Mouse forkhead L2 maintains repression of FSH-dependent genes in the granulosa cell

in Reproduction

The forkhead transcription factor forkhead box L2 (FOXL2) is expressed in granulosa cells of small and medium follicles in the mouse ovary. Foxl2 female knockout mice exhibit primordial follicle depletion and primary ovarian failure, but evidence from adult female conditional Foxl2 knockout mice suggests that FOXL2 may also play a significant role in maintenance of ovarian differentiation at stages beyond the primordial follicle and initial wave of folliculogenesis. We previously showed that human FOXL2 functions as a transcriptional repressor of several key genes involved in granulosa cell proliferation and differentiation, including steroidogenic acute regulatory protein (STAR), P450aromatase (CYP19A1 (CYP19)), P450scc (CYP11A1 (CYP11A)), and cyclin D2 (CCND2). To elucidate the role of mouse FOXL2, we determined its role in transcriptional regulation in Chinese hamster ovary (CHO) cells and then confirmed our findings in mouse granulosa cells. We found that mouse FOXL2 represses the activities of the mouse Star, Cyp19a1, Cyp11a1 promoters in CHO cells, but may not repress the Ccnd2 promoter, and identified the minimal mouse Star, Cyp19a1, and Cyp11a1 promoter regions responsive to FOXL2 regulation. We then knocked down Foxl2 in mouse granulosa cells using siRNA, which resulted in significantly increased expression levels of mouse Star, Cyp19a1, and Cyp11a1 but not Ccnd2. To increase Foxl2 expression levels, we generated a mouse Foxl2 lentiviral construct and used it to infect mouse granulosa cells. Following lentiviral infection, the expression levels of mouse Star, Cyp19a1, and Cyp11a1, but not Ccnd2, decreased significantly. These data confirm that mouse FOXL2 functions as a transcriptional repressor of key granulosa cell genes that influence ovarian development.

Abstract

The forkhead transcription factor forkhead box L2 (FOXL2) is expressed in granulosa cells of small and medium follicles in the mouse ovary. Foxl2 female knockout mice exhibit primordial follicle depletion and primary ovarian failure, but evidence from adult female conditional Foxl2 knockout mice suggests that FOXL2 may also play a significant role in maintenance of ovarian differentiation at stages beyond the primordial follicle and initial wave of folliculogenesis. We previously showed that human FOXL2 functions as a transcriptional repressor of several key genes involved in granulosa cell proliferation and differentiation, including steroidogenic acute regulatory protein (STAR), P450aromatase (CYP19A1 (CYP19)), P450scc (CYP11A1 (CYP11A)), and cyclin D2 (CCND2). To elucidate the role of mouse FOXL2, we determined its role in transcriptional regulation in Chinese hamster ovary (CHO) cells and then confirmed our findings in mouse granulosa cells. We found that mouse FOXL2 represses the activities of the mouse Star, Cyp19a1, Cyp11a1 promoters in CHO cells, but may not repress the Ccnd2 promoter, and identified the minimal mouse Star, Cyp19a1, and Cyp11a1 promoter regions responsive to FOXL2 regulation. We then knocked down Foxl2 in mouse granulosa cells using siRNA, which resulted in significantly increased expression levels of mouse Star, Cyp19a1, and Cyp11a1 but not Ccnd2. To increase Foxl2 expression levels, we generated a mouse Foxl2 lentiviral construct and used it to infect mouse granulosa cells. Following lentiviral infection, the expression levels of mouse Star, Cyp19a1, and Cyp11a1, but not Ccnd2, decreased significantly. These data confirm that mouse FOXL2 functions as a transcriptional repressor of key granulosa cell genes that influence ovarian development.

Introduction

The forkhead family of transcription factors plays a significant role in proliferation and differentiation (Brissette et al. 1996, Dottori et al. 2001, Nakae et al. 2003, Park et al. 2005, Pisarska et al. 2011). Members contain a characteristic winged helix DNA binding domain but have divergent transactivation or transrepression domains (Kaufmann & Knochel 1996, Kaestner et al. 2000, Carlsson & Mahlapuu 2002, Lehmann et al. 2003). A number of forkhead family members that function as transcriptional repressors act to regulate tissue differentiation in a spatiotemporal manner (Brissette et al. 1996, Zhou et al. 1997, Blixt et al. 2000, Nakae et al. 2003). One such member, forkhead box L2 (FOXL2), may function as a determinant of differentiation throughout the lifetime of the female gonad. This may be achieved as early as germ cell fate, through FOXL2's activity as a repressor of the catabolic cytochrome P450 enzyme, CYP26B1, which is involved in degradation of retinoic acid regulating germ cell fate and subsequent sexual differentiation (Kashimada et al. 2011). Tissue differentiation during ovarian development is also regulated by FOXL2, and complete loss of Foxl2 expression leads to an immediate loss of the primordial (type 2) follicle pool (Crisponi et al. 2001, Schmidt et al. 2004, Uda et al. 2004). Histological studies indicate that Foxl2 is expressed in the undifferentiated granulosa cells of small (type 3a) and medium (types 3b, 4, and 5a) follicles in the ovary, past the timepoint when primordial follicle depletion occurs in Foxl2 knockout mice (Crisponi et al. 2001, Schmidt et al. 2004, Uda et al. 2004), and evidence from adult female conditional Foxl2 knockout mice suggests that FOXL2 may also play a significant role in maintenance of ovarian differentiation (Uhlenhaut et al. 2009). However, these studies are limited and a better understanding of FOXL2 in all stages of follicle development is necessary in order to understand the role of FOXL2 in follicle maintenance. In humans, heterozygous mutations in the FOXL2 gene lead to blepharophimosis–ptosis–epicanthus inversus syndrome (BPES), which is associated with characteristic eyelid dysplasia, premature ovarian failure, and infertility in females (Zlotogora et al. 1983). Unlike the primary ovarian failure from primordial follicle arrest that occurs in Foxl2 homozygous knockout mice (Schmidt et al. 2004, Uda et al. 2004), humans with BPES and heterozygous mutations undergo a complete sequence of follicle development with early depletion of the follicle pool and premature ovarian failure (Fraser et al. 1988, Schmidt et al. 2004).

FSH is necessary for maturation of ovarian follicles (Kumar et al. 1997). This process is regulated through the G-protein-coupled FSH receptor, which activates adenylyl cyclase, increases cAMP production, and activation of protein kinase A (Richards 1994, Richards et al. 1998, Richards & Pangas 2010). This and other signaling cascades involving PI3K (Wayne et al. 2007), RAS (Wayne et al. 2007), and glycogen synthase kinase 3β (GSK3β) (Gonzalez-Robayna et al. 2000) regulate transcription factors that in turn influence granulosa cell proliferation and differentiation (Hsueh et al. 1984). Although some transcription factors function as activators under the influence of FSH, including β-catenin (CTNNB1; Fan et al. 2010), others, including members of the forkhead family, act as negative regulators (Park et al. 2005, Liu et al. 2009). In studies performed using Chinese hamster ovary (CHO) cells, we previously demonstrated that human FOXL2 functions as a transcriptional repressor of several key genes involved in granulosa cell proliferation and differentiation. These include the human steroidogenic acute regulatory protein (STAR) gene (Pisarska et al. 2004), which translocates cholesterol from the outer to the inner membrane of mitochondria, the rate-limiting step in steroidogenesis (Clark et al. 1994, Lin et al. 1995, Stocco 2001); human P450aromatase (CYP19A1 (CYP19); Bentsi-Barnes et al. 2010, Kuo et al. 2011), which is a key enzyme expressed in granulosa cells and is the rate-limiting step in the conversion of androgens to estrogens; and human P450scc (CYP11A1 (CYP11A); Bentsi-Barnes et al. 2010, Kuo et al. 2011), which cleaves the side chain of cholesterol to produce pregnenolone, the first committed and rate-limiting step in steroid hormone synthesis (Stocco 2001). We found that human FOXL2 also represses transcription of cyclin D2 (CCND2; Bentsi-Barnes et al. 2010, Kuo et al. 2011), which regulates cyclin-dependent kinases 4 or 6 (Cdk4 or Cdk6) to control G1 phase progression of the cell cycle and is involved in granulosa cell proliferation (Sicinski et al. 1996, Moons et al. 2002). These data suggested that FOXL2 may function as a suppressor of ovarian follicle progression in small and medium follicles by the prevention of premature differentiation and/or proliferation of granulosa cells. However, testing this hypothesis in a human system is limited by lack of access to human granulosa cells other than cell lines derived from granulosa cell tumors, such as the KGN cell line (Nishi et al. 2001), which contains a C402G mutation in FOXL2 (Shah et al. 2009). To determine whether mouse FOXL2 functions similarly to human FOXL2, and the utility of mouse granulosa cells as a model system, we cloned the mouse Foxl2 cDNA and determined its role in the regulation of the mouse Star, Cyp19a1, Cyp11a1, and Ccnd2 genes under the influence of FSH in mouse granulosa cells.

Results

Mouse Star, Cyp19a1, and Cyp11a1 promoters, but not the Ccnd2 promoter, are repressed by mouse FOXL2

We have previously demonstrated that human FOXL2 represses transcription of the human STAR, CYP19A1, CYP11A1, and CCND2 promoters (Pisarska et al. 2004, Bentsi-Barnes et al. 2009, Kuo et al. 2011). To determine whether mouse FOXL2 functions in a similar manner to human FOXL2, the −192 bp mouse Star, −341 bp mouse Cyp19a1, −862 bp mouse Cyp11a1, and −1142 to −248 bp mouse Ccnd2 promoter fragments were cloned into a luciferase reporter vector. These promoter–luciferase constructs were co-transfected into CHO cells with increasing amounts of the mouse Foxl2 expression vector, and the resulting luciferase activities were measured after 24 h of transfection. In the presence of mouse FOXL2, the basal activities of the mouse Star, Cyp19a1, and Cyp11a1 promoters were repressed even at the lowest concentration of FOXL2 (Fig. 1A, B and C), whereas the mouse Ccnd2 promoter was only modestly repressed (Fig. 1D). These results indicate that mouse FOXL2 functions as a transcriptional repressor and represses the activities of the mouse Star, Cyp19a1, and Cyp11a1 promoters and possibly the mouse Ccnd2 promoter.

Figure 1
Figure 1

Mouse Star, Cyp19a1, and Cyp11a1 promoters are repressed by mouse FOXL2. CHO cells were transiently transfected with mouse wild-type FOXL2 and reporter constructs for the mouse Star (A), Cyp19a1 (B), Cyp11a1 (C), or Ccnd2 (D) promoters. The normalized luciferase activity of each sample was compared with the normalized luciferase activity of cells transfected with the pGL2-basic expression vector. Values shown are expressed as percentage (%) of control. One-way ANOVA was performed between samples and different letters (a, b, or c) denote significant differences (P<0.05) between samples. In the presence of mouse FOXL2, the basal activities of the mouse Star, Cyp19a1, and Cyp11a1 promoters were repressed (A, B and C), but minimal effect was seen on the mouse Ccnd2 (D) promoter.

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

Minimal regions of the mouse Star, Cyp19a1, and Cyp11a1 promoters responsive to repression by mouse FOXL2

To determine the minimal regions of these promoters responsive to regulation by FOXL2, we generated a series of luciferase reporter constructs as follows: two mouse Star promoter fragments (from −192 and −100 bp), two mouse Cyp19a1 promoter fragments (from −341 and −58 bp), three mouse Cyp11a1 promoter fragments (from −862, −622, and −182 bp), and two mouse Ccnd2 promoter fragments (from −1142 to −248 bp and −316 to −248 bp). Each of these promoter–luciferase constructs was transiently co-transfected with the mouse FOXL2 expression construct into CHO cells, and the resulting luciferase activities were measured 24 h after transfection. We found that mouse FOXL2 continued to function as a transcriptional repressor of the shortest Star (Fig. 2A), Cyp19a1 (Fig. 2B), and Cyp11a1 promoter fragments (Fig. 2C) but failed to consistently repress transcription of the Ccnd2 promoter fragments (Fig. 2D). These results suggest that binding sites for mouse FOXL2 are located in the −100, −58, and −182 bp regions of the mouse Star, Cyp19a1, and Cyp11a1 promoters respectively.

Figure 2
Figure 2

Minimal promoter regions responsive to repression by mouse FOXL2. A series of luciferase reporter constructs containing fragments of the mouse Star, Cyp19a1, Cyp11a1, and Ccnd2 promoters was generated. Each of these promoter–luciferase constructs was transiently co-transfected with mouse FOXL2 into CHO cells, and the resulting luciferase activities were measured 24 h after transfection. The normalized luciferase activity of each sample was compared with the normalized luciferase activity of cells transfected with the pGL2-basic expression vector. Values shown are expressed as percentage of control. One-way ANOVA was performed between samples, and different letters (a, b, or c) denote significant differences (P<0.05) between samples. FOXL2 continues to function as a transcriptional repressor of the shortest Star (A), Cyp19a1 (B), and Cyp11a1 promoter fragments (C). In contrast, FOXL2 fails to repress transcription of the Ccnd2 promoter (D).

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

Knockdown of FOXL2 in mouse granulosa cells increases the expression of Star, Cyp19a1, and Cyp11a1

To test whether mouse FOXL2 also functions as a transcriptional repressor of the Star, Cyp19a1, Cyp11a1, and Ccnd2 genes in granulosa cells, we used siRNA to knock down the expression of Foxl2 in primary mouse granulosa cells and then treated the cells with either FSH and testosterone or FSH alone. Testosterone was included to better mimic the environment in the two-cell model of ovarian follicles, where testosterone released from theca cells may serve as a substrate for P450aromatase (the product of the Cyp19a1 gene) in the conversion of androgens to estrogens in granulosa cells (Liu & Hsueh 1986), and to enhance Cyp19a1 expression. As shown in Fig. 3A, these primary mouse granulosa cell cultures expressed Foxl2, and following transfection with a Foxl2 siRNA and treatment with FSH and testosterone, the expression level of mouse Foxl2 was reduced to 30% vs the level in cells transfected with non-silencing siRNA. Slightly less reduction in the expression level of mouse Foxl2 was observed when transfected cells were treated with FSH alone (Fig. 3B). We then compared the expression levels of Star, Cyp19a1, Cyp11a1, and Ccnd2 in granulosa cells transfected with Foxl2 siRNA vs a non-silencing siRNA, using quantitative real-time PCR (q-RT-PCR). As shown in Fig. 3C, transfection with the Foxl2 siRNA and treatment with FSH and testosterone resulted in significantly increased expression levels of the mouse Star (2.5-fold, P<0.005), Cyp19a1 (fourfold, P<0.005), and Cyp11a1 (1.5-fold, P<0.005) genes but had no effect on the expression level of Ccnd2 (P>0.1). When cells were transfected with the Foxl2 siRNA and treated with FSH alone, similar results were obtained: significant increases occurred in the expression levels of the mouse Star, Cyp19a1, and Cyp11a1 genes, but no effect was seen on the expression level of mouse Ccnd2 (Fig. 3D). These findings are consistent with the CHO cell model and support a role for FOXL2 as a transcriptional repressor of Star, Cyp19a1, and Cyp11a1, but not Ccnd2, in mouse granulosa cells.

Figure 3
Figure 3

Knock down of FOXL2 in mouse granulosa cells increases the expression of Star, Cyp19a1, and Cyp11a1. (A and B) Primary mouse granulosa cell cultures were transfected with a non-silencing siRNA or a Foxl2 siRNA and then treated with FSH and testosterone (A) or FSH alone (B). Foxl2 is endogenously expressed in these cultures, and following transfection with the Foxl2 siRNA, Foxl2 expression levels were reduced to 30–50% of those in cells transfected with non-silencing siRNA. (C and D) Primary mouse granulosa cell cultures were transfected with a non-silencing siRNA or a Foxl2 siRNA and then treated with FSH and testosterone (C) or FSH alone (D). The expression levels of Star, Cyp19a1, Cyp11a1, and Ccnd2 in granulosa cells transfected with Foxl2 siRNA vs non-silencing siRNA were then compared using q-RT-PCR. Transfection with the Foxl2 siRNA resulted in significantly increased expression levels of the Star (P<0.005), Cyp19a1 (P<0.005), and Cyp11a1 (P<0.005) genes in mouse granulosa cells but had no effect on the expression level of mouse Ccnd2 (P>0.1). *Indicates significant difference. Error bars indicate s.d.

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

Overexpression of FOXL2 in mouse granulosa cells decreases the expression of Star, Cyp19a1, and Cyp11a1

To further confirm that mouse FOXL2 negatively regulates expression of the mouse Star, Cyp19a1, and Cyp11a1 genes, we generated a lentiviral vector for mouse FOXL2 and used this to infect primary mouse granulosa cell cultures. The cells were then treated with FSH and testosterone or FSH alone, as described earlier. As shown in Fig. 4A, when mouse granulosa cells were infected with the mouse Foxl2 lentivirus and treated with FSH and testosterone, the expression level of Foxl2 was increased up to 17-fold vs that seen in cells infected with an empty lentiviral vector backbone. Similar results were obtained when cells were infected with the mouse Foxl2 lentivirus and treated with FSH alone (Fig. 4B). We then compared the expression of the mouse Star, Cyp19a1, Cyp11a1, and Ccnd2 genes in granulosa cells infected with the mouse Foxl2 lentiviral vector vs lentiviral vector backbone. As shown in Fig. 4C, infection with the Foxl2 lentivirus followed by treatment with FSH and testosterone resulted in significantly decreased expression of the mouse Star, Cyp19a1, and Cyp11a1 genes (P<0.05) but had no significant effect on the expression of Ccnd2 (P>0.05). Similar results were obtained when infected cells were treated with FSH alone, with the exception of an increase in the repression of Ccnd2, such that the effect of Foxl2 now reached significance (P<0.05, Fig. 4D). These data suggest that increased expression of mouse Foxl2 further decreases the expression of Star, Cyp19a1, and Cyp11a1 in mouse granulosa cells, again supporting a role for FOXL2 as a transcriptional repressor of these genes in mouse granulosa cells and confirming our studies conducted in the CHO cell line.

Figure 4
Figure 4

Overexpression of FOXL2 in mouse granulosa cells decreases the expression of Star, Cyp19a1, and Cyp11a1. (A and B) Primary mouse granulosa cell cultures were infected with a lentiviral vector for mouse FOXL2 or with an empty lentiviral vector backbone and then treated with FSH and testosterone (A) or FSH alone (B). After 5 days of infection, around 80% of the cells were GFP positive, indicating the MOI was around two. The expression levels of Foxl2 in granulosa cells infected with the mouse Foxl2 lentivirus were increased 13- to 17-fold vs those in cells infected with the lentiviral vector backbone. (C and D) The expression levels of Star, Cyp19a1, Cyp11a1, and Ccnd2 in granulosa cells infected with the mouse Foxl2 lentivirus vs the lentiviral vector backbone were then compared using q-RT-PCR. Infection with the Foxl2 lentivirus in the presence of FSH and testosterone resulted in significantly decreased expression of the mouse Star, Cyp19a1, and Cyp11a1 genes (P<0.05) but had no significant effect on the expression of Ccnd2 (P>0.05). In the presence of FSH alone, infection with the Foxl2 lentivirus also resulted in significant decreased expression of the mouse Star, Cyp19a1, and Cyp11a1 genes (P<0.05); however, there was increased repression of Ccnd2, which now reached significance (P<0.05). *Indicates significant difference. Error bars indicate s.d.

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

Discussion

Understanding the genes and pathways controlling granulosa cell steroidogenesis, proliferation, and differentiation is of central importance in understanding normal ovarian folliculogenesis. We have previously shown that Foxl2 is predominantly expressed in the granulosa cells of small (type 3a) and medium (types 3b, 4, and 5a) follicles in the mouse ovary but is absent from the granulosa cells of large antral follicles (types 7 and 8) and the corpus luteum (Pisarska et al. 2004). Our current results indicate that mouse FOXL2 represses the activities of the Star, Cyp19a1, and Cyp11a1 promoters in CHO cells, and this is confirmed in mouse granulosa cells in both knockdown and upregulation studies following treatment with FSH and testosterone or FSH alone. Follicular maturation to a preovulatory phenotype is dependent on FSH (Kumar et al. 1997) leading to expression of key genes including Cyp19a1 and Cyp11a1 (Hsueh et al. 1984). We previously showed that in the presence of human FOXL2, the transcriptional activities of human StAR (Pisarska et al. 2004), human P450aromatase (CYP19A1), and human P450scc (CYP11A1) (Bentsi-Barnes et al. 2010, Kuo et al. 2011), markers of granulosa cell functional maturation, are repressed. Based on these results and the premature ovarian failure phenotypes seen in humans with heterozygous mutations in FOXL2 and BPES, we have hypothesized that relief of this transcriptional repression may be required to allow granulosa cell differentiation and follicle maturation. Our present results for mouse FOXL2 are consistent with our previous human findings, further supporting our hypothesis that FOXL2 may influence follicle maturation by preventing the premature differentiation of granulosa cells, and thus suppress ovarian follicle progression.

Testosterone was included with FSH in these experiments because in ovarian follicles in vivo, testosterone released from theca cells may serve as a substrate for P450aromatase (the product of the Cyp19a1 gene) in the conversion of androgens to estrogens in granulosa cells (Liu & Hsueh 1986). Testosterone may also enhance expression of Cyp19a1 in granulosa cells (Fitzpatrick & Richards 1991). Therefore, we included testosterone to better mimic the environment in the two-cell model of ovarian follicles, with theca cells surrounding granulosa cells, and controlled for independent effects of testosterone by repeating the experiments using FSH alone. Overall, we did not find significant differences in the effects on Star, Cyp19a1, and Cyp11a1 when Foxl2 was overexpressed in the presence of FSH and testosterone vs FSH alone. Further, the effects on Star, Cyp19a1, and Cyp11a1 or Ccnd2 were also not significantly different when Foxl2 expression was knocked down in the presence of FSH and testosterone vs FSH alone, although the expression of Cyp19a1 in the absence of FOXL2 repression is greater in the presence of FSH and testosterone than for FSH alone, likely because testosterone can enhance Cyp19a1 expression.

We found that mouse FOXL2 does not appear to regulate the activity of the Ccnd2 promoter in CHO cells, or the expression of Ccnd2 in mouse granulosa cells, with the exception that Ccnd2 expression is further repressed when Foxl2 is overexpressed in the presence of FSH alone, as opposed to FSH and testosterone. This may be due to differences in the consensus sites of these various promoters that are regulated by FOXL2. There have been a number of different FOXL2 binding sites described, the traditional forkhead consensus site ((G/A)(T/C)(A/C)AA(C/T)A; Overdier et al. 1994, Pierrou et al. 1994, Kaufmann et al. 1995, Roux et al. 1995, Kaufmann & Knochel 1996) and two nontraditional FOXL2 binding elements identified by Benayoun et al. (2008b) (GT(C/G)AAGG(G/T)) and Lamba et al. (2009) (T(A/G/T)TT(T/G)A; FOXL2 binding sites A and B in Fig. 5 respectively). Interestingly, a steroidogenic factor-1 (SF-1) binding site ((T/C)CAAGG(T/C)C(A/G); Fig. 5, SF-1 binding site A; Ueda et al. 1992) shares sequence similar to the FOXL2 binding site identified by Benayoun et al. (2008b). Furthermore, SF1 binds to its own complimentary sequence ((T/C)G(G/A)CCTTG(G/A); Fig. 5, SF-1 binding site B; Barnhart & Mellon 1994). As shown in Fig. 5, the StAR promoter contains three FOXL2 binding sites B, one SF-1/FOXL2 binding site A, and one SF-1 binding site B; the Cyp19a1 promoter contains two FOXL2 binding sites B and one traditional forkhead binding site; and the Cyp11a1 promoter contains three SF-1/FOXL2 binding sites A, one FOXL2 binding site B, and one SF-1 binding site B, whereas the Ccnd2 promoter only contains a single SF-1/FOXL2 binding site A. As all the other promoters contain multiple FOXL2 and/or SF-1 binding sites, transcriptional regulation may be dependent, at least in part, on the number of binding sites present in a promoter. Furthermore, it may be the result of the interactions between FOXL2 and SF-1, as FOXL2 binding to SF-1 has been implicated in regulation of steroidogenic gene transcription: it has been associated with upregulation (Wang et al. 2007) and inhibition of transcriptional activation (Fleming et al. 2010, Park et al. 2010), whereas other studies have found that FOXL2 and SF-1 have completely opposing effects on gene regulation. As there is only one binding site in the Ccnd2 promoter tested (see Fig. 6), it is possible that FOXL2 and SF-1 compete for this site, leading to loss of transcriptional regulation.

Figure 5
Figure 5

Comparison of the mouse and human CCND2 promoters. The promoters of mouse Ccnd2 and human CCND2 were analyzed and compared for SF-1 and FOXL2 binding sites. The mouse Ccnd2 promoter contains a single SF1 binding site A/FOXL2 binding site A (denoted by a shaded box), whereas the human CCND2 promoter contains a single FOXL2 binding site B (denoted by a solid box). Base pair notations indicated are the positions relative to the transcriptional start sites for all sequences depicted.

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

Figure 6
Figure 6

Analysis of FOXL2 DNA binding sites in the Star, Cyp19a1, Cyp11a1, and Ccnd2 promoters. The promoters of Star, Cyp19a1, Cyp11a1, and Ccnd2 were analyzed for SF-1 binding sites (A, ((T/C)CAAGG(T/C)C(A/G)); B, ((T/C)G(G/A)CCTTG(G/A))) and FOXL2 binding sites (A, (GT(C/G)AAGG(G/T)); B, (T(A/G/T)TT(T/G)A))) as well as the consensus forkhead binding site ((G/A)(T/C)(A/C)AA(C/T)A)). As SF1 binding site A and FOXL2 binding site A share the same core sequence CAAGGT, they are denoted by shaded boxes. FOXL2 binding site B is denoted by solid boxes, the consensus forkhead binding site is denoted by dashed boxes, and SF-1 binding site B is denoted by doted boxes. Base pair notation indicated is position relative to the transcriptional start site for all sequences depicted.

Citation: REPRODUCTION 144, 4; 10.1530/REP-11-0259

In addition to SF-1, FOXL2 transcriptional regulation may be altered by other transcription factors known to bind to FOXL2 (Lee et al. 2005, Blount et al. 2009, Kim et al. 2009, Lamba et al. 2009), as well as FOXL2 binding to itself (Lamba et al. 2009, Benayoun et al. 2010, Fleming et al. 2010, Kuo et al. 2011). Further, posttranslational modifications such as sumoylation (Marongiu et al. 2010, Pisarska et al. 2010), phosphorylation (Benayoun et al. 2008a, Pisarska et al. 2010), and acetylation (Benayoun et al. 2008a) may all act to modify FOXL2 transcriptional activity under the influence of FSH and the various signaling cascades that have been identified in granulosa cell proliferation and differentiation. Further studies are necessary to identify the specific upstream regulators of FOXL2 transcriptional regulation.

Finally, we have demonstrated that CHO cells can be used as a model of FOXL2 regulation, as its activity as a transcriptional repressor in this system is similar to that in mouse granulosa cells. Although the Foxl2 knockout mouse has been instrumental in identifying its role as a determinant of tissue differentiation (Crisponi et al. 2001, Schmidt et al. 2004, Uda et al. 2004), the complete loss of the primordial follicle pool prevents study of Foxl2 in the adult ovary, where it is expressed in the undifferentiated granulosa cells of small and medium follicles, and may be a time when mutations of FOXL2 contribute to the premature ovarian failure phenotype in patients with BPES1. As human model systems to study FOXL2 in granulosa cells are limited, the use of mouse FOXL2 in granulosa cells as well as transfection studies in CHO cells may be suitable, based on our findings of similar transcriptional regulation of genes marking granulosa cell differentiation.

Materials and Methods

Plasmids

The mouse Foxl2 cDNA sequence (GenBank: NM 012020) was amplified from a mouse cDNA library by PCR and subcloned into the pcDNA3 vector using HindIII and XbaI restriction sites. The mouse Star promoter (−192 bp, the translation start site as +1, sequence obtained from the UCSC Genome Browser), mouse P450aromatase (Cyp19a1) ovarian-specific promoter II (−341 bp, GenBank accession no. D67046), and mouse P450scc (Cyp11a1) promoter (−862 bp: GenBank accession no. J05511) were PCR amplified using genomic DNA as a template and Hotstar Taq polymerase (Qiagen) according to the manufacturer's protocol. The mouse cyclin D2 (Ccnd2) promoter (−1142 to −248 bp) was kindly provided by Dr Martin Eilers (IMT University of Phillips, Marburg, Germany). Truncated promoter fragments for the mouse Star (spanning from −100 bp), Cyp19a1 (spanning from −58 bp), Cyp11a1 (spanning from −622 and −182 bp), and Ccnd2 (spanning from −316 to −248 bp) promoters were also PCR amplified. PCR products for each of these promoter fragments were gel electrophoresed, and DNAs were extracted and subcloned into the pGL2 luciferase reporter vector backbone (Promega).

Transfection and reporter assays

CHO cells (1×105/well in a 24-well plate) were cultured in DMEM/F12 supplemented with 10% FBS, 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine. The following day, cells were transfected using Lipofectamine 2000 (Invitrogen) with the Star, Cyp19a1, Cyp11a1, or Ccnd2 promoter luciferase reporter vectors (500 ng/well) and the mouse Foxl2 expression construct (0–200 ng/well). The total DNA concentration in each well was maintained at 1 μg by adding the empty pcDNA3 expression vector, including 50 ng of indicator plasmid, pCMV-β-galactosidase. Twenty-four hours after transfection, luciferase activity was measured using a FLUOstar OPTIMA plate reader (BMG Labtech, Offenberg, Germany). Results were then normalized against β-galactosidase activity. The normalized luciferase activity of each sample was compared with the normalized luciferase activity of cells transfected with the pGL2-basic expression vector. Values shown are expressed as percentage of control. Each condition was tested in quadruplicate, and each experiment was repeated at least three times.

Primary mouse granulosa cell culture

Ovaries were dissected from immature Swiss Webster outbred female mice at 23 days of age. The ovaries were rinsed using PBS and then incubated in separating medium (6.8 mM EGTA and 26 mM sodium bicarbonate in DMEM/F12) for 10 min. The ovaries were then placed in washing medium (0.5 M sucrose in DMEM/F12) for 5 min and then moved to culture medium (10% FBS, 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine in DMEM/F12). Mouse granulosa cells were obtained by puncturing the follicles with 25 gauge needles. The granulosa cells were collected and washed with culture medium, after which they were ready for primary cell culture.

siRNA transfection

Mouse granulosa cells (8×105/well in a six-well plate) were plated shortly before transfection and incubated at 37 °C with 5% CO2. HiPerFect transfection reagent (Qiagen) was mixed with non-silencing siRNA or a mouse Foxl2 siRNA (Qiagen), incubated for 10 min, and then added to cells for a final siRNA concentration of 5 nM, in accordance with the manufacturer's instructions. Two hours after transfection, cells were treated with either 50 μg/ml FSH and 10 μg/ml testosterone or 50 μg/ml FSH alone. Cells were continually cultured for 48 h and then lysed for RNA extraction. The transfection efficiency of siRNA was above 90%, tested by Alexa Fluor 488 modified non-silencing siRNA (Qiagen).

Lentiviral vector infection

The mouse Foxl2 cDNA described earlier was subcloned into the VSVG-pseudotyped lentiviral vector (Gene Vector Core Laboratory, Diabetes and Endocrinology Research Center, Baylor College of Medicine, Houston, TX, USA). Mouse granulosa cells (5×105/well in a six-well plate) were plated in culture medium containing 1 μl/ml Polybrene (hexadimethrine bromide, Sigma) and incubated at 37 °C with 5% CO2 for 2 h. Twenty microliters of concentrated control or Foxl2 lentiviral vectors were then added to the cells. After 3 days of incubation, cells were then treated with 50 μg/ml FSH and 10 μg/ml testosterone or 50 μg/ml FSH alone. Cells were continually cultured for 48 h and then lysed for RNA extractions. The infection efficiency was around 80%, determined by the percentage of GFP-positive cells for lentiviral constructs with GFP reporter. Multiplicity of infection (MOI) was around two, calculated according to the percentage of infected cells.

Quantitative real-time PCR

Total RNA was extracted from mouse granulosa cells using the RNeasy Mini Kit according to the manufacturer's protocol (Qiagen), and cDNA was synthesized from 1 μg total RNA using the iScript cDNA Synthesis kit (Bio-Rad Laboratories). To quantify the amounts of the transcripts present, 1 μl RT reaction was used in a 25 μl q-RT-PCR reaction. Q-RT-PCR was performed on a MyiQ Thermal Cycler (Bio-Rad Laboratories) using iQ SYBR green supermix (Bio-Rad Laboratories) for 40 cycles in two-step reactions: 95 °C for 10 s and 60 °C for 45 s. The primers for mouse Foxl2, Star, Cyp19a1, Cyp11a1, Ccnd2, and Actb were listed in Table 1. Gene expression levels were calculated by normalizing cycle numbers to those of Actb.

Table 1

Primer sequences used for quantitative real-time PCR analyses.

GeneSequence (5′–3′)
Foxl2F: CGGCATCTACCAGTACATCATAGC
R: GCACTCGTTGAGGCTGAGGTTG
StarF: GACGTCGGAGCTCTCTGCTT
R: GCCTTCTGCATAGCCACCTC
Cyp19a1F: ATGTTCTTGGAAATGCTGAACCC
R: AGGACCTGGTATTGAAGACGAG
Cyp11a1F: TTACATCGTGGACCCCAAGG
R: CGGTCTTTCTTCCAGGCATC
Ccnd2F: GGTGCAGTGTGCATGTTCCT
R: GCCAGGTTCCACTTCAGCTT
ActbF: CATTGCTGACAGGATGCAGAAGGAG
R: CCTGCTTGCTGATCCACATCTGCTG

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by R01HD047603 from the National Institute of Child Health and Human Development (NICHD) and the Office of Research on Women's Health (ORWH) (M D Pisarska) and by a grant from the Helping Hands of Los Angeles, Inc. (M D Pisarska).

References

  • BarnhartKMMellonPL1994The orphan nuclear receptor, steroidogenic factor-1, regulates the glycoprotein hormone α-subunit gene in pituitary gonadotropes. Molecular Endocrinology8878885. (doi:10.1210/me.8.7.878)

    • Search Google Scholar
    • Export Citation
  • BenayounBAAuerJCaburetSVeitiaRA2008aThe post-translational modification profile of the forkhead transcription factor FOXL2 suggests the existence of parallel processive/concerted modification pathways. Proteomics831183123. (doi:10.1002/pmic.200800084)

    • Search Google Scholar
    • Export Citation
  • BenayounBACaburetSDipietromariaABailly-BechetMBatistaFFellousMVaimanDVeitiaRA2008bThe identification and characterization of a FOXL2 response element provides insights into the pathogenesis of mutant alleles. Human Molecular Genetics1731183127. (doi:10.1093/hmg/ddn209)

    • Search Google Scholar
    • Export Citation
  • BenayounBACaburetSDipietromariaAGeorgesAD'HaeneBPandaranayakaPJL'HoteDTodeschiniALKrishnaswamySFellousM2010Functional exploration of the adult ovarian granulosa cell tumor-associated somatic FOXL2 mutation p.Cys134Trp (c.402C>G). PLoS ONE5e8789. (doi:10.1371/journal.pone.0008789)

    • Search Google Scholar
    • Export Citation
  • Bentsi-BarnesIKKuoFTBarlowGMPisarskaMD2009Human forkhead L2 represses key genes in granulosa cell differentiation including aromatase, P450scc, and cyclin D2. Fertility and Sterility94353356. (doi:10.1016/j.fertnstert.2009.09.050)

    • Search Google Scholar
    • Export Citation
  • Bentsi-BarnesIKKuoFTBarlowGMPisarskaMD2010Human forkhead L2 represses key genes in granulosa cell differentiation including aromatase, P450scc, and cyclin D2. Fertility and Sterility94353356. (doi:10.1016/j.fertnstert.2009.09.050)

    • Search Google Scholar
    • Export Citation
  • BlixtAMahlapuuMAitolaMPelto-HuikkoMEnerbackSCarlssonP2000A forkhead gene, FoxE3, is essential for lens epithelial proliferation and closure of the lens vesicle. Genes and Development14245254. (doi:10.1101/gad.14.2.245)

    • Search Google Scholar
    • Export Citation
  • BlountALSchmidtKJusticeNJValeWWFischerWHBilezikjianLM2009FoxL2 and Smad3 coordinately regulate follistatin gene transcription. Journal of Biological Chemistry28476317645. (doi:10.1074/jbc.M806676200)

    • Search Google Scholar
    • Export Citation
  • BrissetteJLLiJKamimuraJLeeDDottoGP1996The product of the mouse nude locus, Whn, regulates the balance between epithelial cell growth and differentiation. Genes and Development1022122221. (doi:10.1101/gad.10.17.2212)

    • Search Google Scholar
    • Export Citation
  • CarlssonPMahlapuuM2002Forkhead transcription factors: key players in development and metabolism. Developmental Biology250123. (doi:10.1006/dbio.2002.0780)

    • Search Google Scholar
    • Export Citation
  • ClarkBJWellsJKingSRStoccoDM1994The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). Journal of Biological Chemistry2692831428322.

    • Search Google Scholar
    • Export Citation
  • CrisponiLDeianaMLoiAChiappeFUdaMAmatiPBiscegliaLZelanteLNagarajaRPorcuS2001The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nature Genetics27159166. (doi:10.1038/84781)

    • Search Google Scholar
    • Export Citation
  • DottoriMGrossMKLaboskyPGouldingM2001The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes neural crest cell fate. Development12841274138.

    • Search Google Scholar
    • Export Citation
  • FanHYO'ConnorAShitanakaMShimadaMLiuZRichardsJS2010β-Catenin (CTNNB1) promotes preovulatory follicular development but represses LH-mediated ovulation and luteinization. Molecular Endocrinology2415291542. (doi:10.1210/me.2010-0141)

    • Search Google Scholar
    • Export Citation
  • FitzpatrickSLRichardsJS1991Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology12914521462. (doi:10.1210/endo-129-3-1452)

    • Search Google Scholar
    • Export Citation
  • FlemingNIKnowerKCLazarusKAFullerPJSimpsonERClyneCD2010Aromatase is a direct target of FOXL2: C134W in granulosa cell tumors via a single highly conserved binding site in the ovarian specific promoter. PLoS ONE5e14389. (doi:10.1371/journal.pone.0014389)

    • Search Google Scholar
    • Export Citation
  • FraserISShearmanRPSmithARussellP1988An association among blepharophimosis, resistant ovary syndrome, and true premature menopause. Fertility and Sterility50747751.

    • Search Google Scholar
    • Export Citation
  • Gonzalez-RobaynaIJFalenderAEOchsnerSFirestoneGLRichardsJS2000Follicle-stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinase-independent signaling by FSH in granulosa cells. Molecular Endocrinology1412831300. (doi:10.1210/me.14.8.1283)

    • Search Google Scholar
    • Export Citation
  • HsuehAJAdashiEYJonesPBWelshTHJr1984Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocrine Reviews576127. (doi:10.1210/edrv-5-1-76)

    • Search Google Scholar
    • Export Citation
  • KaestnerKHKnochelWMartinezDE2000Unified nomenclature for the winged helix/forkhead transcription factors. Genes and Development14142146. (doi:10.1101/gad.14.2.142)

    • Search Google Scholar
    • Export Citation
  • KashimadaKSvingenTFengCWPelosiEBagheri-FamSHarleyVRSchlessingerDBowlesJKoopmanP2011Antagonistic regulation of Cyp26b1 by transcription factors SOX9/SF1 and FOXL2 during gonadal development in mice. FASEB Journal2535613569. (doi:10.1096/fj.11-184333)

    • Search Google Scholar
    • Export Citation
  • KaufmannEKnochelW1996Five years on the wings of fork head. Mechanisms of Development57320. (doi:10.1016/0925-4773(96)00539-4)

  • KaufmannEMüllerDKnöchelW1995DNA recognition site analysis of Xenopus winged helix proteins. Journal of Molecular Biology248239254. (doi:10.1016/S0022-2836(95)80047-6)

    • Search Google Scholar
    • Export Citation
  • KimSYWeissJTongMLarondaMMLeeEJJamesonJL2009Foxl2, a forkhead transcription factor, modulates nonclassical activity of the estrogen receptor-α. Endocrinology15050855093. (doi:10.1210/en.2009-0313)

    • Search Google Scholar
    • Export Citation
  • KumarTRWangYLuNMatzukMM1997Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nature Genetics15201204. (doi:10.1038/ng0297-201)

    • Search Google Scholar
    • Export Citation
  • KuoFTBentsi-BarnesIKBarlowGMPisarskaMD2011Mutant forkhead L2 (FOXL2) proteins associated with premature ovarian failure (POF) dimerize with wild-type FOXL2, leading to altered regulation of genes associated with granulosa cell differentiation. Endocrinology15239173929. (doi:10.1210/en.2010-0989)

    • Search Google Scholar
    • Export Citation
  • LambaPFortinJTranSWangYBernardDJ2009A novel role for the forkhead transcription factor FOXL2 in activin A-regulated follicle-stimulating hormone β subunit transcription. Molecular Endocrinology2310011013. (doi:10.1210/me.2008-0324)

    • Search Google Scholar
    • Export Citation
  • LeeKPisarskaMDKoJJKangYYoonSRyouSMChaKYBaeJ2005Transcriptional factor FOXL2 interacts with DP103 and induces apoptosis. Biochemical and Biophysical Research Communications336876881. (doi:10.1016/j.bbrc.2005.08.184)

    • Search Google Scholar
    • Export Citation
  • LehmannOJSowdenJCCarlssonPJordanTBhattacharyaSS2003Fox's in development and disease. Trends in Genetics19339344. (doi:10.1016/S0168-9525(03)00111-2)

    • Search Google Scholar
    • Export Citation
  • LinDSugawaraTStraussJFIIIClarkBJStoccoDMSaengerPRogolAMillerWL1995Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science26718281831. (doi:10.1126/science.7892608)

    • Search Google Scholar
    • Export Citation
  • LiuYXHsuehAJ1986Synergism between granulosa and theca–interstitial cells in estrogen biosynthesis by gonadotropin-treated rat ovaries: studies on the two-cell, two-gonadotropin hypothesis using steroid antisera. Biology of Reproduction352736. (doi:10.1095/biolreprod35.1.27)

    • Search Google Scholar
    • Export Citation
  • LiuZRuddMDHernandez-GonzalezIGonzalez-RobaynaIFanH-YZeleznikAJRichardsJS2009FSH and FOXO1 regulate genes in the sterol/steroid and lipid biosynthetic pathways in granulosa cells. Molecular Endocrinology23649661. (doi:10.1210/me.2008-0412)

    • Search Google Scholar
    • Export Citation
  • MarongiuMDeianaMMeloniAMarciaLPudduACaoASchlessingerDCrisponiL2010The forkhead transcription factor Foxl2 is sumoylated in both human and mouse: sumoylation affects its stability, localization, and activity. PLoS ONE5e9477. (doi:10.1371/journal.pone.0009477)

    • Search Google Scholar
    • Export Citation
  • MoonsDSJirawatnotaiSTsutsuiTFranksRParlowAFHalesDBGiboriGFazleabasATKiyokawaH2002Intact follicular maturation and defective luteal function in mice deficient for cyclin- dependent kinase-4. Endocrinology143647654. (doi:10.1210/en.143.2.647)

    • Search Google Scholar
    • Export Citation
  • NakaeJKitamuraTKitamuraYBiggsWHIIIArdenKCAcciliD2003The forkhead transcription factor Foxo1 regulates adipocyte differentiation. Developmental Cell4119129. (doi:10.1016/S1534-5807(02)00401-X)

    • Search Google Scholar
    • Export Citation
  • NishiYYanaseTMuYObaKIchinoISaitoMNomuraMMukasaCOkabeTGotoK2001Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology142437445. (doi:10.1210/en.142.1.437)

    • Search Google Scholar
    • Export Citation
  • OverdierDGPorcellaACostaRH1994The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix. Molecular and Cellular Biology1427552766. (doi:10.1128/MCB.14.4.2755)

    • Search Google Scholar
    • Export Citation
  • ParkYMaizelsETFeigerZJAlamHPetersCAWoodruffTKUntermanTGLeeEJJamesonJLHunzicker-DunnM2005Induction of cyclin D2 in rat granulosa cells requires FSH-dependent relief from FOXO1 repression coupled with positive signals from Smad. Journal of Biological Chemistry28091359148. (doi:10.1074/jbc.M409486200)

    • Search Google Scholar
    • Export Citation
  • ParkMShinEWonMKimJHGoHKimHLKoJJLeeKBaeJ2010FOXL2 interacts with steroidogenic factor-1 (SF-1) and represses SF-1-induced CYP17 transcription in granulosa cells. Molecular Endocrinology2410241036. (doi:10.1210/me.2009-0375)

    • Search Google Scholar
    • Export Citation
  • PierrouSHellqvistMSamuelssonLEnerbäckSCarlssonP1994Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. EMBO Journal1350025012.

    • Search Google Scholar
    • Export Citation
  • PisarskaMDBaeJKleinCHsuehAJ2004Forkhead l2 is expressed in the ovary and represses the promoter activity of the steroidogenic acute regulatory gene. Endocrinology14534243433. (doi:10.1210/en.2003-1141)

    • Search Google Scholar
    • Export Citation
  • PisarskaMDKuoFTBentsi-BarnesIKKhanSBarlowGM2010LATS1 phosphorylates forkhead L2 and regulates its transcriptional activity. American Journal of Physiology. Endocrinology and Metabolism299E101E109. (doi:10.1152/ajpendo.00534.2009)

    • Search Google Scholar
    • Export Citation
  • PisarskaMDBarlowGKuoFT2011Minireview: roles of the forkhead transcription factor FOXL2 in granulosa cell biology and pathology. Endocrinology15211991208. (doi:10.1210/en.2010-1041)

    • Search Google Scholar
    • Export Citation
  • RichardsJS1994Hormonal control of gene expression in the ovary. Endocrine Reviews15725751. (doi:10.1210/edrv-15-6-725)

  • RichardsJSPangasSA2010The ovary: basic biology and clinical implications. Journal of Clinical Investigation120963972. (doi:10.1172/JCI41350)

    • Search Google Scholar
    • Export Citation
  • RichardsJSRussellDLRobkerRLDajeeMAllistonTN1998Molecular mechanisms of ovulation and luteinization. Molecular and Cellular Endocrinology1454754. (doi:10.1016/S0303-7207(98)00168-3)

    • Search Google Scholar
    • Export Citation
  • RouxJPictetRGrangeT1995Hepatocyte nuclear factor 3 determines the amplitude of the glucocorticoid response of the rat tyrosine aminotransferase gene. DNA and Cell Biology14385396. (doi:10.1089/dna.1995.14.385)

    • Search Google Scholar
    • Export Citation
  • SchmidtDOvittCEAnlagKFehsenfeldSGredstedLTreierACTreierM2004The murine winged-helix transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development131933942. (doi:10.1242/dev.00969)

    • Search Google Scholar
    • Export Citation
  • ShahSPKobelMSenzJMorinRDClarkeBAWiegandKCLeungGZayedAMehlEKallogerSE2009Mutation of FOXL2 in granulosa-cell tumors of the ovary. New England Journal of Medicine36027192729. (doi:10.1056/NEJMoa0902542)

    • Search Google Scholar
    • Export Citation
  • SicinskiPDonaherJLGengYParkerSBGardnerHParkMYRobkerRLRichardsJSMcGinnisLKBiggersJD1996Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature384470474. (doi:10.1038/384470a0)

    • Search Google Scholar
    • Export Citation
  • StoccoDM2001StAR protein and the regulation of steroid hormone biosynthesis. Annual Review of Physiology63193213. (doi:10.1146/annurev.physiol.63.1.193)

    • Search Google Scholar
    • Export Citation
  • UdaMOttolenghiCCrisponiLGarciaJEDeianaMKimberWForaboscoACaoASchlessingerDPiliaG2004Foxl2 disruption causes mouse ovarian failure by pervasive blockage of follicle development. Human Molecular Genetics1311711181. (doi:10.1093/hmg/ddh124)

    • Search Google Scholar
    • Export Citation
  • UedaHSunGCMurataTHiroseS1992A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Molecular and Cellular Biology1256675672. (doi:10.1128/MCB.12.12.5667)

    • Search Google Scholar
    • Export Citation
  • UhlenhautNHJakobSAnlagKEisenbergerTSekidoRKressJTreierACKlugmannCKlasenCHolterNI2009Somatic sex reprogramming of adult ovaries to testes by FOXL2 ablation. Cell13911301142. (doi:10.1016/j.cell.2009.11.021)

    • Search Google Scholar
    • Export Citation
  • WangDSKobayashiTZhouLYPaul-PrasanthBIjiriSSakaiFOkuboKMorohashiKNagahamaY2007Foxl2 up-regulates aromatase gene transcription in a female-specific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1. Molecular Endocrinology21712725. (doi:10.1210/me.2006-0248)

    • Search Google Scholar
    • Export Citation
  • WayneCMFanHYChengXRichardsJS2007Follicle-stimulating hormone induces multiple signaling cascades: evidence that activation of Rous sarcoma oncogene, RAS, and the epidermal growth factor receptor are critical for granulosa cell differentiation. Molecular Endocrinology2119401957. (doi:10.1210/me.2007-0020)

    • Search Google Scholar
    • Export Citation
  • ZhouLDeyCRWertSEYanCCostaRHWhitsettJA1997Hepatocyte nuclear factor-3β limits cellular diversity in the developing respiratory epithelium and alters lung morphogenesis in vivo. Developmental Dynamics210305314. (doi:10.1002/(SICI)1097-0177(199711)210:3<305::AID-AJA10>3.0.CO;2-9)

    • Search Google Scholar
    • Export Citation
  • ZlotogoraJSagiMCohenT1983The blepharophimosis, ptosis, and epicanthus inversus syndrome: delineation of two types. American Journal of Human Genetics3510201027.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 596 554 54
PDF Downloads 122 113 8

Altmetrics

Figures

  • View in gallery

    Mouse Star, Cyp19a1, and Cyp11a1 promoters are repressed by mouse FOXL2. CHO cells were transiently transfected with mouse wild-type FOXL2 and reporter constructs for the mouse Star (A), Cyp19a1 (B), Cyp11a1 (C), or Ccnd2 (D) promoters. The normalized luciferase activity of each sample was compared with the normalized luciferase activity of cells transfected with the pGL2-basic expression vector. Values shown are expressed as percentage (%) of control. One-way ANOVA was performed between samples and different letters (a, b, or c) denote significant differences (P<0.05) between samples. In the presence of mouse FOXL2, the basal activities of the mouse Star, Cyp19a1, and Cyp11a1 promoters were repressed (A, B and C), but minimal effect was seen on the mouse Ccnd2 (D) promoter.

  • View in gallery

    Minimal promoter regions responsive to repression by mouse FOXL2. A series of luciferase reporter constructs containing fragments of the mouse Star, Cyp19a1, Cyp11a1, and Ccnd2 promoters was generated. Each of these promoter–luciferase constructs was transiently co-transfected with mouse FOXL2 into CHO cells, and the resulting luciferase activities were measured 24 h after transfection. The normalized luciferase activity of each sample was compared with the normalized luciferase activity of cells transfected with the pGL2-basic expression vector. Values shown are expressed as percentage of control. One-way ANOVA was performed between samples, and different letters (a, b, or c) denote significant differences (P<0.05) between samples. FOXL2 continues to function as a transcriptional repressor of the shortest Star (A), Cyp19a1 (B), and Cyp11a1 promoter fragments (C). In contrast, FOXL2 fails to repress transcription of the Ccnd2 promoter (D).

  • View in gallery

    Knock down of FOXL2 in mouse granulosa cells increases the expression of Star, Cyp19a1, and Cyp11a1. (A and B) Primary mouse granulosa cell cultures were transfected with a non-silencing siRNA or a Foxl2 siRNA and then treated with FSH and testosterone (A) or FSH alone (B). Foxl2 is endogenously expressed in these cultures, and following transfection with the Foxl2 siRNA, Foxl2 expression levels were reduced to 30–50% of those in cells transfected with non-silencing siRNA. (C and D) Primary mouse granulosa cell cultures were transfected with a non-silencing siRNA or a Foxl2 siRNA and then treated with FSH and testosterone (C) or FSH alone (D). The expression levels of Star, Cyp19a1, Cyp11a1, and Ccnd2 in granulosa cells transfected with Foxl2 siRNA vs non-silencing siRNA were then compared using q-RT-PCR. Transfection with the Foxl2 siRNA resulted in significantly increased expression levels of the Star (P<0.005), Cyp19a1 (P<0.005), and Cyp11a1 (P<0.005) genes in mouse granulosa cells but had no effect on the expression level of mouse Ccnd2 (P>0.1). *Indicates significant difference. Error bars indicate s.d.

  • View in gallery

    Overexpression of FOXL2 in mouse granulosa cells decreases the expression of Star, Cyp19a1, and Cyp11a1. (A and B) Primary mouse granulosa cell cultures were infected with a lentiviral vector for mouse FOXL2 or with an empty lentiviral vector backbone and then treated with FSH and testosterone (A) or FSH alone (B). After 5 days of infection, around 80% of the cells were GFP positive, indicating the MOI was around two. The expression levels of Foxl2 in granulosa cells infected with the mouse Foxl2 lentivirus were increased 13- to 17-fold vs those in cells infected with the lentiviral vector backbone. (C and D) The expression levels of Star, Cyp19a1, Cyp11a1, and Ccnd2 in granulosa cells infected with the mouse Foxl2 lentivirus vs the lentiviral vector backbone were then compared using q-RT-PCR. Infection with the Foxl2 lentivirus in the presence of FSH and testosterone resulted in significantly decreased expression of the mouse Star, Cyp19a1, and Cyp11a1 genes (P<0.05) but had no significant effect on the expression of Ccnd2 (P>0.05). In the presence of FSH alone, infection with the Foxl2 lentivirus also resulted in significant decreased expression of the mouse Star, Cyp19a1, and Cyp11a1 genes (P<0.05); however, there was increased repression of Ccnd2, which now reached significance (P<0.05). *Indicates significant difference. Error bars indicate s.d.

  • View in gallery

    Comparison of the mouse and human CCND2 promoters. The promoters of mouse Ccnd2 and human CCND2 were analyzed and compared for SF-1 and FOXL2 binding sites. The mouse Ccnd2 promoter contains a single SF1 binding site A/FOXL2 binding site A (denoted by a shaded box), whereas the human CCND2 promoter contains a single FOXL2 binding site B (denoted by a solid box). Base pair notations indicated are the positions relative to the transcriptional start sites for all sequences depicted.

  • View in gallery

    Analysis of FOXL2 DNA binding sites in the Star, Cyp19a1, Cyp11a1, and Ccnd2 promoters. The promoters of Star, Cyp19a1, Cyp11a1, and Ccnd2 were analyzed for SF-1 binding sites (A, ((T/C)CAAGG(T/C)C(A/G)); B, ((T/C)G(G/A)CCTTG(G/A))) and FOXL2 binding sites (A, (GT(C/G)AAGG(G/T)); B, (T(A/G/T)TT(T/G)A))) as well as the consensus forkhead binding site ((G/A)(T/C)(A/C)AA(C/T)A)). As SF1 binding site A and FOXL2 binding site A share the same core sequence CAAGGT, they are denoted by shaded boxes. FOXL2 binding site B is denoted by solid boxes, the consensus forkhead binding site is denoted by dashed boxes, and SF-1 binding site B is denoted by doted boxes. Base pair notation indicated is position relative to the transcriptional start site for all sequences depicted.

References

  • BarnhartKMMellonPL1994The orphan nuclear receptor, steroidogenic factor-1, regulates the glycoprotein hormone α-subunit gene in pituitary gonadotropes. Molecular Endocrinology8878885. (doi:10.1210/me.8.7.878)

    • Search Google Scholar
    • Export Citation
  • BenayounBAAuerJCaburetSVeitiaRA2008aThe post-translational modification profile of the forkhead transcription factor FOXL2 suggests the existence of parallel processive/concerted modification pathways. Proteomics831183123. (doi:10.1002/pmic.200800084)

    • Search Google Scholar
    • Export Citation
  • BenayounBACaburetSDipietromariaABailly-BechetMBatistaFFellousMVaimanDVeitiaRA2008bThe identification and characterization of a FOXL2 response element provides insights into the pathogenesis of mutant alleles. Human Molecular Genetics1731183127. (doi:10.1093/hmg/ddn209)

    • Search Google Scholar
    • Export Citation
  • BenayounBACaburetSDipietromariaAGeorgesAD'HaeneBPandaranayakaPJL'HoteDTodeschiniALKrishnaswamySFellousM2010Functional exploration of the adult ovarian granulosa cell tumor-associated somatic FOXL2 mutation p.Cys134Trp (c.402C>G). PLoS ONE5e8789. (doi:10.1371/journal.pone.0008789)

    • Search Google Scholar
    • Export Citation
  • Bentsi-BarnesIKKuoFTBarlowGMPisarskaMD2009Human forkhead L2 represses key genes in granulosa cell differentiation including aromatase, P450scc, and cyclin D2. Fertility and Sterility94353356. (doi:10.1016/j.fertnstert.2009.09.050)

    • Search Google Scholar
    • Export Citation
  • Bentsi-BarnesIKKuoFTBarlowGMPisarskaMD2010Human forkhead L2 represses key genes in granulosa cell differentiation including aromatase, P450scc, and cyclin D2. Fertility and Sterility94353356. (doi:10.1016/j.fertnstert.2009.09.050)

    • Search Google Scholar
    • Export Citation
  • BlixtAMahlapuuMAitolaMPelto-HuikkoMEnerbackSCarlssonP2000A forkhead gene, FoxE3, is essential for lens epithelial proliferation and closure of the lens vesicle. Genes and Development14245254. (doi:10.1101/gad.14.2.245)

    • Search Google Scholar
    • Export Citation
  • BlountALSchmidtKJusticeNJValeWWFischerWHBilezikjianLM2009FoxL2 and Smad3 coordinately regulate follistatin gene transcription. Journal of Biological Chemistry28476317645. (doi:10.1074/jbc.M806676200)

    • Search Google Scholar
    • Export Citation
  • BrissetteJLLiJKamimuraJLeeDDottoGP1996The product of the mouse nude locus, Whn, regulates the balance between epithelial cell growth and differentiation. Genes and Development1022122221. (doi:10.1101/gad.10.17.2212)

    • Search Google Scholar
    • Export Citation
  • CarlssonPMahlapuuM2002Forkhead transcription factors: key players in development and metabolism. Developmental Biology250123. (doi:10.1006/dbio.2002.0780)

    • Search Google Scholar
    • Export Citation
  • ClarkBJWellsJKingSRStoccoDM1994The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). Journal of Biological Chemistry2692831428322.

    • Search Google Scholar
    • Export Citation
  • CrisponiLDeianaMLoiAChiappeFUdaMAmatiPBiscegliaLZelanteLNagarajaRPorcuS2001The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nature Genetics27159166. (doi:10.1038/84781)

    • Search Google Scholar
    • Export Citation
  • DottoriMGrossMKLaboskyPGouldingM2001The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes neural crest cell fate. Development12841274138.

    • Search Google Scholar
    • Export Citation
  • FanHYO'ConnorAShitanakaMShimadaMLiuZRichardsJS2010β-Catenin (CTNNB1) promotes preovulatory follicular development but represses LH-mediated ovulation and luteinization. Molecular Endocrinology2415291542. (doi:10.1210/me.2010-0141)

    • Search Google Scholar
    • Export Citation
  • FitzpatrickSLRichardsJS1991Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology12914521462. (doi:10.1210/endo-129-3-1452)

    • Search Google Scholar
    • Export Citation
  • FlemingNIKnowerKCLazarusKAFullerPJSimpsonERClyneCD2010Aromatase is a direct target of FOXL2: C134W in granulosa cell tumors via a single highly conserved binding site in the ovarian specific promoter. PLoS ONE5e14389. (doi:10.1371/journal.pone.0014389)

    • Search Google Scholar
    • Export Citation
  • FraserISShearmanRPSmithARussellP1988An association among blepharophimosis, resistant ovary syndrome, and true premature menopause. Fertility and Sterility50747751.

    • Search Google Scholar
    • Export Citation
  • Gonzalez-RobaynaIJFalenderAEOchsnerSFirestoneGLRichardsJS2000Follicle-stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinase-independent signaling by FSH in granulosa cells. Molecular Endocrinology1412831300. (doi:10.1210/me.14.8.1283)

    • Search Google Scholar
    • Export Citation
  • HsuehAJAdashiEYJonesPBWelshTHJr1984Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocrine Reviews576127. (doi:10.1210/edrv-5-1-76)

    • Search Google Scholar
    • Export Citation
  • KaestnerKHKnochelWMartinezDE2000Unified nomenclature for the winged helix/forkhead transcription factors. Genes and Development14142146. (doi:10.1101/gad.14.2.142)

    • Search Google Scholar
    • Export Citation
  • KashimadaKSvingenTFengCWPelosiEBagheri-FamSHarleyVRSchlessingerDBowlesJKoopmanP2011Antagonistic regulation of Cyp26b1 by transcription factors SOX9/SF1 and FOXL2 during gonadal development in mice. FASEB Journal2535613569. (doi:10.1096/fj.11-184333)

    • Search Google Scholar
    • Export Citation
  • KaufmannEKnochelW1996Five years on the wings of fork head. Mechanisms of Development57320. (doi:10.1016/0925-4773(96)00539-4)

  • KaufmannEMüllerDKnöchelW1995DNA recognition site analysis of Xenopus winged helix proteins. Journal of Molecular Biology248239254. (doi:10.1016/S0022-2836(95)80047-6)

    • Search Google Scholar
    • Export Citation
  • KimSYWeissJTongMLarondaMMLeeEJJamesonJL2009Foxl2, a forkhead transcription factor, modulates nonclassical activity of the estrogen receptor-α. Endocrinology15050855093. (doi:10.1210/en.2009-0313)

    • Search Google Scholar
    • Export Citation
  • KumarTRWangYLuNMatzukMM1997Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nature Genetics15201204. (doi:10.1038/ng0297-201)

    • Search Google Scholar
    • Export Citation
  • KuoFTBentsi-BarnesIKBarlowGMPisarskaMD2011Mutant forkhead L2 (FOXL2) proteins associated with premature ovarian failure (POF) dimerize with wild-type FOXL2, leading to altered regulation of genes associated with granulosa cell differentiation. Endocrinology15239173929. (doi:10.1210/en.2010-0989)

    • Search Google Scholar
    • Export Citation
  • LambaPFortinJTranSWangYBernardDJ2009A novel role for the forkhead transcription factor FOXL2 in activin A-regulated follicle-stimulating hormone β subunit transcription. Molecular Endocrinology2310011013. (doi:10.1210/me.2008-0324)

    • Search Google Scholar
    • Export Citation
  • LeeKPisarskaMDKoJJKangYYoonSRyouSMChaKYBaeJ2005Transcriptional factor FOXL2 interacts with DP103 and induces apoptosis. Biochemical and Biophysical Research Communications336876881. (doi:10.1016/j.bbrc.2005.08.184)

    • Search Google Scholar
    • Export Citation
  • LehmannOJSowdenJCCarlssonPJordanTBhattacharyaSS2003Fox's in development and disease. Trends in Genetics19339344. (doi:10.1016/S0168-9525(03)00111-2)

    • Search Google Scholar
    • Export Citation
  • LinDSugawaraTStraussJFIIIClarkBJStoccoDMSaengerPRogolAMillerWL1995Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science26718281831. (doi:10.1126/science.7892608)

    • Search Google Scholar
    • Export Citation
  • LiuYXHsuehAJ1986Synergism between granulosa and theca–interstitial cells in estrogen biosynthesis by gonadotropin-treated rat ovaries: studies on the two-cell, two-gonadotropin hypothesis using steroid antisera. Biology of Reproduction352736. (doi:10.1095/biolreprod35.1.27)

    • Search Google Scholar
    • Export Citation
  • LiuZRuddMDHernandez-GonzalezIGonzalez-RobaynaIFanH-YZeleznikAJRichardsJS2009FSH and FOXO1 regulate genes in the sterol/steroid and lipid biosynthetic pathways in granulosa cells. Molecular Endocrinology23649661. (doi:10.1210/me.2008-0412)

    • Search Google Scholar
    • Export Citation
  • MarongiuMDeianaMMeloniAMarciaLPudduACaoASchlessingerDCrisponiL2010The forkhead transcription factor Foxl2 is sumoylated in both human and mouse: sumoylation affects its stability, localization, and activity. PLoS ONE5e9477. (doi:10.1371/journal.pone.0009477)

    • Search Google Scholar
    • Export Citation
  • MoonsDSJirawatnotaiSTsutsuiTFranksRParlowAFHalesDBGiboriGFazleabasATKiyokawaH2002Intact follicular maturation and defective luteal function in mice deficient for cyclin- dependent kinase-4. Endocrinology143647654. (doi:10.1210/en.143.2.647)

    • Search Google Scholar
    • Export Citation
  • NakaeJKitamuraTKitamuraYBiggsWHIIIArdenKCAcciliD2003The forkhead transcription factor Foxo1 regulates adipocyte differentiation. Developmental Cell4119129. (doi:10.1016/S1534-5807(02)00401-X)

    • Search Google Scholar
    • Export Citation
  • NishiYYanaseTMuYObaKIchinoISaitoMNomuraMMukasaCOkabeTGotoK2001Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology142437445. (doi:10.1210/en.142.1.437)

    • Search Google Scholar
    • Export Citation
  • OverdierDGPorcellaACostaRH1994The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix. Molecular and Cellular Biology1427552766. (doi:10.1128/MCB.14.4.2755)

    • Search Google Scholar
    • Export Citation
  • ParkYMaizelsETFeigerZJAlamHPetersCAWoodruffTKUntermanTGLeeEJJamesonJLHunzicker-DunnM2005Induction of cyclin D2 in rat granulosa cells requires FSH-dependent relief from FOXO1 repression coupled with positive signals from Smad. Journal of Biological Chemistry28091359148. (doi:10.1074/jbc.M409486200)

    • Search Google Scholar
    • Export Citation
  • ParkMShinEWonMKimJHGoHKimHLKoJJLeeKBaeJ2010FOXL2 interacts with steroidogenic factor-1 (SF-1) and represses SF-1-induced CYP17 transcription in granulosa cells. Molecular Endocrinology2410241036. (doi:10.1210/me.2009-0375)

    • Search Google Scholar
    • Export Citation
  • PierrouSHellqvistMSamuelssonLEnerbäckSCarlssonP1994Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. EMBO Journal1350025012.

    • Search Google Scholar
    • Export Citation
  • PisarskaMDBaeJKleinCHsuehAJ2004Forkhead l2 is expressed in the ovary and represses the promoter activity of the steroidogenic acute regulatory gene. Endocrinology14534243433. (doi:10.1210/en.2003-1141)

    • Search Google Scholar
    • Export Citation
  • PisarskaMDKuoFTBentsi-BarnesIKKhanSBarlowGM2010LATS1 phosphorylates forkhead L2 and regulates its transcriptional activity. American Journal of Physiology. Endocrinology and Metabolism299E101E109. (doi:10.1152/ajpendo.00534.2009)

    • Search Google Scholar
    • Export Citation
  • PisarskaMDBarlowGKuoFT2011Minireview: roles of the forkhead transcription factor FOXL2 in granulosa cell biology and pathology. Endocrinology15211991208. (doi:10.1210/en.2010-1041)

    • Search Google Scholar
    • Export Citation
  • RichardsJS1994Hormonal control of gene expression in the ovary. Endocrine Reviews15725751. (doi:10.1210/edrv-15-6-725)

  • RichardsJSPangasSA2010The ovary: basic biology and clinical implications. Journal of Clinical Investigation120963972. (doi:10.1172/JCI41350)

    • Search Google Scholar
    • Export Citation
  • RichardsJSRussellDLRobkerRLDajeeMAllistonTN1998Molecular mechanisms of ovulation and luteinization. Molecular and Cellular Endocrinology1454754. (doi:10.1016/S0303-7207(98)00168-3)

    • Search Google Scholar
    • Export Citation
  • RouxJPictetRGrangeT1995Hepatocyte nuclear factor 3 determines the amplitude of the glucocorticoid response of the rat tyrosine aminotransferase gene. DNA and Cell Biology14385396. (doi:10.1089/dna.1995.14.385)

    • Search Google Scholar
    • Export Citation
  • SchmidtDOvittCEAnlagKFehsenfeldSGredstedLTreierACTreierM2004The murine winged-helix transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development131933942. (doi:10.1242/dev.00969)

    • Search Google Scholar
    • Export Citation
  • ShahSPKobelMSenzJMorinRDClarkeBAWiegandKCLeungGZayedAMehlEKallogerSE2009Mutation of FOXL2 in granulosa-cell tumors of the ovary. New England Journal of Medicine36027192729. (doi:10.1056/NEJMoa0902542)

    • Search Google Scholar
    • Export Citation
  • SicinskiPDonaherJLGengYParkerSBGardnerHParkMYRobkerRLRichardsJSMcGinnisLKBiggersJD1996Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature384470474. (doi:10.1038/384470a0)

    • Search Google Scholar
    • Export Citation
  • StoccoDM2001StAR protein and the regulation of steroid hormone biosynthesis. Annual Review of Physiology63193213. (doi:10.1146/annurev.physiol.63.1.193)

    • Search Google Scholar
    • Export Citation
  • UdaMOttolenghiCCrisponiLGarciaJEDeianaMKimberWForaboscoACaoASchlessingerDPiliaG2004Foxl2 disruption causes mouse ovarian failure by pervasive blockage of follicle development. Human Molecular Genetics1311711181. (doi:10.1093/hmg/ddh124)

    • Search Google Scholar
    • Export Citation
  • UedaHSunGCMurataTHiroseS1992A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Molecular and Cellular Biology1256675672. (doi:10.1128/MCB.12.12.5667)

    • Search Google Scholar
    • Export Citation
  • UhlenhautNHJakobSAnlagKEisenbergerTSekidoRKressJTreierACKlugmannCKlasenCHolterNI2009Somatic sex reprogramming of adult ovaries to testes by FOXL2 ablation. Cell13911301142. (doi:10.1016/j.cell.2009.11.021)

    • Search Google Scholar
    • Export Citation
  • WangDSKobayashiTZhouLYPaul-PrasanthBIjiriSSakaiFOkuboKMorohashiKNagahamaY2007Foxl2 up-regulates aromatase gene transcription in a female-specific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1. Molecular Endocrinology21712725. (doi:10.1210/me.2006-0248)

    • Search Google Scholar
    • Export Citation
  • WayneCMFanHYChengXRichardsJS2007Follicle-stimulating hormone induces multiple signaling cascades: evidence that activation of Rous sarcoma oncogene, RAS, and the epidermal growth factor receptor are critical for granulosa cell differentiation. Molecular Endocrinology2119401957. (doi:10.1210/me.2007-0020)

    • Search Google Scholar
    • Export Citation
  • ZhouLDeyCRWertSEYanCCostaRHWhitsettJA1997Hepatocyte nuclear factor-3β limits cellular diversity in the developing respiratory epithelium and alters lung morphogenesis in vivo. Developmental Dynamics210305314. (doi:10.1002/(SICI)1097-0177(199711)210:3<305::AID-AJA10>3.0.CO;2-9)

    • Search Google Scholar
    • Export Citation
  • ZlotogoraJSagiMCohenT1983The blepharophimosis, ptosis, and epicanthus inversus syndrome: delineation of two types. American Journal of Human Genetics3510201027.

    • Search Google Scholar
    • Export Citation

Cited By

PubMed

Google Scholar