Conjugated linoleic acids attenuate FSH- and IGF1-stimulated cell proliferation; IGF1, GATA4, and aromatase expression; and estradiol-17β production in buffalo granulosa cells involving PPARγ, PTEN, and PI3K/Akt

in Reproduction

Conjugated linoleic acid (CLA) has drawn much interest in last two decades in the area ranging from anticancer activity to obesity. A number of research papers have been published recently with regard to CLA's additional biological functions as reproductive benefits. However, not much is known how this mixture of isomeric compounds mediates its beneficial effects particularly on fertility. In this study, we demonstrated the cross talk between downstream signaling of CLA and important hormone regulators of endocrine system, i.e. FSH and IGF1, on buffalo granulosa cell function (proliferation and steroidogenesis). Experiments were performed in primary serum-free buffalo granulosa cell culture, where cells were incubated with CLA in combination with FSH (25 ng/ml) and IGF1 (50 ng/ml). Results showed that 10 μM CLA inhibits FSH- and IGF1-induced granulosa cell proliferation; aromatase, GATA4, and IGF1 mRNA; and estradiol-17β production. Western blot analysis of total cell lysates revealed that CLA intervenes the IGF1 signaling by decreasing p-Akt. In addition, CLA was found to upregulate peroxisome proliferator-activated receptor-gamma (PPARG) and phosphatase and tensin homolog (PTEN) level in granulosa cells. Further study using PPARG- and PTEN-specific inhibitors supports the potential role of CLA in granulosa cell proliferation and steroidogenesis involving PPARG, PTEN, and PI3K/Akt pathway.

Abstract

Conjugated linoleic acid (CLA) has drawn much interest in last two decades in the area ranging from anticancer activity to obesity. A number of research papers have been published recently with regard to CLA's additional biological functions as reproductive benefits. However, not much is known how this mixture of isomeric compounds mediates its beneficial effects particularly on fertility. In this study, we demonstrated the cross talk between downstream signaling of CLA and important hormone regulators of endocrine system, i.e. FSH and IGF1, on buffalo granulosa cell function (proliferation and steroidogenesis). Experiments were performed in primary serum-free buffalo granulosa cell culture, where cells were incubated with CLA in combination with FSH (25 ng/ml) and IGF1 (50 ng/ml). Results showed that 10 μM CLA inhibits FSH- and IGF1-induced granulosa cell proliferation; aromatase, GATA4, and IGF1 mRNA; and estradiol-17β production. Western blot analysis of total cell lysates revealed that CLA intervenes the IGF1 signaling by decreasing p-Akt. In addition, CLA was found to upregulate peroxisome proliferator-activated receptor-gamma (PPARG) and phosphatase and tensin homolog (PTEN) level in granulosa cells. Further study using PPARG- and PTEN-specific inhibitors supports the potential role of CLA in granulosa cell proliferation and steroidogenesis involving PPARG, PTEN, and PI3K/Akt pathway.

Introduction

Conjugated linoleic acid (CLA) is the common element that belongs to a group of C18 fatty acids with two double bonds exhibiting strong nutritional benefits in a variety of animal models (Belury 2002). CLA is a naturally occurring fatty acid produced in the rumen of ruminant animals by the fermentative bacteria, which isomerizes linoleic acid into CLA (Kepler et al. 1970), and is naturally found in food such as milk fat and meat of ruminant animals. A number of studies have supported the role of CLA as anticarcinogenic (Devery et al. 2001, Pariza et al. 2001), antiatherogenic (Lee et al. 1994, Nicolosi et al. 1997), antidiabetic (Houseknecht et al. 1998), and antiobesity (Park et al. 1997) agent.

Dietary n-3 polyunsaturated fatty acids (PUFAs) increase systemic circulation of cholesterol as well as the size of corpus luteum in cows. Marei et al. (2009) showed that linoleic acid influenced follicular development. It has been reported that follicular fluid lipid profile in cows fluctuates according to follicle dominance and stage of estrous cycle (Orsi et al. 2005). There is difference in metabolomic strategies opted by subordinate and dominant follicles, as it has been shown that linoleic acid concentration is higher in dominant follicle (Revelli et al. 2009). In feeding practice, CLA supplements are used to decrease milk fat excretion in early lactation dairy animals to save energy in order to counteract the physiological negative energy balance (Von Soosten et al. 2011) that is most often characterized in postpartum period. Fertility in this period is mostly comprised by incidence of anestrous, which is superiorly determined by fate of dominant follicle. However, high dose of CLA was given to nutritionally manage anestrous problem that arises as a result of negative energy balance (Odens et al. 2007). In spite of the abundance of studies reporting that CLA is a key dietary supplement in animals, the molecular mechanisms that facilitate its beneficial effects are not currently well understood.

Maintenance of fertility in animal requires supreme cooperation of gonadotropins and intraovarian regulators. Among all of them, insulin-like growth factor 1 (IGF1) and its signaling pathways play the critical role. In particular, activation of the PI3K or the MAPK pathway by IGF1 has been reported to not only stimulate proliferation but also differentiation and/or cell survival depending on the cell type (Butt et al. 1999, Poretsky et al. 1999). Phosphatase and tensin homolog (PTEN) is a well-established negative regulator of this pathway, as it antagonizes the activity of PI3K (Maehama & Dixon 1998).

Dietary nutrients like CLA control the metabolism by activating peroxisome proliferator-activated receptor-γ (PPARG (PPARγ)), a nuclear hormone receptor expressed throughout the body. PPARG expression and its implication in ovarian function like steroidogenesis, differentiation, and tissue remodeling have been well established (Komar 2005). In addition, several reports suggested a relationship between PPARG and PTEN signaling in human hepatocellular carcinoma cell line (Cao et al. 2007). Also the studies conducted on human gastric cancer cells speculated that PTEN suppresses the cell growth, at least in part, via disturbing the function (Akt signaling) as well as expression of the IGF system (Yi et al. 2005). Consequently, it can be hypothesized that effects are mediated by CLA on fertility through multiple signaling pathways, including PI3K pathway. Therefore, in this study, we explored whether CLA affects granulosa cell functioning by recruiting PTEN as a mediator molecule. In addition, to verify this hypothesis, this study investigated the effects of CLA on granulosa cell function and its underlying possible mechanism.

Results

Inhibition of FSH- and IGF1-induced cell proliferation by CLA treatment

Cell proliferation assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) was carried out in cells treated as described in the Materials and methods section. FSH (25 ng/ml) and IGF1 (50 ng/ml) alone (dose as optimized earlier) significantly (P<0.001) increased the cell number. Treatment with FSH (25 ng/ml) along with IGF1 (50 ng/ml) showed synergistic increase in cell number (Table 1). However, CLA cotreatment had abolished FSH- and IGF1-induced cell proliferation compared with control (unstimulated cells). However, PPARG antagonist was found to increase cell proliferation significantly (P<0.001).

Table 1

Cell proliferation assay.

TreatmentAbsorbance
Control1.16±0.08c
FSH1.99±0.05b
IGF12.33±0.04a,b
FSH+IGF12.55±0.03a
FSH+CLA0.77±0.05c
IGF1+CLA0.73±0.05c
FSH+IGF1+CLA0.91±0.09c
CLA 0.77±0.03c
GW9662 2.60±0.01a
CLA+GW96621.99±0.04b

Granulosa cells were treated with FSH (25 ng/ml), IGF1 (50 ng/ml), CLA (10 μM), GW9662 (1 μM) alone, or in combination for 48 h in serum-free culture. Cell proliferation was assessed by Cell Titer 96 Aqueous One Solution (Promega) and the values are given as absorbance values. Values are mean±s.e.m. of three independent cultures. Figures with different letters differ significantly at P<0.001.

Dose- and time-dependent effect of CLA on PPARG and PTEN expression in primary cultured buffalo granulosa cell

Dose- and time-dependent effect of CLA on the expression of PPARG and PTEN has been shown in Fig. 1A, B and C. Result showed that all the doses of CLA (10, 25, and 50 μM) studied were found to increase PPARG significantly (P<0.001), thus the highest expression of PPARG was observed at 10 μM. CLA (10 μM) was found to induce PPARG at 24 and 48 h, but maximum induction was observed at 48 h. A similar effect of CLA on PTEN expression was observed and 10 μM CLA was found to increase the expression of PTEN to a maximum at both mRNA and protein level (Fig. 2A and B). The effect of CLA on both PPARG and PTEN was found to be reversed when cells were treated alone or cotreated with 1 and 10 μM of antagonist (GW9662) while the effect of antagonist was maximum at 1 μM. Hence, 10 μM CLA, 1 μM GW9662, and 48 h of treatment period had been chosen for subsequent experiment. Further, we checked the effect of CLA on PPARG and PTEN expression in cells treated with or without FSH (25 ng/ml) and IGF1 (50 ng/ml) for 48 h. Real-time expression data showed that CLA increased PPARG and PTEN expression significantly (P<0.001) in the cells treated with CLA alone or in combination with FSH and IGF1, while FSH and IGF1 alone failed to induce the PPARG and PTEN expression compared with CLA alone (Fig. 3A and B).

Figure 1
Figure 1

Effects of CLA on PPARG and PTEN transcripts level in cultured buffalo granulosa cell. Cells were cultured for initial 48 h in serum-free condition as described in the Materials and Methods section followed by treatment with different doses of CLA (10 μM), GW9662 (1 μM) alone, or in combination for next 48 h. Total RNA was isolated for analysis of PPARG (A) and PTEN (B) transcripts, and also for PPARG induction at two time point 24 and 48 h (C). *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001). In each experiment, measures were obtained as the mean of three replicates.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Figure 2
Figure 2

Dose-dependent induction of PPARG and PTEN in cultured buffalo granulosa cells. Cells were cultured for initial 48 h in serum-free condition as described in the Materials and Methods section followed by treatment with different doses of CLA (10 μM), GW9662 (1 μM) alone, or in combination for next 48 h. The cells were collected for protein isolation and subsequently followed by western analysis using ant-PPARG Ab (top), anti-PTEN Ab (middle), and anti-β-actin (bottom, used as internal control) antibodies. (A) Immunoblot presents both isoforms of PPARG (1 and 2) and PTEN. (B and C) Densitometric analysis of PPARG and PTEN was done, respectively, using β-actin as an internal control. Bars with different letters indicate significant difference at P<0.001. Results are expressed as ±s.e.m. of three independent experiments.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Figure 3
Figure 3

Effect of CLA, FSH, IGF1, and GW9662 on PPARG (A) and PTEN (B) transcripts in cultured buffalo granulosa cells. Total RNA was isolated from cultured granulosa cell treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH (25 ng/ml), IGF1 (50 ng/ml), and GW9662 (1 μM) as shown in the figure and described in the Materials and Methods section. *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters differ significantly at P<0.001. In each experiment, measures were obtained as the mean of three replicates.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

CLA reduces FSH- and IGF1-induced IGF1, aromatase, and GATA4 expression and estradiol-17β synthesis

Treatment of FSH (25 ng/ml), IGF1 (50 ng/ml), for 48 h alone, or in combination increased IGF1 (P<0.001), aromatase (P<0.001), and GATA4 (P<0.001) mRNA significantly compared with control. Cells treated with CLA alone decreased the genes (CYP19A1 (CYP19) and GATA4) significantly in comparison with control and FSH, IGF1, and FSH+IGF1, while in the case of control, some region of significance is shared (as marked with the same letter as well as different letters). IGF1 transcript abundance goes down when cells were treated with CLA alone or in combination with FSH, IGF1, and FSH+IGF1 with a share in the region of statistical significance (Fig. 4A). CLA downregulated the FSH- and FSH+IGF1-induced CYP19A1 gene expression, whereas CLA did not alter the IGF1-stimulated CYP19A1 (Fig. 4B). Additionally, a similar response was observed in hormone (estradiol-17β (E2)) production. Consistent with the aromatase expression pattern, FSH- and IGF1-induced E2 production was significantly (P<0.001) reduced by CLA treatment. CLA downregulated the FSH-stimulated E2 production to the level of control. However, CLA could not alter the IGF1-stimulated CYP19A1 but had shown to decrease the E2 production. Again CLA effect alone was more potent in decreasing E2 production (Fig. 5). Likewise, GW9662 did not have any significant effect on gene expression and E2 production.

Figure 4
Figure 4

Effect of CLA, FSH, IGF1, and GW9662 on IGF1 (A), CYP19A1 (B), and GATA4 (C) transcripts in cultured buffalo granulosa cells. Total RNA isolated from cultured granulosa cells were treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH (25 ng/ml), IGF1 (50 ng/ml), and GW9662 (1 μM) as shown in the figure and described in the Materials and Methods section. *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters differ significantly at P<0.001. In each experiment, measures were obtained as the mean of three replicates.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Figure 5
Figure 5

Effect of CLA on estradiol-17β content. Cells were treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH, IGF1, and GW9662 as shown in the figure and described in the Materials and methods section. Hormone was estimated using ELISA. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001). In each experiment, measures were obtained as the mean of three replicates.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

CLA pretreatment inhibits FSH- and IGF1-induced phosphorylation of AKT

Densitometric analysis of immunoblot showed that IGF1 (50 ng/ml) alone and in combination with FSH (25 ng/ml) induced phosphorylation of Akt in cells without CLA pretreatment (Figs 6, 7A and B). In Fig. 7A, unstimulated cells and stimulated cells with FSH showed same level of p-Akt. When cells were incubated with CLA for 48 h followed by treatment with FSH, IGF1 alone, or in combination for 30 min, it was observed that CLA in combination with FSH, IGF1 alone, or in combination with FSH+IGF1 diminished p-Akt while dephosphorylating effect was more pronounced in cells treated with CLA alone. PTEN and p-Akt protein level shares inverse relationship and the same had been observed in immunoblotting. GW9662 revived the p-AKT to the level of unstimulated cells.

Figure 6
Figure 6

Phosphorylation of Akt and induction of PTEN in cultured buffalo granulosa cells. Cells were cultured as described in the Materials and Methods section. Cells were either left untreated (control) or treated with CLA (10 μM), GW9662 (1 μM) alone, or in combination for 48 h followed by stimulation with FSH (25 ng/ml) or IGF1 (50 ng/ml) for 30 min. After that, cells were collected for protein isolation. Immunoblotting was done using anti-p-AktAb (top), anti-PTENAb (middle), and anti-β-actin Ab (bottom). Immunoblots present the p-Akt and PTEN (A and C) in cells treated with FSH, IGF1, CLA, and GW9662. Ratio of signal intensity of p-Akt and PTEN (B and D), which was normalized to β-actin. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference at P<0.001.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Figure 7
Figure 7

Phosphorylation of Akt and induction of PTEN in cultured buffalo granulosa cells in vitro. Cells were cultured as described in the Materials and Methods section and were either left untreated (control) or treated with CLA (10 μM), GW9662 (1 μM) alone, or in combination for 48 h followed by stimulation with FSH (25 ng/ml)+IGF1 (50 ng/ml) for 30 min. Also cells were incubated with or without bpV(pic) – 10 μM for 30 min followed by induction with CLA (10 μM) for next 48 h. Cell lysates were prepared followed by immunoblotting. (A) Representative immunoblots showing p-Akt (top), PTEN (middle), and β-actin (bottom). (B) Histogram presents their respective densitometric signal intensity normalized to the β-actin. (C) Representative immunoblot showed the effect of bpV(pic) on p-Akt (top), PTEN (middle), and β-actin (bottom). (D) Ratio of signal intensity of p-Akt/β-actin. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001).

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Inhibition of PTEN by bpV(pic) compound and revival of Akt phosphorylation

Result of granulosa cells treated with CLA in the presence or absence of bpV(pic) for 30 min has been shown in Fig. 7C and D. It was observed that PTEN was downregulated in cells pretreated with bpV(pic), which was further characterized by revival of p-Akt to the level of control. The revival in phosphorylation of Akt after incubation with PTEN inhibitor was comparable to control (P<0.001). However, PTEN inhibitor treatment abolished PTEN expression to the level of control. In contrast, CLA alone significantly upregulates (P<0.001; Fig. 7C and D) PTEN expression.

Discussion

In this study, we have demonstrated that CLA increased PTEN expression through activation of PPARG in granulosa cells, which further attenuated the phosphorylation of Akt and thereby regulating granulosa cell functioning (proliferation and steroidogenesis). A number of reports indicated a correlation between nutrition supplements and improved fertility. Renaville et al. (2008) recently demonstrated that intrafollicular CLA level increased in dominant follicle, compared with subordinate follicle. Lipid profile in preovulatory follicle plays detrimental role in assessing follicle rupture, oocyte quality, and its fertilization potential (Singh & Sinclair 2007, Sinclair et al. 2008, Revelli et al. 2009). Fertility in postpartum period is a major concern because after parturition most of the nutrients are driven toward milk production than follicular maturation (Baumen & Currie 1980, Leroy et al. 2008). Dietary supplements like CLA are given during this stage, but the mechanism that leads to subsequent ovulation from dominant follicle as a result of treatment is not completely understood. Recognizing these gaps, we have demonstrated here a serial connection between CLA, PPARG, and PTEN with an inverse relationship between PTEN and p-Akt. Result also showed that CLA disrupts the IGF1 signaling by recruiting PTEN as an intervening molecule, which is upregulated after PPARG induction.

In HT-29 cells, CLA is known to negatively regulate the levels of IGF1, mature IGF1R, and subsequent activation of Akt (Kim et al. 2003). There is reasonable possibility that inhibition of IGF1 signaling may be one of the mechanism by which CLA inhibits cancer cell growth. Our result also supports the functional relevance of CLA in ovary through a signaling mechanism in relation to level of p-Akt. In addition, preliminary data from our laboratory showed that PI3K/Akt pathway mainly contributes to steroidogenesis in buffalo granulosa cell than MAP kinase pathway and the same has been reported in bovine granulosa cell (Murugan et al. 2010). Our results showed that unstimulated cells and stimulated cells with FSH (25 ng/ml) have same level of p-Akt at day 4. The possible reason behind this observed difference could be due to IGF1, which is primarily involved in the PI3K signaling cascade for phosphorylation of Akt instead of FSH (Murugan et al. 2010). In goat granulosa cells, linoleic and oleic acid had no effect on AMPK phosphorylation, whereas they rapidly increased MAPK ERK1/2 phosphorylation, and inhibitor studies have further validated these findings depicting the involvement of fatty acids in improving ovarian steroidogenesis through the MAPK ERK1/2 signaling pathway (Coyral-Castle et al. 2010). However, we did not assess the phosphorylation status of MAPK ERK1/2 protein, as it is not the major pathway operating (Murugan et al. 2010) here, and hence, we have aimed the experiments focusing on p-Akt level only. Our results suggest a possible involvement of CLA that interferes with FSH- and IGF1-stimulated pathway involved in ovarian steroidogenesis in granulosa cell including downregulation of IGF1, aromatase, and GATA4 mRNA and reduced phosphorylation of Akt, hence diminished E2 production. However, CLA did not decrease the IGF1-stimulated IGF1 and CYP19A1 but had shown to decrease the E2 level. It could be observed as an interesting finding of this study which showed that CLA primarily affects the ovarian steroidogenesis by decreasing the IGF1 mRNA. Accordingly, when cells were treated with CLA along with IGF1, one-way CLA decreases the IGF1 synthesis while IGF1 cotreatment neutralizes its effect and that is why CLA+IGF1 treatment does not have much impact while CLA alone significantly decreased the IGF1 mRNA. However, it is difficult to correlate hormone and mRNA level as hormone accumulates and is stable while mRNA is not so stable compared with hormones. Moreover, it is a well-established fact that there is frequently a lack of concordance between mRNA and protein concentration data (Gygi et al. 1999, Schmidt et al. 2007). Furthermore, we have also demonstrated that CLA effects on steroidogenesis are mediated through accumulation of PPARG, which acts as a novel signal for integration of energy balance and reproduction basically by sensing the nutritional status in the microenvironment of follicle (Fernandez-Fernandez et al. 2006). The activated PPARG initiates signal transduction via recruiting phosphates like PTEN (Lee et al. 2006). Activation of PTEN propagates signal to regulate several cellular and metabolic functions such as cell proliferation and phosphorylation status of metabolic enzymes involved in glucose metabolism. Our results showed that CLA induced PTEN expression, which consequently attenuated the endogenous IGF1 transcription as well as FSH- and IGF1-induced phosphorylation of Akt and thereby granulosa cell steroidogenesis and proliferation. Our experiments had shown that CLA in combination with FSH and IGF1 have reduced the phosphorylation of Akt, but the effects were more pronounced when cells were incubated with CLA alone because CLA alone significantly induced the PTEN expression.

Throughout the study, we have used the granulosa cells that were FSH responsive with estrogen dominant and having high CYP19A1 gene expression, i.e. they are not luteinized but LH responsive with high LH receptors. As studied in detail earlier, at this stage (day 4), if cells were treated with LH, LH downregulates almost all gene in the same fashion, as LH surge downregulates the gene in vivo (Monga et al. 2011). Considering these studies, we treated the cells up to day 4, as they exhibit phenotypic characteristic features of preovulatory follicle, which were subsequently followed by their tendency to get luteinized in the succeeding days. We are comparing this in vitro-standardized model with in vivo system that day 4 cultured cells have gene expression characteristic of a dominant follicle. This stage of follicle undergoes subsequent transition from high proliferative and less steroidogenic to less proliferative and high steroidogenic form in response to LH, which is the trigger of ovulation and luteinization (Mitwally et al. 1999). In this phase, CYP19A1 expression goes down and PTEN level increases, which is a prerequisite for dominant follicle to ovulate. However, we cannot exactly correlate the present findings with the preovulatory follicle status in postpartum animal, as they are likely to differ in their proliferative potential and kind of lipid profile in follicular fluid, which further depend on the nutritional status of animal. However, problem remains of sampling from the animals falling in the category of negative energy balance after first calving. Therefore, further studies using granulosa cells from these animals and also profiling their lipid composition in follicular fluid reveal detailed functional evaluation of exogenously administered or nutritionally supplemented CLA.

Polycystic ovarian syndrome (PCOS) is the leading cause of infertility and menstrual irregularities in women of reproductive age and is characterized by chronic hyperandrogenic anovulation (Rimon et al. 2004). This disorder is mainly characterized with instances of insulin resistance. Thiazolidinediones (TZDs) rosiglitazone or pioglitazone have been shown to improve insulin sensitivity in PCOS (Ehrmann et al. 1997). TZDs are exogenous ligand of PPARG. Hereby, it can be suggested that natural dietary CLA can also be used as a substitute to these synthetic ligands, as rosiglitazone and pioglitazone are currently listed as a Pregnancy Category C drug (i.e. not tested for use during human pregnancy). Some side effects of TZD administration are weight gain, fluid retention (Rubenstrunk et al. 2007), and possible bone demineralization. Present report demonstrates the serum-free cultured buffalo granulosa cell as a model to determine the functional significance of CLA in ovary. These cells share the same characteristic features as shown by human ovarian granulosa cells. And hence, we can relate these studies with the mammalian system including human. Therefore, a better experimental approach is required to clarify the role of CLA in fertility considering a lot many aspects of this molecule not only as a mixture but also as a individual isomer. Considering the present data, we can conclude that CLA exerts its role in preovulatory follicle by the negative correlation of PI3 kinase/PKB signaling pathway. Moreover, PTEN and PPARG inhibitor studies symbolize that CLA takes PPARG-dependent pathway to execute its downstream signaling effects. However, PPARG-independent effects also cannot be denied completely as PUFAs are known to take PPAR-independent pathways (Derecka et al. 2008) and also PPARG inhibitor (GW9662) inhibited the cell growth of human tumor mammary cell line, which supports the existence of PPARG-independent pathways (Seargent et al. 2004).

To the best of our knowledge, as proposed (Fig. 8), this is the first report to demonstrate a novel signaling mechanism opted by CLA in regulating steroidogenesis in any species. In conclusion, this study demonstrated that expression of PTEN was induced by CLA through PPARG-dependent pathway in vitro, which attenuates phosphorylation of Akt, and FSH/IGF1-induced effects on granulosa cell steroidogenesis and proliferation. These findings showed that CLA, therefore, can be a key regulatory molecule of granulosa cell functioning in preovulatory follicles. Further studies are required to achieve detailed functional analysis of CLA in ovary during different pathophysiological conditions.

Figure 8
Figure 8

Proposed cross talk between CLA and FSH+IGF1 downstream signaling pathway. In granulosa cell, FSH+IGF1 synergistic effects are indispensable for proliferation and steroidogenesis mainly through PI3K/Akt pathways. CLA binds to nuclear receptor PPARG and induced its expression, which further increased the expression of PTEN and upregulated PTEN, which intervenes IGF1 signaling by two ways: (A) decreasing IGF1 mRNA and (B) dephosphorylating PIP3 to PIP2, which leads to downregulation of p-Akt.

Citation: REPRODUCTION 144, 3; 10.1530/REP-12-0079

Materials and Methods

Collection of buffalo ovaries and isolation of granulosa cells

Buffalo ovaries were collected from commercial abattoir, Delhi. Just after killing animals, ovaries were placed in chilled normal saline (0.9% NaCl) containing penicillin (100 U/ml) and streptomycin (100 μg/ml) and transported to laboratory rapidly (approximately within 4 h). All the tissues were washed at least five times in saline, disinfected once in 70% ethanol for 30 s, then washed again with saline, and processed immediately. Healthy developing follicles were assessed by the presence of vascularized theca externa and clear amber follicular fluid with no debris. Follicular fluid was aspirated from small and medium antral follicles (<8 mm) using 18 gauge needle and sterile, nontoxic, nonpyrogenic, monoinjected brand syringes (Dispovan, Faridabad, Haryana, India; 2.0 ml). The fluid was collected in PBS containing penicillin (100 U/ml), streptomycin (100 μg/ml), and amphotericin B (1.25 μg/ml) in 15 ml centrifuge tube under sterile conditions while continuously maintaining the cells on ice. The granulosa cells were finally separated by centrifugation at low speed (200 g) for 4–6 min to pellet out the cells. Cell number and viability were estimated in hemocytometer using trypan blue exclusion method. Approximately 70–80% of cells were found to be viable.

Culture and treatment of granulosa cell

All the culture reagents were purchased from Sigma–Aldrich, Inc., unless otherwise stated. Cells were seeded in 24-well tissue culture plates (Nunc, Roskilde, Denmark) at a density of 2×105 viable cells in 1.0 ml DMEM serum-free culture medium containing l-glutamine (3 mM), protease-free BSA (1 mg/ml), sodium selenite (4 ng/ml), transferrin (2.5 μg/ml), androstenedione (2 μM), bovine insulin (10 ng/ml), nonessential amino acid mix (1.1 mM), ovine FSH (1 ng/ml), human rIGF1 (1 ng/ml), penicillin (100 U/ml), and streptomycin (100 μg/ml) and maintained at 37 °C in 5% CO2, 95% air as described earlier (Monga et al. 2011).

Experimental design

To standardize the dose of CLA treatment for PPARG and PTEN induction, after the initial 48 h of establishment period, the spent media were carefully removed and replaced with fresh medium prepared as earlier including androstenedione but without other hormonal supplements (1 ng/ml FSH and 1 ng/ml IGF1) as standard. At this stage, cells were either left untreated or treated with different doses of CLA and antagonist (GW9662) as indicated in the figure legends. After a further 48 h of treatment period, media were carefully removed and stored at −20 °C until assayed, and cells from triplicate wells were lysed separately and used for RNA isolation, whereas cells from triplicate wells were collected separately and pooled for protein isolation respectively. CLA dose (10 μM), which was found to induce PPARG maximally, was further used to see its effect at two (24 and 48 h) time points as indicated in the figure legends. Similarly, to study the effect of CLA on FSH-, IGF1-, and FSH+IGF1-stimulated cell proliferation; IGF1, aromatase, and GATA4 mRNA; and E2 production after the initial 48 h of establishment period, the spent media were carefully removed and replaced with fresh medium prepared as earlier including androstenedione but without other hormonal supplements (1 ng/ml FSH and 1 ng/ml IGF1) as standard. At this stage, cells were either left untreated or treated with CLA (10 μM) and antagonist (1 μM, GW9662) alone or in combination, and also cells were cotreated with CLA (10 μM) in combination with FSH, IGF1, and FSH+IGF1 as indicated in the figure legends. After a further 48 h of treatment period, media were carefully removed and stored at −20 °C until assayed, cells from triplicate wells were lysed separately, and were used for RNA isolation. In a similar set of experiments, for cell proliferation assay, cells were plated as in 96-well plates, but other aspects of the experimental treatments remained the same.

In another set of experiments, after the initial 48 h of establishment period, cells were pretreated with CLA (10 μM) for next 48 h, then spent media were removed carefully, and cells were further treated with FSH, IGF1, and FSH+IGF1 for 30 min as described in the figure legends. After treatment, spent media were removed and cells from triplicate wells were collected separately and pooled for immunoblotting of p-Akt and PTEN. The time point of 30 min was chosen specifically for FSH+IGF1-induced Akt phosphorylation experiments because preliminary data of our laboratory using granulsoa cells showed that FSH (20 ng/ml)+IGF1 (50 ng/ml) treatment resulted in peak p-Akt levels from 15 to 60 min.

To evaluate the involvement of PTEN, after the initial 48 h of establishment period, cells were pretreated with bpV(pic) (10 μM; Cayman, Ann Arbor, MI, USA) for 30 min and then media were replaced with fresh media as earlier and supplemented with CLA (10 μM) and incubated for next 48 h followed by removal of spent media, and cells from triplicate wells were collected separately and pooled for immunoblotting of p-Akt and PTEN.

Cell proliferation assay

Growing cells were observed microscopically. Cell proliferation was assayed using Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega) as described earlier (Murugan et al. 2010, Monga et al. 2011). Briefly, 20 μl cell proliferation assay solution was added into each well of a 96-well culture plate containing cells in 100 μl culture medium. The plates were incubated for 4 h at 37 °C in 5% CO2. At the end of the incubation period, the absorbance was recorded at 490 nm using a 96-well ELISA plate reader. The absorbance was directly proportional to the number of living cells in culture. Each treatment for the assay was performed in triplicate.

RNA isolation and RT

Total RNA was isolated using TRIzol (Sigma–Aldrich Co.). Isolated RNA was used immediately for RT-PCR or stored at −80 °C until use. The RNA was quantified using nanophotometer, and RNA integrity was evaluated by denaturing agarose gel electrophoresis. A total of 100 ng RNA was used for each of the set of experiments. cDNA synthesis was performed using the first-strand cDNA synthesis kit (Fermentas, St. Leon-Rot, Germany) using random hexamer primers. The reaction mixture contained 100 ng total RNA, 1 μl random hexamer (0.2 μg/μl), and sH2O to 11 μl. The contents were incubated at 65 °C for 10 min followed by 2 min incubation at room temperature. The reagents added further were 4 μl 5× reaction buffer (250 mM Tris–HCl, pH 8.3; 250 mM KCl, 20 mM MgCl2, and 50 mM dithiothreitol), 1 μl RNase inhibitor (20 IU), 2 μl dNTP mix (10 mM), and 2 μl M-MuLV reverse transcriptase (200 IU) to a final volume of 20 μl. The contents were incubated at 25 °C for 10 min, 42 °C for 30 min, and 95 °C for 3 min. The prepared cDNA was then analyzed using PCR. Gene-specific primers were used for amplification (Table 2). The primers were designed using NCBI database and the Primer 3 Software (Whitehead Institute for Biomedical Research, Cambridge, MI, USA).

Table 2

Primer used for real-time PCR.

Name of genePrimer sequences (5′–3′)Product sizeAccession no.
PTENFP: GCCACAAAGTGCCTCGTTTACC120XM_613125.4
RP: AGAAGGCAACTCTGCCAAACAC
PPARGFP: TCAGTGGAGACCGCCCAGGTT116NM_181024.2
RP: GAGCTGGGAGGACTCGGGGT
CYP19A1FP: CCTGTGCGGGAAAGTACATCGC105DQ407274.2
RP: TCTTCTCAACGCACCGATCTTG
IGF1FP: CATCCTCCTCGCATCTCTTC243HQ324241
RP: ACATCTCCAGCCTCCTCAGA
GATA4FP: AGGCCTCTTGCAATGCGGAAAG86NM_001192877.1
RP: GGACCTGCTGGTGTCTTTGATTTG

PTEN, phosphatase and tensin homolog deleted on chromosome 10; PPARG, peroxisome proliferator-activated receptor-γ; CYP19A1, cytochrome P450 aromatase; IGF1, insulin-like growth factor 1.

Real-time PCR

cDNA prepared from 100 ng RNA was amplified with LC 480 SYBR Green master mix (Roche) in a final reaction mixture of 12 μl. Amplification and quantification were performed using light cycler real-time PCR (Roche Diagnostics) under the following cycling conditions: pre-incubation at 95 °C for 5 min, followed by 40 cycles of denaturation 95 °C for 20 s, annealing at 60 °C for 15 s, and extension at 72 °C for 15 s. Melting peaks were determined using melting curve analysis in order to ensure the amplification and thus generation of single product. Also, agarose gel electrophoresis analysis (1.5%) was carried out to determine the length of the amplified PCR product. Cloned PCR products were used to generate standard curves ranging over eight orders of magnitude (2.5×10−15–2×10−10 g DNA per reaction) using freshly diluted plasmids every time from the stock concentration of 10−9 g DNA/μl. The standard curve slope was found to be −3.35 while efficiency was 1.98, which is under optimal PCR efficiency range of a slope of −3.3 as per Roche Diagnostics, LC rel. Quantification Software, March 2001 (Weihenstephaner, Freising-Weihenstephaner, Germany). Amplification efficiency was determined from the slope of the log-linear portion of the calibration curve, i.e. PCR efficiency=10(−1/slope)−1, when the logarithm of the initial template concentration (the independent variable) is plotted on the x-axis and Cp (the dependent variable) is plotted on the y-axis. Copy number was calculated relative to the amount of RNA that was subjected to cDNA preparation. PCR reaction with all the PCR reagents other than the added cDNA was used as a negative control.

Measurement of E2

The concentration of E2 was determined using ELISA (Omega Diagnostics, Scotland, UK). The E2 standard curve was generated from the standards provided in the kit, which ranged from 0 pg/ml–1 ng/ml. The intra- and interassay coefficients of variation for E2 assay were 3.4 and 5.32% respectively. Estimation was performed as per the manufacturer's instructions using 25 μl spent medium for hormone estimation. Each treatment was performed in triplicate upon each batch of cells and media from each well were assayed individually.

Immunoblotting

Cells were washed with ice-cold PBS (pH 7.5) and the culture wells were aspirated to dryness. Then, lysis buffer (63.5 mM Tris–HCl (pH 6.8), 10% (v/v) glycerol, 2% (w/v) SDS, 10 μl of 1× protease inhibitor cocktail (Sigma–Aldrich Co.), and 200 mM sodium orthovanadate) was added to the cells, which were then incubated on ice for 10 min. The cells were scraped from the culture wells into 1.5 ml microfuge tubes and were then boiled at 100 °C for 5 min and briefly centrifuged to pellet the cell debris, if present. After determination of approximate protein content using absorbance at 280 nm (Nanophotometer, Implen, Schatzbogen, München, Germany), bromophenol blue and β-mercaptoethanol were added to the samples to give final concentrations of 0.02% (w/v) and 5% (v/v) respectively. The samples were then stored at −80 °C until analyzed.

Protein lysates (100 μg) were separated by 10% SDS–PAGE and transferred to polyvinylidene difluoride (Pall Corporation, Port Washington, NY, USA; cat# 66543) using the wet transfer Trans-Blot assembly (Bio-Rad). Membranes were blocked in Tris-buffered saline (TBS-T; 50 mM Tris, pH 7.6, 150 mM NaCl, and 1% Tween 20) containing 5% (w/v) nonfat milk for 2 h at room temperature with gentle agitation. The membrane was then incubated overnight in TBS-TV (TBS-T; 50 mM Tris, pH 7.4, 150 mM NaCl, 1% Tween 20, and 100 mM sodium vandate) with 1% nonfat milk containing antibodies to p-Akt dilution 1:1000 (Santa Cruz, Santa Cruz, CA, USA; cat# sc-101629) or PPARG dilution 1:1000 (Santa Cruz, cat# sc-7273) or PTEN dilution 1:1000 (Santa Cruz, cat# sc-7974) or β-actin dilution 1:1000 (Santa Cruz, cat# sc-47778) and normal mouse IgG (Millipore, Billerica, MA, USA; cat# 12-371B) with gentle agitation at 4 °C. After incubating the membranes overnight with primary antibody, the membranes were washed and incubated with HRP-conjugated secondary antibodies (Santa Cruz, cat# sc-2005, sc-2379) in TBS-TV for 2 h at room temperature and then washed. A chemiluminescent signal was generated using ECL reagent (ECL, Pierce, Rockford, IL, USA) and membranes were exposed to X-ray film (Kodak biomax light film, Sigma). The housekeeping gene β-actin was used as a positive loading control. Normal mouse IgG was used as a negative control.

Statistical analysis

A one-way ANOVA test was performed to determine the effect of significance followed by Tukey's test to find out the significance of each effect level. All experimental data were presented as the mean±s.e.m. of three independent experiments. Bars with different letters indicate significant difference at P<0.001. All statistical analysis was performed using SAS System Software (copyright 2009, SAS Institute, Inc., Cary, NC, USA).

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by NDRI SRF Fellowship to I Sharma and Institute's laboratory contingency grant.

Acknowledgements

The authors thank the Director of National Dairy Research Institute, Karnal, for providing necessary facilities for this work. They also thank Mr Gyan Singh, T-7/8 senior programmer, Data processing Unit, NDRI, for helping in statistical data analysis.

References

  • BaumenDECurrieWB1980Partitioning of nutrients during pregnancy and lactation: a review of mechanisms involving homeostasis and homeorhesis. Journal of Dairy Science6215141529. doi:10.3168/jds.S0022-0302(80)83111-0.

    • Search Google Scholar
    • Export Citation
  • BeluryMA2002Inhibition of carcinogenesis by conjugated linoleic acid: potential mechanisms of action. Journal of Nutritional Biochemistry13229952998.

    • Search Google Scholar
    • Export Citation
  • ButtAJFirthSMBaxterRC1999The IGF axis and programmed cell death. Immunology and Cell Biology77256262. doi:10.1046/j.1440-1711.1999.00822.x.

    • Search Google Scholar
    • Export Citation
  • CaoLQChenXLWangQHuangXHZhenMCZhangLJWenLIJiongBI2007Upregulation of PTEN involved in rosiglitazone-induced apoptosis in human hepatocellular carcinoma cells. Acta Pharmacologica Sinica6879887. doi:10.1111/j.1745-7254.2007.00571.x.

    • Search Google Scholar
    • Export Citation
  • Coyral-CastleSRameCFatetADupontJ2010Effects of unsaturated fatty acids on progesterone secretion and selected protein kinases in goat granulosa cells. Domestic Animal Endocrinology38272283. doi:10.1016/j.domaniend.2009.12.002.

    • Search Google Scholar
    • Export Citation
  • DereckaKSheldrickELWathesDCAbayasekaraDREFlintAPF2008A PPAR-independent pathway to PUFA-induced COX-2 expression. Molecular and Cellular Endocrinology2876571. doi:10.1016/j.mce.2008.02.015.

    • Search Google Scholar
    • Export Citation
  • DeveryRMillerAStantonC2001Conjugated linoleic acid and oxidative behaviour in cancer cells. Biochemical Society Transactions29341344. doi:10.1042/BST0290341.

    • Search Google Scholar
    • Export Citation
  • EhrmannDASchneiderDJSobelBECavaghanMKImperialJRosenfieldRLPolonskyKS1997Troglitazone improves defects in insulin action, insulin secretion, ovarian steroidogenesis, and fibrinolysis in women with polycystic ovary syndrome. Journal of Clinical Endocrinology and Metabolism8221082116. doi:10.1210/jc.82.7.2108.

    • Search Google Scholar
    • Export Citation
  • Fernandez-FernandezRMartiniACNavarroVMCastellanoJMDieguezCAguilarEPinillaLTena-SempereM2006Novel signals for the integration of energy balance and reproduction. Molecular and Cellular Endocrinology254127132. doi:10.1016/j.mce.2006.04.026.

    • Search Google Scholar
    • Export Citation
  • GygiSPRochonYFranzaBRAebersoldR1999Correlation between protein and mRNA abundance in yeast. Molecular and Cellular Biology1917201730.

    • Search Google Scholar
    • Export Citation
  • HouseknechtKLVanden HeuvelJPMoya-CamarenaSYPortocarreroCPPeckLWNickelKPBeluryMA1998Dietary conjugated linoleic acid normalizes impaired glucose tolerance in the Zucker diabetic fatty fa/fa rat. Biochemical and Biophysical Research Communications244678682. doi:10.1006/bbrc.1998.8303.

    • Search Google Scholar
    • Export Citation
  • KeplerCRTuckerWPToveSB1970Biohydrogenation of unsaturated fatty acids, IV. Substrate specificity and inhibition of linoleate δ-12-cis, δ-11-trans-isomerase from Butyrivibrio fibrisolvens. Journal of Biological Chemistry24536123620.

    • Search Google Scholar
    • Export Citation
  • KimEJKangIJChoHJKimWKHaYLParkJHY2003Conjugated linoleic acid downregulates insulin-like growth factor-I receptor levels in HT-29 human colon cancer cells. Journal of Nutrition13326752681.

    • Search Google Scholar
    • Export Citation
  • KomarCM2005Peroxisome proliferator-activated receptors (PPARs) and ovarian function – implications for regulating steroidogenesis, differentiation, and tissue remodeling. Reproductive Biology and Endocrinology341doi:10.1186/1477-7827-3-41.

    • Search Google Scholar
    • Export Citation
  • LeeKNKritchevskyDParizaMW1994Conjugated linoleic acid and atherosclerosis in rabbits. Atherosclerosis1081925. doi:10.1016/0021-9150(94)90034-5.

    • Search Google Scholar
    • Export Citation
  • LeeSYHurGYJungKHJungHCLeeSYKimJHShinCShimJJInKHKangKH2006PPAR-γ agonist increase gefitinib's antitumor activity through PTEN expression. Lung Cancer51297301. doi:10.1016/j.lungcan.2005.10.010.

    • Search Google Scholar
    • Export Citation
  • LeroyJLVanholderTVan knegselATGarcia-IspiertoIBolsPE2008Nutrient prioritization in dairy cow early postpartum: mismatch between metabolism and fertility?Reproduction in Domestic Animals4396103. doi:10.1111/j.1439-0531.2008.01148.x.

    • Search Google Scholar
    • Export Citation
  • MaehamaTDixonJE1998The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. Journal of Biological Chemistry2731337513378. doi:10.1074/jbc.273.22.13375.

    • Search Google Scholar
    • Export Citation
  • MareiWFWathesDCFouladi-NashtaAA2009The effect of linolenic acid on bovine oocyte maturation and development. Biology of Reproduction8110641072. doi:10.1095/biolreprod.109.076851.

    • Search Google Scholar
    • Export Citation
  • MitwallyMFMKuscuNKYalcinkayaTM1999High ovulatory rates with use of troglitazone in clomiphene-resistant women with polycystic ovary syndrome. Human Reproduction1427002703. doi:10.1093/humrep/14.11.2700.

    • Search Google Scholar
    • Export Citation
  • MongaRSharmaIDattaTKSinghD2011Characterization of serum-free buffalo granulosa cell culture and analysis of genes involved in terminal differentiation from FSH- to LH-responsive phenotype. Domestic Animal Endocrinology41195201. doi:10.1016/j.domaniend.2011.07.001.

    • Search Google Scholar
    • Export Citation
  • MuruganMAFenwickMAChengZSharmaMKSinghDWathesDC2010IGF1 induces up-regulation of steroidogenic and apoptotic regulatory genes via activation of phosphatidylinositol-dependent kinase/AKT in bovine granulosa cells. Reproduction139139151. doi:10.1530/REP-09-0050.

    • Search Google Scholar
    • Export Citation
  • NicolosiRJRogersEJKritchevskyDScimecaJAHuthPJ1997Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atherosclerosis in hypercholesterolemic hamsters. Artery22266277.

    • Search Google Scholar
    • Export Citation
  • OdensLJBurgosRInnocentiMVanBaaleMJBaumgardLH2007Effects of varying doses of supplemental conjugated linoleic acid on production and energetic variables during the transition period. Journal of Dairy Science90293305. doi:10.3168/jds.S0022-0302(07)72630-9.

    • Search Google Scholar
    • Export Citation
  • OrsiNMGopichandranNLeeseHJPictonHMHarrisSE2005Fluctuations in bovine ovarian follicular fluid composition throughout the oestrous cycle. Reproduction129219228. doi:10.1530/rep.1.00460.

    • Search Google Scholar
    • Export Citation
  • ParkYAlbrightKJLiuWStorksonJMCookMEParizaMW1997Effect of conjugated linoleic acid on body composition in mice. Lipids32853858. doi:10.1007/s11745-997-0109-x.

    • Search Google Scholar
    • Export Citation
  • ParizaMWParkYCookME2001The biologically active isomers of conjugated linoleic acid. Progress in Lipid Research40283298. doi:10.1016/S0163-7827(01)00008-X.

    • Search Google Scholar
    • Export Citation
  • PoretskyLCataldoNARosenwaksZGiudiceLC1999The insulin-related ovarian regulatory system in health and disease. Endocrine Reviews20535582. doi:10.1210/er.20.4.535.

    • Search Google Scholar
    • Export Citation
  • RenavilleBBacciuNCominAMottaMPoliIVaniniGPrandiA2008Plasma and follicular fluid fatty acid profiles in dairy cows. Reproduction in Domestic Animals45118121. doi:10.1111/j.1439-0531.2008.01264.x.

    • Search Google Scholar
    • Export Citation
  • RevelliADelle PianeLCasanoSMolinariEMassobrioMRinaudoP2009Follicular fluid content and oocyte quality: from single biochemical markers to metabolomics. Reproductive Biology and Endocrinology4740. doi:10.1186/1477-7827-7-40.

    • Search Google Scholar
    • Export Citation
  • RimonESassonRDantesALand-BrachaAAmsterdamA2004Gonadotropin induced gene regulation in human granulosa cells obtained from IVF patients: modulation of genes coding for growth factors and their receptors and genes involved in cancer and other diseases. International Journal of Oncology2413251338.

    • Search Google Scholar
    • Export Citation
  • RubenstrunkAHanfRHumDWFruchartJCStaelsB2007Safety issues and prospects for future generations of PPAR modulator. Biochimica et Biophysica Acta177110651081. doi:10.1016/j.bbalip.2007.02.003.

    • Search Google Scholar
    • Export Citation
  • SchmidtMWHousemanAIvanovARWolfDA2007Comparative proteomic and transcriptomic profiling of the fission yeast Schizosaccharomyces pombe. Molecular Systems Biology379doi:10.1038/msb4100117.

    • Search Google Scholar
    • Export Citation
  • SeargentJMYatesEAGillJH2004GW9662, a potent antagonist of PPARγ, inhibits growth of breast tumour cells and promotes the anticancer effects of the PPARγ agonist rosiglitazone, independently of PPARγ activation. British Journal of Pharmacology143933937. doi:10.1038/sj.bjp.0705973.

    • Search Google Scholar
    • Export Citation
  • SinclairKDLunnLAKwongWYWonnacottKLinforthRSCraigonJ2008Amino acid and fatty acid composition of follicular fluid as predictors of in-vitro embryo development. Reproductive Biomedicine Online16859868. doi:10.1016/S1472-6483(10)60153-8.

    • Search Google Scholar
    • Export Citation
  • SinghRSinclairKD2007Metabolomics: approaches to assessing oocyte and embryo quality. Theriogenology685662. doi:10.1016/j.theriogenology.2007.04.007.

    • Search Google Scholar
    • Export Citation
  • Von SoostenDMeyerUWeberEMRehageJFlachowskyGDänickeS2011Effect of trans-10, cis-12 conjugated linoleic acid on performance, adipose depot weights, and liver weight in early-lactation dairy cows. Journal of Dairy Science946285962870. doi:10.3168/jds.2010-3851.

    • Search Google Scholar
    • Export Citation
  • YiHKKimSYHwangPHKimCYYangDHOhYLeeDY2005Impact of PTEN on the expression of insulin-like growth factors (IGFs) and IGF-binding proteins in human gastric adenocarcinoma cells. Biochemical and Biophysical Research Communications330760776. doi:10.1016/j.bbrc.2005.03.045.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

     An official journal of

    Society for Reproduction and Fertility

 

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 546 137 10
PDF Downloads 198 100 7
  • View in gallery

    Effects of CLA on PPARG and PTEN transcripts level in cultured buffalo granulosa cell. Cells were cultured for initial 48 h in serum-free condition as described in the Materials and Methods section followed by treatment with different doses of CLA (10 μM), GW9662 (1 μM) alone, or in combination for next 48 h. Total RNA was isolated for analysis of PPARG (A) and PTEN (B) transcripts, and also for PPARG induction at two time point 24 and 48 h (C). *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001). In each experiment, measures were obtained as the mean of three replicates.

  • View in gallery

    Dose-dependent induction of PPARG and PTEN in cultured buffalo granulosa cells. Cells were cultured for initial 48 h in serum-free condition as described in the Materials and Methods section followed by treatment with different doses of CLA (10 μM), GW9662 (1 μM) alone, or in combination for next 48 h. The cells were collected for protein isolation and subsequently followed by western analysis using ant-PPARG Ab (top), anti-PTEN Ab (middle), and anti-β-actin (bottom, used as internal control) antibodies. (A) Immunoblot presents both isoforms of PPARG (1 and 2) and PTEN. (B and C) Densitometric analysis of PPARG and PTEN was done, respectively, using β-actin as an internal control. Bars with different letters indicate significant difference at P<0.001. Results are expressed as ±s.e.m. of three independent experiments.

  • View in gallery

    Effect of CLA, FSH, IGF1, and GW9662 on PPARG (A) and PTEN (B) transcripts in cultured buffalo granulosa cells. Total RNA was isolated from cultured granulosa cell treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH (25 ng/ml), IGF1 (50 ng/ml), and GW9662 (1 μM) as shown in the figure and described in the Materials and Methods section. *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters differ significantly at P<0.001. In each experiment, measures were obtained as the mean of three replicates.

  • View in gallery

    Effect of CLA, FSH, IGF1, and GW9662 on IGF1 (A), CYP19A1 (B), and GATA4 (C) transcripts in cultured buffalo granulosa cells. Total RNA isolated from cultured granulosa cells were treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH (25 ng/ml), IGF1 (50 ng/ml), and GW9662 (1 μM) as shown in the figure and described in the Materials and Methods section. *Gene transcript (copy no. ×103/μg RNA). Copy number was calculated and normalized to initial amount of RNA used for cDNA preparation. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters differ significantly at P<0.001. In each experiment, measures were obtained as the mean of three replicates.

  • View in gallery

    Effect of CLA on estradiol-17β content. Cells were treated with or without CLA (10 μM) for 48 h in the presence or absence of FSH, IGF1, and GW9662 as shown in the figure and described in the Materials and methods section. Hormone was estimated using ELISA. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001). In each experiment, measures were obtained as the mean of three replicates.

  • View in gallery

    Phosphorylation of Akt and induction of PTEN in cultured buffalo granulosa cells. Cells were cultured as described in the Materials and Methods section. Cells were either left untreated (control) or treated with CLA (10 μM), GW9662 (1 μM) alone, or in combination for 48 h followed by stimulation with FSH (25 ng/ml) or IGF1 (50 ng/ml) for 30 min. After that, cells were collected for protein isolation. Immunoblotting was done using anti-p-AktAb (top), anti-PTENAb (middle), and anti-β-actin Ab (bottom). Immunoblots present the p-Akt and PTEN (A and C) in cells treated with FSH, IGF1, CLA, and GW9662. Ratio of signal intensity of p-Akt and PTEN (B and D), which was normalized to β-actin. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference at P<0.001.

  • View in gallery

    Phosphorylation of Akt and induction of PTEN in cultured buffalo granulosa cells in vitro. Cells were cultured as described in the Materials and Methods section and were either left untreated (control) or treated with CLA (10 μM), GW9662 (1 μM) alone, or in combination for 48 h followed by stimulation with FSH (25 ng/ml)+IGF1 (50 ng/ml) for 30 min. Also cells were incubated with or without bpV(pic) – 10 μM for 30 min followed by induction with CLA (10 μM) for next 48 h. Cell lysates were prepared followed by immunoblotting. (A) Representative immunoblots showing p-Akt (top), PTEN (middle), and β-actin (bottom). (B) Histogram presents their respective densitometric signal intensity normalized to the β-actin. (C) Representative immunoblot showed the effect of bpV(pic) on p-Akt (top), PTEN (middle), and β-actin (bottom). (D) Ratio of signal intensity of p-Akt/β-actin. Results are expressed as ±s.e.m. of three independent experiments. Bars with different letters indicate significantly difference (P<0.001).

  • View in gallery

    Proposed cross talk between CLA and FSH+IGF1 downstream signaling pathway. In granulosa cell, FSH+IGF1 synergistic effects are indispensable for proliferation and steroidogenesis mainly through PI3K/Akt pathways. CLA binds to nuclear receptor PPARG and induced its expression, which further increased the expression of PTEN and upregulated PTEN, which intervenes IGF1 signaling by two ways: (A) decreasing IGF1 mRNA and (B) dephosphorylating PIP3 to PIP2, which leads to downregulation of p-Akt.

  • BaumenDECurrieWB1980Partitioning of nutrients during pregnancy and lactation: a review of mechanisms involving homeostasis and homeorhesis. Journal of Dairy Science6215141529. doi:10.3168/jds.S0022-0302(80)83111-0.

    • Search Google Scholar
    • Export Citation
  • BeluryMA2002Inhibition of carcinogenesis by conjugated linoleic acid: potential mechanisms of action. Journal of Nutritional Biochemistry13229952998.

    • Search Google Scholar
    • Export Citation
  • ButtAJFirthSMBaxterRC1999The IGF axis and programmed cell death. Immunology and Cell Biology77256262. doi:10.1046/j.1440-1711.1999.00822.x.

    • Search Google Scholar
    • Export Citation
  • CaoLQChenXLWangQHuangXHZhenMCZhangLJWenLIJiongBI2007Upregulation of PTEN involved in rosiglitazone-induced apoptosis in human hepatocellular carcinoma cells. Acta Pharmacologica Sinica6879887. doi:10.1111/j.1745-7254.2007.00571.x.

    • Search Google Scholar
    • Export Citation
  • Coyral-CastleSRameCFatetADupontJ2010Effects of unsaturated fatty acids on progesterone secretion and selected protein kinases in goat granulosa cells. Domestic Animal Endocrinology38272283. doi:10.1016/j.domaniend.2009.12.002.

    • Search Google Scholar
    • Export Citation
  • DereckaKSheldrickELWathesDCAbayasekaraDREFlintAPF2008A PPAR-independent pathway to PUFA-induced COX-2 expression. Molecular and Cellular Endocrinology2876571. doi:10.1016/j.mce.2008.02.015.

    • Search Google Scholar
    • Export Citation
  • DeveryRMillerAStantonC2001Conjugated linoleic acid and oxidative behaviour in cancer cells. Biochemical Society Transactions29341344. doi:10.1042/BST0290341.

    • Search Google Scholar
    • Export Citation
  • EhrmannDASchneiderDJSobelBECavaghanMKImperialJRosenfieldRLPolonskyKS1997Troglitazone improves defects in insulin action, insulin secretion, ovarian steroidogenesis, and fibrinolysis in women with polycystic ovary syndrome. Journal of Clinical Endocrinology and Metabolism8221082116. doi:10.1210/jc.82.7.2108.

    • Search Google Scholar
    • Export Citation
  • Fernandez-FernandezRMartiniACNavarroVMCastellanoJMDieguezCAguilarEPinillaLTena-SempereM2006Novel signals for the integration of energy balance and reproduction. Molecular and Cellular Endocrinology254127132. doi:10.1016/j.mce.2006.04.026.

    • Search Google Scholar
    • Export Citation
  • GygiSPRochonYFranzaBRAebersoldR1999Correlation between protein and mRNA abundance in yeast. Molecular and Cellular Biology1917201730.

    • Search Google Scholar
    • Export Citation
  • HouseknechtKLVanden HeuvelJPMoya-CamarenaSYPortocarreroCPPeckLWNickelKPBeluryMA1998Dietary conjugated linoleic acid normalizes impaired glucose tolerance in the Zucker diabetic fatty fa/fa rat. Biochemical and Biophysical Research Communications244678682. doi:10.1006/bbrc.1998.8303.

    • Search Google Scholar
    • Export Citation
  • KeplerCRTuckerWPToveSB1970Biohydrogenation of unsaturated fatty acids, IV. Substrate specificity and inhibition of linoleate δ-12-cis, δ-11-trans-isomerase from Butyrivibrio fibrisolvens. Journal of Biological Chemistry24536123620.

    • Search Google Scholar
    • Export Citation
  • KimEJKangIJChoHJKimWKHaYLParkJHY2003Conjugated linoleic acid downregulates insulin-like growth factor-I receptor levels in HT-29 human colon cancer cells. Journal of Nutrition13326752681.

    • Search Google Scholar
    • Export Citation
  • KomarCM2005Peroxisome proliferator-activated receptors (PPARs) and ovarian function – implications for regulating steroidogenesis, differentiation, and tissue remodeling. Reproductive Biology and Endocrinology341doi:10.1186/1477-7827-3-41.

    • Search Google Scholar
    • Export Citation
  • LeeKNKritchevskyDParizaMW1994Conjugated linoleic acid and atherosclerosis in rabbits. Atherosclerosis1081925. doi:10.1016/0021-9150(94)90034-5.

    • Search Google Scholar
    • Export Citation
  • LeeSYHurGYJungKHJungHCLeeSYKimJHShinCShimJJInKHKangKH2006PPAR-γ agonist increase gefitinib's antitumor activity through PTEN expression. Lung Cancer51297301. doi:10.1016/j.lungcan.2005.10.010.

    • Search Google Scholar
    • Export Citation
  • LeroyJLVanholderTVan knegselATGarcia-IspiertoIBolsPE2008Nutrient prioritization in dairy cow early postpartum: mismatch between metabolism and fertility?Reproduction in Domestic Animals4396103. doi:10.1111/j.1439-0531.2008.01148.x.

    • Search Google Scholar
    • Export Citation
  • MaehamaTDixonJE1998The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. Journal of Biological Chemistry2731337513378. doi:10.1074/jbc.273.22.13375.

    • Search Google Scholar
    • Export Citation
  • MareiWFWathesDCFouladi-NashtaAA2009The effect of linolenic acid on bovine oocyte maturation and development. Biology of Reproduction8110641072. doi:10.1095/biolreprod.109.076851.

    • Search Google Scholar
    • Export Citation
  • MitwallyMFMKuscuNKYalcinkayaTM1999High ovulatory rates with use of troglitazone in clomiphene-resistant women with polycystic ovary syndrome. Human Reproduction1427002703. doi:10.1093/humrep/14.11.2700.

    • Search Google Scholar
    • Export Citation
  • MongaRSharmaIDattaTKSinghD2011Characterization of serum-free buffalo granulosa cell culture and analysis of genes involved in terminal differentiation from FSH- to LH-responsive phenotype. Domestic Animal Endocrinology41195201. doi:10.1016/j.domaniend.2011.07.001.

    • Search Google Scholar
    • Export Citation
  • MuruganMAFenwickMAChengZSharmaMKSinghDWathesDC2010IGF1 induces up-regulation of steroidogenic and apoptotic regulatory genes via activation of phosphatidylinositol-dependent kinase/AKT in bovine granulosa cells. Reproduction139139151. doi:10.1530/REP-09-0050.

    • Search Google Scholar
    • Export Citation
  • NicolosiRJRogersEJKritchevskyDScimecaJAHuthPJ1997Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atherosclerosis in hypercholesterolemic hamsters. Artery22266277.

    • Search Google Scholar
    • Export Citation
  • OdensLJBurgosRInnocentiMVanBaaleMJBaumgardLH2007Effects of varying doses of supplemental conjugated linoleic acid on production and energetic variables during the transition period. Journal of Dairy Science90293305. doi:10.3168/jds.S0022-0302(07)72630-9.

    • Search Google Scholar
    • Export Citation
  • OrsiNMGopichandranNLeeseHJPictonHMHarrisSE2005Fluctuations in bovine ovarian follicular fluid composition throughout the oestrous cycle. Reproduction129219228. doi:10.1530/rep.1.00460.

    • Search Google Scholar
    • Export Citation
  • ParkYAlbrightKJLiuWStorksonJMCookMEParizaMW1997Effect of conjugated linoleic acid on body composition in mice. Lipids32853858. doi:10.1007/s11745-997-0109-x.

    • Search Google Scholar
    • Export Citation
  • ParizaMWParkYCookME2001The biologically active isomers of conjugated linoleic acid. Progress in Lipid Research40283298. doi:10.1016/S0163-7827(01)00008-X.

    • Search Google Scholar
    • Export Citation
  • PoretskyLCataldoNARosenwaksZGiudiceLC1999The insulin-related ovarian regulatory system in health and disease. Endocrine Reviews20535582. doi:10.1210/er.20.4.535.

    • Search Google Scholar
    • Export Citation
  • RenavilleBBacciuNCominAMottaMPoliIVaniniGPrandiA2008Plasma and follicular fluid fatty acid profiles in dairy cows. Reproduction in Domestic Animals45118121. doi:10.1111/j.1439-0531.2008.01264.x.

    • Search Google Scholar
    • Export Citation
  • RevelliADelle PianeLCasanoSMolinariEMassobrioMRinaudoP2009Follicular fluid content and oocyte quality: from single biochemical markers to metabolomics. Reproductive Biology and Endocrinology4740. doi:10.1186/1477-7827-7-40.

    • Search Google Scholar
    • Export Citation
  • RimonESassonRDantesALand-BrachaAAmsterdamA2004Gonadotropin induced gene regulation in human granulosa cells obtained from IVF patients: modulation of genes coding for growth factors and their receptors and genes involved in cancer and other diseases. International Journal of Oncology2413251338.

    • Search Google Scholar
    • Export Citation
  • RubenstrunkAHanfRHumDWFruchartJCStaelsB2007Safety issues and prospects for future generations of PPAR modulator. Biochimica et Biophysica Acta177110651081. doi:10.1016/j.bbalip.2007.02.003.

    • Search Google Scholar
    • Export Citation
  • SchmidtMWHousemanAIvanovARWolfDA2007Comparative proteomic and transcriptomic profiling of the fission yeast Schizosaccharomyces pombe. Molecular Systems Biology379doi:10.1038/msb4100117.

    • Search Google Scholar
    • Export Citation
  • SeargentJMYatesEAGillJH2004GW9662, a potent antagonist of PPARγ, inhibits growth of breast tumour cells and promotes the anticancer effects of the PPARγ agonist rosiglitazone, independently of PPARγ activation. British Journal of Pharmacology143933937. doi:10.1038/sj.bjp.0705973.

    • Search Google Scholar
    • Export Citation
  • SinclairKDLunnLAKwongWYWonnacottKLinforthRSCraigonJ2008Amino acid and fatty acid composition of follicular fluid as predictors of in-vitro embryo development. Reproductive Biomedicine Online16859868. doi:10.1016/S1472-6483(10)60153-8.

    • Search Google Scholar
    • Export Citation
  • SinghRSinclairKD2007Metabolomics: approaches to assessing oocyte and embryo quality. Theriogenology685662. doi:10.1016/j.theriogenology.2007.04.007.

    • Search Google Scholar
    • Export Citation
  • Von SoostenDMeyerUWeberEMRehageJFlachowskyGDänickeS2011Effect of trans-10, cis-12 conjugated linoleic acid on performance, adipose depot weights, and liver weight in early-lactation dairy cows. Journal of Dairy Science946285962870. doi:10.3168/jds.2010-3851.

    • Search Google Scholar
    • Export Citation
  • YiHKKimSYHwangPHKimCYYangDHOhYLeeDY2005Impact of PTEN on the expression of insulin-like growth factors (IGFs) and IGF-binding proteins in human gastric adenocarcinoma cells. Biochemical and Biophysical Research Communications330760776. doi:10.1016/j.bbrc.2005.03.045.

    • Search Google Scholar
    • Export Citation