Regulation of the hyaluronan system in ovine endometrium by ovarian steroids

in Reproduction

In this study, we investigated steroid regulation of the hyaluronan (HA) system in ovine endometrium including HA synthases (HAS), hyaluronidases, and HA receptor-CD44 using 30 adult Welsh Mountain ewes. Eight ewes were kept intact and synchronized to estrous (day 0). Intact ewes were killed on day 9 (luteal phase; LUT; n=5) and day 16 (follicular phase; FOL; n=3). The remaining ewes (n=22) were ovariectomized and then treated (i.m.) with vehicle (n=6) or progesterone (n=8) for 10 days, or estrogen and progesterone for 3 days followed by 7 days of progesterone alone (n=8). Estradiol and progesterone concentrations in plasma correlated with the stage of estrous or steroid treatment. Our results showed trends (P<0.1) and statistically significant effects (P<0.05, by t-test) indicating that LUT had lower HAS1 and HAS2 and higher HAS3 and CD44 mRNA expression compared with FOL. This was reflected in immunostaining of the corresponding HAS proteins. Similarly, in ovariectomized ewes, progesterone decreased HAS1 and HAS2 and increased HAS3 and CD44, whereas estradiol tended to increase HAS2 and decrease CD44. Sometimes, HAS mRNA expression did not follow the same trend observed in the intact animals or the protein expression. HA and its associated genes and receptors were regulated by the steroids. In conclusion, these results show that the level of HA production and the molecular weight of HA in the endometrium are regulated by ovarian steroids through differential expression of different HAS both at the gene and at the protein levels.

Abstract

In this study, we investigated steroid regulation of the hyaluronan (HA) system in ovine endometrium including HA synthases (HAS), hyaluronidases, and HA receptor-CD44 using 30 adult Welsh Mountain ewes. Eight ewes were kept intact and synchronized to estrous (day 0). Intact ewes were killed on day 9 (luteal phase; LUT; n=5) and day 16 (follicular phase; FOL; n=3). The remaining ewes (n=22) were ovariectomized and then treated (i.m.) with vehicle (n=6) or progesterone (n=8) for 10 days, or estrogen and progesterone for 3 days followed by 7 days of progesterone alone (n=8). Estradiol and progesterone concentrations in plasma correlated with the stage of estrous or steroid treatment. Our results showed trends (P<0.1) and statistically significant effects (P<0.05, by t-test) indicating that LUT had lower HAS1 and HAS2 and higher HAS3 and CD44 mRNA expression compared with FOL. This was reflected in immunostaining of the corresponding HAS proteins. Similarly, in ovariectomized ewes, progesterone decreased HAS1 and HAS2 and increased HAS3 and CD44, whereas estradiol tended to increase HAS2 and decrease CD44. Sometimes, HAS mRNA expression did not follow the same trend observed in the intact animals or the protein expression. HA and its associated genes and receptors were regulated by the steroids. In conclusion, these results show that the level of HA production and the molecular weight of HA in the endometrium are regulated by ovarian steroids through differential expression of different HAS both at the gene and at the protein levels.

Introduction

During the female reproductive cycle, the ovarian steroid hormones estradiol and progesterone play a central role in regulating reproductive events that lead to the establishment of pregnancy. In the endometrium, the estradiol-dominant follicular (FOL) phase of the estrous cycle is characterized by an increase in the blood flow, edema, growth of uterine glands, and mucus secretion (Aplin 2007). Subsequently, the progesterone-dominant luteal (LUT) phase of the estrous cycle is a window of receptivity of the endometrium to the conceptus and is characterized by uterine gland secretions, producing arrays of hormones, cytokines, and growth factors, collectively referred to as histotroph, which support the blastocyst before implantation (Roberts & Bazer 1988). These changes in the endometrial environment require specific changes in the degree of tissue hydration and glycosaminoglycan content (Tellbach et al. 2002) and are associated with ovarian steroid-mediated changes in the composition and organization of glycosaminoglycans in the extracellular matrix (Cidadao et al. 1990).

Hyaluronan (hyaluronic acid; HA), the most abundant glycosaminoglycan, is naturally occurring in all animal tissues including the reproductive tract and its fluids. HA is composed of repeating disaccharide units of d-glucuronic acids and d-N-actetylglycosamine forming a linear polysaccharide (Weissmann et al. 1954). HA is synthesized by integral plasma membrane glycosyltransferases called HA synthases (HAS) of which there are three known mammalian isoforms: HAS1, HAS2, and HAS3, with different enzymatic properties and actions (Itano et al. 1999). While it is being synthesized, HA is extruded onto the extracellular surface (Tammi et al. 2002) resulting in production of HA molecules of various molecular weight reaching >2×106 Da (Toole 2004). HA is degraded by hyaluronidases (HYALs) for which six HYAL genes are identified in human with HYAL1 and HYAL2 being considered as the most important in degradation of HA in somatic cells (Lepperdinger et al. 2001). HYAL2 is localized extracellularly and depolymerizes HA into fragments of ∼25×103 Da, which may then be internalized and depolymerized by HYAL1 into oligosaccharides or tetrasaccharides (Stern et al. 2006).

In mammalian reproduction, HA is involved in oocyte maturation (Schoenfelder & Einspanier 2003), fertilization, implantation (Babayan et al. 2008), and parturition (Straach et al. 2005). The HA level in the endometrium may also be used as an indicator to the physiological or pathological status of this organ (Nykopp et al. 2010). High-molecular-weight (HMW) HA produced by HAS2 is so crucial for mammalian embryogenesis that HAS2-knockout embryos die in mid-gestation due to cardiac and vascular abnormalities (Camenisch et al. 2000). The biological functions of the HA molecules are known to vary depending on their size. HMW HA is anti-angiogenic, immunosuppressive, and inhibits cell migration (Deed et al. 1997, Lee & Spicer 2000). The functions of HMW HA are usually attributed to its unique hygroscopic and viscoelasticity physiochemical properties (Balazs & Gibbs 1970). On the other hand, low-molecular-weight (LMW) HA molecules initiate a molecular signaling pathway via their receptors such as CD44 (Aruffo et al. 1990, Aruffo 1996) or receptor for HA-mediated motility. HA-mediated cell surface signaling through CD44 is usually correlated with either cell migration or cell proliferation responses (Lee & Spicer 2000) and hence may play an important role during embryo development and implantation. LMW HA is also known to be angiogenic and anti-apoptotic (Stern et al. 2006), which can be beneficial during placentation and embryogenesis. Collectively, and according to the previously formulated catabolic scheme of HA (Stern 2003), HA of a wide range of molecular weights may be present at all times in tissue, regulated by fine tuning of the expression of different HAS and HYALs, resulting in diverse biological effects.

While evidence for multiple roles of HA in mammalian reproduction continues to grow, its regulation by the ovarian steroids progesterone and estradiol has not been explicitly defined. Steroids have been reported to be involved in the regulation of HA synthesis in the uterine cervix in sheep (Perry et al. 2010a) and mice (Uchiyama et al. 2005). In this study, we examined changes in the components of the HA system in the endometrium of intact ewes at mid-LUT phase and FOL phase of the estrous cycle. In addition, to investigate the specific role of ovarian steroids in the regulation of HA, we used ovariectomized ewes treated with progesterone (OVXP) or a combination of progesterone and estrogen (OVXEP) or vehicle (OVX) and analyzed mRNA and protein expression of HAS (HAS1–3), HYALs (HYAL1 and HYAL2), and receptor CD44 and determined localization, content, and molecular weight distribution of the HA in the endometrium.

Results

Plasma estradiol and progesterone concentrations

Plasma progesterone concentrations were higher in LUT ewes (2.3±0.49 ng/ml) compared with FOL ewes (below detection limit of the assay; <0.5 ng/ml) on the day of killing and collection of endometrial samples. In ovariectomized animals, progesterone was not detectable in OVX control ewes, and it significantly increased in response to progesterone in the OVXP and OVXEP groups. The plasma estradiol concentration measured in the FOL group on the day of killing was 6.1±1.69 pg/ml. In OVX and OVXP ewes, plasma estradiol was below the detection limit, while in the OVXEP group that received estradiol injections for 3 consecutive days, estradiol levels started to increase following injections and continued to increase until day 10 of uterine sample collection.

Effect of estrous cycle and ovarian steroids on mRNA expression of genes related to the HA system in the endometrium

The data on endometrial mRNA expression of HAS (HAS1, HAS2, and HAS3), as well as HYAL1, HYAL2, and CD44, during different stages of the estrous cycle in the intact ewes and in the ovariectomized animals treated with or without progesterone in the presence or absence of estrogen are presented in Tables 1 and 2 respectively. Expression of mRNA in endometrial samples from the LUT group tended to be lower for HAS1 (P=0.09) and was significantly lower for HAS2 (P<0.001) and significantly higher for HAS3 (P=0.003) compared with the FOL group. Neither HYAL1 nor HYAL2 mRNA expression was affected by the stage of estrous cycle. CD44 was significantly higher in LUT compared with FOL tissue (P=0.007).

Table 1

Comparison of qPCR measurements for HAS13, HYAL1,2, and CD44 mRNA (expressed as copy numbers) in the endometrium of intact ewes at mid-luteal stage (LUT) compared to follicular stage (FOL) of the estrous cycle.

GeneFOL (n=3)LUT (n=5)P value
HAS150 040±15 70125 345±4 0400.09
HAS219 143±3462 139±433<0.001
HAS315 070±3 21829 147±1 4040.003
HYAL166 444±32 18966 808±15 0300.99
HYAL230 095±1 24530 182±5 4980.99
CD4412 715±4 48053 939±7 3770.007

Data are presented as mean±s.e.m. and t-test was used for comparison.

Table 2

Comparison of qPCR measurements for HAS13, HYAL1,2, and CD44 mRNA (expressed as copy numbers) in the endometrium of ovariectomized animals treated with only progesterone (OVXP) or estrogen and progesterone (OVXEP) compared with ovariectomized controls treated with vehicle (OVX).

GeneOVX (n=6)OVXP (n=8)P valueOVXEP (n=8)P value
HAS120 190±5 16044 481±11 5800.2738 503±8 0940.58
HAS25 538±1 2353 252±5210.043 539±2580.07
HAS328 526±1 62318 136±1 9200.00318 081±1 7450.003
HYAL145 253±3 19069 517±40 9301.0034 321±2 6531.00
HYAL259 756±5 00022 395±2 783<0.00125 129±2 164<0.001
CD4412 702±3 84648 395±11 3790.0317 728±6 9411.00

Data are presented as mean±s.e.m. and one-way ANOVA was used for comparison.

In ovariectomized ewes, HAS2 and CD44 mRNA expressions were significantly reduced by administration of progesterone alone in the OVXP groups (P<0.05) but not with combined treatment with both estradiol and progesterone in the OVXEP group (P>0.05). HAS3 mRNA expression was significantly reduced in both OVXP and OVXEP compared with OVX tissue (P<0.05). The levels of HYAL2 in the OVX group were almost double the expression in the FOL and LUT groups, and administration of progesterone with or without estradiol reduced HYAL2 mRNA expression (P<0.001 compared to OVX) to levels approaching those observed in intact animals. HAS1 and HYAL1 did not differ among groups.

Effect of estrous cycle and ovarian steroids on protein expression of HAS and receptor CD44 in the endometrium

Protein expression of the three HAS isoforms and HA receptor CD44 were examined by immunohistochemistry (IHC) and quantified using HSCORE. Generally, in the OVX group, the diameter of the uterine glands and the depth of luminal epithelium (LE) were observed to be smaller than in the OVXP and OVXEP groups. Immunostaining for all proteins examined was detected at variable intensities in the cytoplasm of all cell layers of the endometrium: LE, stroma (ST), and glandular epithelium (GE). HAS1 immunostaining was restricted to the nuclear region of the cells.

HAS1 immunostaining was significantly reduced in the LE and ST but not in the GE of LUT tissues compared with FOL tissues. Steroid-treated OVXP and OVXEP ewes also exhibited reduced HAS1 immunostaining mainly in the ST and GE regions compared with OVX controls (P<0.05; Fig. 1).

Figure 1
Figure 1

Immunohistochemical localization and quantification of HAS1 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS1 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP<0.05 or a vs cP<0.01.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

HAS2 immunostaining was consistently higher in the FOL animals compared with the LUT animals in all endometrial layers (P<0.05). Progesterone administration decreased HAS2 expression in LE and ST in OVXP compared with OVX. However, combined treatment with estradiol and progesterone in OVXEP had similar HAS2 expression compared to the OVX group (P>0.1; Fig. 2).

Figure 2
Figure 2

Immunohistochemical localization and quantification of HAS2 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS2 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP≤0.05 or a vs cP<0.01.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

HAS3 immunostaining in LUT was significantly higher in the LE and GE (P<0.01) and tends to be higher in ST (P=0.079) compared with the FOL group. A similar pattern was observed in OVXP and OVXEP compared with OVX animals (Fig. 3).

Figure 3
Figure 3

Immunohistochemical localization and quantification of HAS3 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS3 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Different letters a vs b indicate a trend (P<0.1) while a vs c or a vs d indicate significant difference at P<0.05 within the same layer. Immune cells, mostly lymphocytes (indicated by black arrows) were extracted from the image before the quantification.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

CD44 expression in the LUT was distinct with a significantly (P<0.05) higher HSCORE for all the three layers of the endometrium when compared with the FOL. CD44 expression in the LE and GE was increased by progesterone administration (OVXP) but not by combined estradiol and progesterone treatment (OVXEP) compared with the OVX group (Fig. 4).

Figure 4
Figure 4

Immunohistochemical localization and quantification of CD44 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). CD44 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP<0.05 or a vs cP<0.01.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

Effect of estrous cycle and ovarian steroids on HA immunostaining in the endometrium

HA immunostaining using biotinylated HA-binding protein (b-HABP) revealed that HA is mainly localized within the ST compartment of the endometrium in all experimental groups, while very low or no staining was observed in the LE or GE (Fig. 5). The intensity and HSCORE of HA immunostaining in the ST in the FOL group (Fig. 5A) was significantly higher (P=0.003) than in the LUT group (Fig. 5B). The latter expressed a moderate staining mainly restricted to the ST immediately beneath the luminal epithelia. In ovariectomized animals, HA immunostaining in the OVX group was high (Fig. 5D). This was significantly reduced by administration of progesterone alone (P=0.001) or in combination with estradiol (P=0.002) as observed in the OVXP or OVXEP groups respectively (Fig. 5E and F).

Figure 5
Figure 5

Immunohistochemical localization and quantification of HA in the uterine endometrium in sheep at the follicular (FOL; A) and luteal (LUT; B) stages of the estrous cycle and in ovariectomized ewes treated with vehicle (OVX; D), progesterone (OVXP; E), or estradiol and progesterone (OVXEP; F). HA is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. P values are shown compared with the FOL (C) or OVX (H) groups.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

Molecular weight of HA

The results of the HA electrophoresis and blotting with b-HABP are shown in Fig. 6A. Immunoreactive smears in Fig. 6A represent the distribution of HA in different treatment groups compared with four HA standards with known molecular weights loaded in the left lane. The highest and lowest molecular weight of HA in each treatment group were determined with AlphaEase software using the HA standards as molecular weight references with the results presented in a boxplot. The FOL group displayed increased levels of the highest-molecular-weight HA when compared with the LUT group (P=0.009). The lowest molecular weight HA detected was significantly reduced in LUT ewes compared with the FOL group (P=0.025; Fig. 6B). In ovariectomized ewes, administration of progesterone only (OVXP) significantly reduced the highest molecular weight of HA detected compared with the OVX group. Combined treatment with estradiol and progesterone (OVXEP) abrogated this effect and the HA molecular weight was not significantly different from that for the OVX group (Fig. 6C)

Figure 6
Figure 6

(A) Estimation of HA molecular weight distribution by b-HABP and HRP-antibiotin IgG (representative blot). The molecular weight of the HA was determined with Alfa Ease FC software using HA standards shown to the left of the gel for reference. (B) The highest and lowest molecular weight of HA in endometrium collected from intact ewes at the follicular (FOL) and luteal (LUT) phases of the estrous cycle, and (C) ovariectomized ewes treated with vehicle (control; OVX), progesterone (OVXP) or estrogen and progesterone (OVXEP). Data are from six independent repeats and presented as mean±s.e.m. in a box plot. P values are shown as compared with the FOL group or OVX group.

Citation: REPRODUCTION 145, 5; 10.1530/REP-13-0001

.

Discussion

In the OVXEP group, although estradiol was injected only during the first 3 days of treatment, the plasma estradiol concentrations remained high throughout the treatment period (10 days) until the animals were killed. This is likely to be due to a delay in absorption from the muscles at the site of injection. Thus, in contrast to the OVXP group treated only with progesterone, the endometrial samples from the OVXEP group were under the influence of both estrogen and progesterone until the day of sample collection, which possibly explains the difference in the expression pattern of some genes and proteins between OVXP and OVXEP groups, as discussed below.

The expression of the three HAS isoforms is organ- and cell-specific (Spicer & McDonald 1998, Pienimaki et al. 2001, Straach et al. 2005). They are differentially regulated by various stimuli, suggesting distinct functional roles of the three proteins (Wang et al. 2009). Nevertheless, changes in the transcriptional levels of HAS mRNA do not always correlate with changes in the synthesis of HA (Recklies et al. 2001) due to posttranscriptional modification (Tammi et al. 2002). Therefore, in this study, it was necessary to examine HAS expression at the gene and protein levels in parallel with the measurement of HA content and molecular weight.

By qPCR analyses, we showed that HAS1 mRNA expression is affected neither by the stage of estrous cycle nor by steroid treatments of ovariectomized animals for 10 days (P>0.05). However, HAS1 expression tended to be lower in LUT when compared with FOL animals (P=0.09). To our knowledge, there are no previous reports comparing HAS expression in the endometrium during different stages of the estrous cycle. In agreement with our results, HAS1 mRNA expression was shown to decrease in the uterine region of the cervix at the LUT phase of the estrous cycle in sheep compared with the FOL phase (pre-LH surge) (Perry et al. 2010b). In mice, although HAS1 mRNA expression was not different in the cervix of pregnant (day 15) vs non-pregnant animals, treatment of cervical fibroblasts with progesterone in vitro for 6 h resulted in a significant reduction of HAS1 expression in vitro (Uchiyama et al. 2005). HAS1 mRNA expression was not different among ovariectomized animals. However, at the protein level, immunostaining showed significant reduction of HAS1 protein in GE and ST in OVXP and OVXEP compared with OVX ewes. This suggests that HAS1 mRNA expression may only be affected when tissue is exposed to progesterone for short periods and this effect is not maintained after an extended treatment with progesterone for 10 days. A similar discrepancy in expression of HAS mRNA and HAS protein was also reported in earlier studies (Nykopp et al. 2009).

The highest HAS2 mRNA expression was observed in the FOL group, which was significantly higher than that in the LUT group. Progesterone appears to reduce the expression of HAS2 only when plasma estrogen levels are not high. Treatment of OVX ewes with progesterone significantly reduced HAS2 expression (P=0.038), while in the presence of a high estrogen concentration in the OVXEP group, the effect of progesterone was not significant. Progesterone was shown to inhibit expression of HAS2 mRNA in uterine cervix in the absence of estrogen (Uchiyama et al. 2005). In contrast, high estradiol induced expression of HAS2 in the ovulatory follicles (Schoenfelder & Einspanier 2003). Here, we show that these two steroids have diverse effects on expression of HAS2 in the uterine endometrium where high estradiol during FOL the phase stimulates HAS2 expression and the high progesterone during the LUT phase downregulates its expression.

HAS3 mRNA in the LUT was significantly higher phase (P<0.01) compared with the FOL phase, suggesting that progesterone upregulates HAS3 synthesis. This was confirmed by IHC where a significant increase in HAS3 staining was observed in GE and LE in the endometrium of the LUT group compared with the FOL group as well as in all endometrial layers of the OVXP and OVXEP groups compared with the OVX group. In accordance with these results, HAS3 mRNA expression was higher in uterine cervix at day 15 of pregnancy compared with non-pregnant mice and treatment of cervical fibroblasts with progesterone resulted in increased HAS3 expression (Uchiyama et al. 2005). It is perhaps paradoxical that the level of HAS3 mRNA expression was increased in LUT vs FOL groups but was lower in the OVXP and OVXEP groups compared with the OVX group. This may be attributed to the duration of progesterone administration, which lasted for 10 days in the OVXP and OVXEP groups. Previous studies have shown that LE and GE exhibit downregulation of progesterone nuclear receptors by days 11 and 13 of the cycle respectively (Spencer & Bazer 2002), which is associated with changes in the functions of the endometrium. Wathes et al. (1996) reported downregulation of progesterone receptors in the LE and superficial gland at all time points when ovariectomized ewes were treated with progesterone for 8, 10, 12, or 14 days. We also observed downregulation of progesterone nuclear receptors in the OVXP and OVXEP groups compared with the OVX group in the present experiment (data not shown) and this may explain the difference in HAS3 expression pattern. However, HAS3 protein expression was increased in the endometrium under progesterone dominance in both the LUT and OVXP groups and it is known that HAS3 mRNA expression is sometimes not correlated with HAS3 immunoreactivity (Nykopp et al. 2010).

HA has a high rate of turnover at both the cellular and the tissue levels mainly due to enzymatic hydrolysis by HYALs that include HYAL1, HYAL2, HYAL3, HYAL4, HYALP1, and PH-20. Predominantly, HYAL1 and HYAL2 are considered the major HA-degrading enzymes in somatic tissue (Bastow et al. 2008). Moreover, HYAL2 is a cell surface receptor of endogenous Jaagsieket sheep retrovirus, which is proposed to partake in the fusion of binucleate giant cells and LE (Bazer et al. 2010) during implantation. HYAL2 cleaves HMW HA into biologically active fragments of 20–30 kDa or 50 disaccharide units whereas HYAL1 has the capacity to digest to smaller fragments, mainly tetrasaccharides (Stern 2004). In this study, HYAL1 and HYAL2 mRNA were not affected by the stage of the estrous cycle. In addition, HYAL1 was not affected by progesterone and estrogen treatment of OVX animals. In contrast, very high levels of HYAL2 were observed in the OVX group (about 60 000 copies compared with ∼30 000 in intact animals). This was reduced by progesterone administration in the presence or absence of estrogen to the levels observed in the intact animals, suggesting that HYAL2 expression is regulated by ovarian steroids. HYAL2 has been reported to be a specific marker for endometrial cancer (Paiva et al. 2005). HA oligosaccharides resulting from HA depolymerization by HYAL2 were found to enhance cell proliferation and make tissue prone to cancer development or facilitate the progression and metastasis of an already established cancer, possibly by angiogenesis (Toole 2004). It was previously reported that administration of steroids reduces the incidence of endometrial cancer in women (Tawil et al. 1973, Wang et al. 2009, Yoffou et al. 2011). This could be mediated by the steroid-induced downregulation of HYAL2 as shown in the OVXP and OVXEP groups compared with the OVX group. Sunil et al. (2000) reported that progesterone, either singly or in combination with estradiol, reduced the activity of HYAL in the mammary gland of an ovariectomized rat.

We have evaluated the HA distribution by IHC using HABP and quantified the results with HSCORE. Although all HAS were variably detectable in ST as well as LE and GE of the endometrium, HA immunostaining was rather localized within the ST. This may be due to the release of the HA produced by LE and GE into the uterine lumen. HA localization in the ST was also shown in the mouse (Gomes et al. 2009) and human endometrium (Afify et al. 2006, Nykopp et al. 2010). In this study, the level of HA was drastically increased in the absence of high plasma progesterone as seen in the FOL and OVX groups. Results of analyses of the kinetic (apparent K(m) values) of different HAS isoforms for the two substrates, UDP-GlcNAc and UDP-GlcUA, were previously shown to differ (Itano et al. 1999). Recombinant HAS1 protein was shown to exhibit a lower rate of synthesis of HA matrix around cells (Tammi et al. 2002). HAS2 was proposed to be the major producer of HA (McDonald & Camenisch 2003). These facts may explain the intense HA immunostaining observed in the FOL and OVX groups (which we found to have high HAS2 expression) compared with the less-intense staining in the LUT as well as in the OVXP and OVXEP groups (with lower HAS2 expression).

In previous reports, kinetic studies demonstrated that HAS proteins are distinct from each other in enzyme stability and elongation rate of HA (Stern et al. 2006). Analysis of the size distributions of HA generated by recombinant HAS proteins demonstrated that HAS3 synthesized smaller HA with a molecular mass of 0.1×106 to 1×106 Da, shorter than those synthesized by HAS1 (0.2–2×106 Da) and HAS2 (>2×106 Da) (Itano et al. 1999). It is worth emphasizing that prediction of the biological effect mediated by the changes in the synthetic rates of HA produced by either HAS1, -2, or -3 is quite difficult unless the degradation pathways brought about by HYAL (s) are also taken into consideration. In this study, we analyzed HA extracted from endometrial samples from different experimental groups using agarose gel electrophoresis to examine the molecular size distribution of the HA produced. We found that the largest size of HA in the LUT group was significantly lower than that observed in the FOL group. A similar result was noticed in OVXP ewes, which showed reduced maximum size of HA compared with OVX ewes. The smallest size of HA was also observed in the LUT group. These results clearly show that endometrial samples collected from animals under high plasma progesterone levels, which show higher HAS3 protein expression, exhibit smaller HA compared with those collected from FOL and OVX animals having lower progesterone plasma concentrations. The presence of high estrogen showed a tendency to increase HA size in the OVXEP when compared with the OVXP group. This is not surprising as estrogen resulted in a tendency to increase HAS2 mRNA expression compared with the OVXP group.

The functions of HMW HA molecules include hydration, space filling, anti-angiogenesis, immunosuppression, impedance of differentiation, and cell cycle arrest. These functions usually depend on the physical properties of the individual HA molecule (Stern et al. 2006). On the other hand, LMW HA molecules are known to be pro-inflammatory, angiogenic, and anti-apoptotic and facilitate cell-to-cell interaction and cell proliferation and are mediated by receptor signaling (Stern et al. 2006). CD44 is a predominant cell surface HA receptor (Singh et al. 2010). Most effects of HA on cell phenotype and biological processes such as adhesion, migration, proliferation, and angiogenesis involve HA–CD44-mediated signaling and cytoskeleton reorganization (Fujita et al. 2002, Bourguignon 2008). The signaling functions of CD44 have been extensively studied and well documented in the literature (Ponta et al. 2003, Toole 2004). Several signaling transduction pathways are initiated when various sizes of HA fragments bind to CD44 (Stern et al. 2006). In this study, we have shown that high plasma estrogen (in the FOL group) is associated with significantly lower CD44 mRNA expression in ovine endometrium compared with the LUT group, which was clearly reflected in CD44 staining by IHC. Progesterone administration significantly increased CD44 mRNA expression compared with the OVX ewes. This effect was completely abolished in the OVXEP group in the presence of estrogen. However, IHC staining showed significant difference in CD44 protein expression among OVX, OVXP, and OVXEP groups. This suggests that a high-estrogen, low-progesterone hormonal profile (as in the FOL group) will inhibit CD44 expression. Several studies have shown that LMW HA–CD44 interaction can induce intriguingly complex signaling transduction involving focal adhesion kinase, proto-oncogene tyrosine-protein kinase (Src), and MAPK3/1 in both health and disease (Toole 2004, Slevin et al. 2007, Matou-Nasri et al. 2009, Wang et al. 2011). In this study, it was obvious that LMW HA and CD44 were prominent under conditions of progesterone dominance in sheep endometrium, whereas HMW HA and less CD44 were observed with estrogen. Collectively, it can be inferred that the larger HA produced by HAS2 in an estrogen-dominant environment is associated with low CD44 expression and is thus required for functions that are not dependent on receptor-mediated signaling. In contrast, smaller HA molecules produced by HAS3 in a progesterone-dominant environment are associated with and possibly dependent on CD44 signaling to convey some biological functions of progesterone in preparation for endometrial receptivity for embryo implantation. This notion is currently under further investigation in our laboratory and is strengthened by the observation that CD44 staining in human endometrial ST occurs during a period when the endometrium is most receptive to embryo implantation (Afify et al. 2006) and during early stages of embryo development in cattle (Furnus et al. 2003) and human (Campbell et al. 1995). In conclusion, our results show that the level of HA production and the molecular weight of HA in the endometrium are partly regulated by ovarian steroids through differential expression of different HAS both at the gene and protein levels.

Materials and Methods

Chemicals and reagents

All chemicals and reagents were purchased from Sigma Chemical Company unless otherwise stated.

Experimental procedure and animal treatments

All experimental procedures complied with regulations in the UK Animal (Scientific Procedures) Act, 1986. Thirty healthy, proven fertile, non-pregnant Welsh Mountain adult ewes were housed indoors with straw bedding. They were fed with hay and concentrate diet. Water was provided and animals were allowed to drink ad libitum. Eight ewes were kept intact while 22 ewes were ovariectomized. The intact ewes (n=8) were synchronized using intravaginal Chronogest sponge (Intervet UK Ltd, Cambridge, UK) for 11 days and treated with 200 IU PMSG (Intervet UK Ltd, Buckinghamshire, UK) i.m. at the time of sponge removal. Estrous was observed 24 h after sponge removal. The intact ewes were killed on day 9 (mid-LUT phase; n=5) or on day 16 (FOL phase; n=3) of the synchronized estrous cycle. Blood samples were collected at the time of killing of intact animals. Simultaneously, 22 ewes were ovariectomized as described by Jackson (2004). To eliminate the effect of endogenous gonadotropins (LH and FSH), ewes received Buserelin acetate (gonadotropin agonist; Surefact, Aventis Pharma Ltd, Kent, UK) during the entire period of study administered continuously by an osmotic pump (ALZET model, DURECT Corp, Cupertino, US), which was inserted subcutaneously in the forelimb at the time of ovariectomy. These pumps contained 2 mg Buserelin in 2 ml normal saline and are designed to secrete 2.5 μl/h for 28 days. After a recovery period of 8 days, the ovariectomized ewes were treated i.m. daily with one of the three treatments: i) 2 ml corn oil (which was used as a vehicle for delivery of progesterone and estradiol) for 10 days (OVX, n=6), ii) 25 mg progesterone for ten successive days (OVXP, n=7), and iii) 6 μg estradiol benzoate and 25 mg progesterone for 3 days followed by progesterone only (25 mg) for 7 days (OVXEP, n=8). Blood samples were collected every other day from the day of commencement of treatments; plasma was separated and stored at −20 °C until assayed for progesterone and estradiol. Ewes were killed 24 h after the last injection of the steroid treatment. Uteri were harvested; small pieces of the caruncular and intercaruncular regions of endometrium of the uterine horn were finely dissected, snap–frozen, and kept at −80 °C for gene expression analysis. Transverse sections of the uterine horns were fixed in 4% formalin (BDH, Poole, UK) and later embedded in paraffin for IHC.

Measurement of progesterone and estradiol in plasma samples

Plasma progesterone concentrations were determined using ELISA kits (Ridgeway Science, Cirencester, UK) following manufacturer's instructions. Standards ranged from 0.5 to 20 ng/ml and were prepared in charcoal-stripped sheep plasma. Plasma estradiol concentrations were determined by RIA as described previously (Robinson et al. 2002). The intra-assay coefficient of variation was 3.2%. No interassay coefficient was calculated as all samples were analyzed in a single assay.

RNA isolation and RT

For total RNA isolation, frozen tissue samples (∼200 mg) were homogenized in TRI reagent followed by standard RNA extraction procedure using chloroform. To achieve better purity, all RNA samples were cleaned through RNeasy Mini Kit columns (Qiagen Ltd) following the RNA Clean-up protocol supplied by the manufacturer. The concentration and purity of the isolated RNA samples were determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA). All samples had an A260:280 ratio of absorbance between 1.9 and 2.1. The integrity of the RNA was confirmed by running it on a 2% agarose gel to visualize the 18S and 28S rRNA bands. Total RNA (500 ng) from each sample was then treated for potential genomic DNA carryover in a single reaction in accordance with guidelines supplied by Promega Corporation. DNase-treated RNA was reverse transcribed using random hexamer primers and processed accordingly (Reverse Transcription System Kit; Promega).

Primer design, optimization, and qPCR

Gene transcripts were quantified by real-time PCR as described previously (Fenwick et al. 2008, Wathes et al. 2011) with some modifications. Bovine nucleotide sequences derived from the coding domain sequence of the genes of interest and housekeeping genes were obtained directly from the GenBank published in the National Centre for Biotechnology Information database (NCBI, Bethesda, MD, USA) and their individual details are supplied in Table 3. For each gene, the primers were tested by conventional PCR amplification using a Multiplex PCR kit (Qiagen), 25 ng cDNA and 0.5 μM primers. The optimal annealing temperature (resulting in minimal threshold cycle (Ct)) was determined using the temperature gradient function of the real-time PCR machine (qPCR, CFX 96 Real-Time PCR Detection System, Bio-Rad Laboratories, Inc.) using a set of eight identical reactions for each primer. A melting curve analysis was performed for each amplicon between 50 and 95 °C and as such any smaller non-specific products such as dimers were melted (if present) before fluorescence acquisition (Table 3). External standards were prepared as described previously (Fenwick et al. 2008) from cDNA as identical to real-time PCR products and purified using QIAquick PCR purification columns (Qiagen) and the presence of a single product was confirmed by electrophoresis on a 2% (w/v) agarose gel.

Table 3

Oligonucleotide primer sequences and amplicon sizes and their corresponding annealing and plate-reading temperatures used for the qPCR assays.

GenePrimer sequence (5′– 3′)Size (bp)Accession no.Annealing temperature (°C)Reading temperature (°C)
HAS1F: GGTACAACCAGAAGTTCCTGGG184AB017803.16182
R: CGGAAGTACGACTTGGACCAG
HAS2F: GGGGGAGATGTCCAGATTTT125NM1740796174
R: ATGCACTGGACACATCCGA
HAS3F: ACAGGTTTCTTCCCCTTCTTCC166NM001192867.16178
R: GCGACATGAAGATCATCTCTGC
CD44F: TATAACCTGCCGATATGCAGG221NM174013.36180
R: CAGCACAGATGGAATTGGG
HYAL1F: TCAGCCTTGAGGTTTCCCTA144NM001017941.16178
R: TCCAGATGGTAGTGAAGGGC
HYAL2F: GGACTCCCACACAGTTCCTG280NM174347.25984
R: ACCCTCGTTAGGTGAAGCCT
B2MF: CGCCAGAAGATGGAAAGC167NM001009284.15976.5
R: GAACTCAGCGTGGGACAGA
GAPDHF: CACTGTCCACGCCATCACT267NM001190390.163.382.5
R: GCCTGCTTCACCACCTTCT
18SF: GCTCGCTCCTCTCCTACTTG326AY753190.15983
R: CGTTTCTCAGGCTCCCTCT
HPRT1F: AGCGTGGTGATTAGCGATG219NM001034035.161.476.5
R: CAACAGGTCGGCAAAGAAC

Copy number standards were then generated as described previously by Clemente et al. (2009). Briefly, the precise concentration of purified PCR product was determined using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.) and the copy numbers of fragments were empirically determined using the following equation: copy number of PCR standard=(amount of cDNA (in ng)×Avogadro Constant)/(PCR product size (in bp)×1×109×660) where Avogadro Constant=6.022×1023). Standards containing 107–100 copies/PCR were then prepared by tenfold serial dilutions. The standards in duplicates and cDNA samples (equivalent to 25 ng reverse transcribed RNA) were then amplified in the same reaction prepared from a master mix containing KAPA SYBR green mix (Anachem, Boston, MA, USA), forward+reverse primer mix (20 μM), and nuclease-free water in 20 μl reactions. No-template controls (NTC) and RT-negative controls were included on every plate for each gene product. To minimize variation, all samples included in each analysis were derived from the same RT batch, prepared under the same conditions, and were analyzed on a single plate in duplicate. Ct values for unknowns and standards were obtained using a real-time PCR machine (qPCR, CFX 96 Real-Time PCR Detection System, Bio-Rad Laboratories, Inc.). Absolute starting quantities (in copy numbers) were calculated by comparing the Ct values of the unknown samples to the standard curve using the CFX Manager Software Version 1.0.1035.131 (Bio-Rad Laboratories, Inc.). Efficiency of the assays (E) was ≥95%, and standard curve R2 was ≥0.999. Gene expression results were normalized using geNorm software using data from the reference genes – B2M and GAPDH. The pattern of gene expression for target genes was similar in caruncular and intercaruncular regions of the endometrium, and data from the two regions were pooled.

Immunohistochemistry

Protein expression for HAS1, HAS2, HAS3, and CD44 was determined by IHC. Paraffin-embedded uterine sections (5 μm) mounted on superfrost slides (VWR International Co., Leicestershire, UK) were dewaxed, rehydrated, and immersed in boiling-hot sodium citrate solution (2.947 g/l pH 6.0) for 30 min. Slides were then rinsed in Tris-buffered saline, pH 7.6, containing 0.1% Triton-X (v/v). Non-specific binding was blocked by incubating sections with 10% (v/v) normal goat serum (Dako, Glostrup, Denmark) in TBS containing 1% (w/v) BSA for 2 h in a humidified chamber. Without washing, sections were incubated with primary antibodies: either polyclonal rabbit anti-HAS1 (5 μg/ml; MCA1730; Abgent, Inc., San Diego, CA, USA), polyclonal rabbit anti-HAS2 (4 μg/ml; Sc-66916; Santa Cruz Biotechnology, Inc.), polyclonal rabbit anti-HAS3 (4 μg/ml; Sc-66917; Santa Cruz), or monoclonal mouse anti-CD44v6 (AP4928C; 10 μg/ml; AbD Serotec, Kidlington, Oxford, UK). The slides were incubated in a humidified chamber at 4 °C overnight. On the following day, the slides were rinsed in TBS and endogenous peroxidase was blocked using peroxidase suppressor (Thermo Scientific, Rockford, IL, USA) for 45 min. The primary antibody was detected using biotinylated anti-rabbit secondary antibody (1:100) or anti-mouse and Vectorstain ABC method according to the manufacturer's instructions (Vector Laboratories, Peterborough, UK), which was followed by visualization using diaminobenzidine (DAB; Vector Laboratories). The sections were counterstained with hematoxylin, dehydrated in graded ethanol, and then Histoclear. The sections were mounted with DPX, coverslipped, and visualized under an Olympus BX60 microscope (Olympus, Essex, UK). Negative controls were treated in the same way except that the primary antibody was replaced with normal rabbit (for HAS1–3) or normal mouse (for CD44) IgGs (Santa Cruz Biotechnology, Inc.).

HA immunostaining

For staining of HA in tissue sections, sections were dewaxed and dehydrated and blocked as for IHC. Sections were then incubated with b-HABP (AMBS Biotechnology, Oxon, UK) at 2.5 μg/ml concentration overnight at 4 °C followed by streptavidin-biotinylated HRP (1:200 in PBS; GE Healthcare, Buckinghamshire, UK), for 1 h at room temperature. Immunostaining was visualized with DAB. Control sections were treated with HYAL2 and washed before staining.

Semiquantitative analysis of immunostaining

Immunostaining was semiquantitatively assessed using a histochemical score (HSCORE) system. This obtained a score range from 0 to 300 by multiplying the intensity of the stains (score 0–3) and the percentage of area stained (0–100) as described previously (Ponglowhapan et al. 2008). The estimate was based on five random fields per section from all the animals in each treatment group. Images were scored by two independent experienced assessors blinded to the corresponding experimental groups under scoring.

HA extraction and determination of HA molecular size

Caruncular and intercaruncular pieces of endometrium that were snap–frozen at the time of tissue collection were digested for 16–18 h in 0.1 M sodium acetate buffer, pH 5.8, containing 0.25 mg/ml papain (Roche Applied Science), 5 mM EDTA, and 5 mM l-cysteine hydrochloride (anhydrous) at 60 °C as described previously (Pitsillides et al. 1999).

HA molecular weight distribution was determined using agarose gel electrophoresis according to the principle described in earlier studies (Bjornsson 1993; Lee & Cowman 1994). The detection method was developed and optimized in our laboratory. It involved mixing digested endometrial samples or HA standards (mixture of 70, 250, 1000 and 2000 kDa Select HA, Hyalose L.L.C., Oklahoma, USA) with loading buffer (TAE buffer containing 20% v/v glycerol and 0.02% w/v Bromophenol Blue). This was followed by electrophoresis on a 1% agarose gel for 90 min at 80 V. Separated HA samples were then transferred onto positively charged nylon membrane (Hybond N+, GE Healthcare, Amersham, Buckinghamshire, UK) by Upward Capillary Transfer overnight using TAE buffer. Membrane blots were blocked in blocking buffer (10% (w/v) nonfat dried milk in PBS–Tween for 2 h at room temperature). For specific detection of HA, membranes were incubated with b-HABP (0.08 μg/ml in PBS containing 5% BSA w/v) for 100 min at room temperature. Membranes were then washed and incubated with HRP-conjugated antibiotin antibody (1:4000; Cell Signaling Technology, Inc., Danvers, US) in PBS-T for 2 h. Membranes were thoroughly washed three times on a shaker at maximum speed in PBS-T and then developed using the ECL (ECL-plus) detection system (GE Healthcare). Images were acquired using the chemiluminescence application in the Syngene Gel doc facility (SYNGENE, Cambridge, UK). Analysis of HA size distribution was done with AlphaEase FC software using bands corresponding to the Select HA standards as reference. HA size analysis followed the same pattern in caruncular and intercaruncular regions of the endometrium, and data from the two regions were pooled.

Statistical analysis

In all the experiments, the data were from at least three animals per experimental group. All data, gene and protein expression, HA immunostaining, as well as HA molecular weights were analyzed using IBM SPSS (version 19) by independent t-test (to compare LUT with FOL groups) or one-way ANOVA (to compare OVXP and OVXEP with OVX group). If the main treatment effect was significant in ANOVA, Bonferroni post hoc tests were performed. Differences of P values ≤0.05 were considered as significant, while P values >0.05 to <0.1 were considered as a trend. Data are shown as mean±s.e.m.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

Mr K A Raheem is funded by a PhD scholarship from the Education Trust Fund, Abuja, and Michael Okpara University of Agriculture, Umudike, Nigeria. The studies presented here were funded by a Biotechnology and Biological Sciences Research Council (BBSRC) New Investigator Award to A A Fouladi-Nashta (BB/G008620/1).

References

  • AfifyAMCraigSPaulinoAF2006Temporal variation in the distribution of hyaluronic acid, CD44s, and CD44v6 in the human endometrium across the menstrual cycle. Applied Immunohistochemistry & Molecular Morphology14328333. (doi:10.1097/00129039-200609000-00012)

    • Search Google Scholar
    • Export Citation
  • AplinJD2007Embryo implantation: the molecular mechanism remains elusive. Reproductive Biomedicine Online144955. (doi:10.1016/S1472-6483(10)60763-8)

    • Search Google Scholar
    • Export Citation
  • AruffoA1996CD44 one ligand 2 functions. Journal of Clinical Investigation9821912192. (doi:10.1172/JCI119026)

  • AruffoAStamenkovicIMelnickMUnderhillCBSeedB1990CD44 is the principal cell surface receptor for hyaluronate. Cell6113031313. (doi:10.1016/0092-8674(90)90694-A)

    • Search Google Scholar
    • Export Citation
  • BabayanANeuerADieterleSBongiovanniAMWitkinSS2008Hyaluronan in follicular fluid and embryo implantation following in vitro fertilization and embryo transfer. Journal of Assisted Reproduction and Genetics25473476. (doi:10.1007/s10815-008-9268-4)

    • Search Google Scholar
    • Export Citation
  • Balazs E & Gibbs D 1970 The rheological properties and the biological function of hyaluronic acid. In Chemistry and Molecular Biology of Intercellular Matrix vol 3 pp 431–437. Eds EA Balazs. New York: Academic Press

  • BastowERByersSGolubSBClarkinCEPitsillidesAAFosangAJ2008Hyaluronan synthesis and degradation in cartilage and bone. Cellular and Molecular Life Sciences65395413. (doi:10.1007/s00018-007-7360-z)

    • Search Google Scholar
    • Export Citation
  • BazerFWWuGSpencerTEJohnsonGABurghardtRCBaylessK2010Novel pathways for implantation and establishment and maintenance of pregnancy in mammals. Molecular Human Reproduction16135152. (doi:10.1093/molehr/gap095)

    • Search Google Scholar
    • Export Citation
  • BjornssonS1993Size-dependent separation of proteoglycans by electrophoresis in gels of pure agarose. Analytical Biochemistry210292298. (doi:10.1006/abio.1993.1198)

    • Search Google Scholar
    • Export Citation
  • BourguignonLYW2008Hyaluronan-mediated CD44 activation of RhoGTPase signaling and cytoskeleton function promotes tumor progression. Seminars in Cancer Biology18251259. (doi:10.1016/j.semcancer.2008.03.007)

    • Search Google Scholar
    • Export Citation
  • CamenischTDSpicerAPBrehm-GibsonTBiesterfeldtJAugustineMLCalabroAJrKubalakSKlewerSEMcDonaldJA2000Disruption of hyaluronan synthase-2 abrogates normal cardiac morphogenesis and hyaluronan-mediated transformation of epithelium to mesenchyme. Journal of Clinical Investigation106349360. (doi:10.1172/JCI10272)

    • Search Google Scholar
    • Export Citation
  • CampbellSSwannHRAplinJDSeifMWKimberSJElsteinM1995CD44 is expressed throughout pre-implantation human embryo development. Human Reproduction10425430. (doi:10.1093/HUMREP/10.6.1571)

    • Search Google Scholar
    • Export Citation
  • CidadaoAJThorsteinsdottirSDavid-FerreiraJF1990Immunocytochemical study of tissue distribution and hormonal control of chondroitin-dermatan-and keratan sulfates from rodents uterus. European Journal of Cell Biology52105116.

    • Search Google Scholar
    • Export Citation
  • ClementeMde La FuenteJFairTAl NaibAGutierrez-AdanARocheJFRizosDLonerganP2009Progesterone and conceptus elongation in cattle: a direct effect on the embryo or an indirect effect via the endometrium?Reproduction138507517. (doi:10.1530/REP-09-0152)

    • Search Google Scholar
    • Export Citation
  • DeedRRooneyPKumarPNortonJDFreemontAJKumarS1997Early-response gene signaling is induced by angiogenic oligosaccharides of hyaluronan in endothelial cells. Inhibition by non-angiogenic, high-molecular-weight hyaluronan. International Journal of Cancer71116122. (doi:10.1002/(SICI)1097-0215(19970410)71:2<251::AID-IJC21>3.0.CO;2-J)

    • Search Google Scholar
    • Export Citation
  • FenwickMAFitzpatrickRKennyDADiskinMGPattonJMurphyJJWathesDC2008Interrelationships between negative energy balance (NEB) and IGF regulation in liver of lactating dairy cows. Domestic Animal Endocrinology343144. (doi:10.1016/j.domaniend.2006.10.002)

    • Search Google Scholar
    • Export Citation
  • FujitaYKitagawaMNakamuraSAzumaKIshiiGHigashiMKishiHHiwasaTKodaKNakajimaN2002CD44 signaling through focal adhesion kinase and its anti-apoptotic effect. FEBS Letters528101108. (doi:10.1016/S0014-5793(02)03262-3)

    • Search Google Scholar
    • Export Citation
  • FurnusCCValcarcelADuloutFNErrecaldeAL2003The hyaluronic acid receptor (CD44) is expressed in bovine oocytes and early stage embryos. Theriogenology6016331644. (doi:10.1016/S0093-691X(03)00116-X)

    • Search Google Scholar
    • Export Citation
  • GomesRCTVernaCNaderHBSimoesRSDreyfussJLMartinsJRMBaracatECSimoesMJSoaresJM2009Concentration and distribution of hyaluronic acid in mouse uterus throughout the estrous cycle. Fertility and Sterility92785792. (doi:10.1016/j.fertnstert.2008.07.005)

    • Search Google Scholar
    • Export Citation
  • ItanoNSawaiTYoshidaMLenasPYamadaYImagawaMShinomuraTHamaguchiMYoshidaYOhnukiY1999Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties. Journal of Biological Chemistry2742508525092. (doi:10.1074/jbc.274.35.25085)

    • Search Google Scholar
    • Export Citation
  • Jackson PGG 2004 Cesarean section. In Handbook of Veterinary Obstetrics ch 11 pp 173–199. 2nd edn Ed. PGG Jackson. Edinburgh UK: Saunders

  • LeeHGCowmanMK1994An agarose gel electrophoretic method for analysis of hyaluronan molecular weight distribution. Analytical Biochemistry219278287. (doi:10.1006/abio.1994.1267)

    • Search Google Scholar
    • Export Citation
  • LeeJSpicerA2000Hyaluronan: a multifunctional, megaDalton, stealth molecule. Current Opinion in Cell Biology12581586. (doi:10.1016/S0955-0674(00)00135-6)

    • Search Google Scholar
    • Export Citation
  • LepperdingerGMulleggerJKreilG2001Hyal2 – less active, but more versatile?Matrix Biology20509514. (doi:10.1016/S0945-053X(01)00170-6)

    • Search Google Scholar
    • Export Citation
  • Matou-NasriSGaffneyJKumarSSlevinA2009Oligosaccharides of hyaluronan induce angiogenesis through distinct CD44 and RHAMM-mediated signalling pathways involving Cdc2 and γ-adducin. International Journal of Oncology35761773. (doi:10.3892/ijo_00000389)

    • Search Google Scholar
    • Export Citation
  • McDonaldJACamenischTD2003Hyaluronan: genetic insights into the complex biology of a simple polysaccharide. Glycoconjugate Journal19331339. (doi:10.1023/A:1025369004783)

    • Search Google Scholar
    • Export Citation
  • NykoppTKRillaKSironenRTammiMITammiRHHamalainenKHeikkinenAMKomulainenMKosmaVMAnttilaM2009Expression of hyaluronan synthases (HAS1–3) and hyaluronidases (HYAL1–2) in serous ovarian carcinomas: inverse correlation between HYAL1 and hyaluronan content. BMC Cancer9143. (doi:10.1186/1471-2407-9-143)

    • Search Google Scholar
    • Export Citation
  • NykoppTKRillaKTammiMITammiRHSironenRHamalainenKKosmaVMHeinonenSAnttilaM2010Hyaluronan synthases (HAS1–3) and hyaluronidases (HYAL1–2) in the accumulation of hyaluronan in endometrioid endometrial carcinoma. BMC Cancer10512. (doi:10.1186/1471-2407-10-512)

    • Search Google Scholar
    • Export Citation
  • PaivaPVandammeMTellbachMJonesRJoblingTSalamonsenL2005Expression patterns of hyaluronan, hyaluronan synthases and hyaluronidases indicate a role for hyaluronan in the progression of endometrial cancer. Gynecologic Oncology98193202. (doi:10.1016/j.ygyno.2005.02.031)

    • Search Google Scholar
    • Export Citation
  • PerryKHaresignWWathesDCKhalidM2010aHyaluronan (HA) content, the ratio of HA fragments and the expression of CD44 in the ovine cervix vary with the stage of the oestrous cycle. Reproduction140133141. (doi:10.1530/REP-09-0424)

    • Search Google Scholar
    • Export Citation
  • PerryKHaresignWWathesDCKhalidM2010bIntracervical application of hyaluronan improves cervical relaxation in the ewe. Theriogenology7416851690. (doi:10.1016/j.theriogenology.2010.07.008)

    • Search Google Scholar
    • Export Citation
  • PienimakiJPRillaKFulopCSironenRKarvinenSPasonenSLammiMJTammiRHascallVCTammiMI2001Epidermal growth factor activates hyaluronan synthase 2 in epidermal keratinocytes and increases pericellular and intracellular hyaluronan. Journal of Biological Chemistry2762042820435. (doi:10.1074/jbc.M007601200)

    • Search Google Scholar
    • Export Citation
  • PitsillidesAASkerryTMEdwardsCJ1999Joint immobilization reduces synovial fluid hyaluronan concentration and is accompanied by changes in the synovial intimal cell population. Rheumatology3811081112. (doi:10.1093/rheumatology/38.11.1108)

    • Search Google Scholar
    • Export Citation
  • PonglowhapanSChurchDBKhalidM2008Differences in the expression of luteinizing hormone and follicle stimulating hormone receptors in the lower urinary tract between intact and gonadectomised male and female dogs. Domestic Animal Endocrinology34339351. (doi:10.1016/j.domaniend.2007.09.005)

    • Search Google Scholar
    • Export Citation
  • PontaHShermanLHerrlichPA2003CD44: from adhesion molecules to signalling regulators. Nature Reviews. Molecular Cell Biology43345. (doi:10.1038/nrm1004)

    • Search Google Scholar
    • Export Citation
  • ReckliesADWhiteCMelchingLRoughleyPJ2001Differential regulation and expression of hyaluronan synthases in human articular chondrocytes, synovial cells and osteosarcoma cells. Biochemical Journal3541724. (doi:10.1042/0264-6021:3540017)

    • Search Google Scholar
    • Export Citation
  • RobertsRMBazerFW1988The functions of uterine secretions. Journal of Reproduction and Fertility82875892. (doi:10.1530/jrf.0.0820875)

  • RobinsonRSPushpakumaraPGChengZPetersARAbayasekaraDRWathesDC2002Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction124119131. (doi:10.1530/rep.0.1240119)

    • Search Google Scholar
    • Export Citation
  • SchoenfelderMEinspanierR2003Expression of hyaluronan synthases and corresponding hyaluronan receptors is differentially regulated during oocyte maturation in cattle. Biology of Reproduction69269277. (doi:10.1095/biolreprod.102.011577)

    • Search Google Scholar
    • Export Citation
  • SinghHNardoLKimberSJAplinJD2010Early stages of implantation as revealed by an in vitro model. Reproduction139905914. (doi:10.1530/REP-09-0271)

    • Search Google Scholar
    • Export Citation
  • SlevinMKrupinskiJGaffneyJMatouSWestDDelisserHSavaniRCKumarS2007Hyaluronan-mediated angiogenesis in vascular disease: uncovering RHAMM and CD44 receptor signaling pathways. Matrix Biology265868. (doi:10.1016/j.matbio.2006.08.261)

    • Search Google Scholar
    • Export Citation
  • SpencerTEBazerFW2002Biology of Progesterone action during pregnancy recognition and maintenance of pregnancy. Frontiers in Bioscience718791898. (doi:10.2741/spencer)

    • Search Google Scholar
    • Export Citation
  • SpicerAPMcDonaldJA1998Characterization and molecular evolution of a vertebrate hyaluronan synthase gene family. Journal of Biological Chemistry27319231932. (doi:10.1074/jbc.273.4.1923)

    • Search Google Scholar
    • Export Citation
  • SternR2003Devising a pathway for hyaluronan catabolism: are we there yet?Glycobiology13105R115R. (doi:10.1093/glycob/cwg112)

  • SternR2004Hyaluronan catabolism: a new metabolic pathway. European Journal of Cell Biology83317325. (doi:10.1078/0171-9335-00392)

  • SternRAsariASugaharaK2006Hyaluronan fragments: an information-rich system. European Journal of Cell Biology85699715. (doi:10.1016/j.ejcb.2006.05.009)

    • Search Google Scholar
    • Export Citation
  • StraachKJSheltonJMRichardsonJAHascallVCMahendrooMS2005Regulation of hyaluronan expression during cervical ripening. Glycobiology155565. (doi:10.1093/glycob/cwh137)

    • Search Google Scholar
    • Export Citation
  • SunilNSrinivasanNAruldhasMMGovindarajuluP2000Impact of oestradiol and progesterone on the glycosaminoglycans and their depolymerizing enzymes of the rat mammary gland. Acta Physiologica Scandinavica168385392. (doi:10.1046/j.1365-201x.2000.00675.x)

    • Search Google Scholar
    • Export Citation
  • TammiMIDayAJTurleyEA2002Hyaluronan and homeostasis: a balancing act. Journal of Biological Chemistry27745814584. (doi:10.1074/jbc.R100037200)

    • Search Google Scholar
    • Export Citation
  • TawilESimardRMethotY1973The addition of progesterone to radiotherapy in cancer of the endometrium. Union Medicale du Canada1028384.

  • TellbachMSalamonsenLAVan DammeM-P2002The influence of ovarian steroids on ovine endometrial glycosaminoglycans. Glycoconjugate Journal19385394. (doi:10.1023/B:GLYC.0000004010.24877.2f)

    • Search Google Scholar
    • Export Citation
  • TooleBP2004Hyaluronan: from extracellular glue to pericellular cue. Nature Reviews. Cancer4528539. (doi:10.1038/nrc1391)

  • UchiyamaTSakutaTKanayamaT2005Regulation of hyaluronan synthases in mouse uterine cervix. Biochemical and Biophysical Research Communications327927932. (doi:10.1016/j.bbrc.2004.12.092)

    • Search Google Scholar
    • Export Citation
  • WangYHanifi-MoghaddamPHanekampEEKloosterboerHJFrankenPVeldscholteJvan DoornHCEwingPCKimJJGrootegoedJA2009Progesterone inhibition of Wnt/β-catenin signaling in normal endometrium and endometrial cancer. Clinical Cancer Research1557845793. (doi:10.1158/1078-0432.CCR-09-0814)

    • Search Google Scholar
    • Export Citation
  • WangYZCaoMLLiuYWHeYQYangCXGaoF2011CD44 mediates oligosaccharides of hyaluronan-induced proliferation, tube formation and signal transduction in endothelial cells. Experimental Biology and Medicine2368490. (doi:10.1258/ebm.2010.010206)

    • Search Google Scholar
    • Export Citation
  • WathesDCMannGEPayneJHRileyPRStevensonKRLammingGE1996Regulation of oxytocin, oestradiol and progesterone receptor concentrations in different uterine regions by oestradiol, progesterone and oxytocin in ovariectomized ewes. Journal of Endocrinology151375393. (doi:10.1677/joe.0.1510375)

    • Search Google Scholar
    • Export Citation
  • WathesDCChengZFenwickMAFitzpatrickRPattonJ2011Influence of energy balance on the somatotrophic axis and matrix metalloproteinase expression in the endometrium of the postpartum dairy cow. Reproduction141269281. (doi:10.1530/REP-10-0177)

    • Search Google Scholar
    • Export Citation
  • WeissmannBMeyerKSampsonPLinkerA1954Isolation of oligosaccharides enzymatically produced from hyaluronic acid. Journal of Biological Chemistry208417429.

    • Search Google Scholar
    • Export Citation
  • YoffouPHEdjekouaneLMeunierLTremblayAProvencherDMMes-MassonA-MCarmonaE2011Subtype specific elevated expression of hyaluronidase-1 (HYAL-1) in epithelial ovarian cancer. PLoS ONE6e20705. (doi:10.1371/journal.pone.0020705)

    • Search Google Scholar
    • Export Citation

K Mifsud is now at School of Clinical Sciences, University of Bristol, Bristol BS1 3NY, UK

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 292 232 12
PDF Downloads 114 98 8

Altmetrics

Figures

  • View in gallery

    Immunohistochemical localization and quantification of HAS1 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS1 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP<0.05 or a vs cP<0.01.

  • View in gallery

    Immunohistochemical localization and quantification of HAS2 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS2 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP≤0.05 or a vs cP<0.01.

  • View in gallery

    Immunohistochemical localization and quantification of HAS3 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). HAS3 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Different letters a vs b indicate a trend (P<0.1) while a vs c or a vs d indicate significant difference at P<0.05 within the same layer. Immune cells, mostly lymphocytes (indicated by black arrows) were extracted from the image before the quantification.

  • View in gallery

    Immunohistochemical localization and quantification of CD44 in the uterine endometrium in sheep at the follicular (FOL) and luteal (LUT) stages of the estrous cycle (left panels) and in ovariectomized ewes treated with vehicle (OVX), progesterone (OVXP), or estradiol and progesterone (OVXEP) (right panels). CD44 is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. Bars with different superscripts within the same layer are significantly different at a vs bP<0.05 or a vs cP<0.01.

  • View in gallery

    Immunohistochemical localization and quantification of HA in the uterine endometrium in sheep at the follicular (FOL; A) and luteal (LUT; B) stages of the estrous cycle and in ovariectomized ewes treated with vehicle (OVX; D), progesterone (OVXP; E), or estradiol and progesterone (OVXEP; F). HA is shown as brown staining (DAB) while nuclei are counterstained with hematoxylin. The HSCORE is shown as mean±s.e.m. P values are shown compared with the FOL (C) or OVX (H) groups.

  • View in gallery

    (A) Estimation of HA molecular weight distribution by b-HABP and HRP-antibiotin IgG (representative blot). The molecular weight of the HA was determined with Alfa Ease FC software using HA standards shown to the left of the gel for reference. (B) The highest and lowest molecular weight of HA in endometrium collected from intact ewes at the follicular (FOL) and luteal (LUT) phases of the estrous cycle, and (C) ovariectomized ewes treated with vehicle (control; OVX), progesterone (OVXP) or estrogen and progesterone (OVXEP). Data are from six independent repeats and presented as mean±s.e.m. in a box plot. P values are shown as compared with the FOL group or OVX group.

References

  • AfifyAMCraigSPaulinoAF2006Temporal variation in the distribution of hyaluronic acid, CD44s, and CD44v6 in the human endometrium across the menstrual cycle. Applied Immunohistochemistry & Molecular Morphology14328333. (doi:10.1097/00129039-200609000-00012)

    • Search Google Scholar
    • Export Citation
  • AplinJD2007Embryo implantation: the molecular mechanism remains elusive. Reproductive Biomedicine Online144955. (doi:10.1016/S1472-6483(10)60763-8)

    • Search Google Scholar
    • Export Citation
  • AruffoA1996CD44 one ligand 2 functions. Journal of Clinical Investigation9821912192. (doi:10.1172/JCI119026)

  • AruffoAStamenkovicIMelnickMUnderhillCBSeedB1990CD44 is the principal cell surface receptor for hyaluronate. Cell6113031313. (doi:10.1016/0092-8674(90)90694-A)

    • Search Google Scholar
    • Export Citation
  • BabayanANeuerADieterleSBongiovanniAMWitkinSS2008Hyaluronan in follicular fluid and embryo implantation following in vitro fertilization and embryo transfer. Journal of Assisted Reproduction and Genetics25473476. (doi:10.1007/s10815-008-9268-4)

    • Search Google Scholar
    • Export Citation
  • Balazs E & Gibbs D 1970 The rheological properties and the biological function of hyaluronic acid. In Chemistry and Molecular Biology of Intercellular Matrix vol 3 pp 431–437. Eds EA Balazs. New York: Academic Press

  • BastowERByersSGolubSBClarkinCEPitsillidesAAFosangAJ2008Hyaluronan synthesis and degradation in cartilage and bone. Cellular and Molecular Life Sciences65395413. (doi:10.1007/s00018-007-7360-z)

    • Search Google Scholar
    • Export Citation
  • BazerFWWuGSpencerTEJohnsonGABurghardtRCBaylessK2010Novel pathways for implantation and establishment and maintenance of pregnancy in mammals. Molecular Human Reproduction16135152. (doi:10.1093/molehr/gap095)

    • Search Google Scholar
    • Export Citation
  • BjornssonS1993Size-dependent separation of proteoglycans by electrophoresis in gels of pure agarose. Analytical Biochemistry210292298. (doi:10.1006/abio.1993.1198)

    • Search Google Scholar
    • Export Citation
  • BourguignonLYW2008Hyaluronan-mediated CD44 activation of RhoGTPase signaling and cytoskeleton function promotes tumor progression. Seminars in Cancer Biology18251259. (doi:10.1016/j.semcancer.2008.03.007)

    • Search Google Scholar
    • Export Citation
  • CamenischTDSpicerAPBrehm-GibsonTBiesterfeldtJAugustineMLCalabroAJrKubalakSKlewerSEMcDonaldJA2000Disruption of hyaluronan synthase-2 abrogates normal cardiac morphogenesis and hyaluronan-mediated transformation of epithelium to mesenchyme. Journal of Clinical Investigation106349360. (doi:10.1172/JCI10272)

    • Search Google Scholar
    • Export Citation
  • CampbellSSwannHRAplinJDSeifMWKimberSJElsteinM1995CD44 is expressed throughout pre-implantation human embryo development. Human Reproduction10425430. (doi:10.1093/HUMREP/10.6.1571)

    • Search Google Scholar
    • Export Citation
  • CidadaoAJThorsteinsdottirSDavid-FerreiraJF1990Immunocytochemical study of tissue distribution and hormonal control of chondroitin-dermatan-and keratan sulfates from rodents uterus. European Journal of Cell Biology52105116.

    • Search Google Scholar
    • Export Citation
  • ClementeMde La FuenteJFairTAl NaibAGutierrez-AdanARocheJFRizosDLonerganP2009Progesterone and conceptus elongation in cattle: a direct effect on the embryo or an indirect effect via the endometrium?Reproduction138507517. (doi:10.1530/REP-09-0152)

    • Search Google Scholar
    • Export Citation
  • DeedRRooneyPKumarPNortonJDFreemontAJKumarS1997Early-response gene signaling is induced by angiogenic oligosaccharides of hyaluronan in endothelial cells. Inhibition by non-angiogenic, high-molecular-weight hyaluronan. International Journal of Cancer71116122. (doi:10.1002/(SICI)1097-0215(19970410)71:2<251::AID-IJC21>3.0.CO;2-J)

    • Search Google Scholar
    • Export Citation
  • FenwickMAFitzpatrickRKennyDADiskinMGPattonJMurphyJJWathesDC2008Interrelationships between negative energy balance (NEB) and IGF regulation in liver of lactating dairy cows. Domestic Animal Endocrinology343144. (doi:10.1016/j.domaniend.2006.10.002)

    • Search Google Scholar
    • Export Citation
  • FujitaYKitagawaMNakamuraSAzumaKIshiiGHigashiMKishiHHiwasaTKodaKNakajimaN2002CD44 signaling through focal adhesion kinase and its anti-apoptotic effect. FEBS Letters528101108. (doi:10.1016/S0014-5793(02)03262-3)

    • Search Google Scholar
    • Export Citation
  • FurnusCCValcarcelADuloutFNErrecaldeAL2003The hyaluronic acid receptor (CD44) is expressed in bovine oocytes and early stage embryos. Theriogenology6016331644. (doi:10.1016/S0093-691X(03)00116-X)

    • Search Google Scholar
    • Export Citation
  • GomesRCTVernaCNaderHBSimoesRSDreyfussJLMartinsJRMBaracatECSimoesMJSoaresJM2009Concentration and distribution of hyaluronic acid in mouse uterus throughout the estrous cycle. Fertility and Sterility92785792. (doi:10.1016/j.fertnstert.2008.07.005)

    • Search Google Scholar
    • Export Citation
  • ItanoNSawaiTYoshidaMLenasPYamadaYImagawaMShinomuraTHamaguchiMYoshidaYOhnukiY1999Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties. Journal of Biological Chemistry2742508525092. (doi:10.1074/jbc.274.35.25085)

    • Search Google Scholar
    • Export Citation
  • Jackson PGG 2004 Cesarean section. In Handbook of Veterinary Obstetrics ch 11 pp 173–199. 2nd edn Ed. PGG Jackson. Edinburgh UK: Saunders

  • LeeHGCowmanMK1994An agarose gel electrophoretic method for analysis of hyaluronan molecular weight distribution. Analytical Biochemistry219278287. (doi:10.1006/abio.1994.1267)

    • Search Google Scholar
    • Export Citation
  • LeeJSpicerA2000Hyaluronan: a multifunctional, megaDalton, stealth molecule. Current Opinion in Cell Biology12581586. (doi:10.1016/S0955-0674(00)00135-6)

    • Search Google Scholar
    • Export Citation
  • LepperdingerGMulleggerJKreilG2001Hyal2 – less active, but more versatile?Matrix Biology20509514. (doi:10.1016/S0945-053X(01)00170-6)

    • Search Google Scholar
    • Export Citation
  • Matou-NasriSGaffneyJKumarSSlevinA2009Oligosaccharides of hyaluronan induce angiogenesis through distinct CD44 and RHAMM-mediated signalling pathways involving Cdc2 and γ-adducin. International Journal of Oncology35761773. (doi:10.3892/ijo_00000389)

    • Search Google Scholar
    • Export Citation
  • McDonaldJACamenischTD2003Hyaluronan: genetic insights into the complex biology of a simple polysaccharide. Glycoconjugate Journal19331339. (doi:10.1023/A:1025369004783)

    • Search Google Scholar
    • Export Citation
  • NykoppTKRillaKSironenRTammiMITammiRHHamalainenKHeikkinenAMKomulainenMKosmaVMAnttilaM2009Expression of hyaluronan synthases (HAS1–3) and hyaluronidases (HYAL1–2) in serous ovarian carcinomas: inverse correlation between HYAL1 and hyaluronan content. BMC Cancer9143. (doi:10.1186/1471-2407-9-143)

    • Search Google Scholar
    • Export Citation
  • NykoppTKRillaKTammiMITammiRHSironenRHamalainenKKosmaVMHeinonenSAnttilaM2010Hyaluronan synthases (HAS1–3) and hyaluronidases (HYAL1–2) in the accumulation of hyaluronan in endometrioid endometrial carcinoma. BMC Cancer10512. (doi:10.1186/1471-2407-10-512)

    • Search Google Scholar
    • Export Citation
  • PaivaPVandammeMTellbachMJonesRJoblingTSalamonsenL2005Expression patterns of hyaluronan, hyaluronan synthases and hyaluronidases indicate a role for hyaluronan in the progression of endometrial cancer. Gynecologic Oncology98193202. (doi:10.1016/j.ygyno.2005.02.031)

    • Search Google Scholar
    • Export Citation
  • PerryKHaresignWWathesDCKhalidM2010aHyaluronan (HA) content, the ratio of HA fragments and the expression of CD44 in the ovine cervix vary with the stage of the oestrous cycle. Reproduction140133141. (doi:10.1530/REP-09-0424)

    • Search Google Scholar
    • Export Citation
  • PerryKHaresignWWathesDCKhalidM2010bIntracervical application of hyaluronan improves cervical relaxation in the ewe. Theriogenology7416851690. (doi:10.1016/j.theriogenology.2010.07.008)

    • Search Google Scholar
    • Export Citation
  • PienimakiJPRillaKFulopCSironenRKarvinenSPasonenSLammiMJTammiRHascallVCTammiMI2001Epidermal growth factor activates hyaluronan synthase 2 in epidermal keratinocytes and increases pericellular and intracellular hyaluronan. Journal of Biological Chemistry2762042820435. (doi:10.1074/jbc.M007601200)

    • Search Google Scholar
    • Export Citation
  • PitsillidesAASkerryTMEdwardsCJ1999Joint immobilization reduces synovial fluid hyaluronan concentration and is accompanied by changes in the synovial intimal cell population. Rheumatology3811081112. (doi:10.1093/rheumatology/38.11.1108)

    • Search Google Scholar
    • Export Citation
  • PonglowhapanSChurchDBKhalidM2008Differences in the expression of luteinizing hormone and follicle stimulating hormone receptors in the lower urinary tract between intact and gonadectomised male and female dogs. Domestic Animal Endocrinology34339351. (doi:10.1016/j.domaniend.2007.09.005)

    • Search Google Scholar
    • Export Citation
  • PontaHShermanLHerrlichPA2003CD44: from adhesion molecules to signalling regulators. Nature Reviews. Molecular Cell Biology43345. (doi:10.1038/nrm1004)

    • Search Google Scholar
    • Export Citation
  • ReckliesADWhiteCMelchingLRoughleyPJ2001Differential regulation and expression of hyaluronan synthases in human articular chondrocytes, synovial cells and osteosarcoma cells. Biochemical Journal3541724. (doi:10.1042/0264-6021:3540017)

    • Search Google Scholar
    • Export Citation
  • RobertsRMBazerFW1988The functions of uterine secretions. Journal of Reproduction and Fertility82875892. (doi:10.1530/jrf.0.0820875)

  • RobinsonRSPushpakumaraPGChengZPetersARAbayasekaraDRWathesDC2002Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction124119131. (doi:10.1530/rep.0.1240119)

    • Search Google Scholar
    • Export Citation
  • SchoenfelderMEinspanierR2003Expression of hyaluronan synthases and corresponding hyaluronan receptors is differentially regulated during oocyte maturation in cattle. Biology of Reproduction69269277. (doi:10.1095/biolreprod.102.011577)

    • Search Google Scholar
    • Export Citation
  • SinghHNardoLKimberSJAplinJD2010Early stages of implantation as revealed by an in vitro model. Reproduction139905914. (doi:10.1530/REP-09-0271)

    • Search Google Scholar
    • Export Citation
  • SlevinMKrupinskiJGaffneyJMatouSWestDDelisserHSavaniRCKumarS2007Hyaluronan-mediated angiogenesis in vascular disease: uncovering RHAMM and CD44 receptor signaling pathways. Matrix Biology265868. (doi:10.1016/j.matbio.2006.08.261)

    • Search Google Scholar
    • Export Citation
  • SpencerTEBazerFW2002Biology of Progesterone action during pregnancy recognition and maintenance of pregnancy. Frontiers in Bioscience718791898. (doi:10.2741/spencer)

    • Search Google Scholar
    • Export Citation
  • SpicerAPMcDonaldJA1998Characterization and molecular evolution of a vertebrate hyaluronan synthase gene family. Journal of Biological Chemistry27319231932. (doi:10.1074/jbc.273.4.1923)

    • Search Google Scholar
    • Export Citation
  • SternR2003Devising a pathway for hyaluronan catabolism: are we there yet?Glycobiology13105R115R. (doi:10.1093/glycob/cwg112)

  • SternR2004Hyaluronan catabolism: a new metabolic pathway. European Journal of Cell Biology83317325. (doi:10.1078/0171-9335-00392)

  • SternRAsariASugaharaK2006Hyaluronan fragments: an information-rich system. European Journal of Cell Biology85699715. (doi:10.1016/j.ejcb.2006.05.009)

    • Search Google Scholar
    • Export Citation
  • StraachKJSheltonJMRichardsonJAHascallVCMahendrooMS2005Regulation of hyaluronan expression during cervical ripening. Glycobiology155565. (doi:10.1093/glycob/cwh137)

    • Search Google Scholar
    • Export Citation
  • SunilNSrinivasanNAruldhasMMGovindarajuluP2000Impact of oestradiol and progesterone on the glycosaminoglycans and their depolymerizing enzymes of the rat mammary gland. Acta Physiologica Scandinavica168385392. (doi:10.1046/j.1365-201x.2000.00675.x)

    • Search Google Scholar
    • Export Citation
  • TammiMIDayAJTurleyEA2002Hyaluronan and homeostasis: a balancing act. Journal of Biological Chemistry27745814584. (doi:10.1074/jbc.R100037200)

    • Search Google Scholar
    • Export Citation
  • TawilESimardRMethotY1973The addition of progesterone to radiotherapy in cancer of the endometrium. Union Medicale du Canada1028384.

  • TellbachMSalamonsenLAVan DammeM-P2002The influence of ovarian steroids on ovine endometrial glycosaminoglycans. Glycoconjugate Journal19385394. (doi:10.1023/B:GLYC.0000004010.24877.2f)

    • Search Google Scholar
    • Export Citation
  • TooleBP2004Hyaluronan: from extracellular glue to pericellular cue. Nature Reviews. Cancer4528539. (doi:10.1038/nrc1391)

  • UchiyamaTSakutaTKanayamaT2005Regulation of hyaluronan synthases in mouse uterine cervix. Biochemical and Biophysical Research Communications327927932. (doi:10.1016/j.bbrc.2004.12.092)

    • Search Google Scholar
    • Export Citation
  • WangYHanifi-MoghaddamPHanekampEEKloosterboerHJFrankenPVeldscholteJvan DoornHCEwingPCKimJJGrootegoedJA2009Progesterone inhibition of Wnt/β-catenin signaling in normal endometrium and endometrial cancer. Clinical Cancer Research1557845793. (doi:10.1158/1078-0432.CCR-09-0814)

    • Search Google Scholar
    • Export Citation
  • WangYZCaoMLLiuYWHeYQYangCXGaoF2011CD44 mediates oligosaccharides of hyaluronan-induced proliferation, tube formation and signal transduction in endothelial cells. Experimental Biology and Medicine2368490. (doi:10.1258/ebm.2010.010206)

    • Search Google Scholar
    • Export Citation
  • WathesDCMannGEPayneJHRileyPRStevensonKRLammingGE1996Regulation of oxytocin, oestradiol and progesterone receptor concentrations in different uterine regions by oestradiol, progesterone and oxytocin in ovariectomized ewes. Journal of Endocrinology151375393. (doi:10.1677/joe.0.1510375)

    • Search Google Scholar
    • Export Citation
  • WathesDCChengZFenwickMAFitzpatrickRPattonJ2011Influence of energy balance on the somatotrophic axis and matrix metalloproteinase expression in the endometrium of the postpartum dairy cow. Reproduction141269281. (doi:10.1530/REP-10-0177)

    • Search Google Scholar
    • Export Citation
  • WeissmannBMeyerKSampsonPLinkerA1954Isolation of oligosaccharides enzymatically produced from hyaluronic acid. Journal of Biological Chemistry208417429.

    • Search Google Scholar
    • Export Citation
  • YoffouPHEdjekouaneLMeunierLTremblayAProvencherDMMes-MassonA-MCarmonaE2011Subtype specific elevated expression of hyaluronidase-1 (HYAL-1) in epithelial ovarian cancer. PLoS ONE6e20705. (doi:10.1371/journal.pone.0020705)

    • Search Google Scholar
    • Export Citation

Cited By

PubMed

Google Scholar