Gene expression and secretion of LH and FSH in relation to gene expression of GnRH receptors in the brushtail possum (Trichosurus vulpecula) demonstrates highly conserved mechanisms

in Reproduction
View More View Less
  • 1 Reproduction Group, School of Biological Sciences, AgResearch Ltd, Invermay Agricultural Centre, Puddle Alley, Private Bag 50013, Mosgiel, New Zealand

Free access

In eutherian mammals, the gonadotrophins (LH and FSH) are synthesized and stored in gonadotroph cells under the regulation of multiple mechanisms including GnRH. Very little is known about the regulation of gonadotrophin secretion and storage in pituitary glands of marsupials. This study revealed, using quantitative PCR and heterologous RIA techniques, that LHB mRNA expression levels remained constant over the oestrous cycle, regardless of the presence of a preovulatory LH surge, which is characteristic of a hormone secreted under regulation. Our sampling regime was unable to detect pulses of LH during the follicular phase, although GNRHR mRNA levels had increased at this time. Pulses of LH were, however, detected in the luteal phase of cycling females, in anoestrus females and in males. There was a positive correlation between gene expression of FSHB and plasma levels of FSH at different stages of the oestrous cycle and no pulses of FSH were detected at any time; all characteristics of a hormone secreted via the constitutive pathway. Using in situ hybridisation and immunohistochemistry methods, we determined that mRNA expression of LHB and FSHB, and protein storage of gonadotrophins exhibited a similar pattern of localisation within the pituitary gland. Additionally, sexual dimorphism of gonadotroph populations was evident. In summary, these findings are similar to that reported in eutherians and considering that marsupial evolution diverged from eutherians over 100 million years ago suggests that the regulation of gonadotrophins is highly conserved indeed.

Abstract

In eutherian mammals, the gonadotrophins (LH and FSH) are synthesized and stored in gonadotroph cells under the regulation of multiple mechanisms including GnRH. Very little is known about the regulation of gonadotrophin secretion and storage in pituitary glands of marsupials. This study revealed, using quantitative PCR and heterologous RIA techniques, that LHB mRNA expression levels remained constant over the oestrous cycle, regardless of the presence of a preovulatory LH surge, which is characteristic of a hormone secreted under regulation. Our sampling regime was unable to detect pulses of LH during the follicular phase, although GNRHR mRNA levels had increased at this time. Pulses of LH were, however, detected in the luteal phase of cycling females, in anoestrus females and in males. There was a positive correlation between gene expression of FSHB and plasma levels of FSH at different stages of the oestrous cycle and no pulses of FSH were detected at any time; all characteristics of a hormone secreted via the constitutive pathway. Using in situ hybridisation and immunohistochemistry methods, we determined that mRNA expression of LHB and FSHB, and protein storage of gonadotrophins exhibited a similar pattern of localisation within the pituitary gland. Additionally, sexual dimorphism of gonadotroph populations was evident. In summary, these findings are similar to that reported in eutherians and considering that marsupial evolution diverged from eutherians over 100 million years ago suggests that the regulation of gonadotrophins is highly conserved indeed.

Introduction

The gonadotrophins, LH and FSH, are dimeric protein hormones composed of a common α-gonadotrophin subunit (αGSU) and a unique β-subunit (LHβ and FSHβ respectively). Regulation of these hormones is facilitated through a complex interplay of multiple mechanisms including a direct action of hypothalamic GnRH, and both direct and indirect actions of gonadal-derived steroids and peptides (Farnworth et al. 1988, Carroll et al. 1989, Gharib et al. 1990, Wang et al. 1990a, 1990b, 1990c, Mann et al. 1992, Hamernik 1995, Besecke et al. 1996, Burger et al. 2001). These regulatory compounds act on gonadotroph cells to influence the differential synthesis, packaging, trafficking, storage and secretion of gonadotrophins, despite both often being present within the same specialized anterior pituitary cells (Childs et al. 1987, Lloyd & Childs 1988, Crawford & McNeilly 2002, Crawford et al. 2002). Additionally, a distinct pattern of localisation of gonadotroph subpopulations has been reported within the pituitary gland of rats (Tixier-Vidal et al. 1975, Denef et al. 1978, Dada et al. 1983, 1984a,b, Childs et al. 1987), sheep (Taragnat et al. 1998, Tortonese et al. 1998, McNeilly et al. 2003), mice (Crawford et al. 2002), horses (Eagle & Tortonese 2000) and humans (Pelletier et al. 1976, Newman & Williams 1989), which may reflect concentration in areas with increased vascularisation. Whilst the pattern of secretion of gonadotrophins in brushtail possums in different physiological states has been defined (Crawford et al. 1999), the regulation and localisation of gonadotrophins in any marsupial species is not well understood.

The brushtail possum is a monovular, polyoestrous seasonal breeder with an oestrous cycle of ∼26 days, consisting of a shorter follicular phase (∼10 days) and a luteal phase similar in length to their gestation period (∼18 days; Fletcher & Selwood 2000). There are some major differences in ovarian function in the possum compared with mono-ovulatory eutherian species. In particular, the steroidogenic capability (Whale et al. 2003), gonadotrophin dependency and the expression of LH receptors (Eckery et al. 2002) of granulosa cells occurs in follicles at a much earlier stage of development in the possum. Expression of LH receptors was first observed in theca interna at the time of antrum formation in possums (Eckery et al. 2002) and many eutherian mammals (Bao & Garverick 1998, McNatty et al. 1999), and is thought to be indicative of steroidogenic capability. However, the expression of LHR in granulosa cells, an event signifying a dominant follicle capable of ovulation and limited to the later stages of antral follicular growth in eutherian mammals (Bao & Garverick 1998, McNatty et al. 1999), occurs at the beginning of antrum formation in possums (Eckery et al. 2002).

The development and maturation of ovarian follicles in eutherian species is dependent upon the successive actions of gonadotrophins. Upon stimulation of immature antral follicles by FSH, there is an upregulation of expression levels of both aromatase and LH receptor mRNA (Adashi & Resnick 1986, Richards 1994). Subsequently, LH acts directly or indirectly through the actions of growth factors (Park et al. 2004) on the FSH-stimulated follicle to facilitate steroid production, and induce luteinisation and ovulation (Adashi & Resnick 1986, Richards 1994). These events require a distinct pattern of gonadotrophin secretion.

Whilst the overall secretory pattern of the gonadotrophins has been established in the brushtail possum over the oestrous cycle (Crawford et al. 1999), the intrapituitary site(s) and levels of mRNA expression, and the storage pattern of gonadotrophins, as well as the parameters of pulsatile secretion are unknown. The aim of this study was to determine in the brushtail possum: the localisation and levels of mRNA expression of LH β-subunit (LHB), FSH β-subunit (FSHB) and GnRH receptor (GNRHR) within the pituitary gland; the frequency and amplitude of pulsatile gonadotrophin secretion in males and in females at different stages of the oestrous cycle; and the number and localisation of gonadotrophs within pituitary glands of females and males.

Results

Quantification of gene expression levels of LHB, FSHB and GNRHR

Confirmation of oestrous cycle stage

Confirmation of the correct stage of the oestrous cycle was validated by observation of ovarian structures either by laparoscopic examination or by gross examination at the time of tissue collection, along with the weight of the cul-de-sac and uteri. The cul-de-sac was pale and small at the time of pouch young removal (RPY) but continually increased (P<0.001) in weight and apparent vascularisation throughout the follicular stage, peaking at the late follicular stage and declining to a nadir (P<0.001) in the mid-luteal stage (Fig. 1A). The uteri were also pale and small at the time of RPY but continually increased (P<0.05) in weight as the oestrous cycle progressed from the follicular to luteal stages, and peaked during the mid-luteal stage of the oestrous cycle (Fig. 1B). There were no significant differences between the weight of the left and right uteri at the time of RPY, during the early follicular stage, or between the ipsi- and contralateral uteri at all other stages of the oestrous cycle, therefore weights were pooled (Fig. 1B). A large (>3.5 mm) presumptive preovulatory follicle, a rupture (ovulation) point on the dominant follicle and a large (>5 mm) vascularized corpus luteum was observed in all animals during the late follicular, early luteal and mid-luteal stages respectively. Animals defined as in the early luteal stage were estimated to have undergone ovulation within 0–48 h before the time of tissue collection.

Figure 1
Figure 1

Wet weight (mean±s.e.m.) of (A) cul-de-sac and (B) both uteri (pooled weights) in adult female brushtail possums at different stages of the oestrous cycle. Different letters denote significant differences (P<0.05) between stages of the oestrous cycle.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

LHB, FSHB and GNRHR mRNA expression levels

The comparison of mean quantified mRNA expression levels of LHB, FSHB and GNRHR from pituitary glands of animals at different stages of the oestrous cycle are shown in Fig. 2. There were no differences (P=0.063) in the mean expression levels of LHB mRNA at any stages of the oestrous cycle. In contrast, in comparison with the time of RPY, the mean expression levels of FSHB mRNA were lower (P<0.0005) in the late follicular stage, and higher (P<0.0005) in the early luteal stage. Mean mRNA expression levels of GNRHR were elevated (P<0.05) during the follicular stages, compared with the time of RPY and during the mid-luteal phase of the oestrous cycle.

Figure 2
Figure 2

Expression levels (mean±s.e.m.) of LHB (top), FSHB (middle) and GNRHR (bottom) mRNA in adult female brushtail possums at different stages of the oestrous cycle. Different letters denote significant differences (P<0.05) between stages of the oestrous cycle. RPY, removal of pouch young.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

Patterns of gonadotrophin secretion

Mean daily concentrations of plasma LH were elevated only at the time of the preovulatory LH surge (Fig. 3A–E) in those female possums that ovulated, and were continually low in female possums that did not ovulate following RPY (Fig. 3F) and in male possums (Fig. 3G). In females that ovulated, mean daily FSH levels were high at the time of RPY but progressively declined to negligible levels during the late follicular stage (Fig. 3A–E). However, in most animals, mean FSH concentrations were elevated at the time of the preovulatory LH surge and variable during the luteal stages of the oestrous cycle (Fig. 3A–E). In those animals that did not ovulate following RPY (Fig. 3F) and in male possums (Fig. 3G), mean FSH concentrations were elevated throughout the sampling period.

Figure 3
Figure 3

Profiles of plasma FSH (○) and LH (•) concentrations (mean±s.e.m.) in groups of either female possums over the oestrous cycle relative to either the time of the preovulatory LH surge (day 0; A–E) or the day of pouch young removal (day 0; F), or male possums (G) over a defined time period. The shaded areas denote the day that a 6-hour period of frequent (20 min) blood samples were collected (see Fig. 5) to gather information on gonadotrophin secretory parameters in either female possums (A) in the early and (B) late follicular stages of the oestrous cycle, (C) immediately after the preovulatory surge, (D) in the early and (E) late luteal stages of the oestrous cycle, (F) that did not respond following removal of pouch young and in (G) male possums.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

Figure 5
Figure 5

Bright-field (left; top and bottom inset) and dark-field (middle inset) views of a pituitary gland from an adult female possum showing expression of (A) LHB and (B) FSHB mRNA by immunohistochemistry and in situ hybridisation. Corresponding bright-field (top inset) and dark-field (middle inset) images at higher magnification show specific labelling of silver grains. Note a higher density of silver grains around lateral (outer) regions of the pars distalis whilst the proximal area immediately anterior to the pars nervosa was virtually devoid of silver grains. A negative control (bottom inset) of hybridisation of sense probe shows no labelling of silver grains.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

Representative profiles of LH and FSH during the intensive sampling period (every 20 min for 6 h) are shown in Fig. 4. During the 6-hour intensive blood sampling interval, no pulses of LH release were detected in the early (Fig. 4A) and late (Fig. 4B) follicular stages or near the end of the preovulatory LH surge (Fig. 4C). One animal out of seven in the early luteal stage (Fig. 4D) and all animals (6/6) in the mid-luteal stage (Fig. 4E) exhibited pulses of LH secretion. A small proportion of both females that failed to ovulate after RPY (Fig. 4F) and males (Fig. 4G) exhibited LH pulses. Pulse amplitudes of LH in animals in the early and mid-luteal stage, in females that failed to ovulate and in males were 0.94, 1.76±0.30, 1.88±0.12 and 1.82±0.67 ng/ml. No pulses of FSH release were observed at any time in either female or male possums.

Figure 4
Figure 4

Representative profiles of plasma FSH (○) and LH (•) concentrations in female possums (A) in the early and (B) late follicular stages of the oestrous cycle, (C) at the end of the preovulatory surge, (D) in the early and (E) late luteal stages of the oestrous cycle, (F) that did not respond following removal of pouch young and (G) in male possums. Note the different scale in (B) and (G) for LH and FSH respectively. Asterisks denote a pulse of LH.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

Quantification of pituitary gland attributes and gonadotroph populations

Pituitary gland volume and total cell number, the numbers of LH- and FSH-positive cells, and the proportion of LH-positive cells were not different between females and males. There was a higher (P<0.005) proportion of FSH-positive cells and a lower ratio of LH:FSH-positive cells in pituitary glands from male possums compared with that from females (Table 1).

Table 1

Comparisons between volume and total cell number, and number, proportion and ratio of LH- and FSH-positive cells of pituitary glands of adult female and male brushtail possums.

AttributesFemaleMale
Pituitary volume (mm3)2.97±0.64a3.41±0.35a
Total cell number (×106)3.17±1.00a3.29±0.21a
LH-positive cell number (×106)0.24±0.08a0.27±0.04a
FSH-positive cell number (×106)0.17±0.06a0.31±0.03a
Proportion of LH-positive cells (%)7.50±0.86a8.26±0.91a
Proportion of FSH-positive cells (%)5.50±0.51a9.53±0.23b
LH:FSH-positive cell ratio1.36±0.03a0.86±0.08b

Different letters denote a significant difference (P<0.005) between female and male possums.

Localisation of gonadotrophin gene expression in the pituitary gland

Representative micrographs of the localisation of LHB and FSHB mRNA in cross sections through the mid-sagittal region of a pituitary gland are shown in Fig. 5A and B respectively. Expression of both LHB and FSHB mRNAs were evident in cells throughout the cross section of the pituitary gland, but both appeared to be more concentrated in the lateral (outer) regions of the pars distalis and in particular, in those cells juxtaposed to the basement membrane and the pars intermedia (Fig. 5A and B).

Localisation of gonadotrophin protein storage in the pituitary gland

Representative micrographs of the localisation of LH and FSH protein in cross sections through the mid-sagittal plane of a pituitary gland are shown in Fig. 6A and B respectively. For LH, immunostaining appeared punctate throughout the gland indicating that very few LH-positive cells were clustered together but were rather individual, or in small groups of two to three (Fig. 6A). The population of both LH- and FSH-positive cells appeared to be at a higher density in the lateral regions of the pars distalis, particularly in those cells positioned adjacent to the basement membrane and pars intermedia (Fig. 6A and B). A proximal area immediately anterior to the pars nervosa was virtually devoid of immunopositive LH and FSH cells (Fig. 6A and B).

Figure 6
Figure 6

Pituitary gland from an adult female possum labelled for (A) LH and (B) FSH. High magnification (top inset) reveals specific cytoplasmic labelling. Note a higher proportion of labelled cells around the lateral (outer) regions of the pars distalis whilst the proximal area immediately anterior to the pars nervosa was virtually devoid of labelled cells. No labelled cells were observed after the primary antiserum was pre-incubated with antigen (negative control; bottom inset) prior to incubation.

Citation: REPRODUCTION 137, 1; 10.1530/REP-08-0347

Discussion

This study has established for the first time, in a marsupial species, the relationship between levels of mRNA expression and protein secretion of gonadotrophins over the oestrous cycle. Additionally, changes in GNRHR mRNA expression levels over the oestrous cycle reveal potential alterations in responsiveness of gonadotroph cells to GnRH in this species.

In eutherians, GnRH is released in pulses from the hypothalamus and acts directly on gonadotroph cells via the portal blood system to stimulate both the biosynthesis and secretion of LH and FSH. Alterations in levels of circulating gonadal steroids (e.g. oestradiol and progesterone; Clarke et al. 1988, Gregg & Nett 1989, Sealfon et al. 1990, Brooks et al. 1993, Yasin et al. 1995), growth factors (e.g. activin and inhibin; Gregg et al. 1991, Braden & Conn 1992) and GnRH itself (Turzillo et al. 1995, 1998) during the oestrous cycle modulates the sensitivity of gonadotroph cells to GnRH through the regulation of expression and hence numbers of GnRH receptors. Changes in GnRH pulse frequencies are capable of differentially regulating LHB and FSHB transcription and mRNA expression levels (Dalkin et al. 1989, Burger et al. 2002), as well as LH and FSH secretion throughout the oestrous cycle. Generally, a higher pulse frequency promotes upregulation of the αGSU (CGA) and LHB genes, and LH secretion, whilst lower frequencies increase FSHB mRNA expression and FSH secretion (Wildt et al. 1981, Savoy-Moore & Swartz 1987, Kaiser et al. 1997, Burger et al. 2002). In particular, during the late follicular phase, the GnRH surge from the hypothalamus combined with the increased responsiveness of gonadotroph cells to GnRH provokes a cascade of intracellular events including potentiation of inositol 1,4,5-triphosphate, intracellular calcium mechanisms and protein kinase C (Mitchell et al. 1988, Johnson et al. 1992, Ison et al. 1993, Simpson et al. 1993, Haisenleder et al. 1997, Washington et al. 2004), as well as the rearrangement of microfilaments and LH-positive secretory granules relative to the plasmalemma (Pickering & Fink 1979, Lewis et al. 1985, Currie & McNeilly 1995, Crawford et al. 2000, 2001) to facilitate the preovulatory LH surge. In the subsequent luteal phase, rising progesterone levels cause a reduction in GNRHR mRNA expression levels (Wu et al. 1994, Nett et al. 2002) and numbers (Laws et al. 1990) and pulse frequency of GnRH and LH (Chabbert-Buffeta et al. 2000), as well as an increase in the LH pulse amplitude (Chabbert-Buffeta et al. 2000, McCartney et al. 2007). It would appear that similar regulatory mechanisms exist in the possum as GNRHR mRNA expression levels increased approximately twofold in the follicular phase after RPY, and declined in the mid-luteal phase.

In this study and as previously reported in female possums (Crawford et al. 1999, 2006), mean daily LH concentrations over the oestrous cycle are usually low with the exception of the preovulatory LH surge during the late follicular stage. The disparity in changes in steady-state levels of LHB mRNA and plasma LH concentrations over the entire oestrous cycle in this study is characteristic of regulated secretion. This is due to the storage and subsequent release of LH in response to ligand (i.e. GnRH) stimulation without the necessity for de novo synthesis (McNeilly et al. 2003) and enables its pulsatile secretion. Interestingly, neither pulses nor rising circulating levels of LH were observed during the follicular phase despite a presumptive increase in gonadotroph responsiveness to GnRH at this time. In fact, pulses of LH were only detected in females in the luteal stages when GNRHR mRNA levels were depressed, and in females that remained anoestrous after RPY, and in males. In eutherians, pulses of LH are more frequent and lower in amplitude in the follicular, compared with the luteal stage of the oestrous cycle (Baird et al. 1976, Baird 1978, Wallace et al. 1988). The lack of frequent pulses of LH release in the follicular phase of possums is at odds with that observed in eutherians. It is possible that the 20-min sampling regime was not frequent enough to detect pulses of LH and/or that LH pulse amplitude during the follicular phase in the possum is lower than the detection limit of the RIA. Another possibility, considering that LH receptors are present in granulosa cells of follicles at a much earlier stage of development in the possum (Eckery et al. 2002), is that the regulatory mechanism(s) of LH is different in this species.

Conversely, FSHB mRNA expression levels reflected a similar pattern to plasma FSH secretion, which is characteristic of a protein that is predominantly secreted in a constitutive manner (McNeilly et al. 2003). This parallel, if somewhat delayed, pattern between gene expression and plasma levels of FSH in possums is similar to that observed in most eutherian species studied (Crawford & McNeilly 2002, Crawford et al. 2002), whereby levels decline during the late follicular stage of the oestrous cycle presumably due to the increasing negative feedback effects of oestradiol (Baird et al. 1981) and inhibin-A (Mann et al. 1992, Padmanabhan & McNeilly 2001) from the growing preovulatory follicle, which also subsequently suppresses the activin gene (Gregg et al. 1991, Nett et al. 2002). Elevation of gene expression levels and secretion of FSH observed in possums in the luteal stages of the oestrous cycle were probably due to the removal of these negative feedback effects (Wallace & McNeilly 1986, Wallace et al. 1988, Brooks et al. 1992), together with augmented progesterone levels (Mann & Barraclough 1973, Rao & Mahesh 1986, Attardi & Fitzgerald 1990, Crawford et al. 2006) and possibly a reduced GnRH pulse frequency (Molter-Gérard et al. 1999). The absence of pulses of FSH in this study is similar to that observed in other mammalian species and reinforces the dogma that FSH is mainly released via a constitutive pathway.

The pattern of gonadotroph localisation is sexually dimorphic in rats where, in males, gonadotrophs were more evenly distributed dorsoventrally within the pars distalis but exhibited a more pronounced anteroposterior polarity compared with that in females (Dada et al. 1984a,b). Whilst in this study we did not compare sex differences of the pattern of gonadotroph distribution, gonadotroph density as detected by both gene expression and protein storage of LH and FSH appeared to be higher in the lateral regions of the pars distalis, whilst a proximal area immediately anterior to the pars nervosa was virtually devoid of gonadotrophs. This may be directly proportional to the vascularisation pattern of the pars distalis as gonadotrophs are commonly located adjacent to blood vessels. It should be noted that in this study localisation of gonadotrophs was only investigated in mid-sagittal cross sections and not the entire pituitary gland.

In the rat, distinct populations of mono- and bi-hormonal gonadotrophs have been characterised by size (Denef et al. 1980) and reportedly exhibit differences in their storage and secretory responses to GnRH (Lloyd & Childs 1988), as well as shift in proportions during the oestrous cycle (Childs et al. 1987). This study did not address colocalisation of LH and FSH within the same gonadotrophs but it would seem sensible to assume that in the brushtail possum at least a proportion of gonadotroph cells contained both LH and FSH. Similar to those of the rat (Dada et al. 1984a,b), pituitary glands of lactating female possums showed a trend of containing more LH-positive and fewer FSH-positive cells than in male possums, resulting in a markedly higher ratio of LH:FSH-positive cells in the pars distalis of female, compared with male, possums. This is consistent with the daily hormone profiles of gonadotrophins where male possums have an overall higher secretory rate of FSH, compared with the female. Additionally, there are some reports in rats that the proportions of LH and FSH-positive cells change over the oestrous cycle and an increase in LH-positive cells were observed at dioestrus (Childs et al. 1987).

In summary, in cycling female possums, LHB mRNA expression levels remained constant over the oestrous cycle, regardless of the presence of a preovulatory LH surge which is a characteristic of a hormone under regulated secretion. Despite an increase in mRNA expression levels of GNRHR, no pulses of LH secretion were detected during the follicular phase which is probably due to sampling or measurement deficiencies. Pulses of LH were, however, detected in the luteal phase, in those females that remained anoestrus after RPY and in male possums. There was a positive correlation between gene expression and plasma levels of FSH at different stages of the oestrous cycle, which is indicative of a hormone secreted via the constitutive pathway. No pulses of FSH were detected at any time. Sexual dimorphism of gonadotroph populations was evident where proportionately more FSH-positive and fewer LH-positive cells were observed in male compared with female possums, which was consistent with the daily secretory profile of these hormones. Gonadotrophs appeared to be concentrated in the lateral regions of the pars distalis, whilst a small region in the middle of the pars distalis, immediately anterior to the pars nervosa, was nearly devoid of gonadotrophs. These findings are similar to that reported in eutherians and considering that marsupial evolution diverged from eutherians over 100 million years ago suggests that the regulation of gonadotrophins is highly conserved indeed.

Materials and Methods

Animals and management

All possums were live-captured in the Wellington region (latitude 41°S) of New Zealand. At the time of capture, each animal was screened for health status and only outwardly healthy animals were included in this study. Animals were housed in the AgResearch Wallaceville possum facility under a group housing system (McLeod et al. 1997). A mixed diet of fresh fruits and vegetables, bread- and cereal-based pellets was provided along with selective browsing of Pinus radiata branches. Fresh water was always available.

At the end of an experiment, all possums were killed by asphyxiation using CO2. All experimental procedures were approved by the AgResearch Wallaceville Animal Ethics Committee in accordance with the Animal Welfare Act of New Zealand, 1999.

Experimental design

To determine the levels of mRNA expression of LHB, FSHB and GNRHR at different stages of the oestrous cycle, 25 adult female possums with pouch young were divided randomly into five groups. Stages of the oestrous cycle were determined by infrequent laparoscopic examination (one to four examinations every ∼2–7 days) of the reproductive tract to observe initial enlargement of the cul-de-sac (early follicular stage), presence of a ‘presumptive’ preovulatory follicle >4 mm in diameter (late follicular stage), or presence of an ovulation point on the preovulatory follicle or corpus luteum (luteal stage) as described previously in detail (Crawford et al. 1997). Pouch young were removed (and killed) from all animals in the late breeding season and five animals were immediately killed (RPY stage). Remaining animals were killed at the early follicular stage (n=5), late follicular stage (n=6), early luteal stage (n=4; 1–2 days after observation of an ovulation point) and mid-luteal stage (n=5; 8–10 days after observation of an ovulation point). Within 5 min of death, reproductive tracts were removed, dissected and weighed, and pituitary glands were removed, snap frozen in dry ice and stored at −80°C until required for processing for quantitative PCR.

To determine the parameters (i.e. pulse frequency and amplitude) of gonadotrophin secretion, a group of 33 lactating female and 12 adult male possums were studied over four breeding seasons (1998–2001). All animals had an indwelling jugular cannula inserted as described previously (Curlewis et al. 1985). Pouch young were removed from female possums, and return to oestrus was monitored daily in individuals by vaginal cytology (influx of epithelial cells and/or sperm in urine; Curlewis et al. 1985) and was retrospectively confirmed by examination of the ovaries and reproductive tract at time of death. Daily blood samples were collected in females from 2 to 4 days prior to RPY till 10–22 days following RPY, and in males over a 26-day period. To determine the pulse frequency and amplitude of gonadotrophin secretion, frequent blood samples (every 20 min) were collected over a 6-hour interval (0000–0600 h) during the early (n=7) and late (n=3) follicular stages of the oestrous cycle, near the end of the preovulatory LH surge (n=3), during the early (n=7) and mid-(n=6) luteal stages, and in females whose ovaries remained inactive after 7 days post-RPY (n=7) and in adult males (n=12).

The pattern of localisation of mRNA expression and protein storage of gonadotrophins was determined using pituitary glands from three anoestrous female possums. Pituitary volume, and the numbers of total and immunopositive LH and FSH cells, was calculated from measurements of pituitary glands from three lactating females and three males. After euthanasia in all animals, pituitary glands were dissected and fixed in 4% (w/v) phosphate-buffered paraformaldehyde and embedded in paraffin wax until processing for in situ hybridisation and immunohistochemistry.

Quantitative PCR

All reagents used and procedures preformed were according to the manufacturer’s instructions. Expression levels of LHB, FSHB, GNRHR and ACTB (β-actin; housekeeping gene) mRNAs were determined using a quantitative Taqman PCR method. Frozen pituitaries were transferred directly to TRIzol reagent (Invitrogen New Zealand Ltd, 1006) and total RNA (tRNA) was extracted. To remove any genomic DNA, 3000 ng of each tRNA sample in 15 μl of di-ethyl-propyl carbonate-treated water was exposed to DNase from the TURBO DNA-free kit (Ambion Inc., Austin, TX, USA). An aliquot (600 ng in 6 μl) of DNase-treated tRNA from each sample was reverse transcribed using reagents including oligo(dT)20 from the SuperScript III First-Strand Synthesis SuperMix kit (Invitrogen New Zealand Ltd).

Primers and Taqman probes (Table 2) were designed using the computer package ‘Beacon Designer’ (Premier Biosoft International, Palo Alto, CA, USA) and were manufactured by Sigma–Proligo (supplied by either Proligo-France SAS 1, Paris France and Proligo-Singapore Pte Ltd, Helios, Singapore).

Table 2

Sequence information of primers and TaqMan probes for real-time Taqman PCR and the resultant product size (bps) for possum LHB (accession no: ), FSHB (accession no: ), GNRHR (accession no: ) and ACTB (β-actin, accession no: ) mRNA.

GeneTaqman probe (5′–3′)Primers (5′–3′)Product (bp)
LHB(HEX)ACAGTGCTGCTGCTGCTGCTGCTGC(BHQ1)F-GCAGGATGGAGAGATACCAGGAG144
R-ACACTGGGCAGGCATCGC
FSHB(ROX)CTTGGTGCTCTGGTTACTGCCATACACGG(BHQ2)F-AATTCTGCATCAGCATCAACACC82
R-GGTCTGATCGGGTCCTTATATACC
GNRHR(6-FAM)TTGGTCCTCTTCTCATCATGCTGGTGTGC(BHQ1)F-TCTTGACCTTTAGCTGCCTCTTC144
R-CCCTTGGGATATTGTTCTTTGATCG
ACTB(CY5)AACACAGCTTCTCCTTGATGTCACGCACGATT(BHQ3)F-GTGATCTGACGGACTACCTCATG135
R-CCATCTCCTGCTCGAAGTCTAGG

Hex, Rox, 6-Fam and Cy5 are fluorophores, and Bhq1–3 are quenchers from Sigma–Proligo.

For quantification of expression levels of LHB and FSHB mRNA, a quadriplex reaction mix was prepared containing primers and Taqman probes (Table 2) for possum LHB, FSHB, ACTB and PRL (prolactin; data not presented in this study) genes at validated concentrations (Table 3; excluding prolactin) and reagents supplied in the ‘Brilliant Multiplex QPCR Master Mix’ kit (Stratagene, La Jolla, CA, USA). For quantification of GNRHR mRNA expression levels, a duplex reaction mix was prepared containing primers and Taqman probes (Table 2) for possum GNRHR and ACTB mRNA at validated concentrations (Table 3) and reagents supplied in the ‘Brilliant Multiplex QPCR Master Mix’ kit (Stratagene). Samples were prepared in duplicate by adding the cDNA sample (10.4 ng in 1.04 μl) into the prepared reaction mix (total volume of 52 μl) and then transferring two 25 μl aliquots containing 5 ng cDNA/aliquot to adjacent wells in an ABI PRISM Optical 96-well reaction plate (Applied Biosystems, Foster City, CA, USA), covered with an ABI PRISM Optical Adhesive Cover (Applied Biosystems). The amplification reaction was run on an MX3000P real-time PCR system (Stratagene) using the following conditions: 1 cycle of 95 °C for 10 min; 40 cycles of 95 °C for 15 s, and 60 °C for 60 s. Controls included samples that underwent RT-PCR with the exclusion of Superscript III/RNaseout enzyme mix to check the effectiveness of DNase treatment, and reactions that omitted addition of template. Quantification of samples was performed by ΔΔCT method (User Bulletin No 2, Applied Biosystems). Before analysis, serial dilutions (1:1–1:64) of a sample were made in both singleplex and quadriplex reactions to validate PCR efficiency. This included the calculation of the line of best fit (slope ±0.1) for LHB, FSHB and GNRHR mRNA when ΔΔCT was plotted against log (input RNA), as well as comparing CT values (<0.65 cycles different) for identical samples for all mRNA transcripts in singleplex and multiplex reactions.

Table 3

Final concentrations of primers and TaqMan probes for real-time PCR for possum LHB, FSHB, GNRHR and ACTB (β-actin) mRNA transcripts.

GeneForward primer (nM)Taqman probe (nM)Reverse primer (nM)
LHB200200200
FSHB100100100
ACTBa200200200
GNRHR150100200
ACTBb150150200

Denotes the concentrations of primers and probe for ACTB mRNA used in a quadriplex reaction, together with primers and probes for possum LHB, FSHB and PRL (prolactin) mRNA (data not presented in this study).

Denotes the concentrations of primers and probe for ACTB mRNA used in a duplex reaction along with primers and probes for possum GNRHR mRNA.

Hormone RIAs

Plasma concentrations of LH and FSH were measured by heterologous RIA using procedures previously described for the possum (Moore et al. 1997a, 1997b). Standards used for these RIAs were purified possum LH and FSH respectively. Within this study, the limits of detection (80% of zero binding) were 0.3 and 0.7 ng/ml for LH and FSH respectively. The intra- and interassay coefficients of variation (CV) in the LH RIA for the medium (2 ng/ml) controls were 15.7 and 16.1% respectively, and high (5 ng/ml) controls were 14.0 and 14.8% respectively. The intra- and interassay CVs in the FSH RIA for the medium (2 ng/ml) controls were 7.1 and 11.0% respectively, and high (5 ng/ml) controls were 6.6 and 7.3% respectively.

Cloning of possum LH β-subunit and FSH β-subunit cDNAs

Total RNA was isolated from frozen pituitaries using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. These tissues were collected from untreated possums being killed for other approved experiments at Wallaceville Animal Research Centre. For the generation of LHB and FSHB cDNAs, first-strand cDNA was produced from 5 μg of tRNA using SuperScript III First-Strand Synthesis SuperMix kit (Invitrogen) in accordance with the manufacturer’s instructions. Complementary cDNAs encoding a section of possum LHB (bases 33–379 of , GenBank accession no.) and possum FSHB (bases 105–402 of , GenBank accession no.) genes were produced using standard RT-PCR techniques. Resulting PCR products were ligated into pGEMTeasy vector (Promega, In Vitro Technologies), and the sequences of resulting plasmids were verified.

In situ hybridisation

Cellular localisation of LHB and FSHB mRNAs was determined using an in situ hybridisation protocol described previously (Tisdall et al. 1999), with minor modifications. Sense and anti-sense RNA probes were generated from cDNA encoding the genes of interest with T7 and SP6 RNA polymerase using the Riboprobe Gemini system (Promega). In brief, 4–6 μm tissue sections were incubated overnight at 55 °C with 45 000 cpm/μl of 33P-labelled antisense RNA. Removal of non-specific hybridisation of RNA was achieved by RNase A digestion followed by stringent washes (2× SSC and 50% formamide at 65 °C and 0.2× SSC at 37 °C). Following washing, sections were dehydrated, air-dried, coated with autoradiographic emulsion (LM-1 emulsion; Amersham Pharmacia Biotech New Zealand) and exposed at 4 °C for 2 weeks (LHB) or 3 weeks (FSHB) and developed for 3.5 min in D10 developer (Kodak). Development was stopped with 1% acetic acid, and slides were fixed in ILFOFIX II (Ilford, Cheshire, UK) for 10 min. Sections were stained with haematoxylin and then viewed and photographed using both light- and dark-field illumination with a Lecia DM6000 microscope (Leica Biosystems Ltd, Victoria, Australia). Hybridisation in adjacent serial sections with sense [33P]UTP-labelled possum LHB and FSHB probes (negative controls) resulted in non-specific signal comparable with the background.

Immunohistochemistry

Immunohistochemistry was used to localize the storage of gonadotrophins in the pituitary gland and confirm the presence of LH and FSH proteins in those cellular types containing corresponding mRNA. As described previously, immunohistochemistry was performed using a pressure cooker antigen retrieval method with minor modifications (Tisdall et al. 1999, Quirke et al. 2001). In brief, LH and FSH proteins were localized in cross sections of pituitary glands using rabbit anti-porcine LH (No. 19526, kindly supplied by Dr Combarnous, INRA, France; Dacheux & Dubois 1978) and rabbit anti-human FSH (M91, kindly donated by Prof AS McNeilly, MRC, Edinburgh, UK) antisera respectively, at final dilutions of 1:300 (counting LH-positive cells) or 1:1000 (visualising localisation of storage of LH) for LH, and 1:200 for FSH, in Tris–HCl buffer containing 0.1% (w/v) BSA (reagent grade; Immuno-chemical Products Ltd, Auckland, New Zealand). Following incubation with the swine anti-rabbit purified IgG secondary antibody (diluted 1:500; DAKO, DAKO Corporation, Carpinteria, CA, USA), staining sensitivity was increased using Tyramide Signal Amplification–Biotin System (New England Nuclear; Perkin–Elmer Life Sciences, Boston, MA, USA). The chromagen used was 3,3′-diaminobenzidine tetrahydrochloride and sections were counterstained with haematoxylin. Negative controls for LH consisted of pre-absorption of the LH antibody with purified possum LH (1 mg/ml) prior to the antibody step, which resulted in abolition of immunostaining of pituitary cells. At the time of this experiment, there was no purified possum FSH available, therefore non-specific staining was determined by replacing the primary antibody with an equivalent amount of non-immune IgG. Recent experiments have proven that the pre-absorption of this FSH antibody with purified possum FSH resulted in abolition of immunostaining of pituitary cells.

A projection microscope (NeoPromar; Leitz) was used to observe and count nuclei in the cells that were immunolabelled for LH and FSH by the presence of brown cytoplasmic immunostaining. The number of total cells in each pituitary was estimated in the same manner, using sections stained with haematoxylin.

Stereology

Pituitary volumes (Vo) were estimated by the Cavalieri principle using the formula Voah, where a, determined by point counting, is the area in μm2 of every 20th section (5 μm thickness) and h is the distance in μm between the sections used to determine a (Gundersen 1986).

The number of cells, N, was determined using the nuclear dissector method (Gundersen 1986) using the formula:
article image
where h(c) is the thickness of adjacent sections in μm (5 μm) and C is the number of cells exclusive to one section in a known area, a(c).

Statistical analysis

All reproductive tract weights, quantified gene expression levels, volumes, numbers and ratios of total or specific pituitary cells and concentrations of plasma gonadotrophins are reported as mean±s.e.m. Data were log transformed and analysed using one-way ANOVA and where a significant (P<0.05) difference was calculated, and a post hoc Student’s t-test was performed using the Minitab 15 statistical package (Minitab Pty Ltd, Sydney, Australia).

The detection of LH and FSH pulses was based on parameters used in the Munro programme, which originated from the pulsar algorithm of Merrian & Wachter (1982). The mean of the peak value and the following sample value was at least twice that of the mean of the two sample values previous to the peak value. Pulse amplitude was measured as the area under the curve (sum of concentration values above baseline).

Declaration of interest

There is no conflict of interest that would prejudice the impartiality of this study.

Funding

This research was supported by grants from the Foundation of Research, Science and Technology (grant no. C10X0308), New Zealand.

Acknowledgements

We are grateful to Leanne Still, Joan Bowen and Catherine Charleson for preparation of histological materials, and Micheal Beaumont, Kirsty Simpson, Lara Colbourne, Brigitta Mester and Dr Gail Shuttleworth for assistance with the animal work.

References

  • Adashi EY & Resnick CE 1986 3′ 5′-Cyclic adensine monophosphate as an intracellular second messenger of luteinizing hormone: application of forskolin criteria. Journal of Cellular Biochemistry 31 217228.

    • Search Google Scholar
    • Export Citation
  • Attardi B & Fitzgerald T 1990 Effects of progesterone on the estrogen induced FSH surge and FSH-β mRNA in the rat. Endocrinology 126 22812287.

    • Search Google Scholar
    • Export Citation
  • Baird DT 1978 Pulsatile secretion of LH and ovarian estradiol during the follicular phase of the sheep estrous cycle. Biology of Reproduction 18 359364.

    • Search Google Scholar
    • Export Citation
  • Baird DT, Swanton IA & Scaramuzzi RJ 1976 Pulsatile release of LH and secretion of ovarian steroids in sheep during the luteal phase of the estrous cycle. Endocrinology 98 14901496.

    • Search Google Scholar
    • Export Citation
  • Baird DT, Swanton IA & McNeilly AS 1981 Relationship between LH, FSH, and prolactin concentration and the secretion of androgens and estrogens by the preovulatory follicle in the ewe. Biology of Reproduction 24 10131025.

    • Search Google Scholar
    • Export Citation
  • Bao B & Garverick HA 1998 Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. Journal of Animal Science 76 19031921.

    • Search Google Scholar
    • Export Citation
  • Besecke LM, Guendner MJ, Schneyer AL, Bauer-Dantoin AC, Jameson JL & Weiss J 1996 Gonadotropin-releasing hormone regulates follicle-stimulating hormone-β gene expression through an activin/follistatin autocrine or paracrine loop. Endocrinology 137 36673673.

    • Search Google Scholar
    • Export Citation
  • Braden TD & Conn PM 1992 Activin-A stimulates the synthesis of gonadotropin-releasing hormone receptors. Endocrinology 130 21012105.

  • Brooks J, Crow WJ, McNeilly JR & McNeilly AS 1992 Relationship between gonadotrophin subunit gene expression, gonadotrophin-releasing hormone receptor content and pituitary and plasma gonadotrophin concentrations during the rebound release of FSH after the treatment of ewes with bovine follicular fluid during the luteal phase of the cycle. Journal of Molecular Endocrinology 8 109118.

    • Search Google Scholar
    • Export Citation
  • Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers WJ & McNeilly AS 1993 Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Molecular and Cellular Endocrinology 94 R23R27.

    • Search Google Scholar
    • Export Citation
  • Burger LL, Dalkin AC, Aylor KW, Workman LJ, Haisenleder DJ & Marshall JC 2001 Regulation of gonadotropin subunit transcription after ovariectomy in the rat: measurement of subunit primary transcripts reveals differential roles of GnRH and inhibin. Endocrinology 142 34353442.

    • Search Google Scholar
    • Export Citation
  • Burger LL, Dalkin AC, Aylor KW, Haisenleder DJ & Marshall JC 2002 GnRH pulse frequency modulation of gonadotropin subunit gene transcription in normal gonadotropes – assessment by primary transcript assay provides evidence for roles of GnRH and follistatin. Endocrinology 143 32433249.

    • Search Google Scholar
    • Export Citation
  • Carroll RS, Corrigan AZ, Gharib SD, Vale W & Chin WW 1989 Inhibin, acitivin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Molecular Endocrinology 3 19691976.

    • Search Google Scholar
    • Export Citation
  • Chabbert-Buffeta N, Skinner DC, Caraty A & Bouchard P 2000 Neuroendocrine effects of progesterone. Steroids 65 613620.

  • Childs GV, Unabia G, Tibolt R & Lloyd JM 1987 Cytological factors that support nonparallel secretion of luteinizing hormone and follicle-stimulating hormone during the estrous cycle. Endocrinology 121 18011813.

    • Search Google Scholar
    • Export Citation
  • Clarke IJ, Cummins JT, Crowder ME & Nett TM 1988 Pituitary receptors for gonadotropin-releasing hormone in relation to changes in pituitary and plasma gonadotropins in ovariectomized hypothalamo/pituitary-disconnected ewes. II. A marked rise in receptor number during the acute feedback effects of estradiol. Biology of Reproduction 39 349354.

    • Search Google Scholar
    • Export Citation
  • Crawford JL & McNeilly AS 2002 Co-localisation of gonadotrophins and granins in gonadotropes at different stages of the oestrous cycle in sheep. Journal of Endocrinology 174 179194.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Shackell GH, Thompson EG, McLeod BJ & Hurst PR 1997 Preovulatory follicle development and ovulation in the brushtail possum (Trichosurus vulpecula) monitored by repeated laparoscopy. Journal of Reproduction and Fertility 110 361370.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McLeod BJ, Thompson EG, Hurst PR, Colbourne LE, Lun S & Eckery DC 1999 Plasma gonadotropin concentrations in the cyclic female brushtail possum (Trichosurus vulpecula). General and Comparative Endocrinology 116 7380.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Currie RJW & McNeilly AS 2000 Replenishment of LH stores of gonadotrophs in relation to expression, synthesis and secretion of LH after the preovulatory phase of the sheep oestrous cycle. Journal of Endocrinology 167 453463.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McNeilly JR & McNeilly AS 2001 Role of granins in differential gonadotrophin secretion in the absence and replacement of GnRH. Reproduction. Abstract Series 27 89 (Abstract 10).

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McNeilly JR, Nicol L & McNeilly AS 2002 Promotion of intragranular co-aggregation with LH by enhancement of secretogranin II storage resulted in increased intracellular granule storage in gonadotrophs of GnRH-deprived male mice. Reproduction 124 267277.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Thomson BP, Beaumont MF & Eckery DC 2006 Plasma concentrations of prolactin in brushtail possums (Trichosurus vulpecula) in different physiological states. Journal of Endocrinology 190 295305.

    • Search Google Scholar
    • Export Citation
  • Curlewis JD, Axelson M & Stone GM 1985 Identification of the major steroids in ovarian and adrenal venous plasma of the brush-tail possum (Trichosurus vulpecula) and changes in the peripheral plasma levels of oestradiol and progesterone during the reproductive cycle. Journal of Endocrinology 105 5362.

    • Search Google Scholar
    • Export Citation
  • Currie RJW & McNeilly AS 1995 Mobilization of LH secretory granules in gonadotrophs in relation to gene expression, synthesis and secretion of LH during the preovulatory phase of the sheep oestrous cycle. Journal of Endocrinology 147 259270.

    • Search Google Scholar
    • Export Citation
  • Dacheux F & Dubois MP 1978 LH-producing cells in the ovine pituitary. An electron microscopic immunocytochemical study. Cell and Tissue Research 188 449463.

    • Search Google Scholar
    • Export Citation
  • Dada MO, Campbell GT & Blake CA 1983 A quantitative immunocytochemical study of the luteinizing hormone and follicle-stimulating hormone cells in the adenohypophysis of adult male rats and adult female rats throughout the estrous cycle. Endocrinology 113 970984.

    • Search Google Scholar
    • Export Citation
  • Dada MO, Campbell GT & Blake CA 1984a The localization of gonadotrophs in normal adult male and female rats. Endocrinology 114 397406.

  • Dada MO, Campbell GT & Blake CA 1984b Pars distalis cell quantification in normal adult male and female rats. Journal of Endocrinology 101 8794.

  • Dalkin AC, Haisenleder DJ, Ortolano GA, Ellis TR & Marshall JC 1989 The frequency of gonadotropin-releasing-hormone stimulation differentially regulates gonadotropin subunit messenger ribonucleic acid expression. Endocrinology 125 917924.

    • Search Google Scholar
    • Export Citation
  • Denef C, Hautekeete E, de Wolf A & Vanderschueren B 1978 Pituitary basophils from immature male and female rats: distribution of gonadotrophs and thyrotrophs as studied by unit gravity sedimentation. Endocrinology 103 724735.

    • Search Google Scholar
    • Export Citation
  • Denef C, Hautekeete E, Dewals R & de Wolf A 1980 Differential control of luteinizing hormone and follicle-stimulating hormone secretion by androgens in rat pituitaries cells in culture: functional diversity of subpopulations separated by unit gravity sedimentation. Endocrinology 106 724729.

    • Search Google Scholar
    • Export Citation
  • Eagle RC & Tortonese DJ 2000 Characterisation and distribution of gonadotrophs in the pars distalis and pars tuberalis of the equive pituitary gland during the estrous cycle and seasonal anestrus. Biology of Reproduction 63 826832.

    • Search Google Scholar
    • Export Citation
  • Eckery DC, Lun S, Thomson BP, Chie WN, Moore LG & Juengel JL 2002 Ovarian expression of messenger RNA encoding the receptors for luteinizing hormone and follicle-stimulating hormone in a marsupial, the brushtail possum (Trichosurus vulpecula). Biology of Reproduction 66 13101317.

    • Search Google Scholar
    • Export Citation
  • Farnworth PG, Robertson DM, de Kretser DM & Burger HG 1988 Effects of 31 kilodalton bovine inhibin on follicle-stimulating hormone and luteinizing hormone in rat pituitary cells in vitro: actions under basal conditions. Endocrinology 122 207213.

    • Search Google Scholar
    • Export Citation
  • Fletcher T & Selwood L 2000 Possum reproduction and development Montague TLIn The Brushtail Possum: Biology, Impact and Management of an Introduced Marsupial Lincoln:Manaaki Whenu Press:6281.

    • Search Google Scholar
    • Export Citation
  • Gharib SD, Wierman ME, Shupnik MA & Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocrine Reviews 11 177199.

  • Gregg DW & Nett TM 1989 Direct effects of estradiol-17β on the number of gonadotropin-releasing hormone receptors in the ovine pituitary. Biology of Reproduction 40 288293.

    • Search Google Scholar
    • Export Citation
  • Gregg DW, Schwall RH & Nett TM 1991 Regulation of gonadotropin secretion and number of gonadotropin-releasing hormone receptors by inhibin, activin-A, and estradiol. Biology of Reproduction 44 725732.

    • Search Google Scholar
    • Export Citation
  • Gundersen HJ 1986 Stereology of arbitrary particles. A review of unbiased number and size estimators and the presentation of some new ones, in memory of William R. Thompson. Journal of Microscopy 143 345.

    • Search Google Scholar
    • Export Citation
  • Haisenleder DJ, Yasin M & Marshall JC 1997 Gonadotropin subunit and gonadotropin-releasing hormone receptor gene expression are regulated by alterations in the frequency of calcium pulsatile signals. Endocrinology 138 52275230.

    • Search Google Scholar
    • Export Citation
  • Hamernik DL 1995 Molecular biology of gonadotrophins. Journal of Reproduction and Fertility 49 257269.

  • Ison AJ, MacEwan DJ, Johnson MS, Clegg RA, Connor K & Mitchell R 1993 Evidence for a distinct H7-resistant form of protein kinase C in rat anterior pituitary gland. FEBS Letters 329 199204.

    • Search Google Scholar
    • Export Citation
  • Johnson MS, Mitchell R & Thomson FJ 1992 The priming effect of luteinizing hormone-releasing hormone (LHRH) but not LHRH-induced gonadotropin release, can be prevented by certain protein kinase C inhibitors. Molecular and Cellular Endocrinology 85 183193.

    • Search Google Scholar
    • Export Citation
  • Kaiser UB, Jakubowiak A, Steinberger A & Chin WW 1997 Differential effects of gonadotropin-releasing hormone (GnRH) pulse frequency on gonadotropin subunit and GnRH receptor messenger ribonucleic acid levels in vitro. Endocrinology 138 12241231.

    • Search Google Scholar
    • Export Citation
  • Laws SC, Beggs MJ, Webster JC & Miller WL 1990 Inhibin increases and progesterone decreases receptors for gonadotropin-releasing hormone in ovine pituitary culture. Endocrinology 127 373380.

    • Search Google Scholar
    • Export Citation
  • Lewis CE, Morris JF & Fink G 1985 The role of microfilaments in the priming effect of LH-releasing hormone: an ultrastructual study using cytochalasin B. Journal of Endocrinology 106 211218.

    • Search Google Scholar
    • Export Citation
  • Lloyd JM & Childs GV 1988 Differential storage and release of luteinizing hormone and follicle-releasing hormone from individual gonadotropes separated by centrifugal elutriation. Endocrinology 122 12821290.

    • Search Google Scholar
    • Export Citation
  • Mann D & Barraclough C 1973 Role of oestrogen and progesterone in facilitating LH release in 4 day cycling rats. Endocrinology 93 634699.

  • Mann GE, Campbell BK, McNeilly AS & Baird DT 1992 The role of inhibin and oestradiol in the control of FSH secretion in the sheep. Journal of Endocrinology 133 381391.

    • Search Google Scholar
    • Export Citation
  • McCartney CR, Blank SK & Marshall JC 2007 Progesterone acutely increases LH pulse amplitude but does not acutely influence nocturnal LH pulse frequency slowing during the late follicular phase in women. American Journal of Physiology. Endocrinology and Metabolism 292 E900E906.

    • Search Google Scholar
    • Export Citation
  • McLeod BJ, Thompson EG, Crawford JL & Shackell GH 1997 Successful group housing of wild-caught brushtail possums (Trichosurus vulpecula). Animal Welfare 6 6776.

    • Search Google Scholar
    • Export Citation
  • McNatty KP, Heath DA, Lundy T, Findler AE, Quirke L, O’Connell A, Smith P, Groome N & Tisdall DJ 1999 Control of early ovarian follicular development. Journal of Reproduction and Fertility 54 316.

    • Search Google Scholar
    • Export Citation
  • McNeilly AS, Crawford JL, Taragnat C, Nicol L & McNeilly JR 2003 The differential secretion of FSH and LH: regulation through genes, feedback and packaging. Reproduction Supplement 61 463476.

    • Search Google Scholar
    • Export Citation
  • Merrian GR & Wachter KW 1982 Algorithms for the study of episodic hormone secretion. American Journal of Physiology 243 E310E318.

  • Mitchell R, Johnson M, Ogier S-A & Fink G 1988 Facilitated calcium mobilization and inositol phosphate production in the priming effect of LH-releasing hormone in the rat. Journal of Endocrinology 119 293301.

    • Search Google Scholar
    • Export Citation
  • Molter-Gérard C, Fontaine J, Guérin S & Taragnat C 1999 Differential regulation of the gonadotropin storage pattern by gonadotropin-releasing hormone pulse frequency in the ewe. Biology of Reproduction 60 12241230.

    • Search Google Scholar
    • Export Citation
  • Moore LG, Ng-Chie W, Lun S, Lawrence SB, Young W & McNatty KP 1997a Follicle-stimulating hormone in the brushtail possum (Trichosurus vulpecula): purification, characterization, and radioimmunoassay. General and Comparative Endocrinology 106 3038.

    • Search Google Scholar
    • Export Citation
  • Moore LG, Ng-Chie W, Lun S, Lawrence SB, Heath DA & McNatty K 1997b Isolation, characterization and radioimmunoassay of luteinizing hormone in the brushtail possum. Reproduction, Fertility, and Development 9 419425.

    • Search Google Scholar
    • Export Citation
  • Nett TM, Turzillo AM, Baratta M & Rispoli LA 2002 Pituitary effects of steroid hormones on secretion of follicle-stimulating hormone and luteinizing hormone. Domestic Animal Endocrinology 23 3342.

    • Search Google Scholar
    • Export Citation
  • Newman GR & Williams ED 1989 Multiple hormone storage by cells of the human pituitary. Journal of Histochemistry and Cytochemistry 37 11831192.

    • Search Google Scholar
    • Export Citation
  • Padmanabhan V & McNeilly AS 2001 Is there an FSH-releasing factor? Reproduction 121 2130.

  • Park J-Y, Su Y-Q, Ariga M, Law E, Jin CS-L & Conti M 2004 EGF-like growth factors as mediators of LH action in the ovulatory follicle. Science 303 682684.

    • Search Google Scholar
    • Export Citation
  • Pelletier G, Leclerc R & Labrie F 1976 Identification of gonadotropic cells in the human pituitary by immunoperoxidase technique. Molecular and Cellular Endocrinology 6 123128.

    • Search Google Scholar
    • Export Citation
  • Pickering AJ-M & Fink G 1979 Priming effect of luteinizing hormone releasing factor in vitro: role of protein synthesis, contractile elements, Ca2+ and cyclic AMP. Journal of Endocrinology 81 223234.

    • Search Google Scholar
    • Export Citation
  • Quirke LD, Juengel JL, Tisdall DJ, Lun S, Heath DA & McNatty KP 2001 Ontogeny of steroidogenesis in the fetal sheep gonad. Biology of Reproduction 65 216228.

    • Search Google Scholar
    • Export Citation
  • Rao I & Mahesh V 1986 Role of progesterone in the modulation of the pre-ovulatory surge of gonadotrophins and ovulation in the PMSG primed immature rat and the adult rat. Biology of Reproduction 35 11541161.

    • Search Google Scholar
    • Export Citation
  • Richards JS 1994 Hormonal control of gene expression in the ovary. Endocrine Reviews 15 725751.

  • Savoy-Moore RT & Swartz KH 1987 Several GnRH stimulation frequencies differentially release FSH and LH from isolated, perfused rat anterior pituitary cells. Advances in Experimental Medicine and Biology 219 641645.

    • Search Google Scholar
    • Export Citation
  • Sealfon SC, Laws SC, Wu JC, Gillo B & Miller WL 1990 Hormonal regulation of gonadotropin-releasing hormone receptors and messenger RNA activity in ovine pituitary culture. Molecular Endocrinology 4 19801987.

    • Search Google Scholar
    • Export Citation
  • Simpson J, Johnson MS & Mitchell R 1993 H7-resistant protein kinase C substrates in two-dimensional gels of proestrous rat anterior pituitary gland. Biochimica et Biophysica Acta 1220 6975.

    • Search Google Scholar
    • Export Citation
  • Taragnat C, Bernier A & Fontaine J 1998 Gonadotrophin storage patterns in the ewe during the oestrous cycle or after long-term treatment with a GnRH agonist. Journal of Endocrinology 156 149157.

    • Search Google Scholar
    • Export Citation
  • Tisdall DJ, Fidler AE, Smith P, Quirke LD, Stent VC, Heath DA & McNatty KP 1999 Stem cell factor and c-kit gene expression and protein localization in the sheep ovary during fetal development. Journal of Reproduction and Fertility 116 277291.

    • Search Google Scholar
    • Export Citation
  • Tixier-Vidal A, Tougard C, Kredelhue B & Jutisz M 1975 Light and electron microscopic studies on immunocytochemical localization of gonadotropic hormones in the rat pituitary gland with antisera against ovine FSH, LH, LHβ and LHα. Annals of the New York Academy of Sciences 254 433461.

    • Search Google Scholar
    • Export Citation
  • Tortonese DJ, Brooks J, Ingelton PM & McNeilly AS 1998 Detection of prolactin receptor gene expression in the sheep pituitary gland and visualization of the specific translation of the signal in gonadotrophs. Endocrinology 139 52155223.

    • Search Google Scholar
    • Export Citation
  • Turzillo AM, Juengel JL & Nett TM 1995 Pulsatile gonadotropin-releasing hormone (GnRH) increases concentrations of GnRH receptor messenger ribonucleic acid and numbers of GnRH receptors during luteolysis in the ewe. Biology of Reproduction 53 418423.

    • Search Google Scholar
    • Export Citation
  • Turzillo AM, Nolan TE & Nett TM 1998 Regulation of gonadotropin-releasing hormone (GnRH) receptor gene expression in sheep: interaction of GnRH and estradiol. Endocrinology 139 48904894.

    • Search Google Scholar
    • Export Citation
  • Wallace JM & McNeilly AS 1986 Changes in FSH and the pulsatile secretion of LH during treatment of ewes with bovine follicular fluid throughout the luteal phase of the oestrous cycle. Journal of Endocrinology 111 317327.

    • Search Google Scholar
    • Export Citation
  • Wallace JM, Martin GB & McNeilly AS 1988 Changes in the secretion of LH pulses, FSH and prolactin during the preovulatory phase of the oestrous cycle of the ewe and the influence of treatment with bovine follicular fluid during the luteal phase. Journal of Endocrinology 116 123135.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Burger HG & Findlay JK 1990a Acute inhibitory effect of follicle-stimulating hormone-suppressing protein (FSP) on gonadotropin-releasing hormone-stimulated gonadotropin secretion in cultured rat anterior pituitary cells. Molecular and Cellular Endocrinology 72 3342.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Burger HG & Findlay JK 1990b Effect of inhibin on activators of protein kinase-C and calcium-mobilizing agents which stimulate secretion of gonadotropins in vitro: implication of a postgonadotropin-releasing hormone receptor effect of inhibin on gonadotropin release. Endocrinology 126 32103217.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Findlay JK & Burger HG 1990c Chronic inhibitory effect of follicle-stimulating hormone (FSH)-suppressing protein (FSP) or follistatin on activin- and gonadotropin-releasing hormone-stimulated FSH synthesis and secretion in cultured rat anterior pituitary cells. Endocrinology 127 13851393.

    • Search Google Scholar
    • Export Citation
  • Washington TM, Blum JJ, Reed MC & Conn PM 2004 A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH. Theoretical Biology & Medical Modelling 1 9.

    • Search Google Scholar
    • Export Citation
  • Whale LJ, Eckery DC & Juengel JL 2003 Determination of steroidogenic potential of ovarian cells of the brushtail possum (Trichosurus vulpecula). Biology of Reproduction 69 947958.

    • Search Google Scholar
    • Export Citation
  • Wildt L, Hausler A, Marshall G, Hutchison JS, Plant TM, Belchetz PE & Knobil E 1981 Frequency and amplitude of gonadotropin-releasing hormone stimulation and gonadotropin secretion in the rhesus monkey. Endocrinology 109 376385.

    • Search Google Scholar
    • Export Citation
  • Wu JC, Sealfon SC & Miller WL 1994 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134 18461850.

    • Search Google Scholar
    • Export Citation
  • Yasin M, Dalkin AC, Haisenleder DJ, Kerrigan JR & Marshall JC 1995 Gonadotropin-releasing hormone (GnRH) pulse pattern regulates GnRH receptor gene expression: augmentation by estradiol. Endocrinology 136 15591564.

    • Search Google Scholar
    • Export Citation

 

     An official journal of

    Society for Reproduction and Fertility

 

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1220 187 7
PDF Downloads 537 137 4
  • View in gallery

    Wet weight (mean±s.e.m.) of (A) cul-de-sac and (B) both uteri (pooled weights) in adult female brushtail possums at different stages of the oestrous cycle. Different letters denote significant differences (P<0.05) between stages of the oestrous cycle.

  • View in gallery

    Expression levels (mean±s.e.m.) of LHB (top), FSHB (middle) and GNRHR (bottom) mRNA in adult female brushtail possums at different stages of the oestrous cycle. Different letters denote significant differences (P<0.05) between stages of the oestrous cycle. RPY, removal of pouch young.

  • View in gallery

    Profiles of plasma FSH (○) and LH (•) concentrations (mean±s.e.m.) in groups of either female possums over the oestrous cycle relative to either the time of the preovulatory LH surge (day 0; A–E) or the day of pouch young removal (day 0; F), or male possums (G) over a defined time period. The shaded areas denote the day that a 6-hour period of frequent (20 min) blood samples were collected (see Fig. 5) to gather information on gonadotrophin secretory parameters in either female possums (A) in the early and (B) late follicular stages of the oestrous cycle, (C) immediately after the preovulatory surge, (D) in the early and (E) late luteal stages of the oestrous cycle, (F) that did not respond following removal of pouch young and in (G) male possums.

  • View in gallery

    Bright-field (left; top and bottom inset) and dark-field (middle inset) views of a pituitary gland from an adult female possum showing expression of (A) LHB and (B) FSHB mRNA by immunohistochemistry and in situ hybridisation. Corresponding bright-field (top inset) and dark-field (middle inset) images at higher magnification show specific labelling of silver grains. Note a higher density of silver grains around lateral (outer) regions of the pars distalis whilst the proximal area immediately anterior to the pars nervosa was virtually devoid of silver grains. A negative control (bottom inset) of hybridisation of sense probe shows no labelling of silver grains.

  • View in gallery

    Representative profiles of plasma FSH (○) and LH (•) concentrations in female possums (A) in the early and (B) late follicular stages of the oestrous cycle, (C) at the end of the preovulatory surge, (D) in the early and (E) late luteal stages of the oestrous cycle, (F) that did not respond following removal of pouch young and (G) in male possums. Note the different scale in (B) and (G) for LH and FSH respectively. Asterisks denote a pulse of LH.

  • View in gallery

    Pituitary gland from an adult female possum labelled for (A) LH and (B) FSH. High magnification (top inset) reveals specific cytoplasmic labelling. Note a higher proportion of labelled cells around the lateral (outer) regions of the pars distalis whilst the proximal area immediately anterior to the pars nervosa was virtually devoid of labelled cells. No labelled cells were observed after the primary antiserum was pre-incubated with antigen (negative control; bottom inset) prior to incubation.

  • Adashi EY & Resnick CE 1986 3′ 5′-Cyclic adensine monophosphate as an intracellular second messenger of luteinizing hormone: application of forskolin criteria. Journal of Cellular Biochemistry 31 217228.

    • Search Google Scholar
    • Export Citation
  • Attardi B & Fitzgerald T 1990 Effects of progesterone on the estrogen induced FSH surge and FSH-β mRNA in the rat. Endocrinology 126 22812287.

    • Search Google Scholar
    • Export Citation
  • Baird DT 1978 Pulsatile secretion of LH and ovarian estradiol during the follicular phase of the sheep estrous cycle. Biology of Reproduction 18 359364.

    • Search Google Scholar
    • Export Citation
  • Baird DT, Swanton IA & Scaramuzzi RJ 1976 Pulsatile release of LH and secretion of ovarian steroids in sheep during the luteal phase of the estrous cycle. Endocrinology 98 14901496.

    • Search Google Scholar
    • Export Citation
  • Baird DT, Swanton IA & McNeilly AS 1981 Relationship between LH, FSH, and prolactin concentration and the secretion of androgens and estrogens by the preovulatory follicle in the ewe. Biology of Reproduction 24 10131025.

    • Search Google Scholar
    • Export Citation
  • Bao B & Garverick HA 1998 Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. Journal of Animal Science 76 19031921.

    • Search Google Scholar
    • Export Citation
  • Besecke LM, Guendner MJ, Schneyer AL, Bauer-Dantoin AC, Jameson JL & Weiss J 1996 Gonadotropin-releasing hormone regulates follicle-stimulating hormone-β gene expression through an activin/follistatin autocrine or paracrine loop. Endocrinology 137 36673673.

    • Search Google Scholar
    • Export Citation
  • Braden TD & Conn PM 1992 Activin-A stimulates the synthesis of gonadotropin-releasing hormone receptors. Endocrinology 130 21012105.

  • Brooks J, Crow WJ, McNeilly JR & McNeilly AS 1992 Relationship between gonadotrophin subunit gene expression, gonadotrophin-releasing hormone receptor content and pituitary and plasma gonadotrophin concentrations during the rebound release of FSH after the treatment of ewes with bovine follicular fluid during the luteal phase of the cycle. Journal of Molecular Endocrinology 8 109118.

    • Search Google Scholar
    • Export Citation
  • Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers WJ & McNeilly AS 1993 Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Molecular and Cellular Endocrinology 94 R23R27.

    • Search Google Scholar
    • Export Citation
  • Burger LL, Dalkin AC, Aylor KW, Workman LJ, Haisenleder DJ & Marshall JC 2001 Regulation of gonadotropin subunit transcription after ovariectomy in the rat: measurement of subunit primary transcripts reveals differential roles of GnRH and inhibin. Endocrinology 142 34353442.

    • Search Google Scholar
    • Export Citation
  • Burger LL, Dalkin AC, Aylor KW, Haisenleder DJ & Marshall JC 2002 GnRH pulse frequency modulation of gonadotropin subunit gene transcription in normal gonadotropes – assessment by primary transcript assay provides evidence for roles of GnRH and follistatin. Endocrinology 143 32433249.

    • Search Google Scholar
    • Export Citation
  • Carroll RS, Corrigan AZ, Gharib SD, Vale W & Chin WW 1989 Inhibin, acitivin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Molecular Endocrinology 3 19691976.

    • Search Google Scholar
    • Export Citation
  • Chabbert-Buffeta N, Skinner DC, Caraty A & Bouchard P 2000 Neuroendocrine effects of progesterone. Steroids 65 613620.

  • Childs GV, Unabia G, Tibolt R & Lloyd JM 1987 Cytological factors that support nonparallel secretion of luteinizing hormone and follicle-stimulating hormone during the estrous cycle. Endocrinology 121 18011813.

    • Search Google Scholar
    • Export Citation
  • Clarke IJ, Cummins JT, Crowder ME & Nett TM 1988 Pituitary receptors for gonadotropin-releasing hormone in relation to changes in pituitary and plasma gonadotropins in ovariectomized hypothalamo/pituitary-disconnected ewes. II. A marked rise in receptor number during the acute feedback effects of estradiol. Biology of Reproduction 39 349354.

    • Search Google Scholar
    • Export Citation
  • Crawford JL & McNeilly AS 2002 Co-localisation of gonadotrophins and granins in gonadotropes at different stages of the oestrous cycle in sheep. Journal of Endocrinology 174 179194.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Shackell GH, Thompson EG, McLeod BJ & Hurst PR 1997 Preovulatory follicle development and ovulation in the brushtail possum (Trichosurus vulpecula) monitored by repeated laparoscopy. Journal of Reproduction and Fertility 110 361370.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McLeod BJ, Thompson EG, Hurst PR, Colbourne LE, Lun S & Eckery DC 1999 Plasma gonadotropin concentrations in the cyclic female brushtail possum (Trichosurus vulpecula). General and Comparative Endocrinology 116 7380.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Currie RJW & McNeilly AS 2000 Replenishment of LH stores of gonadotrophs in relation to expression, synthesis and secretion of LH after the preovulatory phase of the sheep oestrous cycle. Journal of Endocrinology 167 453463.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McNeilly JR & McNeilly AS 2001 Role of granins in differential gonadotrophin secretion in the absence and replacement of GnRH. Reproduction. Abstract Series 27 89 (Abstract 10).

    • Search Google Scholar
    • Export Citation
  • Crawford JL, McNeilly JR, Nicol L & McNeilly AS 2002 Promotion of intragranular co-aggregation with LH by enhancement of secretogranin II storage resulted in increased intracellular granule storage in gonadotrophs of GnRH-deprived male mice. Reproduction 124 267277.

    • Search Google Scholar
    • Export Citation
  • Crawford JL, Thomson BP, Beaumont MF & Eckery DC 2006 Plasma concentrations of prolactin in brushtail possums (Trichosurus vulpecula) in different physiological states. Journal of Endocrinology 190 295305.

    • Search Google Scholar
    • Export Citation
  • Curlewis JD, Axelson M & Stone GM 1985 Identification of the major steroids in ovarian and adrenal venous plasma of the brush-tail possum (Trichosurus vulpecula) and changes in the peripheral plasma levels of oestradiol and progesterone during the reproductive cycle. Journal of Endocrinology 105 5362.

    • Search Google Scholar
    • Export Citation
  • Currie RJW & McNeilly AS 1995 Mobilization of LH secretory granules in gonadotrophs in relation to gene expression, synthesis and secretion of LH during the preovulatory phase of the sheep oestrous cycle. Journal of Endocrinology 147 259270.

    • Search Google Scholar
    • Export Citation
  • Dacheux F & Dubois MP 1978 LH-producing cells in the ovine pituitary. An electron microscopic immunocytochemical study. Cell and Tissue Research 188 449463.

    • Search Google Scholar
    • Export Citation
  • Dada MO, Campbell GT & Blake CA 1983 A quantitative immunocytochemical study of the luteinizing hormone and follicle-stimulating hormone cells in the adenohypophysis of adult male rats and adult female rats throughout the estrous cycle. Endocrinology 113 970984.

    • Search Google Scholar
    • Export Citation
  • Dada MO, Campbell GT & Blake CA 1984a The localization of gonadotrophs in normal adult male and female rats. Endocrinology 114 397406.

  • Dada MO, Campbell GT & Blake CA 1984b Pars distalis cell quantification in normal adult male and female rats. Journal of Endocrinology 101 8794.

  • Dalkin AC, Haisenleder DJ, Ortolano GA, Ellis TR & Marshall JC 1989 The frequency of gonadotropin-releasing-hormone stimulation differentially regulates gonadotropin subunit messenger ribonucleic acid expression. Endocrinology 125 917924.

    • Search Google Scholar
    • Export Citation
  • Denef C, Hautekeete E, de Wolf A & Vanderschueren B 1978 Pituitary basophils from immature male and female rats: distribution of gonadotrophs and thyrotrophs as studied by unit gravity sedimentation. Endocrinology 103 724735.

    • Search Google Scholar
    • Export Citation
  • Denef C, Hautekeete E, Dewals R & de Wolf A 1980 Differential control of luteinizing hormone and follicle-stimulating hormone secretion by androgens in rat pituitaries cells in culture: functional diversity of subpopulations separated by unit gravity sedimentation. Endocrinology 106 724729.

    • Search Google Scholar
    • Export Citation
  • Eagle RC & Tortonese DJ 2000 Characterisation and distribution of gonadotrophs in the pars distalis and pars tuberalis of the equive pituitary gland during the estrous cycle and seasonal anestrus. Biology of Reproduction 63 826832.

    • Search Google Scholar
    • Export Citation
  • Eckery DC, Lun S, Thomson BP, Chie WN, Moore LG & Juengel JL 2002 Ovarian expression of messenger RNA encoding the receptors for luteinizing hormone and follicle-stimulating hormone in a marsupial, the brushtail possum (Trichosurus vulpecula). Biology of Reproduction 66 13101317.

    • Search Google Scholar
    • Export Citation
  • Farnworth PG, Robertson DM, de Kretser DM & Burger HG 1988 Effects of 31 kilodalton bovine inhibin on follicle-stimulating hormone and luteinizing hormone in rat pituitary cells in vitro: actions under basal conditions. Endocrinology 122 207213.

    • Search Google Scholar
    • Export Citation
  • Fletcher T & Selwood L 2000 Possum reproduction and development Montague TLIn The Brushtail Possum: Biology, Impact and Management of an Introduced Marsupial Lincoln:Manaaki Whenu Press:6281.

    • Search Google Scholar
    • Export Citation
  • Gharib SD, Wierman ME, Shupnik MA & Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocrine Reviews 11 177199.

  • Gregg DW & Nett TM 1989 Direct effects of estradiol-17β on the number of gonadotropin-releasing hormone receptors in the ovine pituitary. Biology of Reproduction 40 288293.

    • Search Google Scholar
    • Export Citation
  • Gregg DW, Schwall RH & Nett TM 1991 Regulation of gonadotropin secretion and number of gonadotropin-releasing hormone receptors by inhibin, activin-A, and estradiol. Biology of Reproduction 44 725732.

    • Search Google Scholar
    • Export Citation
  • Gundersen HJ 1986 Stereology of arbitrary particles. A review of unbiased number and size estimators and the presentation of some new ones, in memory of William R. Thompson. Journal of Microscopy 143 345.

    • Search Google Scholar
    • Export Citation
  • Haisenleder DJ, Yasin M & Marshall JC 1997 Gonadotropin subunit and gonadotropin-releasing hormone receptor gene expression are regulated by alterations in the frequency of calcium pulsatile signals. Endocrinology 138 52275230.

    • Search Google Scholar
    • Export Citation
  • Hamernik DL 1995 Molecular biology of gonadotrophins. Journal of Reproduction and Fertility 49 257269.

  • Ison AJ, MacEwan DJ, Johnson MS, Clegg RA, Connor K & Mitchell R 1993 Evidence for a distinct H7-resistant form of protein kinase C in rat anterior pituitary gland. FEBS Letters 329 199204.

    • Search Google Scholar
    • Export Citation
  • Johnson MS, Mitchell R & Thomson FJ 1992 The priming effect of luteinizing hormone-releasing hormone (LHRH) but not LHRH-induced gonadotropin release, can be prevented by certain protein kinase C inhibitors. Molecular and Cellular Endocrinology 85 183193.

    • Search Google Scholar
    • Export Citation
  • Kaiser UB, Jakubowiak A, Steinberger A & Chin WW 1997 Differential effects of gonadotropin-releasing hormone (GnRH) pulse frequency on gonadotropin subunit and GnRH receptor messenger ribonucleic acid levels in vitro. Endocrinology 138 12241231.

    • Search Google Scholar
    • Export Citation
  • Laws SC, Beggs MJ, Webster JC & Miller WL 1990 Inhibin increases and progesterone decreases receptors for gonadotropin-releasing hormone in ovine pituitary culture. Endocrinology 127 373380.

    • Search Google Scholar
    • Export Citation
  • Lewis CE, Morris JF & Fink G 1985 The role of microfilaments in the priming effect of LH-releasing hormone: an ultrastructual study using cytochalasin B. Journal of Endocrinology 106 211218.

    • Search Google Scholar
    • Export Citation
  • Lloyd JM & Childs GV 1988 Differential storage and release of luteinizing hormone and follicle-releasing hormone from individual gonadotropes separated by centrifugal elutriation. Endocrinology 122 12821290.

    • Search Google Scholar
    • Export Citation
  • Mann D & Barraclough C 1973 Role of oestrogen and progesterone in facilitating LH release in 4 day cycling rats. Endocrinology 93 634699.

  • Mann GE, Campbell BK, McNeilly AS & Baird DT 1992 The role of inhibin and oestradiol in the control of FSH secretion in the sheep. Journal of Endocrinology 133 381391.

    • Search Google Scholar
    • Export Citation
  • McCartney CR, Blank SK & Marshall JC 2007 Progesterone acutely increases LH pulse amplitude but does not acutely influence nocturnal LH pulse frequency slowing during the late follicular phase in women. American Journal of Physiology. Endocrinology and Metabolism 292 E900E906.

    • Search Google Scholar
    • Export Citation
  • McLeod BJ, Thompson EG, Crawford JL & Shackell GH 1997 Successful group housing of wild-caught brushtail possums (Trichosurus vulpecula). Animal Welfare 6 6776.

    • Search Google Scholar
    • Export Citation
  • McNatty KP, Heath DA, Lundy T, Findler AE, Quirke L, O’Connell A, Smith P, Groome N & Tisdall DJ 1999 Control of early ovarian follicular development. Journal of Reproduction and Fertility 54 316.

    • Search Google Scholar
    • Export Citation
  • McNeilly AS, Crawford JL, Taragnat C, Nicol L & McNeilly JR 2003 The differential secretion of FSH and LH: regulation through genes, feedback and packaging. Reproduction Supplement 61 463476.

    • Search Google Scholar
    • Export Citation
  • Merrian GR & Wachter KW 1982 Algorithms for the study of episodic hormone secretion. American Journal of Physiology 243 E310E318.

  • Mitchell R, Johnson M, Ogier S-A & Fink G 1988 Facilitated calcium mobilization and inositol phosphate production in the priming effect of LH-releasing hormone in the rat. Journal of Endocrinology 119 293301.

    • Search Google Scholar
    • Export Citation
  • Molter-Gérard C, Fontaine J, Guérin S & Taragnat C 1999 Differential regulation of the gonadotropin storage pattern by gonadotropin-releasing hormone pulse frequency in the ewe. Biology of Reproduction 60 12241230.

    • Search Google Scholar
    • Export Citation
  • Moore LG, Ng-Chie W, Lun S, Lawrence SB, Young W & McNatty KP 1997a Follicle-stimulating hormone in the brushtail possum (Trichosurus vulpecula): purification, characterization, and radioimmunoassay. General and Comparative Endocrinology 106 3038.

    • Search Google Scholar
    • Export Citation
  • Moore LG, Ng-Chie W, Lun S, Lawrence SB, Heath DA & McNatty K 1997b Isolation, characterization and radioimmunoassay of luteinizing hormone in the brushtail possum. Reproduction, Fertility, and Development 9 419425.

    • Search Google Scholar
    • Export Citation
  • Nett TM, Turzillo AM, Baratta M & Rispoli LA 2002 Pituitary effects of steroid hormones on secretion of follicle-stimulating hormone and luteinizing hormone. Domestic Animal Endocrinology 23 3342.

    • Search Google Scholar
    • Export Citation
  • Newman GR & Williams ED 1989 Multiple hormone storage by cells of the human pituitary. Journal of Histochemistry and Cytochemistry 37 11831192.

    • Search Google Scholar
    • Export Citation
  • Padmanabhan V & McNeilly AS 2001 Is there an FSH-releasing factor? Reproduction 121 2130.

  • Park J-Y, Su Y-Q, Ariga M, Law E, Jin CS-L & Conti M 2004 EGF-like growth factors as mediators of LH action in the ovulatory follicle. Science 303 682684.

    • Search Google Scholar
    • Export Citation
  • Pelletier G, Leclerc R & Labrie F 1976 Identification of gonadotropic cells in the human pituitary by immunoperoxidase technique. Molecular and Cellular Endocrinology 6 123128.

    • Search Google Scholar
    • Export Citation
  • Pickering AJ-M & Fink G 1979 Priming effect of luteinizing hormone releasing factor in vitro: role of protein synthesis, contractile elements, Ca2+ and cyclic AMP. Journal of Endocrinology 81 223234.

    • Search Google Scholar
    • Export Citation
  • Quirke LD, Juengel JL, Tisdall DJ, Lun S, Heath DA & McNatty KP 2001 Ontogeny of steroidogenesis in the fetal sheep gonad. Biology of Reproduction 65 216228.

    • Search Google Scholar
    • Export Citation
  • Rao I & Mahesh V 1986 Role of progesterone in the modulation of the pre-ovulatory surge of gonadotrophins and ovulation in the PMSG primed immature rat and the adult rat. Biology of Reproduction 35 11541161.

    • Search Google Scholar
    • Export Citation
  • Richards JS 1994 Hormonal control of gene expression in the ovary. Endocrine Reviews 15 725751.

  • Savoy-Moore RT & Swartz KH 1987 Several GnRH stimulation frequencies differentially release FSH and LH from isolated, perfused rat anterior pituitary cells. Advances in Experimental Medicine and Biology 219 641645.

    • Search Google Scholar
    • Export Citation
  • Sealfon SC, Laws SC, Wu JC, Gillo B & Miller WL 1990 Hormonal regulation of gonadotropin-releasing hormone receptors and messenger RNA activity in ovine pituitary culture. Molecular Endocrinology 4 19801987.

    • Search Google Scholar
    • Export Citation
  • Simpson J, Johnson MS & Mitchell R 1993 H7-resistant protein kinase C substrates in two-dimensional gels of proestrous rat anterior pituitary gland. Biochimica et Biophysica Acta 1220 6975.

    • Search Google Scholar
    • Export Citation
  • Taragnat C, Bernier A & Fontaine J 1998 Gonadotrophin storage patterns in the ewe during the oestrous cycle or after long-term treatment with a GnRH agonist. Journal of Endocrinology 156 149157.

    • Search Google Scholar
    • Export Citation
  • Tisdall DJ, Fidler AE, Smith P, Quirke LD, Stent VC, Heath DA & McNatty KP 1999 Stem cell factor and c-kit gene expression and protein localization in the sheep ovary during fetal development. Journal of Reproduction and Fertility 116 277291.

    • Search Google Scholar
    • Export Citation
  • Tixier-Vidal A, Tougard C, Kredelhue B & Jutisz M 1975 Light and electron microscopic studies on immunocytochemical localization of gonadotropic hormones in the rat pituitary gland with antisera against ovine FSH, LH, LHβ and LHα. Annals of the New York Academy of Sciences 254 433461.

    • Search Google Scholar
    • Export Citation
  • Tortonese DJ, Brooks J, Ingelton PM & McNeilly AS 1998 Detection of prolactin receptor gene expression in the sheep pituitary gland and visualization of the specific translation of the signal in gonadotrophs. Endocrinology 139 52155223.

    • Search Google Scholar
    • Export Citation
  • Turzillo AM, Juengel JL & Nett TM 1995 Pulsatile gonadotropin-releasing hormone (GnRH) increases concentrations of GnRH receptor messenger ribonucleic acid and numbers of GnRH receptors during luteolysis in the ewe. Biology of Reproduction 53 418423.

    • Search Google Scholar
    • Export Citation
  • Turzillo AM, Nolan TE & Nett TM 1998 Regulation of gonadotropin-releasing hormone (GnRH) receptor gene expression in sheep: interaction of GnRH and estradiol. Endocrinology 139 48904894.

    • Search Google Scholar
    • Export Citation
  • Wallace JM & McNeilly AS 1986 Changes in FSH and the pulsatile secretion of LH during treatment of ewes with bovine follicular fluid throughout the luteal phase of the oestrous cycle. Journal of Endocrinology 111 317327.

    • Search Google Scholar
    • Export Citation
  • Wallace JM, Martin GB & McNeilly AS 1988 Changes in the secretion of LH pulses, FSH and prolactin during the preovulatory phase of the oestrous cycle of the ewe and the influence of treatment with bovine follicular fluid during the luteal phase. Journal of Endocrinology 116 123135.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Burger HG & Findlay JK 1990a Acute inhibitory effect of follicle-stimulating hormone-suppressing protein (FSP) on gonadotropin-releasing hormone-stimulated gonadotropin secretion in cultured rat anterior pituitary cells. Molecular and Cellular Endocrinology 72 3342.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Burger HG & Findlay JK 1990b Effect of inhibin on activators of protein kinase-C and calcium-mobilizing agents which stimulate secretion of gonadotropins in vitro: implication of a postgonadotropin-releasing hormone receptor effect of inhibin on gonadotropin release. Endocrinology 126 32103217.

    • Search Google Scholar
    • Export Citation
  • Wang QF, Farnworth PG, Findlay JK & Burger HG 1990c Chronic inhibitory effect of follicle-stimulating hormone (FSH)-suppressing protein (FSP) or follistatin on activin- and gonadotropin-releasing hormone-stimulated FSH synthesis and secretion in cultured rat anterior pituitary cells. Endocrinology 127 13851393.

    • Search Google Scholar
    • Export Citation
  • Washington TM, Blum JJ, Reed MC & Conn PM 2004 A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH. Theoretical Biology & Medical Modelling 1 9.

    • Search Google Scholar
    • Export Citation
  • Whale LJ, Eckery DC & Juengel JL 2003 Determination of steroidogenic potential of ovarian cells of the brushtail possum (Trichosurus vulpecula). Biology of Reproduction 69 947958.

    • Search Google Scholar
    • Export Citation
  • Wildt L, Hausler A, Marshall G, Hutchison JS, Plant TM, Belchetz PE & Knobil E 1981 Frequency and amplitude of gonadotropin-releasing hormone stimulation and gonadotropin secretion in the rhesus monkey. Endocrinology 109 376385.

    • Search Google Scholar
    • Export Citation
  • Wu JC, Sealfon SC & Miller WL 1994 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134 18461850.

    • Search Google Scholar
    • Export Citation
  • Yasin M, Dalkin AC, Haisenleder DJ, Kerrigan JR & Marshall JC 1995 Gonadotropin-releasing hormone (GnRH) pulse pattern regulates GnRH receptor gene expression: augmentation by estradiol. Endocrinology 136 15591564.

    • Search Google Scholar
    • Export Citation