Retrotransposon expression as a defining event of genome reprograming in fertilized and cloned bovine embryos

in Reproduction
View More View Less
  • 1 INRA, The Jackson Laboratory, UMR 7138 Systématique, UMR 1198 Biologie du Développement et Reproduction, F-78352 Jouy en Josas, France

Genome reprograming is the ability of a nucleus to modify its epigenetic characteristics and gene expression pattern when placed in a new environment. Low efficiency of mammalian cloning is attributed to the incomplete and aberrant nature of genome reprograming after somatic cell nuclear transfer (SCNT) in oocytes. To date, the aspects of genome reprograming critical for full-term development after SCNT remain poorly understood. To identify the key elements of this process, changes in gene expression during maternal-to-embryonic transition in normal bovine embryos and changes in gene expression between donor cells and SCNT embryos were compared using a new cDNA array dedicated to embryonic genome transcriptional activation in the bovine. Three groups of transcripts were mostly affected during somatic reprograming: endogenous terminal repeat (LTR) retrotransposons and mitochondrial transcripts were up-regulated, while genes encoding ribosomal proteins were downregulated. These unexpected data demonstrate specific categories of transcripts most sensitive to somatic reprograming and likely affecting viability of SCNT embryos. Importantly, massive transcriptional activation of LTR retrotransposons resulted in similar levels of their transcripts in SCNT and fertilized embryos. Taken together, these results open a new avenue in the quest to understand nuclear reprograming driven by oocyte cytoplasm.

Abstract

Genome reprograming is the ability of a nucleus to modify its epigenetic characteristics and gene expression pattern when placed in a new environment. Low efficiency of mammalian cloning is attributed to the incomplete and aberrant nature of genome reprograming after somatic cell nuclear transfer (SCNT) in oocytes. To date, the aspects of genome reprograming critical for full-term development after SCNT remain poorly understood. To identify the key elements of this process, changes in gene expression during maternal-to-embryonic transition in normal bovine embryos and changes in gene expression between donor cells and SCNT embryos were compared using a new cDNA array dedicated to embryonic genome transcriptional activation in the bovine. Three groups of transcripts were mostly affected during somatic reprograming: endogenous terminal repeat (LTR) retrotransposons and mitochondrial transcripts were up-regulated, while genes encoding ribosomal proteins were downregulated. These unexpected data demonstrate specific categories of transcripts most sensitive to somatic reprograming and likely affecting viability of SCNT embryos. Importantly, massive transcriptional activation of LTR retrotransposons resulted in similar levels of their transcripts in SCNT and fertilized embryos. Taken together, these results open a new avenue in the quest to understand nuclear reprograming driven by oocyte cytoplasm.

Introduction

During normal preimplantation development in mammals, reprograming is defined as extensive epigenetic modifications of differentiated gamete nuclei by the ooplasm that transforms them to a totipotent embryonic nucleus. In somatic cell nuclear transfer (SCNT) experiments, reprograming refers to the transformation of somatic nuclei by the ooplasm to the state, which allows recapitulation of normal developmental process and gene expression programs (Yang et al. 2007, Niemann et al. 2008). These reprograming events, dominated by the oocyte cytoplasm, affect fundamentally different genomes: while during fertilization, reprograming occurs to two transcriptionally silent haploid gametic genomes ‘designed’ for this process by nature, after SCNT a transcriptionally active diploid somatic genome is reprogramed. In both cases, the extent of ooplasm-driven reprograming first manifests during transcriptional activation of the embryonic genome (EGA; Vassena et al. 2007). Indeed, during normal development EGA leads to a transition from development determined by maternal factors to the ‘autonomous’ embryonic control of development, which is mainly regulated at the transcriptional level.

Incomplete reprograming of the somatic nucleus and misexpression of critical regulatory genes are considered the main reasons for developmental failures in clones (Bortvin et al. 2003, Gao et al. 2003, Santos et al. 2003). However, gene expression program of early mammalian embryos is quite flexible. For example, while in vitro culture (IVC) conditions greatly affect early transcriptomes of in vitro- versus in vivo-developed embryos, in vitro development remains compatible with full-term development (Wrenzycki et al. 2001, Corcoran et al. 2007). Consequently, a defining set of features manifesting the ‘adequate’ genome reprograming remains a puzzle due to this gene expression plasticity.

To resolve this, we used a novel strategy to define the properties of the ooplasm reprograming activity. First, two transitions in gene expression programs were analyzed and contrasted: the maternal-to-embryonic transition (MET) in normal embryos, and ‘somatic’ reprograming of the SCNT donor nuclei before nuclear transfer (NT) and after EGA. Secondly, previous studies demonstrated that EGA invokes expression of a very specific subset of genes and genomic loci (Evsikov et al. 2004, Peaston et al. 2004); therefore, we constructed an EGA-specific cDNA array that allowed focusing on the reprograming of genes specifically expressed during this stage of development. In bovine embryos, EGA is ‘progressive’ in that MET extends over 3–4 cell cycles, and major wave of transcriptional activation occurs at the 8–16 cell stage (Camous et al. 1986), while in the mouse embryos, it spans over a single-cell cycle (Bensaude & Morange 1983). Moreover, the efficiency of NT experiments in bovine expressed as the percentage of NT blastocysts developing to term is about five times higher than in the mouse (Yang et al. 2007). For these reasons, bovine oocytes and early embryos were chosen as a superior model to conduct these studies.

Results

To compare gene reprograming in SCNT embryos (somatic reprograming) with that occurring during MET in control embryos (MET reprograming), SCNT embryos produced by oocyte in vitro maturation (IVM), followed by NT and IVC and control embryos produced by IVM, followed by IVF and IVC were used. This allowed alleviating the potential biases in the comparison of gene expression patterns due to IVC conditions. To factor in the epigenotype of a somatic nucleus as another variable, somatic reprograming was analyzed on three types of SCNT embryos produced from different donor cell lines (OV0029, OV5538, and OV7711). All three cell lines provided high rates of embryonic development to the blastocyst stage after NT (32.8–42.2%). The corresponding SCNT embryo types were able to efficiently initiate pregnancy following their transfer at the blastocyst stage into foster recipients (D35 pregnancy rates ranging from 20.3 to 51.9%) and to produce healthy calves, although with different abilities (1.8, 7.8 and 12.7% for OV0029, OV7711, and OV5538 respectively over the period when SCNT embryos were produced for the molecular analyses). To account for the uniqueness of early embryonic transcriptome, we constructed and used an array specifically dedicated to early gene expression in the bovine.

Construction of a dedicated cDNA array

To obtain a cDNA library dedicated to early bovine embryonic transcription at EGA, we subtracted cDNAs from early post-MET embryos by cDNAs from late pre-MET embryos. We chose the morula (20–30 cell, grade 1 morulae) as the early post-MET stage because an increase in embryonic transcription is detected at this stage. The four-cell stage was chosen as the late pre-MET stage because it is the latest stage containing mainly residual maternal transcripts just before EGA (Duranthon & Renard 2003). This work was done by suppressive subtractive hybridization (SSH). Analysis of the quality of this library demonstrated that even though it still contained maternally expressed transcripts, it was greatly enriched in embryo-specific transcripts and contained very rare embryonic transcripts (Bui et al. 2005). From this library we randomly isolated 6530 clones and spotted an array with the corresponding PCR inserts. This embryo-dedicated array was further characterized by sequencing the ESTs. Sequence analysis showed that among these 6530 ESTs, 5231 correspond to 1189 unique genes, 662 encode transposable elements (mostly long terminal repeat (LTR) retrotransposons), 108 were unidentified, 167 represent artifact ‘chimeric’ sequences, and 463 correspond to the Arabidopsis thaliana cDNA present in the starting material (see Bui et al. 2005, and Materials and Methods; Fig. 1). For 1189 unique genes on the array, the number of EST probes varies from one (for 550 genes) to more than one hundred (for two genes). This corresponds to our previous analysis of efficiency for normalization by SSH, when applied to embryonic amplified material (Bui et al. 2005).

Figure 1
Figure 1

Analysis of the EGA dedicated array. (A) Distribution of the 6523 arrayed ESTs among five broad categories. (B) Distribution of the array's ESTs among five groups according to their redundancy.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

Somatic nuclei are extensively reprogramed by NT as soon as the morula stage

Somatic nucleus reprograming was assessed by comparison of gene expression among somatic cells and corresponding SCNT morulae using the dedicated bovine EGA-specific cDNA array. Hybridization signals corresponding to the three different cell lines and the corresponding types of SCNT embryos were analyzed by ANOVA. Five variables were taken into account: array probe, epigenotype (i.e. donor cell line), nuclear state (i.e. somatic versus ‘reprogramed’ SCNT embryonic), amplification method (see Materials and Methods), and experimental replication. We found that the ‘probe-nuclear state’ interaction was the most significant (Supplementary Table 1, which can be viewed online at www.reproduction-online.org/supplemental/), and that the ‘nuclear state’ effect affected 4338 out of the 6523 probes (false discovery rate (FDR)=5%). These results highlight the dramatic extent of reprograming after SCNT. Furthermore, hierarchical clustering of expression data obtained for SCNT and control embryos and somatic cells resulted in two major nodes – ‘somatic’ and ‘embryonic’ (Fig. 2A). Irrespective of the embryo types (control versus SCNT), their global gene expression patterns were significantly different from those of donor cells. These data indicate that SCNT reprograming instigates a gene expression program similar to control embryos by EGA at the morula stage.

Figure 2
Figure 2

Comparison of somatic and MET reprograming. (A) Hierarchical cluster taking into account the three somatic donor cells (OV55838, OV7711, OV029), SCNT (5538NT, 7711NT, 029NT), and IVF (FIV) morula-stage embryos, three repetitions (R1, R2, and R3) and two amplification methods (Amb for Ambion and Labo for cDNA Laboratory protocol). The cluster of 6523 ESTs highlights extensive reprograming of somatic donor nuclei by transfer to oocyte cytoplasm leading to an ‘IVF-like’ gene expression pattern. (B) PCA analysis of MET in control IVF embryos: differential screening between four-cell and morula stages. Horizontal axis corresponds to the analyzed genes. Vertical axis separates the ESTs overexpressed in morulae-stage embryos (negative coordinate) from those overexpressed in four-cell stage (positive coordinate). This axis is called MET reprograming axis. (C) PCA analysis of somatic reprograming: differential screening of three SCNT morulae and their corresponding donor cells. Horizontal axis corresponds to the analyzed genes. Vertical axis separates the ESTs overexpressed in SCNT morulae (positive coordinates) from those overexpressed in their donor cells (negative coordinates). This axis is called ‘somatic reprograming axis’. (D) Four distinct reprograming behaviors evidenced by comparison of somatic and MET reprograming.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

Dynamic comparison of somatic and MET reprograming

To characterize the genome reprograming in control bovine embryos (MET reprograming), differential screening of EGA-specific array was performed using RNA of the four-cell-stage embryos (before MET) and early compacted morulae (after MET). Three independent replications and two different amplification methods of each RNA sample were analyzed by principal component analysis (PCA). This analysis evidenced the ‘MET reprograming axis’ as the second most important axis displaying 13% of total variability. It separated the probes for genes overexpressed in embryos at the morula stage (negative coordinates) from those overexpressed in embryos at the four-cell stage (positive coordinates; Fig. 2B and Supplementary Table 2, which can be viewed online at www.reproduction-online.org/supplemental/). Similarly, genome reprograming after SCNT was analyzed using RNA from three different cell lines and three different SCNT morulae types. PCA analysis of these data permitted separating the probes overexpressed in donor cells (negative coordinates) from those overexpressed in SCNT-embryos (positive coordinates) and to define the ‘somatic reprograming axis’ displaying 16% of total variability (Fig. 2C and Supplementary Table 3, which can be viewed online at www.reproduction-online.org/supplemental/). These two axes allow characterizing the behavior of any gene on the array simultaneously in either SCNT or MET transition.

The data for all 6523 array probes were plotted on the plane defined by the ‘MET reprograming’ and ‘somatic reprograming’ axes to compare the SCNT and MET reprograming processes. This analysis exposed four distinct groups of genes with different ‘reprograming behaviors’. Specifically, all array probes in this plane belong to one of the four quadrants (Fig. 2D). The first and third quadrants contain probes with a disparate pattern of reprograming during somatic and MET reprograming. Namely, transcripts in first quadrant are up-regulated in SCNT morulae and four-cell-stage control embryos when compared with donor cells and control morulae respectively; the third quadrant contains probes for transcripts up-regulated in control morulae and donor cell lines, when compared with four-cell-stage control embryos and SCNT morulae respectively. The second and fourth quadrants contain probes with similar pattern of reprograming over somatic and MET reprograming. The second quadrant contains probes up-regulated in both SCNT and control morulae compared with donor cell lines and four-cell-stage embryos respectively, while the fourth quadrant contains probes up-regulated in four-cell-stage control embryos and somatic donor cells, compared with control and SCNT morulae.

Correlations among reprograming, gene expression, and gene function

To identify the transcripts that have similar reprograming behaviors irrespective of the donor cell epigenotype, three independent PCAs were performed with the data on individual donor cell lines and corresponding SCNT embryos. Scatter plots of data points displayed very similar shapes (not shown). The probes whose absolute values along both axes were higher than one s.d. were identified for each donor cell line. Of these, reprograming behavior for 27, 320, 72, and 29 probes in quadrants I–IV respectively were shared by all three SCNT embryo types and donor cells (Fig. 3). EST identities corresponding to these probes provided further support for nonrandom distribution for specific classes of transcripts among four quadrants. Seven out of the 27 commonly expressed probes in quadrant I correspond to mitochondrial sequences. In quadrant II, 236 of the 320 commonly expressed probes represent LTR retrotransposons. Of 72 probes in quadrant III, 52 correspond to transcripts of 16 different ribosomal proteins (L3, L10a, L12, L14, L23, L30, L34, L35, L38, S15a, S19, S23, S25, S27, S29, and S16-2like respectively). No overt bias was found for the types of transcripts represented by 29 probes in quadrant IV. These data indicate that: a) somatic reprograming results in an up-regulation of mitochondrial transcripts and a repression of genes encoding ribosomal proteins in SCNT embryos compared with donor cells, which is opposite to the behavior of these categories of genes during MET reprograming and b) transcriptional activation of endogenous LTR retrotransposons is a major feature of both somatic and MET reprograming.

Figure 3
Figure 3

Identification of transcripts with similar reprograming behavior irrespective of donor cell epigenotype. Number of probes displayed by each SCNT embryo type in each quadrant were reported in Venn diagrams: only probes whose absolute values along both axes were higher than one s.d. were taken into account. 27, 320, 72, and 29 probes in quadrants I–IV respectively were shared by all three SCNT embryo types.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

Retrotransposon activation during MET and somatic reprograming

However, these results remained qualitative due to the unequal redundancy in the array (Fig. 1). Because one of the most striking results was the reprograming of LTR transcripts, we focused on retrotransposon transcriptional activation within the context of both MET and somatic reprograming. The 236 ESTs encoding LTR sequences present in quadrant 2 belong to three different types of retrotransposons, specifically identified in RepBase (Jurka et al. 2005) as ERV1-1_BT, ERV1-2_BT, and BTLTR1 (Table 1). We focused on ERV1_1_BT because it was the retrotransposon with the highest proportion of array's ESTs present in quadrant 2, irrespective of the epigenotype involved in somatic reprograming. In order to quantify the extent of its transcriptional activation over both reprograming processes, we performed quantitative RT-PCR experiments on the four-cell- and morula-stage control IVF embryos, as well as on the donor cells and the SCNT embryos. ERV1_1_BT transcripts were first quantified starting from batches of ten control four-cell or morula embryos. Three independent embryo pools were used for each category of embryos to provide independent replications, and each sample was analyzed in triplicate. By expressing quantification data as a ratio of ERV1_1_BT/luciferase reporter transcript, we observed a 1000-fold increase in the amount of ERV1_1_BT transcripts per embryo between the four-cell (pre-EGA) stage and the morula (post-EGA) stage (ratio values ∼0.2 and ∼200 respectively; Fig. 4). We then compared control IVF and 5538 SCNT morulae by performing three replications on three independent batches of embryos. The quantity of ERV1_1_BT transcripts expressed as ERV1_1_BT/luciferase ratios did not differ according to the type of embryos (Fig. 5), underscoring that cloned and fertilized morulae expressed ERV1_1_BT at the same level.

Table 1

Number of ESTs encoding for each retrotransposon sequence in quadrant II.

RepBase name (Jurka et al. 2005)Estimated number of full-length elements in the genomeTotal number of ESTs on the arrayNumber of ESTs in quadrant II (% of total)
BTLTR18031 (33)
ERV1-1-LTR_BT130445213 (47)
ERV1-2-LTR_BT1106223 (37)
Figure 4
Figure 4

ERV1_1_BT expression in four-cell and morula-fertilized embryos (quantitative RT-PCR results). At each stage, three batches (R1–R3) of IVM, IVF, IVC embryos were analyzed. Mean±s.d. for the ERV1_1_BT/luciferase reporter ratios were calculated for each batch of embryos.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

Figure 5
Figure 5

Comparison of ERV1_1_BT expression in fertilized and SCNT morulae. Three batches of fertilized and cloned morulae were analyzed. Mean±s.d. ERV1_1_BT/luciferase reporter ratios were calculated on the nine values obtained from three samples analyzed in triplicate.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

In order to quantify ERV1_1_BT transcripts in somatic donor cells, we used samples obtained by two-fold serial dilutions of cDNA synthesized from a cell suspension (from 30 000 to 468 cells). Such serial dilutions were performed thrice starting from three different culture dishes (Fig. 6). Linear regression analysis indicated that the mean number of ERV1_1_BT mRNA molecules per cell was about 100 (R2=0.948). Absolute quantification of ERV1-1_BT molecules in SCNT morulae was 5.9±0.17×106 molecules. Since there are about 30 cells per morula, somatic reprograming was accompanied by a 2000-fold increase in the number of ERV1_1_BT transcripts per transcribing nucleus. This somatic reprograming resulted in the same amount of ERV1_1_BT transcript available in SCNT embryos as in fertilized ones at the morula stage. These data, thus faithfully recapitulated the results obtained by the comparison of MET and somatic reprograming dynamics, and evidenced transcriptional activation of specific retrotransposon sequences as a major event delineating both MET and somatic reprograming.

Figure 6
Figure 6

ERV1_1_BT expression in somatic donor cells. (A) Quantification of ERV1_1_BT transcripts was performed on three independent serial two-fold dilutions of cDNA synthesized from cell suspensions. (B) Linear regression for the determination of a mean number of ERV1_1_BT copies per cell.

Citation: REPRODUCTION 138, 2; 10.1530/REP-09-0042

Discussion

Studies of global changes in gene expression between SCNT and control embryos usually result in long lists of differentially expressed genes and are not successful in providing cues, or even reliable markers, for the process of ooplasm-driven genome reprograming. Here, instead of direct comparison of SCNT to normal embryos, we sought to contrast the two types of genome reprograming: the one that occurs to a somatic nucleus after SCNT and gametic reprograming that occurs during normal MET. We analyzed and compared two shifts in gene expression patterns: the first one is MET itself, while the second is the transition from the somatic to embryonic pattern of gene expression. This bidirectional analysis allows delineating, with greater precision, the differences and similarities in the process of gametic versus somatic genome reprograming, as reflected by the initial establishment of embryonic gene expression program at the morula stage. This analysis identifies genes with the greatest extent of expression changes during the SCNT and MET transitions, opposing them to those whose expression is unchanged. It focuses on new categories of genes that are the most sensitive to reprograming processes and may thus be markers of their efficiency.

By comparing the SCNT embryo gene expression patterns with those of the nucleus donor cell lines and control embryos we established that gene expression patterns of SCNT embryos are different from the corresponding donor cells. Such differences were manifested just after the major EGA. Moreover, as soon as the early morula stage, gene expression pattern of SCNT embryos closely resemble that of control embryos. These results are in accord with the previous studies, where efficient reprograming after SCNT had been shown at the blastocyst stage (De Sousa et al. 1999, Smith et al. 2005). The data on earlier pre-blastocyst reprograming events in SCNT embryos are scarce and deal with a handful of candidate genes and sometimes inconsistent results (Daniels et al. 2000, Winger et al. 2000, Park et al. 2003). Our results show, for the first time, that as early as the morula stage in the bovine, somatic nuclei have already undergone significant nuclear reprograming that makes their gene expression program close to the embryonic one. This result differs from the analysis of mouse SCNT embryos. In mice, the pattern of gene expression in two-cell-stage SCNT embryos was reported to be grossly abnormal (Vassena et al. 2007). However, two important differences between these two mammalian systems may underlie these differences. First, in mouse embryos, the very early and abrupt EGA at the 2-cell stage narrows the window of opportunity for SCNT reprograming comparing to the bovine, where the progressive nature of EGA provides a prolonged period (3–4 cell cycles) to ensure proper reprograming. Secondly, the SCNT efficiency in mice is significantly lower (about five time less) than in bovine (Yang et al. 2007), and therefore ‘abnormality’ versus ‘normality’ of gene expression programs during EGA may be the ultimate determinants of the SCNT embryo viability.

Our analysis of genome reprograming in the artificial epigenetic context of SCNT, when compared to the ‘normal’ context of fertilization (MET), produced four distinct categories of affected genes (Fig. 1D), which can be regrouped into either appropriate or disparate reprograming.

Among the appropriately reprogramed genes, those present in quadrant two (Fig. 2D) represent the genes that are typical for EGA, but are downregulated in somatic cells or pre-EGA embryos. Intriguingly, the major proportion of array probes in this group corresponds to the transcripts of LTR transposons. Unexpectedly, the LTR transposons identified here (Table 1) belong to the Class I LTR sequences, while the major LTR transposon expressed during EGA in the mouse, MuERV-L, is a member of Class III LTR sequences (Evsikov et al. 2004, Peaston et al. 2004). Our stringent analysis of current bovine genome assembly indicates that these retrotransposons are represented by ∼100 copies per haploid genome (Table 1). Our result is the first experimental confirmation of robust LTR transposon up-regulation during EGA in a nonmurine embryo. This expression had not been evidenced by previous analyses of the massive changes in the embryonic transcriptome accompanying EGA in the bovine. This may be explained by the use of nondedicated arrays (Misirlioglu et al. 2006, Kues et al. 2008), by the size of the custom array, or the precise methods used in custom array construction (Vigneault et al. 2009). Moreover, our results show that the expression of LTR transposons is faithfully recapitulated in bovine SCNT embryos, where their transcriptional activation results in a quantity of expressed transcripts that does not differ from fertilized embryos. Apparently, this is not the case in the mouse, where 2-cell stage SCNT embryos do not express the EGA-associated LTR transposon Mu-ERVL at the levels comparable with controls (Suzuki et al. 2006). Given the dramatic differences in developmental capacity between mouse and bovine SCNT embryos, we hypothesize that LTR transposon expression is an important marker of the viability in mammalian clones. Appropriate reprograming of LTR elements in bovine clones shows that their expression is associated with the ooplasm-driven return to totipotency irrespective of the gametic or somatic origin of chromatin. Indeed, the link between retrotransposon expression and pluripotency had been suggested in mice, where expression of ETn LTR retrotransposons is limited to pluripotent cells in early embryogenesis (Brûlet et al. 1985). Overall, the conserved pattern of LTR transposons expression during EGA among mammals reinforces the interest about their functional role at this unique stage of development.

The fourth quadrant (Fig. 2D) contains probes for genes that have undergone transcriptional repression in both SCNT and control embryos and thus are also appropriately reprogramed. Overall, this group is quite small and no functional bias was identified among these genes. However, our cDNA array used for these studies is specifically biased towards embryo-encoded transcripts (see Materials and Methods) and may be unsuitable to provide a faithful representation of genes that have this type of reprograming behavior in SCNT or normal embryos.

Disparately reprogramed genes distribute into two groups. The first is a group of genes that encode transcripts up-regulated during somatic reprograming, while they are down regulated during MET reprograming (Fig. 2D, quadrant 1). This disparate up-regulation is the result either of a transcriptional activation of somatic nucleus by the factors present in the ooplasm or of the persistence of a high level of maternal transcript, the stability of which may be greater in SCNT than in control morulae. Indeed, alterations of pre-EGA transcriptome in early SCNT embryos, and specifically the stabilization of certain maternal mRNAs, have been documented in the mouse (Vassena et al. 2007). Regulation of maternal mRNA stability and cytoplasmic polyadenylation was shown to require, sometimes, the expression of embryo-encoded transcripts across various species, such as zebrafish (Giraldez et al. 2006), African clawed frog (Sible et al. 1997, Bashirullah et al. 1999, Audic et al. 2001), and rabbit (our unpublished data). One of the molecular mechanisms for this regulation involves embryo-encoded micro-RNAs, which regulate a subset of maternal transcripts during zebrafish's early development (Giraldez et al. 2006). Therefore, it is possible that some regulatory RNAs expressed during EGA in normal bovine embryos fail to be correctly reprogramed after SCNT, resulting in the abnormal stabilization of maternal mRNAs in SCNT morulae. Concerning the mitochondrial genome and the transcripts that belong to this group, their disparate up-regulation during SCNT reprograming, if linked to transcription of the somatically inherited nucleus, may again rely on two different mechanisms: either an increased number of mitochondria or an increased transcription of the mitochondrial genome. In normal embryos, mitochondria are maternally inherited organelles, and in the bovine, the levels of mitochondrial transcripts such as COX1 globally increase from the morula stage onward (May-Panloup et al. 2005), that is at or just after the stage we analyzed. On the other hand, in mouse SCNT embryos mitochondrial replication factors are overexpressed, most likely due to their expression in donor nuclei (Bowles et al. 2007). If the same is true for bovine, then up-regulation of mitochondrial transcripts during SCNT reprograming is likely due to an increase in the number of mitochondria.

The third quadrant contains probes downregulated in SCNT morulae compared with the donor cells (Fig. 2D). Undoubtedly, these probes represent genes that have undergone transcriptional repression during somatic reprograming (but transcriptional activation during MET reprograming). Interestingly, most of these are the genes encoding ribosomal proteins. Translation increases dramatically during and after EGA, and protein synthesis is required for blastocyst formation (Kidder & McLachlin 1985). High increase in transcripts encoding ribosomal proteins has been reported during EGA of rabbit (Brunet-Simon et al. 2001) and mouse (Evsikov et al. 2004) embryos, and is confirmed in the bovine by our results. However, SCNT embryos are definitely viable, which indicates they possess functional protein synthesis machinery. We suggest that the reprograming behavior of genes in the third quadrant may be explained by lower-than-somatic levels of expression of a gene during EGA. An alternative explanation is ‘abusive’ repression, or incomplete reactivation, during SCNT reprograming.

According to our results, reprograming of basic cell machinery, such as mitochondrial and ribosomal protein-encoding genes, undertakes different routes during somatic and MET reprograming processes. This makes ‘housekeeping genes’ unexpected candidates for analysis of variations in reprograming efficiency.

In conclusion, comparison of two transitions–MET and somatic reprograming–made possible to analyze four different ‘gene reprograming behaviors’ that are shared by three somatic donor cell lines, when exposed to the oocyte cytoplasm; at the same time, it delineated genes with similar and disparate reprograming behaviors during MET versus SCNT. Faithful reprograming of LTR retrotransposons and their activation during EGA in SCNT embryos suggests a functional, yet still elusive role for these transcripts in mammalian early development. Their faithful reactivation in SCNT embryos provides an important and reliable marker of the ooplasm-driven somatic cell nuclear reprograming.

Materials and Methods

The experiment was performed in accordance with the International Guiding Principle for Biomedical Research involving animals as promulgated by the Society for the Study of Reproduction and with the European Convention on Animal Experimentation. Researchers involved with direct work with the animals possessed an animal experimentation license by the French veterinary services.

Oocyte and embryo recovery

IVF embryos were obtained by in vitro oocyte maturation, fertilization, and embryo culture as described (Parrish et al. 1986, Pavlok et al. 1989). Four-cell- and morulae-stage embryos were recovered at 41 and 120 h post-insemination respectively, from early two-cell-cleaved embryos picked at 32 h post-insemination.

Somatic donor cell culture and NT

Primary cultures of bovine fibroblasts were derived from ear skin biopsies of three distinct Holstein heifers, two 12-month-old (OV029, OV5538) and one 18-month-old (OV7711). The cell types derived from these primary cultures were frozen-stored at passage 1, and used as sources of donor nuclei for NT between passages 3 to 13. Donor fibroblasts were grown to confluence in DMEM (Life Technologies) supplemented with 10% FCS (Life Technologies) at 38 °C with 5% CO2 in air, and further cultured for an additional 2–5 days in DMEM containing either 0.5 or 10% FCS. The cells were collected by trypsinization for NT. For RNA extractions, the cell populations were prepared and collected the same way.

Recipient oocytes were in vitro matured as previously described by (Pavlok et al. 1989) and enucleated at 20–22 h post-maturation (hpm). SCNT embryos were reconstructed by electrofusion of enucleated oocytes with donor cells at 23–24 hpm (2.0 kV/cm 30 μs×2 pulses). Reconstructed embryos were activated by incubation for 5 h after fusion, in 10 μg/ml cycloheximide and 5 μg/ml cytochalasin B in 199 medium (Sigma) with 10% FCS. They were then co-cultured under the same conditions as the IVF embryos (Parrish et al. 1986). Grade 1 (defined in Robertson & Nelson (1998)) morulae were selected at 120 h post-fusion and immediately dry–frozen for further molecular analysis.

RNA extraction and amplification

Total RNAs were extracted from batches of embryos (n=30 embryos) using the RNeasy Mini Kit (Qiagen). The purification procedure included a DNAse I treatment (37 °C, 30 min).

Transcriptomic analyses starting from scarce biological materials require RNA amplification before labeling and hybridization. Two methods are available for such amplification: antisens RNA in vitro transcription and PCR amplification of all cDNAs. Each of these methods may introduce bias into the amplified material. We have observed (data not shown) that the systematic use of both of these methods on each sample makes it possible to isolate the method effect in ANOVA analyses and the subsequent identification of a greater number of differentially expressed genes starting from the same number of scarce samples. For this reason our differential screenings are performed with two distinct targets for each sample corresponding to the two amplification procedures. We routinely use three repetitions of each biological sample.

Half of the extracted RNA was subjected to RNA amplification by in vitro transcription (Eberwine et al. 1992) using the MessageAmp aRNA Kit (Ambion) according to the manufacturer's instructions. One quarter of the sample was used for global RT-PCR amplification as described (Pacheco-Trigon et al. 2002). Briefly, the whole volume of RT-tailing product (10 μl) was subjected to two rounds of PCR amplification. PCRs were performed in a total volume of 50 μl using 15 units of Goldstar DNA polymerase (Eurogentec, Seraing, Belgium) for each round of the PCR cycles. Samples were incubated at 94 °C for 10 min before PCR. Eighteen and 15 cycles were performed for the first and the second PCR respectively. Cycle parameters were: 94 °C for 2 min, 63 °C for 50 s, and 72 °C for 6 min. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen).

cDNA library and array construction

To obtain a cDNA library dedicated to early bovine embryonic transcription at MET; we subtracted cDNAs from early post-MET embryos by cDNAs from late pre-MET embryos. We chose the morula as the early post-MET stage since an increase in embryonic transcription is detected at this stage. The four-cell stage was chosen as the late pre-MET stage because it is the latest stage containing mainly residual maternal transcripts just before EGA (Duranthon & Renard 2003). This work was done by SSH with the PCR Select cDNA Subtraction Kit (Clontech) as described (Bui et al. 2005). Exogenous A. thaliana transcripts were added either to both the tracer and driver materials or only to the tracer material in order to analyze the subtraction and normalization efficiencies. Large-scale analysis of the library we obtained demonstrated that even though it still contained maternally expressed transcripts, it was greatly enriched in embryonic specific transcripts and contained even very rare embryonic transcripts (Bui et al. 2005). From this library, we randomly isolated 6523 clones.

cDNA inserts were amplified by PCR using M13 universal primers. Each reaction started from 2 μl bacterial culture, in 1× PCR Buffer with 1 U Taq Polymerase (Qbiogen). The amplified products were run on a 2% agarose gel to verify the presence of the inserts. After purification and quantification, 6523 inserts were spotted onto nylon membranes (Hybond N+ Amersham) using the QBot robot (Genetix). DNA was denatured (NaOH 0.5 M, NaCl 1.5 M; 5 min), neutralized (Tris 0.5 M, NaCl 1.5 M; 5 min), and fixed to the membranes (2 h, 80 °C). This embryo-dedicated array was subjected to further differential screenings.

Labeling and array hybridization

Two micrograms aRNA were reverse-transcribed and labeled with [α-33P] dATP (Perkin Elmer) as described (Decraene et al. 1999). From global RT-PCR Amplification, 500 ng cDNA was labeled with [α-33P] dATP (Perkin Elmer) using an Atlas SMART probe amplification kit (Clontech) according to the manufacturer's instructions. The labeled aRNA or cDNA targets were hybridized to macro-array replicates using ExpressHyb hybridization solution (Clontech) at 68 °C overnight. Washings were performed four times in 2× SSC, 1% SDS and once in 0.1× SSC, 0.5% SDS at 68 °C for 30 min each. Membranes were then exposed to phosphoscreen (Phosphorimager Amersham) for 5 days. The hybridization signals were quantified using the Imagene 3.1 software from BioDiscovery (Proteigene, Saint Marcel, France).

Data analysis

Hybridization signals (Signal means) after quantification by Imagene were log transformed and normalized before data analysis.

Differential analysis was performed by Anova using GenAnova software (Didier et al. 2002). For each array probe, the equation used for ANOVA was the following:

article image
where Yikjl is the array probe intensity and μ is the mean of intensities of expression measured for the probe. Ei, Sj, Mk, and Rl are respectively, the effects of the analyzed epigenotype i, ‘nuclear state’j (the status of the nucleus: somatic versus reprogramed after transfer into an oocyte), the amplification method k, and the biological repetition l. εijkl is the residual error including all interactions between these factors.

The threshold of 5% for the FDR was chosen to select genes with significant expression changes. (The FDR is the expected proportion of erroneously rejected null hypotheses among the rejected ones).

Hierarchical clustering: to classify our different ‘conditions’, unsupervised hierarchical clustering was performed using free GenAnova software.

PCA was performed using GenAnova software (Didier et al. 2002).

Analysis of array probes

The ESTs sequences representing array probes were initially filtered to eliminate the A. thaliana transcripts (internal control for cDNA library preparation; see Bui et al. 2005) and empty clones. The remaining 6152 ESTs were assembled in consensus sequences (‘clusters’) using CAP3 software (Huang & Madan 1999). Each sequence was assigned a unique identifying number, and analyzed for consistency of CAP3 assembly as described (Evsikov et al. 2004). The identities of these 2465 sequences were established by searching, using BLASTN (Altschul et al. 1990) and MEGABLAST (Zhang et al. 2000) programs, all mammalian mRNAs and Bos taurus ESTs available in GenBank. Genomic locations (B. taurus genome assembly Btau_3.1, August 2006) were established using the SSAHA and BLAST tools of ENSEMBL (Hubbard et al. 2002). Unambiguous genomic locations were determined for a large proportion of sequences (89.5%). Two thousand two hundred five of 2465 sequences are the transcripts of 1188 known or inferred B. taurus genes, i.e. genes curated by the National Center for Biotechnology Information Gene database (Maglott et al. 2005), or genes with unambiguous orthology to known H. sapiens and Mus musculus genes. Totally 155 sequences correspond to retrotransposable elements, and 105 sequences could not be classified. All 5921 ESTs that represent transcripts of known and novel B. taurus genes and retrotransposons have been submitted to GenBank EST database, dbEST (Boguski et al. 1993), under accession numbers GO349393–GO355313.

Real-time RT-PCR

RNA were extracted from batches of ten embryos at the four-cell, or morula (20–30 cell) stage using the PicoPure RNA extraction kit (Arcturus, Sunnyvale, CA, USA). At the first step of extraction, 2.5 μg carrier RNA (16S-28S carrier Roche Diagnostics) and 1 pg per embryo luciferase encoding reporter transcripts (Promega) were added to the extraction buffer. Carrier RNA recovery rate was estimated by OD measurement (embryonic RNA was considered as negligible compared with carrier RNA). This recovery rate was taken into account to normalize the samples and cDNA synthesis was performed starting from seven ‘equivalent embryos’. cDNAs were synthesized from total RNA using the Superscript III enzyme (Invitrogen) and random primers hexamers (Roche Diagnostics) in 20 μl final volume. RT reaction was diluted to 400 μl in water. Quantitative PCR was performed on 0.5 equivalent embryos. A PCR mix was prepared as follows: 12.5 μl of 2× SybrGreen Mastermix (Applied Biosystems, Courtaboeuf, France), 0.25 μl Uracyl N-glycosylase (1 U/μl), 0.5 μl each primer (10 μM initial concentration), 1.25 μl H2O, 10 μl each diluted RT reaction. For each sample the PCR was carried out in triplicates and the mean Ct was determined. The thermal cyclic profile started with a 2 min step at 50 °C, followed by 10 min at 95 °C, and 45 cycles of 95 °C denaturation for 15 s, 60 °C annealing and extension for 60 s. The reactions were performed on an ABI Prism 7000 sequence detector (Applied Biosystems). Dissociation curves were performed after each PCR run to ensure that a single PCR product had been amplified. A standard curve consisting of a tenfold dilution series of quantified amplicon was included in each run. Experiments were carried out thrice starting from distinct batches of embryos. Luciferase transcript was quantified according to the same procedure. Mean ratio values obtained for each batch of embryos were calculated with their s.d.s. Primers sequences were as follows: ERV1_1_BT P3_F CTGCTTTACGGTTTCCATCC and ERV1_1_BT P3_R ATCCTGCCACTTTCCTTCC for ERV1_1_BT; FLuc5: AGAGATACGCCCTGGTTCCT, and RLuc10: ATAAATAACGCGCCCAACAC for luciferase.

Real-time RT-PCR on cell samples. Three independent quantifications were performed as follows. Four dishes were cultured concomittently to confluence from a single-cell suspension. One dish was used to count the cells, while cells from the three other dishes were recovered for RNA extraction using the Qiagen minikit, and cDNA synthesis. Two-fold serial dilutions of the cDNA were submitted to quantitative PCR. Each dilution was analyzed in triplicate experiments.

Declaration of interest

There is no potential conflict of interest.

Funding

The work was supported by the grants awarded to Linh Chi Bui from the PHASE (Physiologie Animale & Système d'Elevage) department (INRA), from the BIODIVA project (UMR Biologie du Développement et de la Reproduction, INRA Jouy en Josas, France, CIRAD, France; and Laboratoire Biologie du Développement et de la Reproduction, VAST, Hanoi, Vietnam) and from FRM (Fondation pour la Recherche Médicale).

Acknowledgements

The authors would like to thank the CRB (Centre de Ressources Biologiques) for its help in developing arrays and the PICT (Plateau d'Instrumentation et de Compétences en Transcriptomique) for making Imagene 3.1 software (BioDiscovery Inc.) available. Our thanks also go to Yvette Lavergne and Christophe Audouard for the production of IVM, IVF, and IVC bovine embryos, Etienne Laloy and Sandrine Peron for the culture of bovine fibroblasts and François Wessner for design of the luciferase primers.

References

  • Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ 1990 Basic local alignment search tool. Journal of Molecular Biology 215 403410.

  • Audic Y, Anderson C, Bhatty R & Hartley RS 2001 Zygotic regulation of maternal cyclin A1 and B2 mRNAs. Molecular and Cellular Biology 21 16621671.

  • Bashirullah A, Halsell SR, Cooperstock RL, Kloc M, Karaiskakis A, Fisher WW, Fu W, Hamilton JK, Etkin LD & Lipshitz HD 1999 Joint action of two degradation pathways controls timing of maternal transcript elimenation at the midblastula transition in Drosophila melanogaster. EMBO Journal 189 26102620.

    • Search Google Scholar
    • Export Citation
  • Bensaude O & Morange M 1983 Spontaneous high expression of heat-shock proteins in mouse embryonal carcinoma cells and ectoderm from day 8 mouse embryo. EMBO Journal 2 173177.

    • Search Google Scholar
    • Export Citation
  • Boguski MS, Lowe TM & Tolstoshev CM 1993 dbEST – database for ‘expressed sequence tags’. Nature Genetics 4 332333.

  • Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry DL, Yanagimachi R, Page DC & Jaenisch R 2003 Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 130 16731680.

    • Search Google Scholar
    • Export Citation
  • Bowles EJ, Lee JH, Alberio R, Lloyd RE, Stekel D, Campbell KH & St John JC 2007 Contrasting effects of in vitro fertilization and nuclear transfer on the expression of mtDNA replication factors. Genetics 176 15111526.

    • Search Google Scholar
    • Export Citation
  • Brûlet P, Condamine H & Jacob F 1985 Spatial distribution of transcripts of the long repeated ETn sequence during early mouse embryogenesis. PNAS 82 20542058.

    • Search Google Scholar
    • Export Citation
  • Brunet-Simon A, Henrion G, Renard JP & Duranthon V 2001 Onset of zygotic transcription and maternal transcript legacy in the rabbit embryo. Molecular Reproduction and Development 58 127136.

    • Search Google Scholar
    • Export Citation
  • Bui LC, Leandri RD, Renard JP & Duranthon V 2005 SSH adequacy to preimplantation mammalian development: scarce specific transcripts cloning despite irregular normalisation. BMC Genomics 6 155163.

    • Search Google Scholar
    • Export Citation
  • Camous S, Kopecný V & Fléchon JE 1986 Autoradiographic detection of the earliest stage of [3H]-uridine incorporation into the cow embryo. Biology of the Cell 58 195200.

    • Search Google Scholar
    • Export Citation
  • Corcoran D, Rizos D, Fair T, Evans AC & Lonergan P 2007 Temporal expression of transcripts related to embryo quality in bovine embryos cultured from the two-cell to blastocyst stage in vitro or in vivo. Molecular Reproduction and Development 74 972977.

    • Search Google Scholar
    • Export Citation
  • Daniels R, Hall V & Trounson AO 2000 Analysis of gene transcription in bovine nuclear transfer embryos reconstructed with granulosa cell nuclei. Biology of Reproduction 63 10341040.

    • Search Google Scholar
    • Export Citation
  • Decraene C, Reguigne-Arnould I, Auffray C & Pietu G 1999 Reverse transcription in the presence of dideoxynucleotides to increase the sensitivity of expression monitoring with cDNA arrays. Biotechniques 27 962966.

    • Search Google Scholar
    • Export Citation
  • Didier G, Brezellec P, Remy E & Henaut A 2002 GeneANOVA – gene expression analysis of variance. Bioinformatics 18 490491.

  • Duranthon V & Renard JP 2003 Storage and functional recovery of molecules in oocytes. In Biology and Pathology of the Oocyte: Its Role in Fertility and Reproductive Medicine, pp 81112. Eds Trounson AL, Gosden RG. Cambridge, UK: Cambridge University Press.

    • Search Google Scholar
    • Export Citation
  • Eberwine J, Yeh H, Miyashiro K, Cao Y, Nair S, Finnell R, Zettel M & Coleman P 1992 Analysis of gene expression in single live neurons. PNAS 89 30103014.

  • Evsikov AV, de Vries WN, Peaston AE, Radford EE, Fancher KS, Chen FH, Blake JA, Bult CJ, Latham KE & Solter D 2004 Systems biology of the 2-cell mouse embryo. Cytogenetic and Genome Research 105 240250.

    • Search Google Scholar
    • Export Citation
  • Gao S, Chung YG, Williams JW, Riley J, Moley K & Latham KE 2003 Somatic cell-like features of cloned mouse embryos prepared with cultured myoblast nuclei. Biology of Reproduction 69 4856.

    • Search Google Scholar
    • Export Citation
  • Giraldez AJ, Mishim Y, Rihel J, Grocock RJ, Van Dongen S, Inoue K, Enright AJ & Schier AF 2006 Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 312 7579.

    • Search Google Scholar
    • Export Citation
  • Huang X & Madan A 1999 CAP3: a DNA sequence assembly program. Genome Research 9 868877.

  • Hubbard T, Barker D, Birney E, Cameron G, Chen Y, Clark L, Cox T, Cuff J, Curwen V & Down T 2002 The Ensembl genome database project. Nucleic Acids Research 30 3841.

  • Jurka J, Kapitonov VV, Pavlicek A, Klonowski P, Kohany O & Walichiewicz J 2005 Repbase Update, a database of eukaryotic repetitive elements. Cytogenetic and Genome Research 110 462467.

    • Search Google Scholar
    • Export Citation
  • Kidder GM & McLachlin JR 1985 Timing of transcription and protein synthesis underlying morphogenesis in preimplantation mouse embryos. Developmental Biology 112 265275.

    • Search Google Scholar
    • Export Citation
  • Kues WA, Suheer S, Herrmann D, Carnwath JW, Havlicek V, Besenfelder U, Lehrach H, Adjaye J & Niemann H 2008 Genome-wide expression profiling reveals distinct clusters of transcriptional regulation during bovine preimplantation devlopment in vivo. PNAS 105 1976819773.

    • Search Google Scholar
    • Export Citation
  • Maglott D, Ostell J, Pruitt KD & Tatusova T 2005 Entrez Gene: gene-centered information at NCBI. Nucleic Acids Research 33 D54D58.

  • May-Panloup P, Vignon X, Chrétien MF, Heyman Y, Tamassia M, Malthièry Y & Reynier P 2005 Increase of mitochondrial DNA content and transcripts in early bovine embryogenesis associated with upregulation of mtTFA and NRF1 transcription factors. Reproductive Biology and Endocrinology 3 6572.

    • Search Google Scholar
    • Export Citation
  • Misirlioglu M, Page GP, Sagirkaya H, Kaya A, Parrish JJ, First NL & Memili E 2006 Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos. PNAS 103 1890518910.

    • Search Google Scholar
    • Export Citation
  • Niemann H, Tian XC, King WA & Lee RS 2008 Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning. Reproduction 135 151163.

    • Search Google Scholar
    • Export Citation
  • Pacheco-Trigon S, Hennequet-Antier C, Oudin JF, Piumi F, Renard JP & Duranthon V 2002 Molecular characterization of genomic activities at the onset of zygotic transcription in mammals. Biology of Reproduction 67 19071918.

    • Search Google Scholar
    • Export Citation
  • Park SH, Park SB & Kim NH 2003 Expression of early development-related genes in bovine nuclear transferred and fertilized embryos. Zygote 11 355360.

    • Search Google Scholar
    • Export Citation
  • Parrish JJ, Susko-Parrish JL, Leibfried-Rutledge ML, Critser ES, Eyestone WH & First NL 1986 Bovine in vitro fertilization with frozen–thawed semen. Theriogenology 25 591600.

    • Search Google Scholar
    • Export Citation
  • Pavlok A, Motlik J, Kanka J & Fulka J 1989 In vitro techniques of bovine oocyte maturation, fertilization and embryo culture resulting in the birth of a calf. Reproduction, Nutrition, Development 29 611616.

    • Search Google Scholar
    • Export Citation
  • Peaston AE, Evsikov AV, Graber JH, de Vries WN, Holbrook AE, Solter D & Knowles BB 2004 Retrotransposons regulate host genes in mouse oocytes and preimplantation embryos. Developmental Cell 7 597606.

    • Search Google Scholar
    • Export Citation
  • Robertson I & Nelson RE 1998 Certification and identification of the embryo. In Manual of International Embryo Transfer Society, 3 edn, pp 103134. Eds Stringfellow DA, Seidel M. Savoy: International Embryo Transfer Society (IETS).

    • Search Google Scholar
    • Export Citation
  • Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W & Dean W 2003 Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Current Biology 13 11161121.

    • Search Google Scholar
    • Export Citation
  • Sible JC, Anderson JA, Lewellyn AL & Maller JL 1997 Zygotic transcription is required to block a maternal program of apoptosis in Xenopus embryos. Developmental Biology 189 335346.

    • Search Google Scholar
    • Export Citation
  • Smith SL, Everts RE, Tian XC, Du F, Sung LY, Rodriguez-Zas SL, Jeong BS, Renard JP, Lewin HA & Yang X 2005 Global gene expression profiles reveal significant nuclear reprogramming by the blastocyst stage after cloning. PNAS 102 1758217587.

    • Search Google Scholar
    • Export Citation
  • De Sousa PA, Winger Q, Hill JR, Jones K, Watson AJ & Westhusin ME 1999 Reprogramming of fibroblast nuclei after transfer into bovine oocytes. Cloning 1 6369.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Minami N, Kono T & Imai H 2006 Zygotically activated genes are suppressed in mouse nuclear transferred embryos. Cloning and Stem Cells 8 295304.

    • Search Google Scholar
    • Export Citation
  • Vassena R, Han Z, Gao S, Baldwin DA, Schultz RM & Latham KE 2007 Tough beginnings: alterations in the transcriptome of cloned embryos during the first two cell cycles. Developmental Biology 3041 7589.

    • Search Google Scholar
    • Export Citation
  • Vigneault C, Gravel C, Vallée M, McGraw S & Sirard MA 2009 Unveiling the bovine embryo transcriptome during maternal to embryonic transition. Reproduction 137 245257.

    • Search Google Scholar
    • Export Citation
  • Winger QA, Hill JR, Shin T, Watson AJ, Kraemer DC & Westhusin ME 2000 Genetic reprogramming of lactate dehydrogenase, citrate synthase, and phosphofructokinase mRNA in bovine nuclear transfer embryos produced using bovine fibroblast cell nuclei. Molecular Reproduction and Development 56 458464.

    • Search Google Scholar
    • Export Citation
  • Wrenzycki C, Herrmann D, Keskintepe L, Martins AJr Jr, Sirisathien S, Brackett B & Niemann H 2001 Effects of culture system and protein supplementation on mRNA expression in pre-implantation bovine embryos. Human Reproduction 16 893901.

    • Search Google Scholar
    • Export Citation
  • Yang X, Smith SL, Tian XC, Lewin HA, Renard JP & Wakayama T 2007 Nuclear reprogramming of cloned embryos and its implications for therapeutic cloning. Nature Genetics 39 295302.

    • Search Google Scholar
    • Export Citation
  • Zhang Z, Schwartz S, Wagner L & Miller W 2000 A greedy algorithm for aligning DNA sequences. Journal of Computational Biology 7 203214.

A V Evsikov and D R Khan contributed equally to this work

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

     An official journal of

    Society for Reproduction and Fertility

 

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 3338 1058 108
PDF Downloads 281 74 5
  • View in gallery

    Analysis of the EGA dedicated array. (A) Distribution of the 6523 arrayed ESTs among five broad categories. (B) Distribution of the array's ESTs among five groups according to their redundancy.

  • View in gallery

    Comparison of somatic and MET reprograming. (A) Hierarchical cluster taking into account the three somatic donor cells (OV55838, OV7711, OV029), SCNT (5538NT, 7711NT, 029NT), and IVF (FIV) morula-stage embryos, three repetitions (R1, R2, and R3) and two amplification methods (Amb for Ambion and Labo for cDNA Laboratory protocol). The cluster of 6523 ESTs highlights extensive reprograming of somatic donor nuclei by transfer to oocyte cytoplasm leading to an ‘IVF-like’ gene expression pattern. (B) PCA analysis of MET in control IVF embryos: differential screening between four-cell and morula stages. Horizontal axis corresponds to the analyzed genes. Vertical axis separates the ESTs overexpressed in morulae-stage embryos (negative coordinate) from those overexpressed in four-cell stage (positive coordinate). This axis is called MET reprograming axis. (C) PCA analysis of somatic reprograming: differential screening of three SCNT morulae and their corresponding donor cells. Horizontal axis corresponds to the analyzed genes. Vertical axis separates the ESTs overexpressed in SCNT morulae (positive coordinates) from those overexpressed in their donor cells (negative coordinates). This axis is called ‘somatic reprograming axis’. (D) Four distinct reprograming behaviors evidenced by comparison of somatic and MET reprograming.

  • View in gallery

    Identification of transcripts with similar reprograming behavior irrespective of donor cell epigenotype. Number of probes displayed by each SCNT embryo type in each quadrant were reported in Venn diagrams: only probes whose absolute values along both axes were higher than one s.d. were taken into account. 27, 320, 72, and 29 probes in quadrants I–IV respectively were shared by all three SCNT embryo types.

  • View in gallery

    ERV1_1_BT expression in four-cell and morula-fertilized embryos (quantitative RT-PCR results). At each stage, three batches (R1–R3) of IVM, IVF, IVC embryos were analyzed. Mean±s.d. for the ERV1_1_BT/luciferase reporter ratios were calculated for each batch of embryos.

  • View in gallery

    Comparison of ERV1_1_BT expression in fertilized and SCNT morulae. Three batches of fertilized and cloned morulae were analyzed. Mean±s.d. ERV1_1_BT/luciferase reporter ratios were calculated on the nine values obtained from three samples analyzed in triplicate.

  • View in gallery

    ERV1_1_BT expression in somatic donor cells. (A) Quantification of ERV1_1_BT transcripts was performed on three independent serial two-fold dilutions of cDNA synthesized from cell suspensions. (B) Linear regression for the determination of a mean number of ERV1_1_BT copies per cell.