Abstract
To determine if changes in endometrial expression of the enzymes and receptors involved in prostaglandin (PG) synthesis and action might provide insights into the PGs involved in the initiation of decidualization, ovariectomized steroid-treated rats at the equivalent of day 5 of pseudopregnancy were given a deciduogenic stimulus and killed at various times up to 32 h thereafter. The expression of PG-endoperoxide synthases (PTGS1 and PTGS2), microsomal PGE synthases (PTGES and PTGES2), cytosolic PGE synthase (PTGES3), prostacyclin synthase (PTGIS), prostacyclin receptor, peroxisome proliferator-activated receptor δ (PPARD) and retinoid x receptor α (RXRA) in endometrium was assessed by semiquantitative RT-PCR, western blot analyses and immunohistochemistry. In addition, to determine which PG is involved in mediating decidualization, we compared the ability of PGE2, stable analogues of PGI2, L165041 (an agonist of PPARD), and docasahexanoic acid (an agonist of RXRA) to increase endometrial vascular permeability (EVP, an early event in decidualization), and decidualization when infused into the uterine horns of rats sensitized for the decidual cell reaction (DCR). EVP was assessed by uterine concentrations of Evans blue 10 h after initiation of infusions. DCR was assessed by the uterine mass 5 days after the initiation of the infusions. Because enzymes associated with the synthesis of PGE2, including PTGS2, are up-regulated in response to a deciduogenic stimulus and because PGE2 was more effective than the PGI2 analogues and PPARD and RXRA agonists in increasing EVP and inducing decidualization, we suggest that PGE2 is most likely the PG involved in the initiation of decidualization in the rat.
Introduction
An increase in the endometrial vascular permeability (EVP) at the sites of blastocyst apposition is one of the earliest macroscopically identifiable signs of blastocyst implantation (Psychoyos 1973). In rodents, this step is followed by proliferation and differentiation of endometrial stromal cells into decidual cells, a process termed decidualization (reviewed by Kennedy et al. 2007). In addition, the endometrium of rodents responds to non-specific stimuli with increased EVP and subsequent decidualization provided that the stimulus is applied at the appropriate time (Psychoyos 1973).
Previous studies conducted in various species have shown that during pregnancy, the levels of prostaglandins (PGs) are elevated at implantation sites, suggesting a role of PGs in implantation (reviewed by Kennedy et al. 2007). Moreover, numerous studies have shown that administration of inhibitors of PG synthesis and PG antagonists can inhibit or delay the initiation of implantation (reviewed by Kennedy et al. 2007). In addition, indomethacin, an inhibitor of PG biosynthesis, reduces the artificially induced decidual cell reaction (DCR), suggesting a role for PGs in the process of decidualization (reviewed by Kennedy et al. 2007). The effects of this inhibitor can be reversed, at least partially, by exogenous PGs (reviewed by Kennedy et al. 2007).
PG production requires the liberation of arachidonic acid (AA) from membrane phospholipids by phospholipases. AA is then converted into PG endoperoxide H2 (PGH2) by PG-endoperoxide synthases (PTGS), also termed cyclooxygenases. Two isoforms of PTGS, known as PTGS1 and PTGS2, are involved in the process. Once PGH2 is formed, it is the substrate for the synthesis of five different prostanoids, PGE2, PGI2, PTGDS, PGF2α and thromboxane A2 via specific synthases (Wang & Dey 2005). Previous studies have suggested that of these prostanoids only PGE2 and PGI2 are involved in implantation. PGE synthases (PTGES) catalyze the synthesis of PGE2 from PGH2. Several forms of PTGES including microsomal PTGES (PTGES), microsomal PTGES 2 (PTGES2), and cytosolic PTGES (PTGES3) have been characterized and are coupled with PTGSs. Prostaglandin I2 (PGI2 or prostacyclin) synthesis occurs when PGH2 is converted to PGI2 by PGI synthase (PTGIS). Once PGs are produced, they exert their actions via specific cell surface G-protein coupled receptors and nuclear receptors (Helliwell et al. 2004). PGE2 acts via the PGE family of receptors (PTGER1-PTGER4), whereas PGI2 acts via prostacyclin receptor (PTGIR). Recently, based on the ability of some PGI2 analogues to act as ligands for the nuclear receptor peroxisome proliferator-activated receptor δ (PPARD) that then heterodimerizes to retinoid x receptor α (RXRA), it has been suggested that the effects of PGI2 may be mediated by a PPARD–RXRA complex (Lim & Dey 2002).
It has been proposed that PGI2, acting via PPARD, is the primary PG mediating implantation and decidualization in mice (Lim et al. 1999). This proposal was based on studies in PTGS2 null mice where analogues of PGI2 that induce DNA-binding and transcriptional activation by PPARD and PPARD ligands were more effective than PGE2 at inducing implantation and decidualization. Moreover, in mice, it has been shown that PTGS2, PTGIS, and the receptor PPARD coexist at the implantation site in mouse endometrium during the peri-implantation period (Lim et al. 1999). These observations have been interpreted to indicate that in the mouse the PTGS2/PTGIS system generates PGI2 and mediates embryo implantation via PPARD (Lim et al. 1999). By contrast, in the hamster, it has been reported that PGE2 but not PGI2 is the major PG produced, and is a product of induced PTGS2 and PTGES at the implantation site (Wang et al. 2004). Based primarily on the responses to exogenously administered PGs, it has been proposed that PGE2 is the primary PG involved in rats (reviewed by Kennedy et al. 2007). Moreover, the expression of mRNA for three subtypes of the PGE receptors (Ptger2, Ptger3, and Ptger4) is correlated with endometrial preparation for decidualization in the rat and consistent for a role for PGE2 in this process (Papay & Kennedy 2000). Whether the mouse or the hamster is representative of mammalian species in general is unknown. Thus, to determine if changes in endometrial expression of the enzymes and receptors involved in PG synthesis and action could provide insight into the PGs involved in the initiation of decidualization in the rat, we assessed levels of transcripts and proteins for PTGS1 and PTGS2, PTGES, PTGES2, PTGES3, PTGIS, PTGIR, PPARD, and RXRA. We chose to study artificially induced decidualization rather than pregnancy because the timing of endometrial stimulation can be readily controlled in this model. The early endometrial responses to artificial stimuli and implanting blastocysts are thought to be similar. Furthermore, to determine which PG has a primary role in initiation of decidualization in the rat endometrium, we compared the effectiveness of PGE2 and various analogues of PGI2 to increase EVP and induce decidualization when infused into the uterine lumen of rats sensitized for the DCR. PGI2 analogues were selected based on their different affinities for PTGIR and PPARD. Those tested were carbaprostacyclin (cPGI2), a ligand for both PTGIR and PPARD (Forman et al. 1997); cicaprost, a ligand for PTGIR but not PPARD (Forman et al. 1997); and AFP-07 a high-affinity ligand for PTGIR (Chang et al. 1997) but no information available for binding to PPARD. In addition, L165041, a synthetic high-affinity ligand for PPARD without significant binding to PTGIR (Seimandi et al. 2005) was used. Since PPARD heterodimerizes with RXRA upon activation, docasahexanoic acid (DHA), a ligand for RXRA (Germain et al. 2006) was also included.
Results
Pattern of expression of PTGS1, PTGS2, PTGES, PTGES2, PTGES3, PTGIS, PTGIR, PPARD, and RXRA in the rat endometrium
Semiquantitative RT-PCR indicated that Ptgs1 transcript levels were significantly lower (P<0.05) in the endometrium at 4, 8, 16, and 32 h after the application of a deciduogenic stimulus compared with 0 and 2 h (Fig. 1). Because no differences were detected between the stimulated and non-stimulated endometrium at 8 and 32 h (P>0.05), the results suggest that the decrease was due to the time and not to the stimulus. Although, levels of Ptgs1 mRNA changed, levels of PTGS1 protein did not change significantly (P>0.05) at any of the times studied (Fig. 1).
Expression of PTGS1 in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8, and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
Ptgs2 transcript levels significantly increased at 2 and 4 h after the deciduogenic stimulus was given (P<0.05), and the levels returned to prestimulated levels at 8, 16, and 32 h (Fig. 2). In contrast to PTGS1 protein levels, PTGS2 protein was significantly higher at 8 h and remained elevated at 16 and 32 h (P<0.05). PTGS2 protein levels were significantly (P<0.05) higher in stimulated endometrium at 8 and 32 h than in non-stimulated endometrium, indicating that the increase was a consequence of the deciduogenic stimulus rather than the passage of time (Fig. 2).
Expression of PTGS2 in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
Ptges mRNA levels increased significantly at 16 h and remained elevated at 32 h (P<0.05; Fig. 3). The increase at 32 h was the result of the deciduogenic stimulus since transcript levels in the stimulated endometrium were higher (P<0.05) than in the non-stimulated endometrium at this time. There were no significant differences (P>0.05) in PTGES protein levels in the stimulated endometrium at any time studied. However, PTGES protein levels were higher at 32 h in the stimulated endometrium than the non-stimulated at the same time (P<0.05). This was a consequence of a decrease in PTGES protein levels in the non-stimulated endometrium.
Expression of PTGES in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
No changes in Ptges2 mRNA levels were detected in the stimulated endometrium at any time studied (Fig. 4). However, the transcript levels were significantly (P<0.05) higher in the non-stimulated than the stimulated endometrium at 8 and 32 h, suggesting that the stimulus decreased the levels. The PTGES2 protein levels were significantly higher at 2 and 4 h when compared with all the other time points (P<0.05; Fig. 4).
Expression of PTGES2 in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
No changes in mRNA levels were detected for Ptges3 at any time studied (Fig. 5). By contrast, western blot analysis indicated that PTGES3 protein levels decreased (P<0.05) with time in stimulated endometrium, being lowest at 16 and 32 h. However, this decrease was not attributable to the deciduogenic stimulus since a similar decrease was seen in non-stimulated endometrium at 8 and 32 h.
Expression of PTGES3 in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
There were no statistical differences (P>0.05) of Ptgis transcript levels at any time following stimulation or between stimulated and non-stimulated endometrium at 8 and 32 h (Fig. 6). When western blot analyses were conducted using antibodies against PTGIS protein, two immunoreactive bands were obtained; one at a molecular mass of 56–57 kDa and one at ∼ 75 kDa (Fig. 6). When the primary antibody was incubated in the presence of its own blocking peptide, all the bands observed disappeared (data not shown), suggesting that the two bands could represent different isoforms of the same protein that are present specifically in rat endometrium. To investigate changes in the expression of PTGIS protein during initiation of decidualization, we quantified only the 56–57 kDa band for PTGIS because this was the band reported by the supplier and corresponds to the one previously reported in human fallopian tubes (Huang et al. 2002) and uterine myometrium (Giannoulias et al. 2002), and rat liver (Suhara et al. 2002). In our study, no significant changes (P>0.05) were detected for PTGIS protein levels at any time studied (Fig. 6).
Expression of PTGIS in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
Semiquantitative RT-PCR and western blot analyses were also conducted to study the expression of the PGI2 receptors in the rat endometrium. These receptors included PTGIR, PPARD, and RXRA. Ptgir mRNA levels were significantly higher (P<0.05) in the stimulated endometrium at all time points when compared with 0 h (Fig. 7). However, no significant differences were found in the transcript levels between stimulated and non-stimulated at 8 and 32 h. The expression of Ptgir mRNA is very low in the rat endometrium compared with the other genes studied. Moreover, we were unable to detect a quantifiable band in endometrium by western blot analysis under conditions that demonstrated the presence of PTGIR protein in other rat tissues including heart, lung, kidney, and spleen (data not shown).
Expression of Ptgir in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
There were no statistical differences (P>0.05) for Ppard or Rxra mRNA levels at any time following stimulation or in transcript levels when comparing stimulated and non-stimulated endometrium at 8 and 32 h (Figs 8 and 9 respectively). No significant changes were detected for PPARD protein at any time studied (Fig. 8), although there was a trend (0.05<P<0.1) for PPARD protein expression levels to increase with time. When western blot analyses were conducted using antibodies against RXRA protein, we detected three immunoreactive bands: one at ∼ 80–85 kDa, one at 54 kDa and one at ∼ 40–45 kDa (Fig. 9). There are at least two major physiological forms of the RXRA protein in human and mouse livers; a full-length form with a molecular weight of 54 kDa and a truncated form that lacks a portion of the amino-terminal A/B domain with a molecular weight of 44 kDa (Matsushima-Nishiwaki et al. 1996). In normal human prostatic epithelial cell lines and prostatic adenocarcinoma cells, there are three forms of the proteins; the full-length form with a molecular weight of 54 kDa and two truncated forms of 47 and 44 kDa (Zhong et al. 2003). In addition, in rat testis, three RXRA isoforms were detected in germ cells, whereas only one major isoform was observed in extracts from Sertoli cells and testes (Dufour & Kim 1999). During our study, the three bands observed for RXRA disappeared when the primary antibody was incubated in the presence of its own blocking peptide (data not shown) suggesting that the bands could represent different isoforms from the same protein that are present specifically in rat endometrium. To investigate changes in the expression of RXRA protein during initiation of decidualization, we quantified only the 54 kDa band for RXRA for several reasons; this is the band reported by the supplier; it is the only isoform found it in the human placenta (Tarrade et al. 2001); according to the literature, it is the only full-length form; and is the most abundant form of the protein that is present in most tissues and cell lines studied (Matsushima-Nishiwaki et al. 1996, Dufour & Kim 1999, Zhong et al. 2003). RXRA protein levels significantly increased (P<0.05) at 16 h and remained high at 32 h as compared with 0 and 2 h (Fig. 9). Moreover, PPARD and RXRA protein levels significantly increased (P<0.05) at 32 h in stimulated as compared with non-stimulated endometrium, suggesting that the increase was due to the stimulus and not to the time (Figs 8 and 9 respectively).
Expression of PPARD in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
Expression of RXRA in rat uterine endometrium following a deciduogenic stimulus. Samples from animals at 2, 4, 8, 16, 32 h following stimulation with sesame oil or non-stimulated (NS) at 0, 8 and 32 h are shown. A photograph of a representative gel (A) or blot (C) for one set of endometrium is shown. Histograms represent the mean optical density ratios ±s.e.m. of cDNAs of interest normalized to Gapdh cDNA (B) or proteins of interest normalized to ACTB protein (D) from four independent isolations.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
Protein localization of PTGS1, PTGS2, PTGES, PTGES2, PTGES3, PTGIS, PTGIR, PPARD, and RXRA in the rat endometrium
To localize the enzymes involved in PGE2 and PGI2 synthesis, immunohistochemistry was conducted on sections of rat uteri at different times after a deciduogenic stimulus. Results of the immunolocalization are shown in Fig. 10. PTGS1 was localized in the nucleus as well as in the cytoplasm of the luminal epithelial cells, glandular epithelial cells, and with less intensity, in the stromal cells at all times studied. The intensity of the signal appeared to be similar at all times.
Localization of PTGS1, PTGS2, PTGES, PTGES2, PTGES3, PTGIS, PPARD and RXRA proteins in rat uteri following a deciduogenic stimulus. Uterine sections from animals stimulated with sesame oil at times where maximal signal was detected (PTGS1, 2 h; PTGS2, 16 h; PTGES, 32 h; PTGES2, 4 h; PTGES3, 2 h; PTGIS, 4 h; PPARD, 32 h; and RXRA, 32 h) are shown. Uterine sections from non-stimulated animals (NS) at 0 and 32 h are also shown. Immunohistochemistry was performed as described in Materials and Methods. Positive staining is shown in brown. In each slide, bar: 100 micrometer. Negative controls included substitution of primary antibodies with the same concentration of normal rabbit IgG.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
At all times studied, PTGS2 was localized only to the cytoplasm of the stromal cells. There were low levels of PTGS2 staining at 0, 2, 4, and 8 h confined to the antimesometrial stromal cells. After 8 h, the signal started to spread throughout the stroma and was localized to the mesometrial as well as the antimesometrial stromal cells. At 32 h, all stromal cells in the section stained positive for PTGS2. In concordance with the results obtained in the western blot analysis, there was increased intensity in staining and more PTGS2 positive stromal cells at 32 h in stimulated endometrium than at the same time in non-stimulated endometrium.
PTGES was localized to the nucleus and to the cytoplasm of the glandular epithelium, luminal epithelium and in the stroma at all times studied. The intensity of the signal appeared to be similar at all times. PTGES2 and PTGES3 were localized to the nucleus as well as in the cytoplasm of the stromal cells, glandular and luminal epithelium at all times studied. The staining for both proteins was very intense in the luminal epithelium and glands at 0, 2, 4, and 8 h and appeared to decrease at 16 and 32 h.
PTGIS was localized mainly to the nucleus and cytoplasm of the glandular epithelium and the staining did not change over time.
PPARD staining was extremely weak; however, it was possible to identify some staining mainly in the cytoplasm of glandular and luminal epithelium and the signal did not change at any time.
Finally, we studied the localization of RXRA in the rat endometrium. RXRA was localized mainly to the cytoplasm of the glands, luminal epithelium, and with less intensity in the stroma at all time points studied. The staining appeared intense at 8 and 16 h and decreased at 32 h.
Effects of cPGI2 and PGE2 infusion
All data were analyzed as a 2-factor mixed model ANOVA. Factor 1 was a between-animal comparison, and was the effect of the type of compound infused. Factor 2 was a within-subject comparison, being the effect of infusion (i.e. infused horn versus non-infused horn). For uterine Evans blue concentrations, ANOVA indicated a highly significant interaction (Fig. 11A, P<0.001) between the effects of infusion and compound infused. Uterine dye concentrations did not differ (Fig. 11A, P>0.05) in non-infused horns, whereas infusion of PGE2 resulted in markedly increased (Fig. 11A, P<0.001) dye concentrations above those of horns infused with vehicle or cPGI2. The infusion of cPGI2 resulted in uterine Evans blue concentrations not different from those of the vehicle.
Effects of PGE2 and cPGI2 on the EVP response (A), measured by uterine concentrations of Evans blue dye (mean±s.e.m., n=6 to 7) and DCR (B), assessed by uterine weight (mean±s.e.m., n=6 to 7). Geometric means for infused (grey bars) and non-infused horns (white bars) are shown for the DCR experiment (B). PGE2 infusion markedly increased (A, P<0.001) uterine Evans blue concentrations, while cPGI2 infused horns were not different from the vehicle. For the DCR, both cPGI2 and PGE2 infused horns were significantly (B, P<0.05) heavier than the vehicle infused horns. In addition, PGE2 horns were heavier (B, P<0.05) than cPGI2 infused horns. For both experiments, non-infused horns were not significantly (P>0.05) different between groups.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
For uterine mass, statistical analyses of logarithmically transformed data revealed that there was a highly significant interaction (Fig. 11B, P<0.001) between effects of infusion and of compound. In all groups, the infused horns were significantly heavier (Fig. 11B, P<0.05) than non-infused horns. The infused horns of both the PGE2 (geometric mean of 867 mg) and cPGI2 (geometric mean of 551 mg) groups differed significantly (Fig. 1B, P<0.05) from the vehicle control (geometric mean of 325 mg). In addition, PGE2 infused horns were significantly heavier (Fig. 11B, P<0.05) than the cPGI2 infused horns. The non-infused horns of each group were not significantly different (Fig. 11B, P>0.05).
Effects of cicaprost, AFP-07, and PGE2 infusion
For uterine Evans blue concentrations, statistical analyses showed a highly significant interaction (Fig. 12A, P<0.001) between the effects of infusion and of compound. Evans blue concentrations in PGE2 infused horns were significantly greater (Fig. 12A, P<0.05) than those of the cicaprost and AFP-07 infused horns. In addition, concentrations of Evans blue in the AFP-07 infused horns were significantly higher (Fig. 12A, P<0.05) than cicaprost infused horns. These results imply that PGE2 elicited the largest increase in vascular permeability, followed by AFP-07, then cicaprost. For non-infused horns, Evans blue concentrations were significantly (Fig. 12A, P<0.05) higher in the AFP-07 group with no differences observed between the other groups, suggesting systemic effects of AFP-07.
Effects of PGE2, cicaprost and AFP-07 on the EVP response (A), measured by uterine concentrations of Evans blue dye (mean±s.e.m., n=7) and DCR (B), assessed by uterine weight (mean±s.e.m., n=7). Geometric means for infused (grey bars) and non-infused horns (white bars) are shown for the DCR experiment (B). Infused horns of PGE2, cicaprost, and AFP-07 resulted in significantly (A, P<0.05) higher Evans blue concentrations than vehicle infused horns. In addition, Evans blue concentration in PGE2 infused horns were significantly greater (A, P<0.05) than both cicaprost and AFP-07 infused horns; dye concentrations were higher (A, P<0.05) in AFP-07 than cicaprost infused horns. Only AFP-07 non-infused horns showed an increase in Evans blue concentrations, suggesting systemic effects of this compound. For the DCR, infused horns of all groups were significantly heavier (B, P<0.05) than their respective non-infused horns. PGE2 infused horns were significantly heavier (B, P<0.05) than vehicle and cicaprost, but not different (B, P<0.05) from AFP-07, infused horns. Cicaprost infusion produced uterine horns that were similar to the vehicle and AFP-07 infused horns. No statistical differences were observed in non-infused horns between groups.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
For the DCR, ANOVA of the logarithmically transformed data revealed a highly significant interaction (Fig. 12B, P<0.001) between infusion and effect of compound. For all groups, the masses of infused uterine horns were significantly (Fig. 12B, P<0.05) greater than their respective non-infused horns. For infused uterine horns, those infused with PGE2 were the heaviest (geometric mean of 1010 mg) but not significantly (Fig. 12B, P>0.05) different that those infused with AFP-07 (geometric mean of 650 mg); both compounds resulted in uterine horns significantly (Fig. 12B, P<0.05) heavier than the vehicle infused horns (geometric mean of 310 mg). Cicaprost infused horns (geometric mean of 471 mg) were not significantly (Fig. 12B, P>0.05) different in mass from either vehicle infused or AFP-07 infused horns, but were significantly (Fig. 12B, P<0.05) lighter than PGE2 infused horns. There were no statistical differences (Fig. 12B, P>0.05) between treatment groups when comparing uterine masses of the non-infused horns.
Effects of L165041, DHA, and PGE2 infusion
For uterine Evans blue concentrations, there was a highly significant interaction (Fig. 13A, P<0.001) between the effects of infusion and compound. A significant increase (Fig. 13A, P<0.05) in uterine Evans blue concentration was observed only in the PGE2 infused horns. Evans blue concentrations in the infused horns of L165041, DHA, and combination groups were not different from those of the vehicle infused horns (Fig. 13A, P>0.05) or to their respective non-infused horns (Fig. 13A, P>0.05). No significant changes were observed between non-infused horns.
Effects of PGE2, L165041, DHA, and combination of L165041 and DHA on the EVP response (A), measured by uterine concentrations of Evans blue dye (mean±s.e.m., n=6 to 7) and DCR (B), assessed by uterine weight (mean±s.e.m., n=5). Geometric means for infused (grey bars) and non-infused horns (white bars) are shown for the DCR experiment (B). Only PGE2 infusion caused a significant increase (A, P<0.05) in uterine Evans blue concentrations with no other differences observed between groups. For DCR, PGE2 infusion caused a marked increase in uterine mass. Although, there were effects from the infusion of L165041 alone or DHA alone, these responses were marginal in comparison to PGE2 infusion.
Citation: REPRODUCTION 137, 3; 10.1530/REP-08-0294
For the DCR, ANOVA of logarithmically transformed data revealed a highly significant interaction (Fig. 13B, P<0.001) between the effects of infusion and of compound. All groups, with the exception of the combination treatment, showed differences (Fig. 13B, P<0.05) in mass between infused and non-infused horns. A marked increase in uterine mass was observed in the PGE2 infused horns (geometric mean of 1324 mg) when compared with the vehicle infused horn (geometric mean of 235 mg) (Fig. 13B, P<0.05). Statistical analyses also revealed a significant interaction (Fig. 13B, P<0.005) between the effects of L165041 and DHA. This effect was apparent as the independent infusions of L165041 (geometric mean of 359 mg) or DHA (geometric mean of 166 mg) resulted in a significant (Fig. 13B, P<0.05) increase or decrease, respectively, in uterine mass, while the infused horns of the combination treatment (geometric mean of 209 mg) did not differ from the control (Fig. 13B, P>0.05). The masses of non-infused horns in all groups except the combination group, were significantly different (Fig. 13B, P<0.05) from the non-infused horns of the vehicle group.
Discussion
In rats, an increase in EVP is first detectable about 4 h after a deciduogenic stimulus is given, whereas differentiation of stromal cells to decidual cells starts after about 20 h (Psychoyos 1973). During pregnancy, these two processes are sequential steps that vary in time depending upon the species. In rats, the increase in EVP occurs late in the afternoon of day 5, whereas in hamsters and mice, it occurs in the afternoon and the evening of day 4 respectively. Previous studies in mice and hamsters have suggested a role of PTGS2, but not of PTGS1, in implantation (Chakraborty et al. 1996, Lim et al. 1999, Wang et al. 2004, Pakrasi & Jain 2008) and also in decidualization and placentation in mice (Lim et al. 1997, Wang et al. 2007, Pakrasi & Jain 2008). The presence of Ptgs1 transcripts in the rat endometrium prior to implantation is in agreement with the hamster study (Wang et al. 2004), where it was detected as early as days 1 and 3, before the initiation of implantation occurs. However, down-regulation of Ptgs1 mRNA at 4 h after the deciduogenic stimulus in the rat endometrium appears to be different from the results reported in mice. In mice, no changes in Ptgs1 transcripts were detected at any time after a deciduogenic stimulus (Lim et al. 1997), and down-regulation of Ptgs1 transcripts was only detected in pregnant animals at the time of blastocyst attachment (Chakraborty et al. 1996). At this time, our study is the only one available reporting the expression of PTGS1 protein, a better indication of function than transcript levels, during early stages of the initiation of decidualization. The levels of PTGS1 protein did not change at any time after the deciduogenic stimulus, indicating that is not regulated during the increase in EVP or the initiation of decidualization in rat endometrium. A recent report conducted in pregnant rats indicated that PTGS1 protein is localized in the luminal epithelium at the implantation sites on day 4 and day 5, prior to implantation (Cong et al. 2006). On day 6 of pregnancy, after the increase in EVP and initiation of decidualization have already occurred, PTGS1 protein was localized to the luminal epithelium and at a basal level in the subluminal stroma (Cong et al. 2006). In our study, PTGS1 protein was localized to the luminal epithelial cells, glandular epithelial and the stromal cells before, during and after the increase in EVP and the initiation of decidualization, suggesting that it could have a role in both of these events in the rat endometrium.
In agreement with studies in mice (Lim et al. 1997, 1999), our study indicates that in the rat endometrium Ptgs2 transcripts were significantly higher at 2 and 4 h followed by a decrease at 8 h after the deciduogenic stimulus was given. Because increased levels of PTGS2 protein were not detected until 8 h after stimulation, it seems that in the rat endometrium increased expression of PTGS2 is not required for the increase in EVP, as previously suggested in mice, but may be required for subsequent decidual transformation. In hamsters, endometrial PTGS2 protein was detected at day 1 and the morning of day 4 of pregnancy, prior to when implantation occurs (Wang et al. 2004). In mice, PTGS2 protein is present in pregnant mice on day 5, after EVP and initiation of decidualization have occurred (Lim et al. 1997). Our immunolocalization studies indicated that before and during the increase in EVP, PTGS2 protein is specifically localized in the stromal cells at the antimesometrial area where embryo attachment occurs during implantation and where decidual transformation is first seen. At the time when differentiation of stromal cells to decidual cells starts, the signal for PTGS2 spreads throughout the endometrial stroma and is also localized in the stromal cells of the mesometrial area. No signal of PTGS2 was detected in the luminal epithelium at any time. These results agree with those reported by Cong et al. (2006) where in pregnant rats, PTGS2 protein was localized in the stromal cells on the morning of day 5, before the initiation of implantation, and continued to be expressed in the stroma at both implantation sites and inter-implantation sites through to day 6, after initiation of implantation had occurred.
There appear to be species differences in localization of PTGS2 in the endometrium in the implantation period. While our results in rat showed that PTGS2 protein is localized in stromal cells before and after the initiation of decidualization, in hamsters, PTGS2 protein is localized to the luminal epithelial cells on the morning of day 4, prior to implantation. On the afternoon of day 4 and the morning of day 5, after implantation has been initiated in hamsters, PTGS2 is detected in epithelial and in several layers of stromal cells adjacent to the blastocysts (Wang et al. 2004). The results in rats also differ from those in mice, where PTGS2 was localized to the luminal epithelium, underlying stroma and in glandular epithelium 24 h after a deciduogenic stimulus was given (at the time when decidualization would have started) and then dramatically decrease at 48 and 120 h (Pakrasi & Jain 2008). In our study, as well as in those of Wang et al. (2004) and Cong et al. (2006), there was a gradual increase in the number of PTGS2 positive stromal cells as shown by immunostaining. These results agree also with what is reported in pregnant mice, where PTGS2 protein gradually localizes in stromal cells and the primary decidual zone surrounding the implanting embryos after implantation has been initiated (Lim et al. 1997).
The constitutive expression and localization of PTGS1 in the luminal epithelium at all times as well as the gradual increase in positive stromal cells for PTGS2 and the up-regulation of the expression detected by western blot analysis at later times suggest that PTGS1 and PTGS2 have distinct roles in the initiation of implantation/decidualization in the rat endometrium. For example, PTGS1 may be involved in producing PGs that increase EVP, whereas PGs produced by up-regulation of PTGS2 may be involved in the proliferation and differentiation of stromal cells to decidual cells during the initiation of decidualization.
Here, we also determined the expression of all the different PGE synthases (PTGESs) including PTGES, PTGES2, and PTGES3. We detected a significant increase in the expression of PTGES2 protein at 2 and 4 h and high levels of PTGES3 protein at 0 and 2 h. These results suggest a role for these two enzymes in the increase of PGE2 levels to initiate the increase in EVP.
There is some evidence to suggest that PTGS1 and PTGS2 may be coupled to a particular PTGES. In previous in vitro studies of early stages of the inflammatory process and PGE2 production, PTGES3 was found to be coupled to PTGS1 (Tanioka et al. 2000), whereas in delayed inflammatory responses, PTGES was the only enzyme associated with PTGS2 (Murakami et al. 2000). Moreover, a recent study in rat endometrium during the peri-implantation period suggested that because there is a co-localization of PTGS2 and PTGES in the subluminal stromal cells and also a co-localization of PTGS1, PTGES3, and PTGES2 in the luminal epithelium surrounding the implantating blastocyst, PGE2 could be produced through PTGS2/PTGES, PTGS1/PTGES3, and/or PTGS1/PTGES2 pathways (Cong et al. 2006). However, it is still unclear which specific PTGS is interacting with which PTGES in the rat endometrium to increase PGE2 production during the initiation of the decidualization. Our immunohistochemistry study shows that both PTGES and PTGS2 are present in stromal cells and were highly expressed during later times after the deciduogenic stimulus was given, suggesting that in the rat endometrium PGE2 could be produced through the PTGS2/PTGES pathway at the later stages of the initiation of decidualization to regulate proliferation and differentiation of stromal cells. Because PTGES3 and PTGES2 protein levels increase only at early times and these enzymes appear to co-localize with PTGS1 in luminal epithelium and glandular cells at those times, we suggest that the PTGS1/PTGES3 or PTGS1/PTGES2 pathway could be involved in producing PGE2 at early stages to regulate EVP.
It has been previously suggested that PGI2 is generated via the PTGS2/PTGIS pathway during implantation in the mouse endometrium (Lim et al. 1999). In mice, PTGIS protein was co-localized with PTGS2 in stromal cells surrounding the implantating embryo (Lim et al. 1999). In our study, no significant changes were found in the expression of PTGIS transcripts and protein at any time after the deciduogenic stimulus. Moreover, no co-localization of PTGIS with PTGS2 in the stromal cells was found, suggesting that the PTGS2/PTGIS pathway is unlikely to be involved in EVP or initiation of decidualization in the rat endometrium.
Based on the studies in Ptgs2 null mice, it has been recently suggested that PGI2 acts as an endogenous ligand of PPARD, which then heterodimerizes with RXRA to activate decidualization (Lim et al. 1999). There were no significant changes in the levels of PPARD transcripts or proteins at any time after the deciduogenic stimulus in the rat endometrium. These results are supported by those obtained with Ppard knockout mice, where it was shown that the animals have successful, although delayed implantation and defects were only in placental development and parturition (Wang et al. 2007). In our study, we did find a significant increase for RXRA protein and a trend for increased PPARD protein at 16 and 32 h after the deciduogenic stimulus. Our results are in agreement with Pakrasi & Jain (2008) where in mice PPARD protein expression is significantly higher 24 h after deciduogenic stimulus was given. However, it is important to highlight that by that time, the increase in EVP and the first differentiation of decidual cells would have occurred, suggesting that these PPARD and RXRA receptors, if they have a role in rodents, may only be in the later stages of decidualization.
The intrauterine infusion of PGE2 induced decidualization as indicated by an increase in EVP and uterine mass. By contrast, PTGIR, PPARD, and RXRA agonists produced varying results. These results together with the expression data suggest that these three receptors do not play an important role in the early stages of decidualization. Cicaprost and AFP-07, compounds that are highly selective for PTGIR (Chang et al. 1997, Jones et al. 1997), elicited an EVP response, although not to the same extent as PGE2; cPGI2, which binds to both PTGIR and PPARD (Kiriyama et al. 1997), did not. cPGI2 and AFP-07 induced decidualization while cicaprost infusion produced uterine weights that were similar to the vehicle. In addition, L165041 and DHA infused separately or together were unable to evoke increased EVP or appreciably induce decidualization. Although there were some effects of these synthetic ligands, they did not produce the same magnitude of response in EVP and DCR when compared with PGE2. These findings are not consistent with studies by Lim et al. (1997, 1999) where cPGI2 was able to partially restore decidualization in Ptgs2 null mice. It is possible that the main PG mediating implantation is species specific (reviewed by Kennedy et al. 2007). In addition, Lim et al. (1997) injected PGs into the uterine lumen. However, sustained and elevated uterine levels of PGs may be necessary to produce a maximal response in decidualization (reviewed Kennedy et al. 2007). It was also shown that AFP-07 elicited a greater increased EVP response than cicaprost. Furthermore, cicaprost and AFP-07 evoked an EVP response and significantly increased uterine mass when compared with the control while L165041 did not. This suggests that PTGIR may play a greater role in decidualization than PPARD that is surprising for several reasons: 1) rat Ptgir transcripts levels were low as compared with the other genes studied, 2) rat PTGIR protein levels were not detectable, and 3) Ptgir null mice showed normal implantation (Murata et al. 1997).
Previous studies used 9-cis retinoic acid (9cRA) to activate RXRA (Lim et al. 1999) but 9cRA can pan-activate other retinoid-X-receptor subtypes (i.e. RXRB, RXRG) (Allenby et al. 1993). Since RXRB was detected in the peri-implantation mouse uterus (Lim et al. 1999), an RXRB and PPARD heterodimer could be involved in implantation associated events. To focus on the RXRA and PPARD heterodimer more precisely, we used DHA, which is more specific for RXRA than 9cRA (Lengqvist et al. 2004) and also suggested to bind only to the RXRA subtype (reviewed by Germain et al. 2006). Neither the increase in EVP nor the DCR was observed when DHA was infused alone, indicating that RXRA may not be essential for these processes. Furthermore, a synergistic increase in EVP or uterine mass was not observed when infusing both PPARD and RXRA agonists concurrently, which is not consistent with in vitro synergistic responses reported in previous investigations (Lim et al. 1999). Studies have shown that activating PPARD initiates cell proliferation in keratinocytes (Romanowska et al. 2008) while RXRA activation induces a caspase-dependent apoptotic pathway (Lee et al. 2005). This may explain the absence of a synergistic response when L165041 and DHA were infused together as countervailing mechanisms may have been activated. It is also possible that an RXR homodimer (Germain et al. 2006) pathway was activated which induced signaling events independent of the PPARD/RXRA system. It cannot be ruled out that the simultaneous presence of L165041 and DHA interferes with the ability of these ligands to bind to their targets. Interestingly, non-infused horns of L165041 and DHA groups showed a significant, but marginal increase and decrease respectively, in uterine mass, when compared with the vehicle group suggesting systemic effects of these compounds.
In conclusion, the present study reports the expression of the enzymes involved in the PGE2 and PGI2 biosynthetic pathways at the levels of mRNA and proteins at different stages during the initiation of decidualization in rat endometrium. Up-regulation of PTGES2 and PTGES3 proteins and co-localization with PTGS1 protein in luminal epithelium and glands was observed at the time when EVP is increased and decidualization is initiated, suggesting that this is the most likely pathway by which PGE2 production is increased in response to a deciduogenic stimulus. Since PTGS2 protein is present at 0 h, it could contribute to PGE2 production early in the response to a deciduogenic stimulus. Differential cellular sites of PG production by PTGS1 and PTGS2 and PTGESs may account for distinct roles of these isoforms in various cellular functions and in differences between species. Since stable agonists of PTGIR were unable to elicit either an increase in EVP or decidualization to the same extent as PGE2 and because we were unable to detect the protein in the rat endometrium, it seems unlikely that PTGIR is the main pathway mediating implantation and decidualization. Furthermore, the selective agonists for PPARD and RXRA were also unable to elicit an increase in EVP or appreciably induce decidualization. In addition, stable analogues of PGI2 that are agonists for PPARD were less effective than PGE2. This strongly suggests that PGI2 acting on the previously proposed PPARD/RXRA system may not be the molecular focal point in the processes of decidualization and implantation in the rat. Furthermore, it should be noted that PGI2 itself has never been shown to be a ligand for PPARD, only that some stable analogues of PGI2 are ligands. Ppard and Rxra may ultimately mediate a different aspect of pregnancy such as placental development, as indicated in Ppard and Rxra deficient mice studies (Sapin et al. 1997, Barak et al. 2002, Wang et al. 2007). Overall, the data suggest that PGE2 is the primary PG involved in decidualization in the rat.
Materials and Methods
Reagents
Unless otherwise indicated, all general chemicals including progesterone, oestradiol and sesame oil were purchased from Sigma. First-strand cDNA synthesis kit and all reagents for western blot analyses were purchased from GE Healthcare Bio-Sciences Inc. (Baie d'Urfé, QC, Canada). DNase I and Platinum Taq DNA polymerase were purchased from Invitrogen. Secondary antibodies were purchased from Sigma. Primary antibodies, unless otherwise specified, were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). Normal rabbit IgG and anti-PTGS1 primary antibodies were purchased from Upstate Biotechnology (Lake Placid, NY, USA). Anti-RXRA primary antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Anti-ACTB (β-actin) primary antibody was purchased from Chemicon International (Temecula, CA, USA). The same primary and secondary antibodies were used for the western blot and immunohistochemistry studies.
Animal and tissue preparation
Female Sprague–Dawley rats (200–225 g body mass; Charles River, St Constant, QC, Canada) were housed in temperature- and light-controlled conditions (lights on from 05:00 to 19:00 h) with free access to food and water. Animals were ovariectomized under isoflurane anesthesia (Abbot Laboratories, Saint-Laurent, QC, Canada) and allowed at least 5 days to recover. Ovariectomized rats were treated with oestradiol and progesterone s.c. to mimic pseudopregnancy as previously described (Kennedy & Ross 1997). To induce decidualization, animals received a bilateral injection of 0.1 ml sesame oil into the uterine lumen around noon on the equivalent of day 5 of pseudopregnancy and were referred to as stimulated as opposed to non-stimulated (NS). Rats were killed by decapitation at 2, 4, 8, 16, 32 h after the deciduogenic stimulus was given or at 0, 8, and 32 h for the non-stimulated animals (NS). The non-stimulated animals killed at the latter two time points were included in order to determine if any changes observed in the endometrium of stimulated animals were a consequence of the deciduogenic stimulus or of the progression of pseudopregnancy. Endometrium was separated from myometrium and placed in GTC solution (4 M guanidinium thiocyanate, 0.5% sarkosyl, 25 mM sodium citrate, 0.1% v/v antifoam A, 5% β-mercaptoethanol) or RIPA buffer (50 mM Tris–HCl, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 100 μM Na3VO3, and COMPLETE, Mini, EDTA-free protease inhibitors cocktail (Roche Diagnostics)) for subsequent RNA and protein isolation respectively. Endometrium from three animals for each treatment group was pooled and four sets were used for each treatment. Portions of uteri were fixed in 4% paraformaldehyde prior to immunohistochemistry studies.
All procedures involving animals were performed in accordance with the guidelines of the Canadian Council on Animal Care and The University Council on Animal Care at the University of Western Ontario.
Semiquantitative RT-PCR
Semiquantitative RT-PCR (RT-PCR) was performed on Ptgs1, Ptgs2, Ptges, Ptges2, Ptges3, Ptgis, Ptgir, Ppard, and Rxra transcripts to detect differences in mRNA levels following the application of the deciduogenic stimulus. First-strand cDNA syntheses were performed on DNase-treated total RNA from rat endometrium by reverse transcription using a First-strand cDNA Synthesis Kit. Samples were then subjected to PCR in a Gene Amp PCR System 2400 (PerkinElmer, Woodbridge, ON, Canada) using Platinum Taq DNA polymerase. The oligonucleotide primers were designed using Primer 3 program (Whitehead Institute for Biomedical Research, Cambridge, MA, USA). Downstream and upstream primers, GenBank accession for cDNA sequence and amplification conditions for each gene studied are shown in Table 1. The cycle number for each gene studied was determined to be in the linear range for each primer set in preliminary experiments. A water control and no RT product were carried through all reactions. All PCR products were confirmed by sequencing. PCR samples were electrophoretically separated on 1.5% agarose gels. Bands were quantified by Image Master VDS software. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the internal control. Optical density units of the cDNA bands of all genes studied were normalized with the corresponding Gapdh cDNA. Downstream and upstream primers, GenBank accession for cDNA sequence and amplification conditions for these two internal controls are also shown in Table 1.
Primers, GenBank accession numbers, and amplification conditions for each gene studied and each internal control.
| Target genes | Primer sequence (5′→3′) | Sense | Position | GenBank accession no. | Amplification conditions | |
|---|---|---|---|---|---|---|
| Ptgs1 | TGCATGTGGCTGTGGATGTCATCAA | US | 1392–1416 | S67721 | 94 °C-45 s | |
| CACTAAGACAGACCCGTCATCTCCA | DS | 1816–1840 | 63 °C-1 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
| Ptgs2 | AACCCACCCCAAACACAG | US | 337–354 | NM_000963 | 94 °C-1 min | |
| CTGGCCCTCGCTTATGATCT | DS | 728–747 | 60 °C-1.5 min | 33 Cycles | ||
| 72 °C-1 min | ||||||
| Ptges | ATCAAGATGTACGCGGTGGCT | US | 115–135 | AF280967 | 94 °C-45 s | |
| CACTTCCCAGAGGATCTGTA | DS | 467–486 | 63 °C-1 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
| Ptges2 | GAAGGACCGAGATTAAATTC | US | 421–440 | XM_001078154 | 94 °C-45 s | |
| GCCTTCATGGGTGGGTAATA | DS | 575–594 | 57 °C-1 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
| Ptges3 | ACCATGCAGCCTGCTTCTGC | US | 328–347 | AY281130 | 94 °C-45 s | |
| CATGACTGGCCGGATTCTCC | DS | 568–587 | 63 °C-1 min | 33 Cycles | ||
| 72 °C-1 min | ||||||
| Ptgis | CTGGACCCACACTCTTAC | US | 241–258 | U53855 | 94 °C-1 min | |
| CACTCCATACAGGGTCAG | DS | 541–558 | 60 °C-1.5 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
| Ptgir | CTGGAGAAGACGGAAACAAA | US | 1–20 | D28966 | 94 °C-1 min | |
| TGTCACACAGCATCGTCCCA | DS | 430–449 | 60 °C-1.5 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
| Ppard | CGGGAAGAGGAGAAAGAGG | US | 282–300 | U75918 | 94 °C-45 s | |
| AGCGGATAGCGTTGTGG | DS | 662–678 | 58 °C-1 min | 33 Cycles | ||
| 72 °C-30 s | ||||||
| Rxra | GGACACCAAACATTTCCTGCC | US | 3–23 | AM392401 | 94 °C-45 s | |
| GATGTGCTTGGTGAAGGA | DS | 400–417 | 58 °C-1 min | 35 Cycles | ||
| 72 °C-30 s | ||||||
| Gapdh | ATGGGAAGCTGGTCATCAAC | US | 261–280 | NM_017008 | 95 °C-1 min | |
| GGATGCAGGGATGATGTTCT | DS | 681–700 | 58 °C-1.2 min | 35 Cycles | ||
| 72 °C-1 min | ||||||
US and DS indicate upstream and dowstream primers respectively. During the PCR protocol, initial denaturation was at 94 °C for 5 min and the final extension was at 72 °C for 30 min for all genes studied. The size of the predicted products were 449 bp for Ptgs1, 411 bp for Ptgs2, 372 bp for Ptges, 174 bp for Ptges2, 260 bp for Ptges3, 318 bp for Ptgis, 449 bp for Ptgir, 397 bp for Ppard, 415 bp for Rxra, and 440 bp for Gapdh cDNAs.
Western blot analyses
To determine changes in endometrial protein levels following endometrial stimulation, western blot analyses were conducted. Endometrial extracts were prepared by homogenizing tissue in seven volumes of ice-cold RIPA buffer using 10 strokes of a Potter–Elvehjem homogenizer. Extracts were incubated on ice for 30 min and then centrifuged at 15 700 g for 15 min at 4 °C to pellet cellular debris. Supernatants were retained and stored at −70 °C. Protein concentrations were determined using Bio-Rad dye reagent (BioRad Laboratories). Equivalent amounts of protein (40 or 80 μg) were separated in 12 or 15% SDS-PAGE gels and electrotransferred to 0.2 or 0.45 micrometer nitrocellulose membranes (GE Healthcare Bio-Sciences Inc). After blocking in 5% non-fat milk, Tris-buffered saline containing 1% Tween-20, membranes were incubated with rabbit polyclonal antibodies against PTGS1 (1 μg/ml; cat. no. 06-970; Millipore, Billerica, MA, USA), PTGS2 (4 μg/ml; cat. no. 160107; Cayman Chemical Company), PTGES (4 μg/ml; cat. no. 160140; Cayman Chemical Company), PTGES2 (4 μg/ml; cat. no. 160145; Cayman Chemical Company), PTGES3 (1.34 μg/ml; cat. no. 160150; Cayman Chemical Company), PTGIS (2.5 μg/ml; cat. no. 100023; Cayman Chemical Company), PPARD (8 μg/ml; cat. no. 101720; Cayman Chemical Company), or RXRA (2 μg/ml; cat. no. 55350; Santa Cruz Biotechnology) overnight at 4 °C. Secondary antibodies included HRP-goat anti-rabbit IgG (1:10 000; cat. no. A6154; Sigma) or HRP-rabbit anti-mouse IgG (1:10 000; cat. no. A9044; Sigma). Immunoreactive bands were detected by enhanced chemiluminescence (GE Healthcare Bio-Sciences Inc). As a negative control normal rabbit IgG (cat. no. 12-370; Millipore) was used instead of the primary antibody. To assess protein loading, membranes were incubated with mouse monoclonal ACTB (1:10000; cat. no. mab1501; Millipore) antibody. Protein products of all the genes studied were normalized using ACTB.
Immunohistochemistry
After fixation in 4% paraformaldehyde, the uterine horns were embedded in paraffin and ∼ 6 micrometer serial sections were prepared and placed on SuperfrostPlus microscope slides (VWR International Ltd., Mississauga, ON, Canada). Sections were deparaffinized in xylene, rehydrated through a series of ethanol washes and rinsed in water. Endogenous peroxidase activity was blocked by incubating sections in 0.3% H2O2 in methanol for 40 min at room temperature. Slides were blocked for 1 h in PBS supplemented with 10% normal goat serum. Localization of PTGS1, PTGS2, PTGES, PTGES2, PTGES3, PTGIS, PPARD, and RXRA proteins was performed by incubating sections of rat uteri with either rabbit polyclonal antibodies against PTGS1 (3.3 μg/ml), PTGS2 (6.7 μg/ml), PTGES (16 μg/ml), PTGES2 (5 μg/ml), PTGES3 (2 μg/ml), PTGIS (7.14 μg/ml), PPARD (20 μg/ml) or RXRA (5 μg/ml) overnight at 4 °C. Negative controls included substitution of the primary antibodies with the same concentration of normal rabbit IgG. Sections were incubated with 1:3000 HRP-conjugated goat anti-rabbit IgG in 10% goat serum for 1 h at room temperature. To visualize bound antibody, the 3,3′-diaminobenzidine tetrahydrochloride-plus kit (Zymed Laboratories Inc., San Francisco, CA, USA) was utilized according to the manufacturer's instructions. Sections were then briefly counterstained (10 s) with hematoxylin solution (Gill no. 3, Sigma), and examined using a Nikon microscope. Images were captured using a Nikon microscope, camera and ACT-1 software (Nikon Inc., Mississauga, ON, Canada). Final images were generated using Photoshop 5.5. For each gene studied, the immunohistochemical staining was repeated twice at each time point with sections obtained from four different rats.
Intrauterine infusions
On the equivalent of day 5 of pseudopregnancy, the day of maximal uterine sensitization for the DCR (Kennedy & Ross 1997) the rats were randomized to the appropriate number of treatment groups for that experiment to receive unilateral intrauterine infusions of PGE2 (Cayman Chemical Company) or various agonists. Because of differing solubility properties of the compounds, it was not possible to compare the effects of all of them in a single experiment. All compounds were infused at the rate of 1.42 nmol/h using Alzet osmotic mini-pumps, model 2001 (pumping rate 1 μl/h) (DURECT Corporation, Cupertino, CA, USA). cPGI2 was obtained from Cayman Chemical Company cicaprost was a generous gift of Dr Fiona McDonald, Schering AG, Berlin, Germany; AFP-07 was generously provided by Dr Yasushi Matsamura, (Asahi Glass Co., Ltd., Yokohama, Japan); L165041 was obtained from Calbiochem, San Diego, CA; and DHA (cis-4, 7, 10, 13, 16, 19-docosahexanoic acid) from Sigma-Aldrich. cPGI2, cicaprost, and AFP-07 were infused in 1.5% ethanol, 3 mg/ml β-cyclodextran (Schering), 10 mM Tris (Sigma-Aldrich), pH 8.3. L165041 and DHA were infused in 50% (v/v) dimethyl sulphoxide (Caledon Laboratories Ltd, Georgetown, ON, USA), 0.5 mM indomethacin (Sigma-Aldrich) in PBS, pH 7.4. PGE2 was infused in the same vehicle as the compounds to which it was being compared. Preparation of the pumps and the technique for inserting them have been described previously (Kennedy & Lukash 1982). In summary, one uterine horn of each animal was infused from the uterotubal end towards the cervical end. The contra-lateral non-infused horn served as a control that provided an opportunity to detect possible systemic effects of the infused compounds. Two to 3 h prior to pump insertion, the animals received 2 mg indomethacin in 0.4 ml 20% ethanol in sesame oil s.c. to inhibit PG synthesis in response to the unavoidable trauma of pump insertion. This combination of s.c. and intrauterine administration of indomethacin has been shown to reduce endogenous PG production during decidualization (Kennedy 1985).
Endometrial vascular permeability
Changes in EVP were assessed 10 h after pump insertion by using Evans blue (GURR, Searle Diagnostics, High Wycombe, England), a macromolecular dye which, in the circulation, binds avidly to albumin (Psychoyos 1971). Nine hours and 45 min after pump insertion, the rats were given Evans blue (60 mg/kg) via a lateral tail vein under isoflurane anesthesia. The animals were decapitated 15 min later and uterine Evans blue concentrations in infused and non-infused horns were determined by spectrophotometry as described by Udaka et al. (1970).
Decidualization
The extent of uterine decidualization was evaluated 5 days after the insertion of the pumps by separately weighing the infused and non-infused horns (Finn & Keen 1963, Yochim & De Feo 1963).
Statistical analyses
Expression of all the RT-PCR products was normalized to Gapdh and the expression of all the protein products to ACTB. Data from RT-PCR studies and western blot analyses were subjected to ANOVA to determine statistical significance of treatments. The effects of time after stimulation were determined by one-way ANOVA, and the effects of stimulation by two-way ANOVA. Differences were considered statistically significant when P<0.05. ANOVAs were also performed to determine statistical significance of treatment effects on EVP and decidualization, with the variance being partitioned on a between- and within-animal basis where appropriate. Where appropriate, data were logarithmically transformed prior to ANOVA to remove or substantially reduce heterogeneity of variance, as indicated by Bartlett's test (Snedecor 1956). In addition, Duncan's tests were performed for between-animal group comparisons, and paired t-tests for within-animal comparisons when significant interactions were observed. Practical Statistics Version 3.0 (Canadian Technology 1990) program was used for all the analyses.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This project was supported by CIHR grant MT-10414. This study was also funded by the Canadian Institute of Health Research (CIHR) Master's Trainee Award to Sen Han Phang.
Acknowledgements
We thank Elizabeth Ross for her valuable help with the surgery, hormone injections and tissue collections and Gerald Barbe for his technical assistance in the design of the primers for the RT-PCR technique. The authors also thank Elizabeth Ross for her valuable assistance in preparing the manuscript.
References
Allenby G, Bocquel MT, Saunders M, Kazmer S, Speck J, Rosenberger M, Lovey A, Kastner P, Grippo JF, Chambon P & Levin AA 1993 Retinoic acid receptors and retinoid X receptors: interactions with endogenous retinoic acids. PNAS 90 30–34.
Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM, Boland R & Evans RM 2002 Effects of peroxisome proliferator-activated receptor δ on placentation, adiposity, and colorectal cancer. PNAS 99 303–308.
Chakraborty I, Das SK, Wang J & Dey SK 1996 Developmental expression of the cyclo-oxygenase-1 and cyclo-oxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by the blastocyst and ovarian steroids. Journal of Molecular Endocrinology 16 107–112.
Chang CS, Negishi M, Nakano T, Morizawa Y, Matsumura Y & Ichikawa A 1997 7,7-Difluoroprostacyclin derivative, AFP-07, a highly selective and potent agonist for the prostacyclin receptor. Prostaglandins 53 83–90.
Cong J, Diao HL, Zhao YC, Ni H, Yan YQ & Yang ZM 2006 Differential expression and regulation of cylooxygenases, prostaglandin E synthases and prostacyclin synthase in rat uterus during the peri-implantation period. Reproduction 131 139–151.
Dufour JM & Kim KH 1999 Cellular and subcellular localization of six retinoid receptors in rat testis during postnatal development: identification of potential heterodimeric receptors. Biology of Reproduction 61 1300–1308.
Finn CA & Keen PM 1963 The induction of deciduomata in the rat. Journal of Embryology and Experimental Morphology 11 673–682.
Forman BM, Chen J & Evans RM 1997 Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors α and δ. PNAS 94 4312–4317.
Germain P, Chambon P, Eichele G, Evans RM, Lazar MA, Leid M, De Lera AR, Lotan R, Mangelsdorf DJ & Gronemeyer H 2006 International union of pharmacology, LXIII. retinoid X receptors. Pharmacological Reviews 58 760–772.
Giannoulias D, Alfaidy N, Holloway AC, Gibb W, Sun M, Lye SJ & Challis JRG 2002 Expression of prostaglandin I2 synthase, but not prostaglandin E synthase, changes in myometrium of women at term pregnancy. Journal of Clinical Endocrinology and Metabolism 87 5274–5282.
Helliwell RJ, Berry EBE, O'Caroll SJ & Mitchell MD 2004 Nuclear prostaglandin receptors: role in pregnancy and parturition? Prostaglandins, Leukotrienes and Essential Fatty Acids 70 149–165.
Huang JC, Arbab F, Tumbusch KJ, Goldsby JS, Matijevic-Aleksic N & Wu KK 2002 Human fallopian tubes express prostacyclin (PGI) synthase and cyclooxygenases and synthesize abundant PGI. Journal of Clinical Endocrinology and Metabolism 87 4361–4368.
Jones RL, Quian YM, Wise H, Wong HNC, Lam WL, Chan HW, Yim APC & Ho JKS 1997 Relaxant actions of nonprostanoid prostacyclin mimetics on human pulmonary artery. Journal of Cardiovascular Pharmacology 29 525–535.
Kennedy TG 1985 Evidence for the involvement of prostaglandins throughout the decidual cell reaction in the rat. Biology of Reproduction 33 140–146.
Kennedy TG & Lukash LA 1982 Induction of decidualization in rats by the intrauterine infusion of prostaglandins. Biology of Reproduction 27 253–260.
Kennedy TG & Ross HE 1997 Temporal- and hormone-dependent changes in uterine sensitization for the decidual cell reaction and decidualization in vitro of rat endometrial stromal cells. Journal of Reproduction and Fertility 109 129–136.
Kennedy TG, Gillio-Meina C & Phang SH 2007 Prostaglandins and the initiation of blastocyst implantation and decidualization. Reproduction 134 635–643.
Kiriyama M, Ushikubi F, Kobayashi T, Hirata M, Sugimoto Y & Narumiya S 1997 Ligand binding specificities of the eight types and subtypes of the mouse prostanoid receptors expressed in Chinese hamster ovary cells. British Journal of Pharmacology 112 217–224.
Lee KW, Ma L, Yan X, Liu B, Zhang XK & Cohen P 2005 Rapid apoptosis induction by IGFBP-3 involves an insulin-like growth factor-independent nucleomitochondrial translocation of RXRα/Nur77. Journal of Biological Chemistry 280 16942–16948.
Lengqvist J, de Urquiza AM, Bergman AC, Willson TM, Sjövall J, Perlman T & Griffiths WJ 2004 Polyunsaturated fatty acids including docosahexanoic and arachadonic acid bind to the retionoid x receptor α ligand-binding domain. Molecular and Cellular Proteomics 3 692–703.
Lim H & Dey SK 2002 A novel pathway of prostacyclin signaling-hanging out with nuclear receptors. Endocrinology 143 3207–3210.
Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM & Dey SK 1997 Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91 197–208.
Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, DuBois RN, Trzaskos JM & Dey SK 1999 Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARδ. Genes and Development 13 1561–1574.
Matsushima-Nishiwaki R, Shidoji Y, Nishiwaki S, Yamada T, Moriwaki H & Muto Y 1996 Aberrant metabolism of retinoid X receptor proteins in human hepatocellular carcinoma. Molecular and Cellular Endocrinology 121 179–190.
Murakami M, Naraba H, Tanioka T, Semmyo N, Nakatani Y, Kojima F, Ikeda T, Fueki M, Ueno A, Oh-ishi S & Kudo I 2000 Regulation of prostaglandin E2 biosynthesis by inducible membrane-associated prostaglandin E2 synthase that acts in concert with cyclooxygenase-2. Journal of Biological Chemistry 275 32783–32792.
Murata T, Ushikubi F, Matsuoka T, Hirata M, Yamasaki A, Sugimoto Y, Ichikawa A, Aze Y, Tanaka T & Yoshida N et al. 1997 Altered pain perception and inflammatory response in mice lacking prostacyclin receptor. Nature 388 678–682.
Pakrasi PL & Jain AK 2008 Cyclooxygenase-2 derived PGE2 and PGI2 play an important role via EP2 and PPARδ receptors in early steps of oil induced decidualization in mice. Placenta 29 523–530.
Papay KD & Kennedy TG 2000 Characterization of temporal and cell-specific changes in transcripts for prostaglandin E2 receptors in pseudopregnant rat endometrium. Biology of Reproduction 62 1515–1525.
Psychoyos A 1971 Methods for studying changes in capillary permeability of the rat endometrium Daniel JC JrIn Methods in Mammalian Embryology San Francisco:W. H. Freeman and Company:334–338.
Psychoyos A Greep RO, Astwood EB, Geiger SRIn Endocrine Control of Egg Implantation Handbook of Physiology vol II 1973 Bethesda:American Physiological Society:187–215 (Section 7, part 2).
Romanowska M, al Yacoub N, Seidel H, Donandt S, Gerken H, Phillip S, Haritonova N, Artuc M, Schweiger S & Sterry W et al. 2008 PPARδ enhances keratinocyte proliferation in psoriasis and induces heparin-binding EGF-like growth factor. Journal of Investigative Dermatology 128 110–124.
Sapin V, Dollé P, Hindelang C, Kastner P & Chambon P 1997 Defects of the chorioallontoic placenta in mouse RXRα null fetuses. Developmental Biology 191 29–41.
Seimandi M, Lemaire G, Pillon A, Perrin A, Carlavan I, Voegel JJ, Vignon F, Nicolas JC & Balaguer P 2005 Differential responses of PPARα, PPARδ, and PPARγ reporter cell lines to selective PPAR synthetic ligands. Analytical Biochemistry 344 8–15.
Snedecor GWIn Statistical Methods 5th edn. 1956 Ames, Iowa:The Iowa State University Press:.
Suhara H, Sawa Y, Fukushima N, Kagisaki K, Yokoyama C, Tanabe T, Ohtake S & Matsuda H 2002 Gene transfer of human prostacyclin synthase into the liver is effective for the treatment of pulmonary hypertension in rats. Journal of Thoracic and Cardiovascular Surgery 123 855–861.
Tanioka T, Nakatani Y, Semmyo N, Murakami M & Kudo I 2000 Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis. Journal of Biological Chemistry 275 32775–32782.
Tarrade A, Schoonjans K, Pavan L, Auwerx J, Rochette-Egly C, Evain-Brion D & Fournier T 2001 PPARγ/RXRα heterodimers control human trophoblast invasion. Journal of Clinical Endocrinology and Metabolism 86 5017–5024.
Udaka K, Takeuchi Y & Movat HZ 1970 Simple method for quantitation of enhanced vascular permeability. Proceedings of the Society for Experimental Biology and Medicine 133 1384–1387.
Wang H & Dey SK 2005 Lipid signaling in embryo implantation. Prostaglandins & Other Lipid Mediators 77 84–102.
Wang X, Su Y, Deb K, Raposo M, Morrow JD, Reese J & Paria BC 2004 Prostaglandin E2 is a product of induced prostaglandin-endoperoxide synthase 2 and microsomal-type prostaglandin E synthase at the implantation site of the hamster. Journal of Biological Chemistry 279 30579–30587.
Wang H, Xie H, Sun X, Tranguch S, Zhang H, Jia X, Wang D, Das SK, Desvergne B & Wahli W et al. 2007 Stage-specific integration of maternal and embryonic peroxisome proliferator-activated receptor δ signaling is critical to pregnancy success. Journal of Biological Chemistry 282 37770–37782.
Yochim JM & De Feo VJ 1963 Hormonal control of the onset, magnitude and duration of uterine sensitivity in the rat by steroid hormones of the ovary. Endocrinology 72 317–326.
Zhong C, Yang S, Huang J, Cohen MB & Roy-Burman P 2003 Aberration in the expression of the retinoid receptor, RXRα, in prostate cancer. Cancer Biology & Therapy 2 179–184.
