 2006). Although the functions of miRNAs in animals are largely unknown, some are believed to regulate tissue differentiation and the maintenance of tissue identity (Ambros 2004, Wienholds & Plasterk 2005, Kloosterman & Plasterk 2006). Recent evidence also suggests that miRNAs exhibit tissue-specific effects during vertebrate development (Wienholds & Plasterk 2005). Ason et al. (2006) compared miRNA expression among various vertebrate species by in situ hybridization. Their results indicate that the timing and location of miRNA expression are not strictly conserved; instead, miRNA expression may depend on the particular structure and function that is needed.

The patterns of gene expression in meiotic and haploid germ cells are repressed by post-transcriptional control (Eddy 1998, Kleene 2001, Grimes 2004). This is partly due to sequestration of mRNAs in translationally inactive free-messenger ribonucleoprotein particles (Eddy & O'Brien 1998). However, recent studies indicate that miRNA is also involved in post-transcriptional repression during spermatogenesis. Yu et al. (2005) reported that Mirn122a down-regulates the expression of transition protein 2 mRNA by mRNA cleavage in the mammalian testis. Moreover, Kotaja et al. (2006) have found that the chromatoid body, a perinuclear cytoplasmic cloud-like structure, in male germ cells serves like a somatic glycine-tryptophan body (GW-body), also known as a mammalian processing body (P-body), which is a cytoplasmic focus involved in the post-transcriptional regulation of gene expression. These findings stimulate us to further studies of post-transcriptional small RNA pathways involved in the reproductive system. Analysis of the expression profiles of miRNAs in reproductive tissues of interest and subsequent identification of tissue-specific miRNAs is the first step toward understanding the biological functions of these molecules. Cloning of miRNAs has contributed greatly to an accelerated advance in miRNA profiling (Lau et al. 2001, Lee & Ambros 2001, Lagos-Quintana et al. 2002), but the total number of clones identified for mouse testis and ovary was relatively small in most previous studies (Yu et al. 2005, Takada et al. 2006, Watanabe et al. 2006, Ro et al. 2007a, 2007b). Here, we sequenced more than 20 000 small RNAs from adult mouse testis and ovary to produce a miRNA expression profile of each reproductive organ and revealed their differences in terms of gender.

Results

Small RNA sequencing

We obtained 10 852 small RNA clones from 768 sequences in adult mouse testis. The testis-derived small RNAs were classified as follows: mouse miRNAs, 6630 (159 genes); piwi-interacting RNAs (piRNAs), 1474; rRNAs, 314; tRNAs, 95; small nuclear RNAs (snRNAs), 1; small nucleolar RNAs (snoRNAs), 5; and mRNA, 199 (Fig. 1). We also obtained 11 744 small RNA clones from 768 sequences in adult mouse ovary. The ovary-derived small RNAs were as follows: mouse miRNAs, 10 192 (154 genes); piRNAs, 58; rRNAs, 236; tRNAs, 49; snRNAs, 3; snoRNAs, 8; and mRNAs, 59 (Fig. 1).

Figure 1

Download Figure

Figure 1

Bioinformatic analysis of small RNA clones derived from adult mouse testis (left) and ovary (right). The sequences composed of 16–30 nt were extracted as valid small RNAs and were compared with various RNA databases. Novel miRNA candidates (i.e., those not matching known RNA sequences) were determined by secondary structural analysis followed by small RNA detection using Ago2-immunoprecipitation. Size distribution of the cloned miRNAs (lower panels). The nt length of each cloned miRNAs is shown on the X-axis; the percentage of different nt lengths in the sized miRNAs among the total miRNA population is shown on the Y-axis. piRNAs, piwi-interacting RNAs; rRNAs, ribosomal RNAs; tRNAs, transfer RNAs; snRNAs, small nuclear RNAs; snoRNAs, small nucleolar RNAs; mRNA, messenger RNA.

Citation: REPRODUCTION 136, 6; 10.1530/REP-08-0349

miRNA profiling of adult mouse testis and ovary

All of the known miRNA cloning profile data, including cloned sequence information (ID, representative clone sequence, location in the 5′- and 3′-strand duplex of each miRNA stem-loop, clone count, cloning frequency), are presented in Supplementary Table 1, which can be viewed online at www.reproduction-online.org/supplemental. All sequences of the known miRNAs cloned in this study are shown in Supplementary Table 2, which can be viewed online at www.reproduction-online.org/supplemental. Genes encoding miRNAs cloned from mouse testis and ovary were found on all chromosomes but the Y-chromosome. There was no significant chromosome bias in the distribution of the cloned miRNA genes between testis and ovary, except for miRNA genes on the X-chromosome (Table 1). The size distribution of the known miRNA clones derived from testis (22 nt, 44.1%; 23 nt, 26.6%; and 21 nt, 16.8%) was similar to that of clones derived from ovary (22 nt, 42.3%; 23 nt, 26.9%; and 21 nt, 17.4%; Fig. 1).

Table 1

Cloning profiles of microRNAs (miRNAs) from adult mouse testis and ovary by small RNA library sequencing.

TestisOvary
Mature miRNA (Mirn)%ChrClusteraRemarkbMature miRNA (Mirn)%ChrClusteraRemarkb
Highly cloned miRNAsc
125b13.216125b-5p (#2)125b11.7 16125b-5p (#2)
1915.892111.311
34a5.04199a*7.79199a-3p (#2)
15b3.8399a4.116
30c3.741454.018C1
99a3.5163513.5X
30b3.0152143.01
4493.013449a (#2)1432.718C1
20a3.014932.45
34b2.4934b-5p (#2)
199a*2.29199a-3p (#2)
7422.2X
202-5p2.17(#1)
1432.118
932.15
Exclusive miRNAsd
7422.23XC4542-5p0.33X
7411.01XC3Let7b-3p0.1415Let7b* (#1&2)
883a-3p0.82XC4708-5p0.13 7708 (#1&2)
124a0.6514
2040.3819
4710.24XC3
4700.20X
5470.18XC2
4630.15XC3
7430.15XC4743a (#2)
2010.14XC2
425-5p0.129425 (#1&2)
465-5p0.11X465a-5p (#2)
742-5p0.11XC4742* (#1&2)
Mature miRNA (Mirn)T/OChrClusteraRemarkbMature miRNA (Mirn)O/TChrClusteraRemarkb
Predominant miRNAse
449103.013449a (#2)126-5p29.92
34c-3p33.89C534c* (#2)32022.714
34c29.29C5Let7d*16.213
34b-3p27.99C5(#1)181a12.92
34b24.49C534b-5p (#2)2148.81
20314.61299b-3p7.11799b* (#1&2)
189.4143516.6XC6
3508.914506.5XC6450a-5p (#2)
1388.79181b6.01
34a7.841455.918
19b7.6145035.9XC6
151-5p7.615(#1)3225.8XC6
19a5.314215.711
126-3p5.02

%, Percentage of mRNA genes in the total miRNA clone population in testis or ovary; Chr, chromosome; T/O, testis/ovary ratio for miRNA in cloning frequency; O/T, ovary/testis ratio for miRNA in cloning frequency.

Cluster (C1-6) indicates miRNA gene clusters.

Remark shows the current miRNA IDs in the miRBase version 11.0 that are different from those in the miRBase version 9.1 employed in this study. In Remark, the hash 1 symbol (#1) indicates miRNAs that were the unregistered opposite-strand miRNAs of the known ‘unpaired’ miRNAs in the miRBase version 9.1 and are now registered in version 11.0; the hash 2 symbol (#2) indicates miRNA IDs that has been renamed in the miRBase version 11.0.

Greater than 2% of the total miRNA clone population in testis or ovary.

Greater than 0.1% in one gonad and none in the other gonad.

More than fivefold difference between testis and ovary in cloning frequency, and greater than 0.1% in either gonad.

The highly cloned miRNAs (i.e., greater than 2% of the entire miRNA clone population in testis or ovary) included Mirn15b, Mirn20a, Mirn30b, Mirn30c, Mirn34a, Mirn34b, Mirn93, Mirn99a, Mirn125b, Mirn143, Mirn191, Mirn199a, Mirn202-5p, Mirn449, and Mirn742 in testis and Mirn21, Mirn93, Mirn99a, Mirn125b, Mirn143, Mirn145, Mirn199a*, Mirn214, and Mirn351 in ovary. These results are summarized in Table 1. Five miRNAs (Mirn93, Mirn99a, Mirn125b, Mirn143, and Mirn199a*; 23 and 29% of the entire miRNA clone population in testis and ovary respectively) were common between adult testis and ovary. We next directed our attention to the miRNAs that were cloned exclusively either from testis or from ovary (Table 1 and Supplementary Table 3, which can be viewed online at www.reproduction-online.org/supplemental). The following miRNAs were cloned only from testis: Mirn124a, Mirn201, Mirn204, Mirn425-5p, Mirn463, Mirn465-5p, Mirn470, Mirn471, Mirn547, Mirn741, Mirn742, Mirn742-5p, Mirn743, and Mirn883a-3p (greater than 0.1% of the total miRNA clone population in testis), and 35 others. Similarly, those cloned only from ovary were: Let7b-3p, Mirn542-5p and Mirn708-5p (greater than 0.1% of the total miRNA clone population in ovary), and 45 others. Although some of the miRNAs, for example, Mirn742 and Mirn741, were highly cloned, others represented relatively small proportions in cloning frequency (Supplementary Table 3). Based upon the cloning profiles, male-biased expression occurred on the X-chromosome. Approximately, 79% of miRNA genes detected exclusively from testis were derived from the X-chromosome (at cutoff of 0.1% cloning frequency), whereas 33% of miRNAs cloned exclusively from ovary were from the X-chromosome (Table 1). Similarly, with no cutoff, X-linked miRNA genes in the miRNAs cloned exclusively from testis and ovary were 31and 13% respectively. All exclusive-miRNAs (without cutoff) examined in this study are shown in Supplementary Table 3. Furthermore, the miRNAs that were differentially detected between testis and ovary by at least fivefold and greater than 0.1% of the entire miRNA clone population in either gonad were: Mirn18, Mirn19a, Mirn19b, Mirn34a, Mirn34b-3p, Mirn34b, Mirn34c, Mirn34c-3p, Mirn138, Mirn151-5p, Mirn203, Mirn350, and Mirn449, totaling 13 genes in favor of the testis, and Let7d*, Mirn21, Mirn99b-3p, Mirn126-3p, Mirn126-5p, Mirn145, Mirn181a, Mirn181b, Mirn214, Mirn320, Mirn322, Mirn351, Mirn450, and Mirn503, totaling 14 genes in favor of the ovary (Table 1). Table 1 summarizes characteristic miRNA signatures in testis and ovary.

We also examined paired miRNAs that are the 5′- and 3′-strand miRNAs derived from the same pre-miRNAs. In this small RNA library sequencing analysis, 55 paired miRNA genes (stem-loop sequences) were detected in moue gonads (Table 2). Paired miRNA genes with the ratio of 5′/3′-strand clone count ranging from 1:5 to 5:1 (i.e., 0.2–5.0) were 42 and 34% of all paired miRNA genes in testis and ovary respectively. In these paired miRNA genes, most, if not all, 5′- and 3′-strand miRNAs were almost evenly cloned at least either in testis or in ovary. The other paired miRNA genes were cloned preferentially either 5′-strand or 3′-strand, without sex dependence. Interestingly, four paired miRNA genes (Let7d, Mirn22, Mirn126, and Mirn425) showed sex-dependent expression (Table 2 and Supplementary Table 1). For example, cloning frequency for Let7d (5′-strand) were three times more abundant than that of Let7d* (3′-strand) in testis. On the other hand, Let7d* were four times more abundant than Let7d in ovary. We also found that 12 miRNAs (Let7e-3p, Mirn16-2-3p, Mirn92a-1-5p, Mirn103-2-5p, Mirn107-5p, Mirn195-3p, Mirn328-5p, Mirn350-5p, Mirn351-3p, Mirn361-3p, Mirn-449c-3p, and Mirn670-3p) cloned in this study were the sister miRNAs of the known ‘unpaired’ miRNAs (see miRNAs marked with #3 in Table 2 and Supplementary Table 3).

Table 2

Paired-microRNAs (miRNAs) cloned in adult mouse testis and ovary.

Pre-miRNA (Mirn)5′-str3′-strRatio of 5′/3′-strChrRemarka
Testis
99a2351235.000 16
30b2021202.000 15
125b-28815176.200 16
931391139.0005
16-11271127.00014
202144272.0007
99b67167.00017
14545145.00018
19523211.50011
32231310.333X
Let7g10110.0009
15a5469.00014
425818.0009
34c114225.1829
181a-2623.0002
Let7d623.00013
4701352.600X
30a1152.2001
31422.0004
362212.000X
106b741.7505
34b159911.7479
30e441.0004
324111.00011
361111.000X#3
126240.5002
532260.333X
199a-1451510.2989
181c140.2508
29c2150.1331
3502290.0691#3
1422300.06711
92a-21180.056X
74271480.047X
2141230.0431
1401710.0148
Ovary
125b-211962598.00016
99a4191419.00016
3513583119.333X
125a1061106.00017
20a83183.00014
15b110255.0003
93254550.8005
181a-2119339.6672
202147436.7507
74427127.00011
54234217.000X
50382516.400X
Let7a-139313.00013
99b1371112.45517
154818.00012
Let7e717.00017
322190286.786X
34c616.0009
Let7b77145.50015
15a2655.20014
22623.00011
12692312.9682
106b1042.5005
34b1052.0009
151431.33315
132541.25011
30a761.1671
434111.00012
361230.667X#3
30e350.6004
324360.50011
181c130.3338
Let7d12500.24013
199a-11767930.2229
1072210.09519#3
5321180.056X
3281190.0538#3
103-21480.0212#3
21463130.0191
29a1650.0156
14011830.0058

5′-str, Clone count of 5′-strand miRNAs; 3′-str, clone count of 3′-strand miRNAs; Ratio of 5′/3′-str, ratio of 5′/3′-strand miRNA clones; Chr, chromosome.

In Remark, the hash 3 symbol (#3) indicates that the unregistered opposite-strand miRNAs of the known ‘unpaired’ miRNA genes in the miRBase version 11.0 were detected in the pre-miRNA genes; the dagger symbol (†) shows that pre-miRNA genes showed reciprocal expression of 5′- and 3′-strand miRNAs between testis and ovary.

Real-time PCR

Real-time PCR analysis was performed to confirm selected data obtained using cloning. Thirteen miRNAs (Let7d*, Mirn15b, Mirn21, Mirn34a, Mirn99a, Mirn124a, Mirn125b, Mirn145, Mirn191, Mirn199b, Mirn204, Mirn351, and Mirn542-5p) that were cloned predominantly or exclusively either from testis or from ovary were examined by real-time PCR using commercially available kits. The level of expression was compared among seven organs (lung, heart, liver, kidney, spleen, testis, and ovary). Our analysis revealed that 11 out of the 13 miRNAs (i.e., all except Mirn15b and Mirn124a) were expressed higher in either ovary or testis compared with the others. Mirn34a, Mirn191, Mirn204, and Let7d*, Mirn21, Mirn99a, Mirn125b, Mirn145, Mirn199b, Mirn351, Mirn542-5p were expressed preferentially in testis and ovary respectively (Fig. 2). No significant differences in the expression levels of Mirn15b and Mirn124a were detected between testis and ovary (data not shown), and Mirn124a is considered to be highly specific for the central nervous system (CNS; Lim et al. 2005, Mishima et al. 2007).

Figure 2

Download Figure

Figure 2

Real-time PCR analysis of adult mouse organs. (A) The expression of eight miRNAs (Mirn21, Mirn34a, Mirn99a, Mirn125b, Mirn145, Mirn191, Mirn199b, and Mirn351) that were each highly cloned from testis or ovary. (B) The expression of three miRNAs (Let7d*, Mirn204 and Mirn542-5p) that were cloned exclusively either from testis or from ovary. Real-time RT-PCR analysis was performed using 5SrRNA or U6 snRNA as an internal control. The expression of each miRNA is given relative to its expression level in testis or ovary with the higher level of expression assigned a value of 1. The Y-axis includes integer numbers. Values are means±s.d.

Citation: REPRODUCTION 136, 6; 10.1530/REP-08-0349

For each of the 11 miRNAs (Mirn21, Mirn34a, Mirn99a, Mirn125b, Mirn145, Mirn191, Mirn199b, Mirn204, Mirn351, Mirn542-5p, and Let7d*), we compared the ratio of testis/ovary expression identified by cloning with the ratio quantified by real-time PCR to assess whether the number of cloned cDNAs for a given miRNA corresponded to its level of tissue or organ expression. For example, the testis/ovary ratio for Mirn351 was 0.15 ((35 Mirn351 clones/6630 total known miRNA clones in testis)/(358/10 192 in ovary)), and the Mirn351 expression level was 0.11 (0.11:1.00=testis:ovary) by real-time PCR. Our results are summarized in Fig. 3. The ratios calculated from the cloning data were in substantial agreement with those determined from real-time PCR data, except for data on Mirn125b. These results suggest that the number of times a particular miRNA is cloned in small RNA sequencing correlates well with its actual level of expression.

Figure 3

Download Figure

Figure 3

Correlation of the number of miRNA clones identified by cloning with the expression level of the miRNAs determined by real-time PCR. (A) The ratio (testis/ovary) of the percentage of each of the 11 miRNAs (Let7d*, Mirn21, Mirn34a, Mirn99a, Mirn125b, Mirn145, Mirn191, Mirn199b, Mirn204, Mirn351, and Mirn542-5p) among the total miRNA population identified by cloning. If the percentage of a miRNA gene in the total miRNA clone population was higher in testis than in ovary, the miRNA was assigned a value of 1. (B) The expression ratio (testis/ovary) for each of the 11 miRNAs quantified by real-time PCR. If the expression level of a particular miRNA was higher in testis than in ovary, the miRNA was assigned a value of 1.

Citation: REPRODUCTION 136, 6; 10.1530/REP-08-0349

Novel miRNAs

We next evaluated whether any of our cloned cDNAs might represent novel miRNA genes. After comparison with existing gene databases to exclude sequences matching known RNAs (Fig. 1), the remaining small RNAs were evaluated in silico for the ability of their putative precursor sequences to form thermodynamically stable stem-loop structures. After secondary structural analysis, a total of 69 (14 genes) and 7 clones (5 genes) were identified as novel miRNA candidates in testis and ovary respectively. We further examined the 19 candidates using Argonaute2 (Ago2)-immunoprecipitation to determine whether they are indeed novel miRNAs. Out of the 19 candidates, 4 were specifically detected in the immunoprecipitates with anti-mouse Ago2 antibody from mouse testis lysate (Fig. 4A). Specific bands for the other 15 genes were undetectable (data not shown). We assigned tentative miRNA names (MirnG14) to the four novel miRNA genes in this study. Although MirnG1 was detected exclusively in testis (Fig. 4B), MirnG2, MirnG3, and MirnG4 were widely expressed in most, if not all, organs examined (Table 3). Sanger Data Base (miRBase) has been just recently updated to version 11.0 (as of April, 2008). After additional analysis for homology for the four novel RNAs with miRBase version 11.0, we found that two of the four miRNAs are newly registered miRNAs (i.e., Mirn883a-3p and Mirn883b-5p, see Table 3). Data on the novel miRNAs (representative sequence, clone count in testis and ovary, expression level of miRNA in seven oranges analyzed by semi-quantitative PCR, locus in the mouse genome, and minimum free energy (ΔG) of the miRNA/miRNA binding-site duplex) are summarized in Table 3.

Figure 4

Download Figure

Figure 4

Analysis of novel miRNAs cloned from mouse testis and ovary using Ago2-immunoprecipitation followed by semi-quantitative PCR analysis. (A) MirnG1G4 were detected in the immunoprecipitate with anti-mouse Ago2 (anti-mAgo2); on the other hand, they were undetectable in that with non-immune IgG. Let7c was used for a positive control. (B) A representative gel picture showing the expression level of MirnG1 in adult mouse organs. A DNA ladder in each gel indicates the size of the fragments (bp).

Citation: REPRODUCTION 136, 6; 10.1530/REP-08-0349

Table 3

Novel microRNAs (miRNAs) cloned from adult mouse testis and ovary.

ClonesExpression profiles by PCRb
MirnaRepresentattive sequence (5′–3′)TOHLuLiKSTOChrStartEndStrΔGRemark
G1UAACUGCAACAGCUCUCAGUAU5500000040X6304143263041454−44.80883a-3pc
G2UACUGAGAAUGGGUAGCAGUCAC102211320X6305060063050622−35.90883b-5pc
G3CAUCUAACCCUGGCCUUUGACA0102322221186523196186523217−41.70
G4GUAAAGGCUGGGCUUAGACGUGG1023333321186523254186523276−41.70

T, testis; O, ovary; H, heart; Lu, lung; Li, liver; K, kidney; S, spleen; Chr, chromosome; Str, strand.

We assigned tentative miRNA names (MirnG14) to the four genes in this study.

The expression levels of the miRNAs were classified as follows: 4 for high, 3 for medium, 2 for low, 1 for little to none and 0 for none.

MirnG1 and MirnG2 are newly registered as Mirn883a-3p and Mirn883b-5p respectively, in the miRBase version 11.0.

Discussion

Small RNA sequencing

We have produced detailed miRNA profiles of adult mouse gonads. We achieved a high level of efficiency using this method: 61% (6630 miRNA clones/10 852 small RNA clones) and 87% (10 192/11 744) for adult mouse testis and ovary respectively. Some studies on miRNA expression profiling by cloning methods were previously reported (Cummins et al. 2006, Takada et al. 2006, Landgraf et al. 2007). Cummins et al. (2006) discovered a novel miRNA in human colorectal cancer cells through a combination of cloning and serial gene expression analysis, referred to as miRNA serial analysis of gene expression (miRAGE), although their cloning efficiency was only 25% (68 376 miRNA clones/273 986 small RNA clones). Takada et al. (2006) developed a new cloning method, termed miRNA amplification profiling (mRAP), which they applied to various mouse embryos and adult organs, with a cloning efficiency of 16% (11 988 miRNA clones/77 436 small RNA clones). Landgraf et al. (2007) cloned over 250 small RNA libraries from 26 different organ systems and cell types of human and rodents including mouse testis and ovary. Their cloning efficiencies were 23% (3075 miRNA clones/13 398 small RNA clones) and 90% (1217/1343) for mouse testis and ovary respectively. Although it could in part have resulted from differences in RNA complexity in these tissues, miRNA-cloning efficiencies in this study are higher than those in previous studies mentioned above, except for the cloning efficiency of mouse ovary by Landgraf et al. (2007). We concatenated more than 20 cDNAs into a single fragment prior to TA cloning. However, in our study, the average number of counts detected in a single sequencing reaction was 14.2 in testis and 13.2 in ovary, since it depends on the sequence read length of the instrument used. In addition, it is likely that our approach does not affect the proportions of the miRNAs in a given sample, as the expression of many of the miRNAs we identified by cloning was in substantial agreement with that determined by real-time PCR analysis (see Fig. 3). Moreover, Landgraf et al. (2007) indicated that the relative cloning frequencies of miRNAs represent a measure of miRNA expression. Several hundred miRNA clones may not be enough to accurately profile miRNA expression in tissues or organs. By real-time PCR analysis, we practically detected the expression of cloned miRNAs that are less than 0.1% of the total miRNA clone population in one organ (e.g., two clones of Let7d* in testis; Fig. 2).

miRNA profiling of adult mouse testis and ovary

The most highly cloned miRNA in both testis (13.2%) and ovary (11.7%) was Mirn125b. The expression of Mirn125 in developing mouse embryos and in adult mouse organs has been extensively studied (Lagos-Quintana et al. 2002, Miska et al. 2004, Kloosterman et al. 2006, Takada et al. 2006). These reports indicate that Mirn125 is expressed mainly in the CNS throughout mouse development. We confirmed the ovary-enriched expression of Mirn125b in adult mouse by real-time PCR (Fig. 2). Several researchers cloned miRNAs from adult mouse testis and ovary (Lagos-Quintana et al. 2002, Yu et al. 2005, Takada et al. 2006, Watanabe et al. 2006, Ro et al. 2007a, 2007b). However, the total number of clones identified for each organ was relatively small in those studies. The focus was likely on the discovery of novel miRNAs rather than the organ-specific profiling of miRNA expression. Landgraf et al. (2007) showed an excellent atlas of mammalian miRNA expression including that of mouse testis and ovary by cloning. By comparison between their data and ours, Mirn15b, Mirn16, Mirn21, Mirn29b, Mirn34c, Mirn143, Mirn191, Mirn449, and Mirn741 in testis and Mirn26a, Mirn143, and Mirn322-5p in ovary are common highly cloned miRNAs that are greater than 1% of the entire miRNA clone population. However, there are also differences between the expression profiles obtained by their methods and ours (compare Supplementary Table 1 in this study with Table S6 in Landgraf et al. 2007). These differences may be explained by considering the total number of miRNA clones included in each analysis. They obtained 3075 and 1217 miRNA clones from mouse testis and ovary respectively. Another possible explanation for differences in miRNA profiles between their data and ours is a systematic bias in cloning methods, as indicated by Landgraf et al. (2007). Recently, Ro et al. (2007a) reported PCR-based expression profiles of 122 miRNAs cloned from 15 mouse tissues and two purified spermatogenic cell types using PCR. They found that 24 known miRNAs were preferentially expressed in testis, and that one known miRNA, Mirn469, was exclusively detected in testis. By comparison between our data and those by Ro et al., 6 of the 14 testis-exclusive miRNAs shown in Table 1 in this study (i.e., Mirn465, Mirn468, Mirn470, Mirn470*, Mirn471, and Mirn741) are the miRNAs that were expressed preferentially in testis in their PCR-based study. Yan et al. (2007) observed differential miRNA expression between neonatal (1-week-old) and adult (7-week-old) mouse testes by miRNA microarray analysis. Five miRNAs (Mirn29, Mirn34a, Mirn34b, Mirn34c, and Mirn449) were downregulated in the neonatal mice. Their results are in good agreement with our findings that these miRNAs were highly cloned from adult mouse testis (see Supplementary Table 1). It should be noted that the miRNAs that were cloned only from testis (i.e., testis-exclusive miRNAs) were preferentially derived from the X-chromosome (see Table 1 and Supplementary Table 3). These results are consistent with earlier findings (Landgraf et al. 2007, Ro et al. 2007a). These X-linked, testis-exclusive miRNAs may play specific roles related to spermatogenesis and meiotic sex-chromosome inactivation, as suggested previously (Ro et al. 2007a). In addition, despite great endeavors to sequence several thousands of miRNA clones form testis, no miRNA genes were detected on the Y-chromosome. The Y-chromosome may encode few, if any, miRNA genes.

It has been considered that the thermodynamic stability of the 5′-strand and the 3′-strand in the stem-loop structure of a pre-miRNA is important for preferential selection of the less stable one (designated as the miRNA or guide strand) and obliteration of the other one (designated as the miRNA* or passenger strand; Schwarz et al. 2003). However, Ro et al. (2007a, 2007c) recently reported that the strand selection in pre-miRNAs occurs in a tissue-dependent manner. In certain mouse tissues including the testis, most, if not all, of miRNAs were evenly co-expressed as sister pairs (5′- and 3′-strand miRNAs), whereas in some other tissues either the 5′-strand miRNA or the 3′-strand miRNA were detectable. In the present study, some paired miRNA genes showed the guide strand-biased cloning profiles without sex dependence, others displayed co-cloning profiles or sex-dependent profiles (see Table 2). Although some, but not many, paired miRNAs may not be equally co-expressed in testis and ovary, it is likely that tissue-dependent strand selection occurs in vivo.

Novel miRNAs

In this study, we discovered four different novel miRNA genes using the minimum, operational criteria for miRNA identification (Ambros et al. 2003, Berezikov et al. 2006) followed by analysis of small RNAs associated with Ago2. Ago2 is one of the main components of RNA-induced silencing complex (Hutvagner & Simard 2008). Although it might be hereafter hard to find novel miRNAs that are expressed in low quantities, Ago2-immunoprecipitation would be valuable for discovery of novel miRNAs as well as for profiling of the tissue-specific miRNA expression.

Concluding remarks

We produced detailed miRNA expression profiles for adult mouse testis and ovary by small RNA library sequencing. Acquisition of cDNA clones as many as possible should be critical for the tissue-specific profiling of miRNA expression based on this type of analysis, as mentioned above. Although target mRNAs for the miRNAs revealed in this study are computationally predicted, identification of functional target mRNAs in reproductive organs remains to be elucidated. The miRNA expression profiles presented in this study would provide important information resources for facilitating studies of the reproductive organ-specific functions of miRNAs.

Materials and Methods

Animals and total RNA extraction

The Nippon Medical School Ethics Review Committee for Animal Experimentation approved our experimental protocols. Twelve BALB/c mice (8-weeks-old) were purchased from Japan SLC (Hamamatsu, Japan). The ovaries from female mice and testes, lungs, hearts, livers, kidneys, and spleens from male mice were excised. Total RNA was isolated using Isogen (Nippon Gene, Toyama, Japan) according to the manufacturer's instructions.

miRNA cloning

We cloned small RNA by the miRNA cloning protocol of Lagos-Quintana et al. (2002). Briefly, 50 μg of total RNA from mouse testis and ovary were used. Linker ligation, cDNA synthesis, and PCR-amplification of cDNAs were carried out. Then, we concatenated more than 20 cDNAs into a single fragment using a BanI restriction enzyme (New England Biolabs, Ipswich, MA, USA), a DNA ligation kit ver. 2.1 (Takara Bio, Shiga, Japan), and a Geneclean III kit (Qbiogene, Irvine, CA, USA) prior to TA cloning. The concatenated products were then inserted into plasmids and sequenced. Sequencing and the following bioinformatics analysis were supported by Takara Bio DragonGenomics Center (Yokkaichi, Japan).

It was important to avoid contamination from other samples and molecular-weight makers during electrophoresis. Such contaminants considerably diminished the accuracy and efficiency of miRNA cloning. We avoided contamination by performing the cloning procedure separately for each sample, by using a special gel with a small plastic rod that divided the sample and marker lanes, and by using separate vats for each gel for ethidium bromide staining. We made small RNA libraries by excising a portion of a polyacrylamide gel containing species 18–24 nt in length to avoid contaminating our purified RNAs with piRNAs (Kim 2006).

Bioinformatic analysis of the sequence data

We performed a homology search for all cloned small RNAs and a secondary structural analysis for all novel miRNA candidates.

Step 1: extraction of the target sequences

Using Paracel Filtering Package software (Pasadena, CA, USA), the vector sequence, the 5′ and 3′ linkers, and their coupled sequences (CTGTAGGCACCTGAAA) were removed. Those extracted sequences composed of 16–30 nt were defined as valid small RNAs and were subjected to step 2.

Step 2: comparing the sequences of the clones with those of known RNAs

The small RNA sequences from step 1 were analyzed for homology with known RNAs and mouse genomic DNA sequences, including miRNA (mouse and non-mouse), piRNAs, rRNAs, tRNAs, snRNAs, snoRNAs, mRNA, and genomic DNA. The databases used were: miRNA (mature and pre), Sanger Data Base version 9.1 (http://microrna.sanger.ac.uk/sequences/index.shtml); piRNA, NCBI Entrez Nucleotide database (http://www.ncbi.nlm.nih.gov/entrez/); rRNA, the European rRNA database (http://bioinformatics.psb.ugent.be/webtools/rRNA/); tRNA, the Genomic tRNA database (http://lowelab.ucsc.edu/GtRNAdb/); sn/snoRNA, RNAdb (http://research.imb.uq.edu.au/rnadb/); and NONCODE (http://www.noncode.org); mRNA, NCBI Reference Sequence Release18 (ftp://ftp.ncbi.nih.gov/refseq/); Mouse genome, UCSC Genome Bioinformatics Site (mm8, Build 36, February 2006 Assembly; http://genome.ucsc.edu). In our search, we defined the top-hit results with greater than 90% Mus musculus homology as valid if they met our criteria for sequence error, erroneous PCR amplification, and 3′, 5′ variation.

Those clones with 100% homology to mouse genomic DNA but that did not match with known RNAs were subjected to step 3. The cloned small RNAs were compared with the above databases on 31 March 2007. Subsequent additions and changes to these databases are not reflected in our analysis.

Step 3: secondary structural analysis

The two-dimensional pre-miRNA configurations of our novel miRNA candidates were predicted as per Mineno et al. (2006). Briefly, 198 nt of genomic sequence were added to the candidate sequences (88 nt at each end). Each candidate sequence was divided into 110-nt windows and subjected to two-dimensional analysis along its entire length, using RNAfold software from the Vienna RNA Secondary Structure Package (Hofacker 2003). Those configurations with the least free energy and that met the following criteria were termed novel miRNA candidates: i) contains a stem-loop configuration, ii) cloned mature miRNA sequence portion consists of more than 16 nt in its double-stranded region, iii) the loop is less than 20 nt long, iv) the internal loop is less than 10 nt long, and v) the bulge is less than 5 nt long. Furthermore, novel sequences with overlapping positions in the genome were grouped together. The remaining candidates were then subjected to PCR analysis described below.

Real-time PCR analysis of known miRNAs

Real-time PCR was performed on an ABI7300 (Applied Biosystems, Foster City, CA, USA) using various mirVana qRT-PCR primer sets (Ambion, Austin, TX, USA) and a SYBR ExScript RT-PCR kit (Takara Bio), or with TaqMan miRNAs assays (Applied Biosystems), a High capacity cDNA archive kit (Applied Biosystems), and Absolute QPCR ROX mix (Abgene, Rochester, NY, USA), according to the manufacturers' instructions. As an endogenous control, 5SrRNA or U6 snRNA was used. The primers used for Let7d* (catalog number: 30208), Mirn15b (30061), Mirn21 (30102), Mirn34a (30168), Mirn99a (30205), Mirn125b (30022), Mirn145 (30047), Mirn191 (30079), Mirn199b (30090), Mirn351 (30266), and 5SrRNA (30302) were purchased from Ambion. The primers used for Mirn124a (part number: 4373295), Mirn204a (4373313), Mirn542-5p (4378110), and U6 snRNA (4373381) were from Applied Biosystems.

Ago2-immunoprecipitation and PCR analysis of novel miRNAs

After bioinformatic analysis of the sequence data, we further validated novel miRNAs by using a combination of Ago2-immunoprecipitation (Azuma-Mukai et al. 2008) followed by PCR-based miRNA detection (Ro et al. 2006). Briefly, 50 μl Dynabeads protein G slurry (Invitrogen) was immobilized with 20 μg mouse anti-mouse Ago2 monoclonal antibody (clone 2D4, Wako Pure Chemical Industries, Osaka, Japan). One hundred fifty micrograms of adult mouse testis were homogenized in 1.5 ml of a cell lysis solution (provided in miRNAs isolation kit, Wako) using a Polytron PT1200C homogenizer (Kinematica AG, Lucerne, Switzerland) for 10 s at 4 °C, and then 1.5 ml of the cell lysis solution was added into the homogenized solution. Following incubation for 15 min on ice, testis lysate was centrifuged at 20 000 g for 20 min at 4 °C and filtered through a 0.8 μm Supor Acrodisc syringe filter (Pall Corporation, Ann Arbor, MI, USA). One milliliter of the filtered lysate was incubated with 25 μl of the anti-Ago2-Dynabead protein G for incubation for 60 min at 4 °C. After immunoprecipitation, Ago2-associated RNAs were isolated from the immunoprecipitate according to the manufacture's protocol (Wako). We confirmed that the immunoprecipitate contained mouse Ago2 protein of ∼100 kDa in size by western blot (data not shown). Non-immune mouse IgG (Sigma) was used as a control for Ago2-immunoprecipitation. Preparation of the cDNA library using the Ago2-associated RNAs and semi-quantitative PCR analysis of the above-mentioned novel miRNA candidates were performed, as reported previously (Ro et al. 2006). The expected cDNA sizes for mature miRNAs are ∼120 bp. PCR information (primer sequence, annealing temperature, and PCR cycle) is shown in Supplementary Table 4, which can be viewed online at www.reproduction-online.org/supplemental. Complimentary DNA libraries were also generated from small RNAs isolated from seven mouse organs including heart, lung, liver, kidney, spleen, testis, and ovary. The expression levels of novel miRNAs in the seven organs were examined by semi-quantitative PCR and scored as 4 for high, 3 for medium, 2 for low, 1 for little to none and 0 for none.

Declaration of interest

The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

Funding

This work was supported in part by Grants-in-Aids (Nos 17790931 and 19591602 to M T, No. 17659524 to Ta T, No. 20590200 to O I, No. 20591931 to S L, No. 18591786 to T I, Nos. 19659428 and 20390437 to To T) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

Acknowledgements

We thank Yukiko Hachiya and Takuji Kosuge for their technical assistance.

References

T Mishima and T Takizawa contributed equally to this work

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

An official journal of

Society for Reproduction and Fertility

Sections

Figures

  • View in gallery

    Bioinformatic analysis of small RNA clones derived from adult mouse testis (left) and ovary (right). The sequences composed of 16–30 nt were extracted as valid small RNAs and were compared with various RNA databases. Novel miRNA candidates (i.e., those not matching known RNA sequences) were determined by secondary structural analysis followed by small RNA detection using Ago2-immunoprecipitation. Size distribution of the cloned miRNAs (lower panels). The nt length of each cloned miRNAs is shown on the X-axis; the percentage of different nt lengths in the sized miRNAs among the total miRNA population is shown on the Y-axis. piRNAs, piwi-interacting RNAs; rRNAs, ribosomal RNAs; tRNAs, transfer RNAs; snRNAs, small nuclear RNAs; snoRNAs, small nucleolar RNAs; mRNA, messenger RNA.

  • View in gallery

    Real-time PCR analysis of adult mouse organs. (A) The expression of eight miRNAs (Mirn21, Mirn34a, Mirn99a, Mirn125b, Mirn145, Mirn191, Mirn199b, and Mirn351) that were each highly cloned from testis or ovary. (B) The expression of three miRNAs (Let7d*, Mirn204 and Mirn542-5p) that were cloned exclusively either from testis or from ovary. Real-time RT-PCR analysis was performed using 5SrRNA or U6 snRNA as an internal control. The expression of each miRNA is given relative to its expression level in testis or ovary with the higher level of expression assigned a value of 1. The Y-axis includes integer numbers. Values are means±s.d.

  • View in gallery

    Correlation of the number of miRNA clones identified by cloning with the expression level of the miRNAs determined by real-time PCR. (A) The ratio (testis/ovary) of the percentage of each of the 11 miRNAs (Let7d*, Mirn21, Mirn34a, Mirn99a, Mirn125b, Mirn145, Mirn191, Mirn199b, Mirn204, Mirn351, and Mirn542-5p) among the total miRNA population identified by cloning. If the percentage of a miRNA gene in the total miRNA clone population was higher in testis than in ovary, the miRNA was assigned a value of 1. (B) The expression ratio (testis/ovary) for each of the 11 miRNAs quantified by real-time PCR. If the expression level of a particular miRNA was higher in testis than in ovary, the miRNA was assigned a value of 1.

  • View in gallery

    Analysis of novel miRNAs cloned from mouse testis and ovary using Ago2-immunoprecipitation followed by semi-quantitative PCR analysis. (A) MirnG1G4 were detected in the immunoprecipitate with anti-mouse Ago2 (anti-mAgo2); on the other hand, they were undetectable in that with non-immune IgG. Let7c was used for a positive control. (B) A representative gel picture showing the expression level of MirnG1 in adult mouse organs. A DNA ladder in each gel indicates the size of the fragments (bp).

Index Card

Cited By

PubMed

Google Scholar

Related Articles

Altmetrics

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 416 416 53
PDF Downloads 50 50 7