Abstract
As the distal part of the crustacean male reproductive tract, terminal ampullae play important roles in sperm development and storage of mature spermatophores. In the present study, the novel gene terminal ampullae peptide (TAP) was cloned from terminal ampullae of the prawn, Macrobrachium rosenbergii. The cDNA sequence consists of 768 nucleotides, with an open-reading frame of 264 nucleotides which encodes a putative 88-amino acid precursor protein with a 17-amino acid residue signal peptide. Western blotting and immunohistochemical analysis revealed that TAP was distributed on terminal ampullae and sperm, and its expression was related to gonad development. To elucidate the functional role of TAP in vivo, we disrupted the TAP gene by RNA interference (RNAi) and evaluated the effect on fertility and several sperm parameters. Although there was no difference in fertility between RNAi-induced prawns and controls, RNAi treatment decreased the sperm gelatinolytic activity and blocked proteolytic activity on the vitelline coat. These data provide evidence that TAP participates in regulating sperm proteolytic activity, and performs a crucial role in sperm maturation and degradation of the vitelline coat during fertilization.
Introduction
Fertilization is a complex physiological process that involves a precisely ordered set of molecular and cellular events, including generation and maturation of haploid gametes, sperm penetration of the egg coat, and final fusion of oocyte–sperm cell membranes (Vacquier 1998, Wassarman 1999, Stein et al. 2006). In most fertilization models, motile male gamete systems have been well studied. In general, testicular sperm become competent to fertilize only after undergoing a series of changes during their transit through the male and female reproductive tracts; in mammals, these changes are known as maturation and capacitation respectively (Yanagimachi 1994). In the male reproductive tract, the epididymis synthesizes a large numbers of products and releases them into the lumen of the tract (Kinura et al. 1998, Gatti et al. 2004, Dacheux et al. 2005, Sipilä et al. 2009). These secretions are arranged around or on the different parts of the sperm, and affect sperm motility and proteolytic ability (Kinura et al. 1998, Cornwall 2009, Sipilä et al. 2009). Many epididymis tissue and development-specific genes that potentially contribute to specialized functions in sperm maturation or oocyte–sperm fusion have been identified and characterized (Penttinen et al. 2003, Gatti et al. 2004, Dacheux et al. 2005, Thimon et al. 2007). For example, P34H expressed in the epididymis progressively accumulates in the sperm acrosomal region, and participates in zona pellucida recognition and binding (Saez et al. 2003). Furthermore, TESP5, a gelatin-hydrolyzing serine protease, is involved in the acrosome reaction and sperm penetration of the zona pellucida in the mouse (Honda et al. 2002). TESP5 is initially synthesized in the testis, then is converted into active enzymes during sperm transport in the epididymis and localized on the sperm plasma membrane (Honda et al. 2002). In addition, several protease inhibitor families present in the epididymis, including the cystatin (Syntin & Coenwall 1999, Wassler et al. 2002, Hsia & Cornwall 2003), Kunitz (Penttinen et al. 2003), Kazal (Jalkanen et al. 2006), WAP (Jalkanen et al. 2006), and serpin families (Laurell et al. 1992, Law et al. 2006), interfere with the activity of enzymes on sperm and block fertilization.
In contrast, nonmotile male gamete systems are poorly understood, particularly in decapod crustaceans such as crayfish, crab, lobster, and prawn. Spermiogenesis, sperm maturation, and fertilization in decapods greatly differ from those of motile male gamete systems (Lynn & Clark 1983a, Shigekawa & Clark 1986, Bauer & Min 1993, Alfaro et al. 2007, Kang et al. 2008). First, decapod sperm are atypical and nonflagellate. A decapod sperm cell consists of a spherical main body with a variable number of radiating appendages (Talbot & Summers 1978, Medina 1994, Medina et al. 1994, Tudge et al. 1998, Kim et al. 2003, Kang et al. 2008). They are nonmotile and invariably enclosed in sperm packets called spermatophores before being transferred to the female during mating. A spermatophore is an uninterrupted column that is formed by secretory epithelium products in the terminal ampullae of the male reproductive tract (Lynn & Clark 1983a, Bauer & Min 1993, Tudge et al. 1998). Secondly, crustacean fertilization is external, occurring as the eggs are released from the female gonopores and pass posteriorly over the spermatophore mass (Lynn & Clark 1983b). However, few data are available about the genes and proteins that participate in sperm maturation of crustacean decapods.
In recent studies, some male reproductive tract peptides from the giant fresh water prawn, Macrobrachium rosenbergii, were examined. For instance, MRPINK, a Kazal-type peptidase inhibitor that is uniquely expressed in the male reproductive tract (Cao et al. 2007), was found to have an inhibitory effect on the gelatinolytic activity of prawn sperm and to specifically block the activity of M. rosenbergii sperm gelatinase (MSG), a sperm gelatinase (Li et al. 2008). Mr-IAG, an insulin-like peptide, is the androgenic gland (AG)-specific peptide in M. rosenbergii. Silencing of Mr-IAG led to the arrest of testicular spermatogenesis and spermatophore development in the terminal ampullae of the sperm duct (Ventura et al. 2009). Much more research is needed to understand the molecular mechanisms of sperm maturation and fertilization in crustaceans. The terminal ampullae are greatly dilated portions of the distal male reproductive tract in decapods, and they perform important functions on sperm maturation, such as secretion of epithelium products surrounding the sperm and storage of the mature spermatophore in a thick layer of muscle (Lynn & Clark 1983b, Pochon-Masson 1983). Consequently, identifying and characterizing the functions of terminal ampullae-specific proteins are important research goals.
In the present study, we identified a novel terminal ampullae peptide (TAP) gene in M. rosenbergii by screening a subtracted library. The mRNA expression and protein distribution were well illuminated. Furthermore, in vivo knockdown of the TAP gene by RNA interference (RNAi) was performed, and changes in various parameters related to reproductive function were evaluated. The influence of this knockdown on sperm gelatinolytic activity and proteolytic activity on the vitelline coat were detected.
Results
Gene screening and identification of TAP
To study the molecular mechanism of sperm maturation regulated by terminal ampullae in M. rosenbergii, a suppression subtractive hybridization (SSH) library was constructed using mRNA from the adult male reproductive tract. The dscDNA from terminal ampullae and vas deferens of M. rosenbergii were used as tester and driver respectively. Forty-seven clones were obtained from the SSH library enriched for the terminal ampullae-specific transcripts. One of them was found to be terminal ampullae-specific and was named TAP. The cDNA sequence contains 768 nucleotides, including an open-reading frame of 264 nucleotides which encodes an 88-amino acid peptide with a molecular weight of 10.165 kDa, pI 7.00. The deduced peptide consists of a putative 17-amino acid residue signal peptide and a 71-amino acid residue mature peptide. The amino acid sequence contains two predicted casein kinase II phosphorylation sites and a relatively high percentage of Leu and Cys (14.9 and 9.2% respectively; Fig. 1). The nucleotide sequence of TAP has been submitted to the GenBank database (accession number FJ595507).
Complete cDNA of TAP and its deduced amino acid sequence. The putative signal peptide sequence is marked in bold. The open boxes indicate the predicted casein kinase II phosphorylation sites. The asterisk indicates the position of the stop codon.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Complete cDNA of TAP and its deduced amino acid sequence. The putative signal peptide sequence is marked in bold. The open boxes indicate the predicted casein kinase II phosphorylation sites. The asterisk indicates the position of the stop codon.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Complete cDNA of TAP and its deduced amino acid sequence. The putative signal peptide sequence is marked in bold. The open boxes indicate the predicted casein kinase II phosphorylation sites. The asterisk indicates the position of the stop codon.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
TAP expression characterization and localization
As no signal was detected in northern blotting analysis, semi-quantitative RT-PCR was performed to characterize the tissue-specific expression pattern of the TAP gene using primers F2 and R1 (Table 1). The male reproductive tract of M. rosenbergii (Fig. 2A-a) is divided morphologically into three parts: testis, vas deferens, and terminal ampullae (Pochon-Masson 1983, Ro et al. 1990). Significant accumulations of mRNA were observed in terminal ampullae of the male reproductive tract, and fewer were observed in testis (Fig. 2A-b); mRNA expression was not detected in any other tissues, including vas deferens, ovary, hepatopancreas, heart, muscle, and thoracic ganglia. Thus, the results showed that the TAP gene was dominantly expressed in the terminal ampullae of the male reproductive tract.
Nucleotide sequences and positions of primers used in PCRs.
| Primer | Length (bp) | Position | Direction | Sequence (5′–3′) |
|---|---|---|---|---|
| F1 | 20 | 54–70 | F | GACGAGGACGAAGAAGAAGA |
| F2 | 20 | 131–150 | F | GGTCAACAGAGCGTCTATGA |
| R1 | 20 | 719–738 | R | ATGTAACTGTGCCGCTTGGA |
| R2 | 20 | 327–346 | R | CTATTTCTCGCAGCATTCCA |
| RNAiF | 20 | 98–117 | F | GCTCTAGACTTTTCTTGTTGATGGCACT |
| RNAiR | 20 | 314–333 | R | GGAATTCCATTCCAGGTTCATGTCGCA |
| GFPF | 30 | 122–144 | F | GGAATTCAACTTACCCTTAATTTTATTTGC |
| GFPR | 28 | 461–480 | R | GCTCTAGAGCCATTCTTTGGTTTGTCTC |
| ISHF | 20 | 101–121 | F | CCCAAGCTTTCTTGTTGATGGCACTGGTC |
| ISHR | 20 | 315–335 | R | GGAATTCAGCATTCCAGGTTCATGTCG |
| 18SF | 22 | F | GGTAGTGACGAAAAATAACAAT | |
| 18SR | 21 | R | CCCACCCCAGTCCGGAACTGA |
F and R indicate the forward and reverse directions respectively. The underlined regions represent the adscititious recognition sequences of restriction endonucleases.
Expression characterization and localization of TAP mRNA. (A) TAP mRNA expression in different tissues. (a) Diagram of the male reproductive tract. The tract was divided into three parts marked by the diagonal denotations. (b) Semi-quantitative RT-PCR. 18S was used as an inner control: testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), and thoracic ganglia (TG). (B) The expression of TAP mRNA in the three morphotypically differentiated developmental stages. (a) Examples of the three morphotypically differentiated developmental stages. Scale bar, 20 cm. (b) Semi-quantitative RT-PCR: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) In situ hybridization analysis of testis. (a, a′) A general cross-section: testicular lobules (TL), sperm (S), spermatogenic cells (SC). (b, b′) Antisense probe. The black arrows indicate positive signals. (c, c′) Sense probe. Scale bars, 30 μm. (D) In situ hybridization analysis of terminal ampullae. (a) A photograph of terminal ampullae with the adhesive androgenic gland (AG). (b) A hand drawn illustration of cross-section: muscle layer (M), spermatophore wall (SW), sperm (S), epithelial cell layer (E). (c, c′) Antisense probe. The black arrows indicate positive signals. (d, d′) Sense probe. Scale bars, 30 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Expression characterization and localization of TAP mRNA. (A) TAP mRNA expression in different tissues. (a) Diagram of the male reproductive tract. The tract was divided into three parts marked by the diagonal denotations. (b) Semi-quantitative RT-PCR. 18S was used as an inner control: testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), and thoracic ganglia (TG). (B) The expression of TAP mRNA in the three morphotypically differentiated developmental stages. (a) Examples of the three morphotypically differentiated developmental stages. Scale bar, 20 cm. (b) Semi-quantitative RT-PCR: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) In situ hybridization analysis of testis. (a, a′) A general cross-section: testicular lobules (TL), sperm (S), spermatogenic cells (SC). (b, b′) Antisense probe. The black arrows indicate positive signals. (c, c′) Sense probe. Scale bars, 30 μm. (D) In situ hybridization analysis of terminal ampullae. (a) A photograph of terminal ampullae with the adhesive androgenic gland (AG). (b) A hand drawn illustration of cross-section: muscle layer (M), spermatophore wall (SW), sperm (S), epithelial cell layer (E). (c, c′) Antisense probe. The black arrows indicate positive signals. (d, d′) Sense probe. Scale bars, 30 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Expression characterization and localization of TAP mRNA. (A) TAP mRNA expression in different tissues. (a) Diagram of the male reproductive tract. The tract was divided into three parts marked by the diagonal denotations. (b) Semi-quantitative RT-PCR. 18S was used as an inner control: testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), and thoracic ganglia (TG). (B) The expression of TAP mRNA in the three morphotypically differentiated developmental stages. (a) Examples of the three morphotypically differentiated developmental stages. Scale bar, 20 cm. (b) Semi-quantitative RT-PCR: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) In situ hybridization analysis of testis. (a, a′) A general cross-section: testicular lobules (TL), sperm (S), spermatogenic cells (SC). (b, b′) Antisense probe. The black arrows indicate positive signals. (c, c′) Sense probe. Scale bars, 30 μm. (D) In situ hybridization analysis of terminal ampullae. (a) A photograph of terminal ampullae with the adhesive androgenic gland (AG). (b) A hand drawn illustration of cross-section: muscle layer (M), spermatophore wall (SW), sperm (S), epithelial cell layer (E). (c, c′) Antisense probe. The black arrows indicate positive signals. (d, d′) Sense probe. Scale bars, 30 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
In M. rosenbergii, there are three morphotypically differentiated developmental stages (small males, orange-claw males, and blue-claw males; Fig. 2B-a), which have been reported to be under the control of the AG hormone (AGH; Kuris et al. 1987, Okumura & Hara 2004). Our results revealed that the TAP transcript level was low in immature prawns, and a steady increase was observed as gonad development in progressed (Fig. 2B-b).
In situ hybridization was used to determine the cellular location of TAP mRNA in testis and terminal ampullae. M. rosenbergii testis (Fig. 2C-a) consists of a large number of testiscular lobules or cylinders compactly held together by connective tissues (Sagi et al. 1988). During spermatogenesis, the testicular lobule (Fig. 2C-a′) contains a spermatogenic zone formed by germinal and sustentacular cells, and a large amount of sperm confined to a blind-ending cyst (Dougherty & Sandifer 1983, Sagi et al. 1988). In situ hybridization results showed that the distinct signals were observed in spermatogenic cells of testiscular lobules (Fig. 2C-b, b′), and no signal was detected in the testis hybridized with a sense control probe (Fig. 2C-c, c′).
Terminal ampullae are the end dilated part of male reproductive tract, and the AG adhibits on the outer surface of terminal ampullae (Fig. 2D-a). The epithelial cells synthesize secretions to form spermatophore wall (Pochon-Masson 1983), and the whole spermatophore was stored and packaged inside the muscle layer (Fig. 2D-b). In situ hybridization results showed that clear signals were observed in the epithelial cells of terminal ampullae and in AG cells (Fig. 2D-c, c′). The signal was absent in muscle layer. Hybridization with a sense control probe produced no significant signal in the tissues (Fig. 2D-d, d′).
In conclusion, our data showed that TAP mRNA was located specifically in the spermatogenic cells of testis, the epithelial cells of terminal ampullae, and AG cells. TAP was a terminal ampullae-dominating gene, and its transcription increased remarkably with AG maturation.
Western blotting and immunohistochemical analysis
Western blotting was performed to identify the distribution of TAP protein in the male reproductive tract. TAP protein was distributed exclusively on sperm and terminal ampullae; no signal was detected in other tissues (Fig. 3A). Analysis of the levels of TAP protein at different prawn developmental stages showed that along with gonad development, TAP protein increased steadily from the immature stage to the mature stage, and was abundantly accumulated in blue-claw prawns (Fig. 3B) in accordance with the trend of TAP mRNA in terminal ampullae. Immunohistochemical analysis further illustrated that TAP was located in secretory epithelial cells of terminal ampullae (Fig. 3C-a) and spermatophore sperm (Fig. 3C-a, a′). The signal was absent in the spermatophore wall. No hybridization signal was observed in sections incubated without anti-TAP antibody (Fig. 3C-b, b′).
Western blotting and immunohistochemical analysis. (A) The distribution of TAP protein in different tissues. Equal amounts of tissue proteins (50 μg) were hybridized with anti-TAP antibody. For the control protein, α-tubulin was detected with anti-α-tubulin antibody: sperm (S), testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), thoracic ganglia (TG), abdominal ganglia (AG), gill (GL), stomach (SH), and gut (GT). (B) The distribution of TAP protein in the three morphotypically differentiated developmental stages: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) Immunohistochemical analysis. Cross-sections of terminal ampullae (a) and spermatophore (a′) were hybridized with anti-TAP antibody: epithelial cell (E), spermatophore wall (SW), and sperm (S). The black arrows indicate positive signals. No hybridization signal was observed in sections incubated without anti-TAP antibody (b, b′). Scale bars, 40 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Western blotting and immunohistochemical analysis. (A) The distribution of TAP protein in different tissues. Equal amounts of tissue proteins (50 μg) were hybridized with anti-TAP antibody. For the control protein, α-tubulin was detected with anti-α-tubulin antibody: sperm (S), testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), thoracic ganglia (TG), abdominal ganglia (AG), gill (GL), stomach (SH), and gut (GT). (B) The distribution of TAP protein in the three morphotypically differentiated developmental stages: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) Immunohistochemical analysis. Cross-sections of terminal ampullae (a) and spermatophore (a′) were hybridized with anti-TAP antibody: epithelial cell (E), spermatophore wall (SW), and sperm (S). The black arrows indicate positive signals. No hybridization signal was observed in sections incubated without anti-TAP antibody (b, b′). Scale bars, 40 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Western blotting and immunohistochemical analysis. (A) The distribution of TAP protein in different tissues. Equal amounts of tissue proteins (50 μg) were hybridized with anti-TAP antibody. For the control protein, α-tubulin was detected with anti-α-tubulin antibody: sperm (S), testis (T), vas deferens (VD), terminal ampullae (TA), ovary (OV), hepatopancreas (HP), heart (HT), muscle (M), thoracic ganglia (TG), abdominal ganglia (AG), gill (GL), stomach (SH), and gut (GT). (B) The distribution of TAP protein in the three morphotypically differentiated developmental stages: small males (SM), orange-claw males (OC), and blue-claw males (BC). (C) Immunohistochemical analysis. Cross-sections of terminal ampullae (a) and spermatophore (a′) were hybridized with anti-TAP antibody: epithelial cell (E), spermatophore wall (SW), and sperm (S). The black arrows indicate positive signals. No hybridization signal was observed in sections incubated without anti-TAP antibody (b, b′). Scale bars, 40 μm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Thus, we concluded that TAP protein was secreted from the epididymal cells, and then transferred and localized on sperm in the terminal ampullae, and its expression increased steadily with gonad development.
Localization of TAP on sperm
The mature sperm of M. rosenbergii is a nonmotile, aflagellate, atypical cell that resembles an everted umbrella consisting of a base and a single spike. The main body (base) of the sperm is slightly cupped with a convex surface, and has a ruffled or irregular appearance of peripheral edges (Lynn & Clark 1983b). To determine the localization of TAP on sperm, individual sperm cells were taken from terminal ampullae and mounted on glass slides for immunoreactivity analysis. The immunofluorescence results showed distinct signals on the convex surface of the sperm base and spike (Fig. 4A-a) compared with control sperm (i.e. those not incubated with anti-TAP antibody; Fig. 4A-b). Moreover, transmission electron microscope immunohistochemical analysis revealed that vivid gold nanoparticles were exiguously scattered on the cap-like area of the convex surface of the base (Fig. 4B-a) and the spike of the sperm (Fig. 4B-b). No signal was observed on sperm incubated without anti-TAP antibody (Fig. 4B-c, d, e).
Immunolocalization of TAP on sperm. (A) Immunofluorescence analysis. Sperm from terminal ampullae were immunostained with anti-TAP antibody: base (b), spike (s). The immunofluorescence signal appeared on the convex surface of the sperm base as a green fluorescent zona and spike (a). White arrows indicate the positive signals. No fluorescence was detected on sperm incubated without anti-TAP antibody (b). The bright field images of sperm (a′, b′). Scale bars, 5 μm. (B) Transmission electron micrographs of immunohistochemical analysis. The prawn sperm were incubated with anti-TAP antibody and gold nanoparticles (a, b). Positive signals (white gold nanoparticles) were observed on the convex surface of the base (a) and the spike of sperm (b). No signal was detected on the base (c) and spike (d) of sperm (e) incubated without anti-TAP antibody. Scale bars, 100 nm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Immunolocalization of TAP on sperm. (A) Immunofluorescence analysis. Sperm from terminal ampullae were immunostained with anti-TAP antibody: base (b), spike (s). The immunofluorescence signal appeared on the convex surface of the sperm base as a green fluorescent zona and spike (a). White arrows indicate the positive signals. No fluorescence was detected on sperm incubated without anti-TAP antibody (b). The bright field images of sperm (a′, b′). Scale bars, 5 μm. (B) Transmission electron micrographs of immunohistochemical analysis. The prawn sperm were incubated with anti-TAP antibody and gold nanoparticles (a, b). Positive signals (white gold nanoparticles) were observed on the convex surface of the base (a) and the spike of sperm (b). No signal was detected on the base (c) and spike (d) of sperm (e) incubated without anti-TAP antibody. Scale bars, 100 nm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Immunolocalization of TAP on sperm. (A) Immunofluorescence analysis. Sperm from terminal ampullae were immunostained with anti-TAP antibody: base (b), spike (s). The immunofluorescence signal appeared on the convex surface of the sperm base as a green fluorescent zona and spike (a). White arrows indicate the positive signals. No fluorescence was detected on sperm incubated without anti-TAP antibody (b). The bright field images of sperm (a′, b′). Scale bars, 5 μm. (B) Transmission electron micrographs of immunohistochemical analysis. The prawn sperm were incubated with anti-TAP antibody and gold nanoparticles (a, b). Positive signals (white gold nanoparticles) were observed on the convex surface of the base (a) and the spike of sperm (b). No signal was detected on the base (c) and spike (d) of sperm (e) incubated without anti-TAP antibody. Scale bars, 100 nm.
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
In vivo knockdown of TAP by RNAi in M. rosenbergii
RNAi was performed by dsRNA injection into mature male M. rosenbergii prawns. Both the TAP mRNA and protein levels were reduced to <10% compared with control samples (Fig. 5A-a, b). Moreover, immunohistochemical analysis further illustrated that TAP protein was greatly decreased in RNAi-induced prawns. Only a weak signal was detected on sperm of RNAi-induced spermatophores, whereas a distinct intensity was visible in control sperm (Fig. 5A-c).
Differences between TAP RNAi-induced and control sperm extracts. (A-a) Detection of the relative TAP mRNA level in RNAi-induced and control groups. (A-b) Western blotting of RNAi-induced and control sperm extracts. (A-c) Immunohistochemical analysis of RNAi-induced and control spermatophores. Scale bars, 50 μm. (B) Gelatin SDS-PAGE zymographs. Three major bands with gelatinolytic activity were visible in the control sperm extract zymograph (black arrows), but the bands were not present in the RNAi-induced sperm extracts. (C) The proteolytic effect of sperm extracts on the vitelline coat: 1) sperm extracts, 2) vitelline coat, 3) vitelline coat incubated with control sperm extracts, and 4) vitelline coat incubated with RNAi-induced sperm extracts. Two bands (90 and 95 kDa) (arrows) were degraded when vitelline coat was incubated with control sperm extracts (3), but the degradation was blocked when vitelline coat was incubated with RNAi-induced sperm extracts (4).
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Differences between TAP RNAi-induced and control sperm extracts. (A-a) Detection of the relative TAP mRNA level in RNAi-induced and control groups. (A-b) Western blotting of RNAi-induced and control sperm extracts. (A-c) Immunohistochemical analysis of RNAi-induced and control spermatophores. Scale bars, 50 μm. (B) Gelatin SDS-PAGE zymographs. Three major bands with gelatinolytic activity were visible in the control sperm extract zymograph (black arrows), but the bands were not present in the RNAi-induced sperm extracts. (C) The proteolytic effect of sperm extracts on the vitelline coat: 1) sperm extracts, 2) vitelline coat, 3) vitelline coat incubated with control sperm extracts, and 4) vitelline coat incubated with RNAi-induced sperm extracts. Two bands (90 and 95 kDa) (arrows) were degraded when vitelline coat was incubated with control sperm extracts (3), but the degradation was blocked when vitelline coat was incubated with RNAi-induced sperm extracts (4).
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Differences between TAP RNAi-induced and control sperm extracts. (A-a) Detection of the relative TAP mRNA level in RNAi-induced and control groups. (A-b) Western blotting of RNAi-induced and control sperm extracts. (A-c) Immunohistochemical analysis of RNAi-induced and control spermatophores. Scale bars, 50 μm. (B) Gelatin SDS-PAGE zymographs. Three major bands with gelatinolytic activity were visible in the control sperm extract zymograph (black arrows), but the bands were not present in the RNAi-induced sperm extracts. (C) The proteolytic effect of sperm extracts on the vitelline coat: 1) sperm extracts, 2) vitelline coat, 3) vitelline coat incubated with control sperm extracts, and 4) vitelline coat incubated with RNAi-induced sperm extracts. Two bands (90 and 95 kDa) (arrows) were degraded when vitelline coat was incubated with control sperm extracts (3), but the degradation was blocked when vitelline coat was incubated with RNAi-induced sperm extracts (4).
Citation: REPRODUCTION 140, 2; 10.1530/REP-10-0062
Although RNAi-induced and control sperm showed neither significant abnormal phenotypes nor distinct changes in fertilization ability, the sperm gelatinolytic activity of RNAi treatment was remarkablely decreased. On the gelatin zymographs, three major bands with gelatinolytic activity were observed at ∼120, 20, and 16 kDa in control sperm extracts (Fig. 5B-control). In contrast, these bands were not present in RNAi sperm extracts (Fig. 5B-RNAi). This result illustrates that the gelatinolytic activity of RNAi-induced sperm was distinctly inhibited.
To further explain the influence of TAP knockdown on sperm activity, the proteolytic activity of sperm extracts on the vitelline coat was analyzed using 10% SDS-PAGE. When the vitelline coat was incubated with control sperm extracts for 24 h at 28 °C, the two major bands (90 and 95 kDa) of vitelline coat components were sharply degraded (Fig. 5C-1, 2, 3). However, these bands were intact, and degradation of the vitelline coat was inhibited when incubated with RNAi sperm extracts (Fig. 5C-4). The proteolytic activity of sperm extracts on the vitelline coat was obviously blocked. These results indicate that TAP likely plays a crucial role in regulating sperm proteolytic activity during sperm maturation and degradation of vitelline coat.
Discussion
The male reproductive tract and spermiogenesis of crustaceans are extraordinarily different from those of vertebrates (Lynn & Clark 1983a, Pochon-Masson 1983, Shigekawa & Clark 1986, Bauer & Min 1993, Alfaro et al. 2007). To date, only a few sperm proteins have been reported to be associated with reproduction in decapods. In the present study, we successfully isolated a novel terminal ampullae gene and named it TAP. We found that TAP mRNA was transcribed dominatingly in terminal ampullae of the male reproductive tract, and that TAP protein was distributed exclusively on terminal ampullae and sperm.
In situ hybridization revealed that TAP was located in the spermatogenic cells of testis, the epithelial cells of terminal ampullae, and in AG cells. The AG is a peculiar and unique gland in crustaceans, and principally governs male sexual differentiation. In the isopod, Armadillidium vulgare, the gonads of genetic females were transformed into testes by implantations of AGs during the sex differentiation period (Suzuki 1999). AG is also essential for inhibiting female differentiation, and controlling male primary (e.g. spermatogenesis) and secondary (e.g. external morphology) sexual characteristics (Sagi et al. 1990, 1997, Suzuki 1999, Khalaila et al. 2001, Ventura et al. 2009). In the red claw crayfish, Cherax quadricarinatus, most immature females with AG implanted developed male-like propodi and inhibited female secondary sex characteristics and vitellogenesis (Khalaila et al. 2001). At present, AGHs have been isolated in the terrestrial isopod species A. vulgare (Okuno et al. 1999), Porcellio scaber, and P. dilatatus (Ohira et al. 2003). However, decapod AGHs have not been identified, and only two AG-specific genes have been characterized: the C. quadricarinatus insulin-like AG factor (Cq-IAG) gene (Manor et al. 2007), and the M. rosenbergii insulin-like AG (Mr-IAG) gene (Ventura et al. 2009). In our study, the distribution of TAP mRNA in AG cells indicated that TAP was one component of the AG, and that it may be a peptide involved in sexual function. AG seems to synthesize several proteins (e.g. TAP and Mr-IAG) to cooperate and regulate sexual functions in M. rosenbergii.
Moreover, TAP was located in the spermatogenic cell zone of testicular lobules in testis. In general, testicular lobules are full with spermatocytes during the sexually differentiated period. During spermatogenesis, testicular lobules always contain the spermatogenic zone and sperm, whereas the testicular lobules of mature males contain mature spermatozoa almost to the exclusion of other cell types, and the spermatogenic zone is barely observable (Sagi et al. 1988). In RNAi-induced small males, both spermatogenic zone and sperm were present in comparison with only spermatocytes present in control groups (data not shown). Silencing of TAP led to the express development of testicular spermatogenesis. These results clearly indicate that TAP participates in controlling spermatogenesis.
On the other hand, TAP mRNA was also found in the epithelial cells of terminal ampullae. Generally, the epithelial cells secrete numerous and complex regulatory elements into the lumen to modify pre-existing proteins or maintain a particular environment for sperm activity. These epididymis secretion processes are highly regulated, and half of the epididymal proteins are under androgen control (Dacheux et al. 2005). In our study, TAP likely was a secreted protein, as indicated by the existence of a 17-amino acid signal peptide. It was originally synthesized from epithelial cells, transferred on sperm, and then participated in controlling or inducing the final sperm changes. Moreover, this process likely was under AG control, as TAP expression increased progressively in the three morphotypically differentiated developmental stages.
The RNAi technique was applied to reveal the potential function of TAP in fertilization and sperm maturation. The mature male prawns underwent targeted gene disruption to elucidate the functional role of TAP. When RNAi-induced male prawns were bred with females of proven fertility, they were found to be fertile. The fertilization ratio and fertilized egg cell development showed no difference between RNAi-induced and control groups (data not shown). RNAi-induced male prawns also were used to evaluate different parameters related to reproductive function. No difference between treated and control prawns was observed in terminal ampullae at the histological level, and no apparent changes were detected in sperm morphology (data not shown). In other words, TAP gene knockdown had no influence on the process and capability of fertilization. Hence, TAP does not seem to be essential for M. rosenbergii fertilization.
Considering that gene knockdown might influence sperm maturation, we evaluated the proteolytic activity of RNAi-induced sperm and their ability to penetrate the egg coat. Routine investigation of sperm viability, motility, and incidence of spontaneous acrosome reactions are not suitable for prawn sperm because they are nonmotile, aflagellate, and atypical. Instead, we used other methods to test sperm activity. Previously, the gelatin SDS-PAGE assay was routinely used to determine acrosin activity of crustacean sperm (Rios & Barros 1997, Honda et al. 2002, Li et al. 2008). In this study, gelatinolytic activity of sperm extracts was reduced in RNAi-induced prawns. The knockdown of the TAP gene caused a significant inhibitory effect on the gelatinolytic activity of prawn sperm. More interestingly, the activity of MSG was also severely impaired in RNAi-induced prawns (data not shown). These results indicate that the TAP protein may play an important role in regulating sperm proteolytic activity in terminal ampullae.
Such gelatinolytic activity has also been suggested to play a role in nonmotile decapod sperm penetration of the vitelline coat (Rios & Barros 1997, Honda et al. 2002, Li et al. 2008). Several reports have indicated that sperm extracts possess proteolytic activity on vitelline coat components. For instance, in ascidians, enzymes released from the sperm acrosome degraded a sperm receptor, HrVC70 (70 kDa), on the surface of the vitelline coat during fertilization (Lambert et al. 2002, Sawada et al. 2002). Likewise, in M. rosenbergii, two major components (90 and 95 kDa) of the vitelline coat were hydrolyzed by the sperm extracts (Li et al. 2008). In the present study, sperm proteolytic activity on the vitelline coat was severely impaired in RNAi-induced prawn. Moreover, the vitelline coat degradation of the fertilized eggs of females that mated with the RNAi males was distinctly different from wild-type group. The vitelline coat of wild-type fertilized eggs was immediately degraded into several various sized proteins. Whereas, only few degraded proteins were observed in RNAi group (data not shown). There are likely to other fungible pathways to help sperm penetration vitelline coat in the fertilization of TAP silencing group. In other words, silencing of TAP mRNA interfered with prawn sperm's ability to degrade the vitelline coat. Thus, TAP likely performs a pivotal role in regulating the proteolytic activity of the sperm.
In general, a sperm cell contains a differentiated organelle, the acrosome, which packages digestive enzymes (including hyaluronidase and acrosin). Many proteinases and protein inhibitors are located or bound specifically to the acrosomal region (Stein et al. 2006), and perform specific functions (Vacquier 1998, Sawada & Yokota 2007, Kashiwabara & Baba 2009). In most decapods (e.g. Sicyonia ingentis and Penaeus aztecus), the spike of the sperm is part of an elaborate acrosomal complex (Medina et al. 1994). However, the structure of the M. rosenbergii spike is dissimilar, and its possible role in the acrosome remains uncertain (Lynn & Clark 1983b). The spike is composed primarily of protein, projects from the convex surface of the base, is formed by radial fibril anastomosis, and undergoes a dramatic bending process during fertilization (Lynn & Clark 1983a). In our study, the immunolocalization assay provided evidence that TAP was located on the convex surface of the sperm base and the spike. This peculiar distribution of TAP further implied the crucial function of TAP in the sperm–egg interaction. In a previous study, MRPINK was also illustrated to bond to the lateral edge of the sperm base (Li et al. 2008). Thus, the convex surface of the sperm base and the spike may have a function similar to that of the acrosome, as they contain proteins involved in the sperm–egg interaction. We conclude that TAP affects the activity of the proteinases or protease inhibitors on the sperm spike during sperm maturation process of terminal ampullae. Further studies are needed to identify its target peptide and regulatory elements in sperm maturation and degradation vitelline coat.
Materials and Methods
Animals
Giant fresh water prawns, M. rosenbergii, were obtained from Yuanpu Prawn Culture located in Hangzhou, China. They were reared in aquaria with circulating freshwater at 25 °C with an artificial photoperiod of 14-h light:10-h dark per day. Prawns were fed with compound foods twice daily.
Total RNA extraction, cDNA synthesis, and SSH
Mature male prawns were placed in an ice bath for 1–2 min until they were lightly anesthetized. Vas deferens and terminal ampullae of the male reproductive tract were removed, snap-frozen in liquid nitrogen, and stored at −80 °C until RNA preparation. Tissues were homogenized in Trizol Reagent (Invitrogen), and total RNA was prepared according to the manufacturer's instructions.
Next, 2 μg of each total RNA were used to synthesize the first-strand cDNA using PowerScript reverse transcriptase (Takara Bio Inc., Otsu, Kyoto, Japan) at 42 °C for 90 min, and two adaptors were added to both ends using the SMART 3′ CDS Primer II A and SMART II Oligonucleotide (SMART PCR cDNA Synthesis Kit; Takara Bio Inc). The first-strand cDNAs were purified by NucleoSpin columns (Takara Bio Inc.), and then were amplified using 5′ PCR Primer II A for optimized cycles. The dscDNAs were purified using NucleoSpin columns.
For SSH, the dscDNAs of terminal ampullae samples were used as the tester, and the dscDNAs of vas deferens samples were used as the driver. The subtractive library was generated using the Clontech PCR-Select cDNA Subtraction Kit (Takara Bio Inc.), according to established protocols. After two cycles of hybridization and two cycles of PCR amplification, a total of 192 individual recombinant clones in pUCm-T vector (Bio Basic Inc., Markham, ON, Canada) were chosen and used as templates for PCR amplification using the vector primers M13F and M13R. Each PCR product (1 μl) was spotted onto a nylon membrane (Milllipore Corporation, Billerica, MA, USA), hybridized with the tester and driver cDNA probes in order, and detected using the digoxigenin (DIG) chemiluminescent detection system (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche Diagnostics GmbH).
3′- and 5′-RACE
Forty-seven clones that exhibited distinct expression differences according to the SSH results were sequenced (Shanghai Sangon Biological Engineering Technology & Service Co. Ltd, Shanghai, China). One full-length cDNA (TAP) of these clones was obtained using the RACE method. The gene-specific primers F1 and F2 for 3′-RACE, and R1 and R2 for 5′-RACE (Table 1) were designed based on the nucleotide sequences of TAP, and the cDNAs for RACE were synthesized from the terminal ampullae of the male reproductive tract. All processes of 3′- and 5′-RACE were conducted following the manufacturer's protocol for the FirstChoice RLMRACE Kit (Ambion; Austin, TX, USA). The sequenced cDNA was analyzed using Lasergene software (DNAStar Inc., Madison, WI, USA), the deduced amino acid sequence of the peptide was predicted by the PredictProtein (http://www.predictprotein.org/) and Scratch Protein Predictor (http://www.ics.uci.edu/~baldig/scratch/) websites, and the potential signal sequences were identified using SignalP V3.0 at the Center for Biological Sequence Analysis (http://www.cbs.dtu.dk/services/SignalP). Otherwise, Blast (blastx and blastn) program was performed for protein analysis using the NCBI website (http://www.ncbi.nlm.nih.gov/blast). The nucleotide sequence of TAP was submitted to GenBank under the accession number FJ595507.
Semi-quantitative RT-PCR
All the tissues, including muscle, hepatopancreas, heart, thoracic ganglia, gut, ovary, and all three parts of the male reproductive tract, were removed from mature prawns. Tissues were homogenized in Trizol reagent (Invitrogen), and total RNA was prepared according to the manufacturer's instructions.
First-strand cDNAs of each sample were synthesized from 2 μg of total RNA using the SuperScript/First-Strand cDNA Synthesis Kit (Invitrogen). Next, 2 μl of RT products were used as the PCR templates, and both the TAP cDNA fragment and the constitutively expressed 18S cDNA fragment were simultaneously amplified in a 25-μl reaction containing 10 pmol of F2 and R1 (Table 1) and 5 pmol of 18SF and 18SR (Table 1). After PCR amplification, an aliquot of the PCR products was fractionated in a 1.5% agarose gel.
Relative abundances were expressed as the ratio of TAP transcript levels to those of 18S (GenBank accession number DQ642856). In each case, peak values were set to 100, and the rest of the values were normalized. All data are from three separate RNA pools.
In situ hybridization
The DIG-labeled sense and antisense RNA probes corresponding to nucleotides 101–335 of M. rosenbergii TAP cDNA cloned in the plasmid vector pSPT18 were transcribed in vitro using the DIG RNA Labeling kit SP6/T7 (Roche Diagnostics GmbH) from the EcoRI- and HindIII-linearized templates respectively.
For tissue slice preparation, terminal ampullae and testis were removed from the specimens and immediately snap-frozen in liquid nitrogen. The samples were embedded in a TissueTek OCT-compound (Sakura Finetechnical Co. Ltd, Chuo-ku, Tokyo, Japan), and cut into 8-μm thick section using a frozen ultramicrotome. Dry sections were fixed with 4% (w/v) paraformaldehyde, digested with proteinase K, and hybridized at 42 °C overnight. These slices were then blocked by 1% blocking solution (Roche Diagnostics GmbH) and treated with the anti-DIG-alkaline phosphatase (AP) conjugate fab fragments (1:500, Roche Diagnostics GmbH) and visualized with the colorimetric substrates nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate toluidine salt (NBT/BCIP; 1:50, Roche Diagnostics GmbH) according to the manufacturer's instructions. Finally, photographs were taken using an inverted microscope equipped with a camera (Nikon Eclipse TE2000-S; Nikon Instruments Inc., Kyoto, Japan).
SDS-PAGE and western blotting
Proteins were extracted from each tissue using protein loading buffer (0.2 mmol/l dithiothreitol, 4% (w/v) SDS, 0.2% (w/v) bromphend blue, 20% (v/v) glycerol in 0.1 mmol/l Tris–HCl, pH 6.8). Rabbit anti-TAP antibody was produced by immunization with TAP polypeptide (CSVYDKSEEEQIEL; HuaAn Biotechnology Co. Ltd, Hangzhou, China). Then, 50 μg of protein of each sample were separated on 12.5% SDS-PAGE gels and transferred to PVDF membranes (Milllipore Corporation) for western blotting analysis. The membranes were incubated with anti-TAP antibody (1:600, HuaAn Biotechnology Co. Ltd) and anti-α-tubulin antibody (1:10 000; HuaAn Biotechnology Co. Ltd) overnight at 4 °C, and detected using the BM Chemiluminescence Western Blotting Kit (Roche Diagnostics GmbH).
Immunohistochemistry
The terminal ampullae and spermatophores were removed from the specimens and cut into 8-μm thick sections for tissue slice preparation according to the above instructions. Frozen sections were alcohol-gradient dehydrated and incubated with the anti-TAP antibody (1:60) overnight at 4 °C, then incubated with the goat anti-rabbit IgG (Fc) AP-conjugate secondary antibody (1:250; Promega Corporation). The staining was performed using the NBT/BCIP solution in the darkness.
Immunolocalization of TAP on sperm
Spermatophores from terminal ampullae were fragmented and resuspended in PBS. Sperm suspensions were mounted on glass slides and dried up. All samples were fixed in 4% (w/v) paraformaldehyde/PBS for 10 min. After washing with PBS, slides were blocked with 0.5% BSA (w/v)/PBS for 1 h and incubated with anti-TAP antibody (1:60) at 4 °C overnight. After washing with 0.1% (v/v) Tween-20/PBS, the slides were incubated with anti-rabbit IgG labeled with Alexa Fluor 488 (1:250; Biotechnology Co. Ltd) for 30 min at 37 °C. After washing, the slides were observed under a fluorescence microscope (Nikon Eclipse TE2000-S; Nikon Instruments Inc).
For transmission electron microscopy (TEM) immunohistochemical analysis, sperm were fixed in 2.5% (v/v) glutaraldehyde/PBS at 4 °C overnight. Then, they were washed and postfixed in 1% (w/v) osmium tetroxide, dehydrated in a graded acetone series, and embedded in spurr resin. Sections of 70 nm were cut with a microtome (Leica EM UC6; Leica, Nussloch, Germany), incubated with the anti-TAP antibody (1:100), and coated with 15 nm gold nanoparticle-conjugated secondary antibody (1:50; HuaAn Biotechnology Co. Ltd). Sperm were viewed under the TEM (JEM-1230; JEOL Ltd, Tokyo, Japan) and photographed at a voltage of 80 kV.
RNA interference
A pair of primers (RNAiF and RNAiR in Table 1) was designed for the preparation of TAP dsRNA. A 236-bp cDNA fragment was subcloned into the plasmid pET-T7 vector at the XbaI and EcoRI restriction sites. For a negative control, a 359-bp GFP cDNA fragment was amplified using the primers GFPF and GFPR (Table 1), and then subcloned into the pET-T7 vector at the same restriction sites. The recombinant plasmids were transformed into Escherichia coli HT115, and the dsRNAs were produced and purified as described by Yodmuang et al. (2006).
For RNAi experiments, mature male prawns (25–35 g) were purchased from the prawn culture facility. In total, 40 M. rosenbergii males were selected according to the presence of genital papillae on the fifth walking legs, and were acclimated in a culture tank 1 week prior to injection. Then, 2 μl of TAP dsRNA (10 μg in 0.9% (w/v) physiological saline) were injected into the prawns (n=20) through the arthrodial membrane at the basis of the fifth walking leg using microinjection needles. The controls (n=20) received an equal amounts of GFP dsRNA injection. Prawns were returned to the culture tanks for 4 weeks before being killed to obtain samples for further analysis.
Gelatin SDS-PAGE
A 10% SDS-PAGE containing 0.1% (w/v) gelatin was prepared according to the technique described previously (Rios & Barros 1997). Spermatophores from terminal ampullae were fragmented, resuspended in PBS, and treated with ultrasound for periods of 3 s on an ice bath for a total of 10 min in 50 mmol/l Tris–HCl, pH 7.4. The suspension was centrifuged at 12 000 g for 10 min at 4 °C. The supernatant was stored at −80 °C until use. Sperm extracts (30 μg) were loaded and ran in nonreducing conditions at 20 mA at 4 °C. After electrophoresis, the gels were equilibrated in 0.1 mol/l Tris–HCl, pH 8.0, containing 2.5% (v/v) Triton X-100 for 1.5 h at room temperature. After being washed several times with 0.1 mol/l Tris–HCl, pH 8.0, the gels were incubated for 20 h at 37 °C in the same buffer without Triton X-100, but containing 5 mmol/l CaCl2 and 0.2 mol/l NaCl. The gels were stained with Coomassie blue.
Extraction of vitelline coat
The mature ovary was dissected from the cephalothorax of three reproductive ecdysis females. The membrane surrounding the ovary was gently peeled off and discarded. Oocytes were suspended in PBS containing 0.5% (v/v) Triton X-100. After stirring for 30 min at 4 °C, the suspension was centrifuged at 10 000 g for 30 min to obtain the supernatant (i.e. the solubilized vitelline coat). The proteolytic effect of sperm extracts on the vitelline coat was evaluated by coincubation of the vitelline coat with sperm extracts for 24 h at 28 °C, and then analysis by 10% SDS-PAGE in reducing conditions.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Science and Technology Department of Zhejiang Province (2008C02G2010021).
Acknowledgements
We wish to thank Ping Yang of Zhejiang University for assistance with the transmission electron microscope immunohistochemical analysis and Ye Li of Ningbo University for help with the sperm gelatin SDS-PAGE assay.
References
Alfaro J, Ulate K & Vargas M 2007 Sperm maturation and capacitation in the open thelycum shrimp Litopenaeus (Crustacea: Decapoda: Penaeoidea). Aquaculture 270 436–442.
Bauer RT & Min LJ 1993 Spermatophores and plug substance of the marine shrimp Trachypenaeus similis (Crustacea: Decapoda: Penaeidae): formation in the male reproductive tract and disposition in the inseminated female. Biological Bulletin 185 174–185.
Cao JX, Dai JQ, Dai ZM, Yin GL & Yang WJ 2007 A male reproduction-related Kazal-type peptidase inhibitor gene in the prawn, Macrobrachium rosenergii molecular characterization and expression patterns. Marine Biotechnology 9 45–55.
Cornwall GA 2009 New insights into epididymal biology and function. Human Reproduction Update 15 213–227.
Dacheux JL, Castella S, Gatti JL & Dacheus F 2005 Epididymal cell secretory activities and the role of proteins in boar sperm maturation. Theriogenology 63 319–341.
Dougherty WJ & Sandifer PA 1983 Junctional relationships between germinal cells and sustentacular cells in the testes of a palaemonid shrimp. Tissue and Cell 16 115–124.
Gatti JL, Castella S, Dacheux F, Ecroyd H, Métayer S, Thimon V & Dacheux JL 2004 Post-testicular sperm environment and fertility. Animal Reproduction Science 82–83 321–339.
Honda A, Yamagata K, Sugiura S, Watanabe K & Baba T 2002 A mouse serine protease TESP5 is selectively included into lipid rafts of sperm membrane presumably as a glycosylphosphatidylinositol-anchored protein. Journal of Biological Chemistry 277 16976–16984.
Hsia N & Cornwall GA 2003 Cres2 and Cres3: new members of the cystatin-related epididymal spermatogenic subgroup of family 2 cystatins. Endocrinology 144 909–915.
Jalkanen J, Kotimäki M, Huhtaniemi I & Poutanen M 2006 Novel epididymal protease inhibitors with Kazal or WAP family domain. Biochemical and Biophysical Research Communications 349 245–254.
Kang XJ, Ge SQ, Guo MS, Liu GR & Mu SM 2008 A transmission electron microscopy investigation: the membrane complex in spermatogenesis of Fenneropenaeus chinensis. Cytotechnology 56 113–121.
Kashiwabara SI & Baba T 2009 Functional roles of mouse sperm hyaluronidases, HYAL5 and SPAM1, in fertilization. Biology of Reproduction 81 939–947.
Khalaila I, Katz T, Abdu U, Yehezkel G & Sagi A 2001 Effects of implantation of hypertrophied androgenic glands on sexual characters and physiology of the reproductive system in the female red claw crayfish, Cherax quadricarinatus. General and Comparative Endocrinology 121 242–249.
Kim DH, Jo Q, Choi JH, Yun SJ, Oh TY, Kim BK & Han CH 2003 Sperm structure of the pandalid shrimp Pandalopsis japonica (Decapoda Pandalidae). Journal of Crustacean Biology 23 23–32.
Kinura M, Kim E, Kang W, Yamashita M, Saigo M, Yamazaki T, Nakanishi T & Kirchhoff C 1998 Molecular characterization of epididymal proteins. Reproduction 3 86–95.
Kuris AM, Ra'anan Z, Sagi A & Cohen D 1987 Morphotypic differentiation of male Malaysian giant prawns, Macrobrachium rosenbergii. Journal of Crustacean Biology 7 219–237.
Lambert CC, Someno T & Sawada H 2002 Sperm surface proteases in ascidian fertilization. Journal of Experimental Zoology 292 88–95.
Laurell M, Christensson A, Abrahamsson PA, Stenflo J & Lilja H 1992 Protein C inhibitor in human body fluids and seminal plasma is rich in inhibitor antigen deriving from cells throughout the male reproductive system. Journal of Clinical Investigation 89 1094–1101.
Law RH, Zhang QW, McGowan S, Buckle AM, Silverman GA, Wong W, Rosado CJ, Langendorf CG, Pike RN & Bird PI et al. 2006 An overview of the serpin superfamily. Genome Biology 7 216.
Li Y, Ma WM, Dai JQ, Feng CZ, Yang F, Ohira T, Nagasawa H & Yang WJ 2008 Inhibition of a novel sperm gelatinase in prawn sperm by the male reproduction-related Kazal-type peptidase inhibitor. Molecular Reproduction and Development 75 1327–1337.
Lynn JW & Clark WH Jr 1983a A morphological examination of sperm–egg interaction in the freshwater prawn, Macrobrachium rosenergii. Biological Bulletin 164 446–458.
Lynn JW & Clark WH Jr 1983b The fine structure of the mature sperm of the freshwater prawn, Macrobrachium rosenergii. Biological Bulletin 164 459–470.
Manor R, Weil S, Oren S, Glazer L, Aflalo DE, Ventura T, Chalifa-Caspi V, Lapidot M & Sagi A 2007 Insulin and gender an insulin like gene expressed exclusively in the androgenic gland of the male crayfish. General and Comparative Endocrinology 150 326–336.
Medina A 1994 Spermiogenesis and sperm structure in the shrimp Parapenaeus longirostris (Crustacea, Dendrobranchiata): comparative aspects among decapods. Marine Biology 119 449–460.
Medina A, Lo′ pez de la Rosa I & Santos A 1994 Ultrastructural comparison of the spermatozoa of Sicyonia carinata (Sicyoniidae) and Penaeopsis serrata (Penaeidae) shrimps (Crustacea, Dendrobranchiata), with particular emphasis on the acrosomal structure. Journal of Submicroscopic Cytology and Pathology 26 395–403.
Ohira T, Hasegawa Y, Tominaga S, Okuno A & Nagasawa H 2003 Molecular cloning and expression analysis of cDNAs encoding androgenic gland hormone precursors from two porcellionidae species, Porcellio scaber and P. dilatatus. Zoological Science 20 75–81.
Okumura T & Hara M 2004 Androgenic gland cell structure and spermatogenesis during the molt cycle and correlation to morphotypic differentiation in the giant freshwater prawn, Macrobrachium rosenbergii. Zoological Science 21 621–628.
Okuno A, Hasegawa Y, Ohira T, Katakura Y & Nagasawa H 1999 Characterization and cDNA cloning of androgenic gland hormone of the terrestrial isopod Armadillidium vulgare. Biochemical and Biophysical Research Communications 264 419–423.
Penttinen J, Pujianto DA, Sipilä P, Huhtaniemi L & Poutanen M 2003 Discovery in silico and characterization in vitro of novel genes exclusively expressed in the mouse epididymis. Molecular Endocrinology 17 2138–2151.
Pochon-Masson J 1983 Arthropoda-Crustacea. In Reproductive Biology of Invertebrates, pp 107–449 Ed. Adiyodi KG. New York: John Wiley and Sons Press.
Rios M & Barros C 1997 Trypsin-like enzymes during fertilization in the shrimp Rhynchocinetes typus. Molecular Reproduction and Development 46 581–586.
Ro S, Talbot P, Leung-Trujillo J & Lawrence AL 1990 Structure and function of the vas deferens in the shrimp Penaeus setiferus: segments 1–3. Journal of Crustacean Biology 10 455–468.
Saez F, Frenette G & Sullivan R 2003 Epididymosomes and prostasomes: their roles in posttesticular maturation of the sperm cells. Journal of Andrology 24 149–154.
Sagi A, Milner Y & Cohen D 1988 Spermatogenesis and sperm storage in the testes of the behaviorally distinctive male morphotypes of Macrobrachium tosenbergii (Decapoda, Palaemonidae). Biological Bulletin 174 330–336.
Sagi A, Cohen D & Milner Y 1990 Effect of androgenic gland ablation on morphotypic differentiation and sexual characteristics of male freshwater prawns, Macrobrachium rosenbergii. General and Comparative Endocrinology 77 15–22.
Sagi A, Snir E & Khalaila I 1997 Sexual differentiation in decapod crustaceans: role of the androgenic gland. Invertebrate Reproduction and Development 31 55–61.
Sawada H & Yokota N 2007 Sperm proteasomes are responsible for the acrosome reaction and sperm penetration of the vitelline envelope during fertilization of the sea urchin Pseudocentrotus depressus. Developmental Biology 308 222–231.
Sawada H, Sakai N, Abe Y, Tanaka E, Takahashi Y, Fujino J, Kodama E, Takizawa S & Yokosawa H 2002 Extracellular ubiquitination and proteasome-mediated degradation of the ascidian sperm receptor. PNAS 99 1223–1228.
Shigekawa K & Clark WH Jr 1986 Spermiogenesis in the marine shrimp, Sicyonia ingentis. Development, Growth & Differentiation 28 95–112.
Sipilä P, Jalkanen J, Huhtaniemi IT & Poutanen M 2009 Novel epididymal proteins as targets for the development of post-testicular male contraception. Reproduction 137 379–389.
Stein KK, Go JC, Lane WS, Primakoff P & Myles DG 2006 Proteomic analysis of sperm regions that mediate sperm–egg interactions. Proteomics 6 3533–3543.
Suzuki S 1999 Androgenic gland hormone is a sex-reversing factor but cannot be a sex-determining factor in the female crustacean isopods Armadillidium vulgare. General and Comparative Endocrinology 115 370–378.
Syntin P & Coenwall GA 1999 Immunolocalization of CRES (Cystatin-Related Epididymal Spermatogenic) protein in the acrosomes of mouse spermatozoa. Biology of Reproduction 60 1542–1552.
Talbot P & Summers RG 1978 The structure of sperm from Panulirus, the spiny lobster, with special regard to the acrosome. Journal of Ultrastructure Research 64 341–351.
Thimon V, Koukoui O, Calvo E & Sullivan R 2007 Region-specific gene expression profiling along the human epididymis. Molecular Human Reproduction 7 1–14.
Tudge CC, Jamieson BGM, Sandberg L & Eeséus C 1998 Ultrastructure of the mature spermatozoon of the king crab Lithodes maja (Lithodidae Anomura, Decapoda): further confirmation of a lithodid–pagurid relationship. Invertebrate Biology 117 57–66.
Vacquier VD 1998 Evolution of gamete recognition proteins. Science 281 1995–1998.
Ventura T, Manor R, Aflalo ED, Weil S, Raviv S, Glazer L & Sagi A 2009 Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology 150 1278–1286.
Wassarman PM 1999 Mammalian fertilization: molecular aspects of gamete adhesion, exocytosis, and fusion. Cell 96 175–183.
Wassler M, Syntin P, Sutton-Walsh HG, Hsia N, Hardy DM & Cornwall GA 2002 Identification and characterization of cystatin-related epididymal spermatogenic protein in human spermatozoa: localization in the equatorial segment. Biology of Reproduction 67 795–803.
Yanagimachi R 1994 Fertility of mammalian spermatozoa: its development and relativity. Zygote 2 371–372.
Yodmuang S, Tirasophon W, Roshorm Y, Chinnirunvong W & Panyim S 2006 YHV-protease dsRNA inhibits YHV replication in Penaeus monodon and prevents mortality. Biochemical and Biophysical Research Communications 341 351–356.
