Induction of avian β-defensins by CpG oligodeoxynucleotides and proinflammatory cytokines in hen vaginal cells in vitro

in Reproduction
Authors:
Yuka Sonoda Graduate School of Biosphere Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan and

Search for other papers by Yuka Sonoda in
Current site
Google Scholar
PubMed
Close
,
Ahmad M Abdel Mageed Graduate School of Biosphere Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan and
Graduate School of Biosphere Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan and

Search for other papers by Ahmad M Abdel Mageed in
Current site
Google Scholar
PubMed
Close
,
Naoki Isobe Graduate School of Biosphere Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan and

Search for other papers by Naoki Isobe in
Current site
Google Scholar
PubMed
Close
, and
Yukinori Yoshimura Graduate School of Biosphere Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan and

Search for other papers by Yukinori Yoshimura in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

Immune function in the vagina of hen oviduct is essential to prevent infection by microorganisms colonizing in the cloaca. The aim of this study was to determine whether CpG oligodeoxynucleotides (CpG-ODN) stimulate the expression of avian β-defensins (AvBDs) in hen vaginal cells. Specific questions were whether CpG-ODN affects the expression of AvBDs and proinflammatory cytokines and whether the cytokines affect AvBDs expression in vaginal cells. The dispersed vaginal cells of White Leghorn laying hens were cultured and stimulated by different doses of lipopolysaccharide (LPS), CpG-ODN, interleukin 1β (IL1B), or IL6. The cultured cell population contained epithelial cells, fibroblast-like cells, and CD45-positive leukocytes. The immunoreactive AvBD3, -10, and -12 were localized in the mucosal epithelium in the section of the vagina. The expression of AvBDs, IL1B, and IL6 was analyzed by quantitative RT-PCR. RT-PCR analysis showed the expression of AvBD1, -3, -4, -5, -10, and -12 in the cultured vaginal cells without stimulation. Toll-like receptors (TLRs) 4 and 21, which recognize LPS and CpG-ODN respectively and IL1 and IL6 receptors (IL1R1 and IL6R) were also expressed in them. The expression of IL1B, IL6, and AvBD10 and -12 was upregulated by LPS, whereas only IL1B and IL6 were upregulated by CpG-ODN. IL1B stimulation upregulated AvBD1 and -3 expression, whereas IL6 stimulation did not cause changes in AvBDs expression. These results suggest that CpG-ODN derived from microbes upregulates the expression of IL1B and IL6 by interaction with TLR21 and then IL1B induces AvBD1 and -3 to prevent infection in the vagina.

Abstract

Immune function in the vagina of hen oviduct is essential to prevent infection by microorganisms colonizing in the cloaca. The aim of this study was to determine whether CpG oligodeoxynucleotides (CpG-ODN) stimulate the expression of avian β-defensins (AvBDs) in hen vaginal cells. Specific questions were whether CpG-ODN affects the expression of AvBDs and proinflammatory cytokines and whether the cytokines affect AvBDs expression in vaginal cells. The dispersed vaginal cells of White Leghorn laying hens were cultured and stimulated by different doses of lipopolysaccharide (LPS), CpG-ODN, interleukin 1β (IL1B), or IL6. The cultured cell population contained epithelial cells, fibroblast-like cells, and CD45-positive leukocytes. The immunoreactive AvBD3, -10, and -12 were localized in the mucosal epithelium in the section of the vagina. The expression of AvBDs, IL1B, and IL6 was analyzed by quantitative RT-PCR. RT-PCR analysis showed the expression of AvBD1, -3, -4, -5, -10, and -12 in the cultured vaginal cells without stimulation. Toll-like receptors (TLRs) 4 and 21, which recognize LPS and CpG-ODN respectively and IL1 and IL6 receptors (IL1R1 and IL6R) were also expressed in them. The expression of IL1B, IL6, and AvBD10 and -12 was upregulated by LPS, whereas only IL1B and IL6 were upregulated by CpG-ODN. IL1B stimulation upregulated AvBD1 and -3 expression, whereas IL6 stimulation did not cause changes in AvBDs expression. These results suggest that CpG-ODN derived from microbes upregulates the expression of IL1B and IL6 by interaction with TLR21 and then IL1B induces AvBD1 and -3 to prevent infection in the vagina.

Introduction

In hens, the vagina opens to the cloaca where various microorganisms colonize. The host defense functions of the vagina play essential roles to prevent infection by these microorganisms ascending the oviduct. Toll-like receptors (TLRs) that recognize pathogen-associated molecular patterns initiate innate immune responses. To date, ten TLRs have been identified in chickens (Brownlie & Allan 2011). Among them, TLR4 recognizes lipopolysaccharide (LPS), which is a major component of the outer membrane of Gram-negative bacteria. CpG oligodeoxynucleotide (CpG-ODN) containing unmethylated CpG motifs is conserved in the genomic DNA in bacteria (Krieg et al. 1995, Wagner 1999). The CpG-ODN is recognized by TLR9 in mammals (Hemmi et al. 2000, Bauer et al. 2001), whereas TLR21 acts as a functional homolog to mammalian TLR9 in the recognition of CpG-ODN in chickens (Brownlie et al. 2009). The expression of proinflammatory cytokines, interferon (IFN)γ, and nitric oxide was found to be induced in response to CpG-ODN in mononuclear cells and splenocytes in chickens (He et al. 2003, Patel et al. 2008). However, it is unknown whether an immune response is induced by CpG-ODN in the mucosal tissue of hen vagina.

Defensins, antimicrobial peptides, are cysteine-rich cationic peptides (Selsted & Ouellette 2005). The avian β-defensins (AvBDs) are characterized by six cysteine residues, and 14 AvBDs genes have been identified in chickens (Lynn et al. 2007). They have the potential to kill a wide spectrum of microorganisms, including Gram-positive and Gram-negative bacteria, fungi, and yeasts (Yang et al. 2002, Sugiarto & Yu 2004). Proinflammatory cytokines such as interleukin 1β (IL1B) and IL6 also play important roles in innate and adaptive immune systems and induce inflammatory responses in infected tissue (Staeheli et al. 2001, Ferro et al. 2004). IL1B was shown to enhance the production of immune-related molecules, such as nitric oxide, acute-phase proteins, cytokines, and chemokines (Arend et al. 2008). IL6 has multiple functions, such as stimulation of antibody synthesis by B cells (Okada et al. 1983) and the differentiation of monocytes from dendritic cells to macrophages (Chomarat et al. 2000). We have reported that the injection of birds with LPS enhanced the expression of both AvBDs and proinflammatory cytokines, IL1B and IL6, in the vagina (Abdel Mageed et al. 2008, Nii et al. 2011). In mammals, there are reports that β-defensin expression was upregulated by IL1B in keratinocytes, and in corneal and uterus epithelium (Liu et al. 2002, McDermott et al. 2003, Shin et al. 2004, Pioli et al. 2006). If CpG-ODN was shown to enhance AvBDs expression, this would provide a novel understanding of the process of AvBDs induction in response to bacterial components in the vagina. For further determination of the mechanism by which AvBDs expression is regulated downstream of CpG-ODN stimulation, the role of proinflammatory cytokines that may be expressed by CpG-ODN in AvBDs expression should also be examined.

The aim of this study was to determine whether CpG-ODN leads to an increase in the AvBDs expression in hen vagina. In experiment 1, the effects of LPS and CpG-ODN on the expression of IL1B, IL6, and AvBDs in cultured vaginal cells were examined. This experiment examined whether CpG-ODN induces the expression of AvBDs and proinflammatory cytokines and whether there are differences in the effects of their induction between CpG-ODN and LPS. Then, in experiment 2, the effects of IL1B and IL6 on the AvBDs expression in those cells were examined. The induction of AvBDs by these proinflammatory cytokines was analyzed to know the possibility that CpG-ODN induces the cytokines and then they affect AvBDs expression.

Results

Figure 1 shows the pattern of RT-PCR products of AvBDs, TLR4 and TLR21, and IL1 and IL6 receptors (IL1R1 and IL6R) in vaginal mucosa cells cultured for 24 h. Clear bands of six AvBDs including AvBD1, AvBD35, AvBD10, and AvBD12 were identified (Fig. 1a). Thus, the changes in the expression of these six AvBDs in response to LPS, CpG-ODN, IL1B, and IL6 were examined in experiments 1 and 2. The PCR products of TLR4 and TLR21, and IL1R1 and IL6R, were also identified (Fig. 1b and c). The cultured cell population contained epithelial cells including the cells positive for Alcian blue and Periodic acid-Schiff reaction (AB-PAS), elongated fibroblast-like cells, and CD45-positive leukocytes (Fig. 1d and e). The immunoreaction products for AvBD3, -10, and -12 were identified in the mucosal epithelium in the section of the vagina (Fig. 2a, b, and c), but the negative control staining using normal rabbit IgG did not show any immunoreaction products (Fig. 2d).

Figure 1
Figure 1

Profile of RT-PCR products for 14 avian β-defensins (AvBDs) (a), TLR4 and TLR21 (b), receptors of IL1 and IL6 (IL1R1 and IL6R) (c), and cell type identification (d and e) in the cultured vaginal cells. The PCR products of AvBDs, TLRs, and IL receptors were electrophoresed on 2% agarose gel containing ethidium bromide. M=100 bp DNA size marker. Micrographs of (d) and (e) show the cultured cells stained by Alciam blue (AB) and Periodic acid-Schiff reaction (PAS), and immunostained by anti-CD45 antibody respectively. In the micrograph of (d), AB-positive (short arrows) and PAS-positive (long arrows) epithelial cells and fibroblast-like cells (arrow heads) are observed. In the micrograph of (e), CD45-positive cells are indicated by arrows. Scale bars represent 50 μm.

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

Figure 2
Figure 2

Micrographs of the vagina immunostained for AvBD3, -10, and -12. Immunoreaction products for AvBD3 (a), AvBD10 (b), and AvBD12 (c) are localized in the mucosal epithelium (arrows). Control staining using normal rabbit IgG in place of primary antibodies shows no positive reaction product (d). E, mucosal epithelium; L, lamina propria. Scale bars represent 30 μm.

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

Experiment 1: effects of LPS and CpG-ODN on the expression of IL1B, IL6, and AvBDs in vaginal cells

Figure 3 shows the changes in the expression of IL1B, IL6, and AvBDs in the vaginal cells stimulated by different doses of LPS. The IL1B expression was significantly higher at ∼17-fold in the 102 ng/ml LPS group and was also higher in the 103 and 104 ng/ml LPS groups compared with that in the control (0 ng/ml LPS) (Fig. 3a). The IL6 expression was significantly upregulated by 104 ng/ml LPS (Fig. 3b). The expression of AvBD1, -3, -4, and -5 was not affected by LPS stimulation (Fig. 3c, d, e, and f). However, the expression of AvBD10 was significantly higher at approximately fourfold in the 102 ng/ml LPS group compared with that in the control, but this was not caused by a higher dose of LPS (Fig. 3g). AvBD12 expression was also significantly higher in the 104 ng/ml LPS group than in the control (Fig. 3h).

Figure 3
Figure 3

Changes in the expression of IL1B, IL6, and AvBDs in the cultured vaginal cells in response to different doses of LPS. The cultured vaginal cells were stimulated by 0–104 ng/ml LPS, and the relative expression of IL1B and IL6 (a and b) and AvBD1, 3, 4, 5, 10, and 12 (c, d, e, f, g, and h) was examined by real-time PCR. Values are mean±s.e.m. (n=6). a,b,cThe values with different letters are significantly different (P<0.05).

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

The effects of different doses of CpG-ODN on the expression of IL1B, IL6, and AvBDs are shown in Fig. 4. The expression of IL1B and IL6 was upregulated ∼500- and 8-fold respectively in the 1 and 10 μg/ml CpG-ODN groups (Fig. 4a and b). No significant effects of CpG-ODN on AvBDs expression were identified (Fig. 4c, d, e, f, g, and h).

Figure 4
Figure 4

Changes in the expression of IL1B, IL6, and AvBDs in the cultured vaginal cells in response to different doses of CpG-ODN. The cultured vaginal cells were stimulated by 0–10 μg/ml CpG-ODN, and the relative expression of IL1B and IL6 (a and b) and AvBD1, -3, -4, -5, -10, and -12 (c, d, e, f, g, and h) was examined. Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

Experiment 2: effects of IL1B and IL6 on the expression of AvBDs in vaginal cells

Figure 5 shows the effects of different doses of IL1B on the expression of AvBDs. The expression of AvBD1 was significantly increased ∼2.5-fold by 102 or 103 ng/ml IL1B (Fig. 5a). The AvBD3 expression showed approximately fivefold change due to 103 ng/ml IL1B (Fig. 5b). The expression of AvBD4, -5, -10, and -12 was not changed by IL1B (Fig. 5c, d, e, and f).

Figure 5
Figure 5

Changes in the expression of AvBDs in the cultured vaginal cells in response to different doses of IL1B. The cultured vaginal cells were stimulated by 0–103 ng/ml recombinant chicken IL1B and the relative expression of AvBD1, -3, -4, -5, -10, and -12 was examined (a–f). Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

The effects of IL6 on the AvBDs expression are shown in Fig. 6. The expression of AvBD1, -3, -4, -5, and -10 was not affected by 102 or 103 ng/ml IL6 (Fig. 6a, b, c, d, and e). The AvBD12 expression was significantly higher in the 103 ng/ml IL6 group than in the 102 ng/ml IL6 group, whereas the expression of both groups was not different from that of the control (0 ng/ml IL6 group) (Fig. 6f).

Figure 6
Figure 6

Changes in the expression of AvBDs in the cultured vaginal cells in response to different doses of IL6. The cultured vaginal cells were stimulated by 0–103 ng/ml recombinant chicken IL6, and relative expression of AvBD1, -3, -4, -5, -10, and 12 was examined (a–f). Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

Citation: REPRODUCTION 145, 6; 10.1530/REP-12-0518

Discussion

We report that the expression of proinflammatory cytokines and AvBDs is induced in response to LPS and CpG-ODN in cultured mucosal cells of the vagina and that IL1B also upregulates AvBDs expression. Significant findings were as follows: i) stimulation of the vaginal cells by LPS enhanced the expression of IL1B and IL6 and also AvBD10 and -12, whereas CpG-ODN upregulated only IL1B and IL6. ii) IL1B upregulated the expression of AvBD1 and -3, but IL6 did not show significant effects on AvBDs expression by the vaginal cells. Previous studies revealed that the expression of AvBD15 and AvBD812 was identified in fresh vaginal tissue (Abdel Mageed et al. 2008), whereas the expression of AvBD1, AvBD35, and AvBD9–14 was higher than that of AvBD2 and AvBD68 in cultured oviductal epithelial cells obtained from the isthmus (Ebers et al. 2009). The current study showed clear RT-PCR products of AvBD1, -3, -4, -5, -10, and -12 in the cultured vaginal cells. This result partially supports the findings of Ebers et al. (2009) and suggests that the expression of these six AvBDs in the vaginal cells is maintained even after cell culture for 24 h. The cultured cell population involved the epithelial cells, fibroblast-like cells, and leukocytes expressing CD45, a leukocyte common antigen (Symons et al. 1999). Immunoreactive AvBD3, -10, and -12 were localized in the mucosal epithelium, supporting our previous reports that localized immunoreactive AvBD3, -11, and -12 in the mucosal epithelium of the hen vagina (Yoshimura et al. 2007, Abdel Mageed et al. 2009). Although the cells immunoreactive for AvBD1 have not been examined because of the lack of its antibody, many of the AvBD proteins are likely to exist in the mucosal epithelium in the vagina.

The expression of IL1B and IL6 was upregulated by LPS and CpG-ODN in the vaginal cells (Figs 3 and 4). Previous studies reported that TLR1 type 1, 2–5, 7, 15, and 21 were expressed in chicken vaginal tissues (Ozoe et al. 2009, Michailidis et al. 2011). Among these TLRs, TLR4 recognized LPS, whereas TLR21, an avian-specific TLR, recognized unmethylated CpG motifs as TLR9 in mammals (Brownlie & Allan 2011). The current study further confirmed that TLR4 and 21 expression was detected in cultured vaginal cells (Fig. 1b). These two TLRs play important roles in the defense against Salmonella infection because susceptibility to Salmonella enteritidis is closely related to the responsiveness of three TLRs, namely, TLR4, TLR21, and TLR2 type 1 (Gou et al. 2012). It is likely that the upregulation of IL1B and IL6 expression by LPS is caused by an interaction of LPS with TLR4 in the vaginal cells. The induction of these proinflammatory cytokines by LPS supports the results of our previous in vivo study in the vagina (Ozoe et al. 2009). In addition, it is assumed that the enhancement of IL1B and IL6 expression by CpG-ODN is mediated by TLR21 expressed in the vaginal cells.

The expression of AvBD10 and -12 in the vaginal cells was elevated by exposure of cells to LPS at 102 and 104 ng/ml respectively (Fig. 3). However, the AvBD10 expression was not increased by 103 or 104 ng/ml LPS. Although the reason why higher dose of LPS did not elevate AvBD10 expression is not known, it may be toxic for the vaginal cells, and disturb the expression of some AvBDs. We have observed that expression of AvBD1, -7, and -12 in the ovarian follicles were increased by injection of birds with LPS at 1 mg/kg BW, but not at 2 mg/kg BW, in laying hens (Subedi et al. 2007). In contrast, CpG-ODN did not show any significant effects on AvBDs expression (Fig. 4). In the downstream of TLRs, signal molecules involved in Myd88-dependent or -independent pathways regulate transcriptional factors such as nuclear factor-κB (NFκB) and activator protein 1 (AP1), leading to the initiation of transcription in the nucleus (Riley & Nelson 2010). The release of human β-defensin (hBD) 2 was found to be controlled by phosphoinositide 3 kinase (PI3K) and NFκB, whereas hBD 3 was triggered via the c-Jun N-terminal kinase (JNK)-AP1 pathway in human lung epithelium (Scharf et al. 2012). Different TLRs may modulate different molecules that activate transcriptional factors, such as IFN regulatory factor 3 (IRF3), NFκB, and AP1 (Rhee 2011). Andersen et al. (2006) reported that, in cervical epithelial cells, IL8 expression was upregulated by CpG-DNA or poly(I:C), the ligands of TLR9 and TLR3, respectively, whereas IFNβ and CC chemokine were induced by poly(I:C) but not by CpG-DNA. Thus, it is assumed that the intracellular signaling pathways of LPS and CpG-ODN stimulation for transcriptional regulation of AvBDs and IL1B and IL6 are different. LPS might activate a pathway that induces both AvBD10 and -12 as well as IL1B and IL6, whereas CpG-ODN might activate only the pathway for IL1B and IL6.

The expression of AvBD1 and -3 in the vaginal cells was upregulated by exposure to IL1B but not IL6 (Figs 5 and 6). We have reported that, in the theca of hen ovarian follicles, IL1B enhanced the expression of AvBD12, but IL6 did not show significant effects on its expression (Abdelsalam et al. 2012). In humans, hBD expression was induced in keratinocytes and corneal epithelial cells by IL1B (Liu et al. 2002, McDermott et al. 2003). Harder et al. (2000) reported that IL1B and TNFα, but not IL6, induced hBD 2 in human respiratory epithelia. Thus, IL1B, but not IL6, likely plays a role in the induction of AvBDs in the hen vagina as in other tissues of hens and mammals. In this study, the expression of IL1R1 and IL6R was identified in cultured vaginal cells (Fig. 1c). Thus, it is suggested that IL1B synthesized in response to bacterial components such as LPS and CpG-ODN stimulated AvBD1 and -3 expression in an autocrine and/or paracrine manner by interaction with IL1R1 in the vaginal cells. Exposure of the vaginal cells to LPS increased the expression of AvBD10 and -12 (Fig. 3). The intracellular pathway or transcriptional regulation of AvBDs may differ between IL1B and LPS because they induced different AvBDs; namely, IL1B-induced AvBD1 and -3, whereas LPS-induced AvBD10 and -12.

AvBDs display a wide range of microbicidal or microbiostatic activities against Gram-negative and Gram-positive bacteria as well as fungi (van Dijk et al. 2008). Although it remains unknown whether the target microorganisms differ among the different AvBDs, the defense functions against pathogens may be stronger if different AvBDs are induced when tissue is infected. Thus, the ability of vaginal cells to induce various immune molecules including proinflammatory cytokines and different AvBDs may enable the tissue to form a well-developed defense system. We have confirmed that the injection of laying or molting hens with LPS induced the expression of IL1B, IL6, and CXCLi2 chemokine in association with CD8+ and CD4+T-cell influx, suggesting that a host defense system formed by different immune factors is activated by pathogenic agents in hen vagina (Nii et al. 2011). The cultured mucosal cells of the vagina consisted of different types of cells in this study, and thus some of them are assumed to synthesize proinflammatory cytokines. We assume that immune factors such as IL1B derived from those cells in the vaginal mucosa are responsible for induction of AvBDs.

In conclusion, we suggest that chicken vaginal cells are sensitive to CpG-ODN to induce proinflammatory cytokines, IL1B and IL6, probably through interaction with TLR21. The synthesized IL1B may induce AvBD1 and -3 in the vaginal cells. Stimulation of the tissue by LPS may induce not only proinflammatory cytokines but also AvBD10 and -12. The ability to induce a variety of immune molecules including proinflammatory cytokines and different AvBDs in response to pathogenic agents may enable the vaginal tissue to form a more efficient defense system against bacterial infection.

Materials and Methods

Experimental birds

White Leghorn hens (∼400 days old) laying five or more eggs in a sequence were used. They were kept in individual cages under a lighting regimen of 14 h light:10 h darkness and provided with feed and water ad libitum. They were killed under anesthesia with sodium pentobarbital and the oviducts were collected at 4 h after oviposition. This study was carried out in accordance with the Guidelines for Animal Experimentation, Hiroshima University, Japan.

TLR ligands and recombinant IL1B and IL6

The LPS of Southern Minnesota and synthetic class B CpG-ODN (2007) (CpG-ODN) were purchased from InvivoGen (San Diego, CA, USA), and recombinant chicken IL1B and IL6 were from AbD Serotec (Oxford, UK). The sequence of CpG-ODN was 5′-TCGTCGTTGTCGTTTTGTCGTT-3′ (Patel et al. 2008). The LPS and CpG-ODN were dissolved in endotoxin-free water and kept at −20 °C until use.

Cell culture of vaginal mucosa cells

Mucosal tissues collected from the middle part of the vagina were washed in sterile PBS containing 10 U/ml penicillin and 10 μg/ml streptomycin (Cosmo Bio Co., Ltd., Tokyo, Japan). They were cut into small specimens and incubated with a mixture of 400 U/ml DNase I (Worthington Biochemical Co., Raynham, MA, USA), 320 mg/ml liberase TL (Roche Diagnostics GmbH Co.), and 1600 U/ml hyaluronidase (Nacalai Tesque Co., Kyoto, Japan) in PBS for 30 min at 37 °C on a water bath. After the cells were dispensed by pipetting, they were filtrated through a stainless steel mesh and washed three times using TCM-199 culture medium (Nissui Pharmaceutical Co., Tokyo, Japan) containing 10% bovine serum (Biological Ind., Kibbutz Beit Haemek, Israel), 10 U/ml penicillin, and 10 μg/ml streptomycin (Cosmo Bio Co., Ltd.). The cell viability examined by trypan blue staining was more than 90%. The separated cells were placed on six-well tissue culture plates at a density of 2.5×107 vial cells/well, containing 5 ml TCM-199 culture medium, and incubated in a CO2 incubator with 5% CO2 and 95% air at 37 °C for 24 h. Then, the wells were washed to remove nonadherent and dead cells using TCM-199 culture medium.

A part of separated cell samples were also cultured on sterile cover glasses for 24 h and fixed with 10% (v/v) formalin in PBS or cold acetone. The formalin-fixed cells were stained by AB-PAS to identify the mucosal epithelial cells containing mucopolysaccharide. The cell samples fixed with acetone were used for identification of leukocytes by immunocytochemistry for CD45, a leukocyte common antigen (Symons et al. 1999). They were incubated overnight with mouse anti-chicken CD45 antibody (Southern Biotech, Birmingham, AL, USA) diluted at 1:500 in PBS. Then, they were incubated with biotinylated anti-mouse IgG and avidin–biotin–peroxidase complex in Vecta Stain ABC mouse IgG kit (Vector Lab., Inc., Burlingame, CA, USA) for 30 min and 1 h respectively. Immunoreaction products were visualized by incubating the samples with 0.02% (wt/vol) 3′,3′-diaminobenzidine tetrahydrochloride and 0.005% (vol/vol) H2O2 in 0.05 M Tris–HCl, pH 7.6, (DAB-H2O2). They were dehydrated and mounted. These staining of cultured cells were repeated in duplicate.

Immunohistochemistry for AvBDs

The vaginal tissues of the experimental birds (n=3) were fixed in 10% (v/v) formalin in PBS and processed for paraffin sections (4 μm in thickness) that were air-dried in MAS-coated pre-cleaned slides (Matsunami Glass, Inc., Osaka, Japan). The immunohistochemistry was performed using rabbit antibodies to AvBD3, -10, and -12 for primary antibodies that were used in our previous studies (Abdel Mageed et al. 2009, Abdelsalam et al. 2010). Vecta Stain ABC rabbit IgG kit (Vector Lab., Inc.) was used to identify the immunoreaction products. Briefly, after deparaffinization, antigen retrieval of the sections was performed by autoclaving them for 1 min in 0.1 M citric acid, pH 6.0. They were incubated with blocking solution (1.5% (vol/vol) normal goat serum in PBS) for 1 h at room temperature. Then sections were incubated overnight with antibodies to AvBD3, -10, or -12 diluted at a concentration of 20 μg/ml followed by washing with PBS (3×5 min). The sections were then incubated with biotinylated anti-rabbit IgG and avidin–biotin–peroxidase complex for 1 h each and were washed with PBS. Immunoprecipitates were visualized by incubating the sections with DAB-H2O2. The sections were dehydrated and covered and examined under a light microscope with a Nomarsky filter (Nikon Eclipse E600; Nikon, Tokyo, Japan). Control staining was carried out simultaneously in which the first antibody was replaced with normal rabbit IgG.

Stimulation of cultured cells

In experiment 1, the effects of LPS and CpG-ODN on the expression of proinflammatory cytokines and AvBDs in the vaginal cells were examined. Different doses of LPS (0–104 ng/ml) or CpG-ODN (0–10 μg/ml) were added to the wells containing the cells cultured for 24 h. After 3 h incubation, the expression of IL1B, IL6, and AvBD1, AvBD35, AvBD10, and AvBD12 was examined. We applied incubation for 3 h because the expression of IL1B, IL6, and AvBDs responded to LPS by 3 h in the theca in our previous study (Abdelsalam et al. 2012). In experiment 2, the effects of IL1B and IL6 on the expression of AvBDs were examined. The cultured cells were stimulated by 0–103 ng/ml IL1B or 0–103 ng/ml IL6 for 3 h. In each experiment, trials were repeated six times.

RNA isolation and cDNA preparation

Total RNA was extracted from the cultured vaginal cells using Sepasol RNA I Super (Nacalai Tesque, Inc.) in each experiment as described previously (Nii et al. 2011). The extracted total RNA was dissolved in TE buffer (0.01 M Tris–HCl, pH 8.0, and 1 mM EDTA). Samples were treated with RQ1 RNase-free DNase (Promega Co.) in a 10 μl reaction mixture (0.5 μg of total RNA, 1×DNase buffer, and 1 U DNase) on a PTC-100 programmable thermal controller (MJ Research, Inc., Waltham, MA, USA), programmed at 37 °C for 45 min and 65 °C for 10 min. The concentration of RNA in each sample was measured using Gene Quant Pro (Amersham Pharmacia Biotech). RNA samples were reverse transcribed using ReverTra Ace (Toyobo Co. Ltd., Osaka, Japan) according to the instructions of the manufacturer. The reaction mixture (10 μl) consisted of 0.5 μg of total RNA, 1×RT buffer, 1 mM dNTP mixture, 20 U RNase inhibitor, 0.5 μg oligo(dT) 20 primer, and 50 U ReverTra Ace. The RT was performed at 42 °C for 30 min followed by heat inactivation for 5 min at 99 °C using the PTC-100 Programmable Thermal Controller.

PCR to analyze the expression of AvBDs, TLR4 and TLR21, and IL1R1 and IL6R was performed using Takara Ex Taq (Takara Bio, Inc., Shiga, Japan) according to the protocol of the manufacturer on a PTC-100 Programmable Thermal Controller. The primers for target genes and ribosomal protein S17 (RPS17) used in this study are shown in Table 1. The PCR mixture (25 μl) contained a 0.5 μl aliquot of cDNA, 1×PCR buffer, 1.5 mM MgCl2, 0.2 mM each dNTP, 1.25 U Takara Ex Taq, and 0.5 μM each primer. The cycle parameters were denaturated at 94 °C for 30 s, 30 cycles (for IL1R1 and RPS17), or 40 cycles (AvBD114, TLR4, -21, and IL6R); annealing at 56 °C (for AvBD3, AvBD57, AvBD10, and AvBD14), 58 °C (AvBD1, -2, -8, -9, -11, -12, TLR4, -21, and IL1R1), or 60 °C (AvBD4, -13, IL6R, and RPS17) for 30 s, and extension at 72 °C for 1 min followed by final extension at 72 °C for 6 min. The PCR products were separated by electrophoresis on a 2% (w/v) agarose gel containing 0.4% (w/v) ethidium bromide. Analysis was performed in duplicate using different cultured cell samples.

Table 1

Primer sequences for AvBDs, IL1B, IL6, TLRs, IL1R1, IL6R, and RPS17.

Target genesSequences 5′–3′Accession no.References
AvBD1F: AAACCATGCGGATCGTGTACCTGCAF033335Subedi et al. (2007)
R: CAATGCTAAACTGCACACCTTTA
AvBD2F: GTTCTGTAAAGGAGGGTCCTGCCACAF033336Subedi et al. (2007)
R: ACTCTACAACACAAAACATATTGC
AvBD3F: CTGCCGCTTCCCACACATAGNM_204650Subedi et al. (2007)
R: GCAATGCCAAACTGCACGCCTTTA
AvBD4F: ATCGTGCTCCTCTTTGTGGCAGTTCANM_001001610Subedi et al. (2007)
R: CTACAACCATCTACAGCAAGAATACT
AvBD5F: ATGCAGATCCTGCCTGCCTCTCTCTTTGCTNM_001001608Subedi et al. (2007)
R: TCAGGAATACCATCGGCTCCGGCAGCAGAA
AvBD6F: GATCCTTTACCTGCTGCTGTCTNM_00100193Subedi et al. (2007)
R: TCCTCACACAGCAAGATTTTAGTC
AvBD7F: CTGCTGTCTGTCCTCTTTGTGGNM_001001194Subedi et al. (2007)
R: CATTTGGTAGATGCAGGAAGGA
AvBD8F: TTCTCCTCACTGTGCTCCAANM_001001781Watanabe et al. (2011)
R: AAGGCTCTGGTATGGAGGTG
AvBD9F: ATGAGAATCCTTTTCTTCCTTGTTGCNM_001001611Subedi et al. (2007)
R: TTAGGAGCTGGGTGCCCATTTGCAGC
AvBD10F: CTGTTCTCCTCTTCCTCTTCCAGNM_001001609Subedi et al. (2007)
R: AATCTTGGCACAGCAGTTTAACA
AvBD11F: ACTGCATCCGTTCCAAAGTCTGNM_001001779Ebers et al. (2009)
R: GTCCCAGCTGTTCTTCCAG
AvBD12F: GGAACCTTTGTTTCGTGTTCAAY534898Abdelsalam et al. (2012)
R: GAGAATGACGGGTTCAAAGC
AvBD13F: CATCGTTGTCATTCTCCTCCTCNM_001001780Subedi et al. (2007)
R: ACTTGCAGCGTGTGGGAGTTG
AvBD14F: CATATTCCTCCTGTTTCTTGTTCTCAM402954Watanabe et al. (2011)
R: GCCAGTCCATTGTAGCAGGT
TLR4F: AGTCTGAAATTGCTGAGCTCAAATAY064697Zhang et al. (2012)
R: GCGACGTTAAGCCATGGAAG
TLR21F: TGCCCCTCCCACTGCTGTCCACTNM001030558Zhang et al. (2012)
R: AAAGGTGCCTTGACATCCT
IL1BF: GGGCATCAAGGGCTACAANM_204524Nii et al. (2011)
R: CTGTCCAGGCGGTAGAAGAT
IL6F: AGAAATCCCTCCTCGCCAATNM_204628.1Nii et al. (2011)
R: AAATAGCGAACGGCCCTCA
IL1R1F: TTGTTCAGTGCTGAAGAATGTGTTATTTGNM_205485*
R: ACGAATGTTCTGAACTGGGTGTTC
IL6RF: TGAGGATGATCCCTACGGCTATGNM_001044675*
R: CCGGCATCATCAGCAGTGT
RPS17F: AAGCTGCAGGAGGAGGAGAGGNM_204217Nii et al. (2011)
R: GGTTGGACAGGCTGCCGAAGT

F, forward; R, reverse. *PCR products were sequenced for verification.

Quantitative real-time PCR

Real-time PCR was performed using the Roche Light Cycler system (Roche Applied Science) as described in our previous study (Abdelsalam et al. 2012). The reaction mixture (20 μl) consisting of 1 μl cDNA, 1×SYBR Premix EX Taq (Takara Bio, Inc.), and 0.5 μM each primer was placed into 20 μl capillaries (Roche Diagnostics GmbH). The thermal protocols for PCR were at 95 °C for 5 s; 60 °C for 20 s (AvBD10 and RPS17), 60 °C for 30 s (AvBD1 and AvBD4), or 63 °C for 30 s (AvBD3, -5, and -12) and then 72 °C for 1 min (AvBD1, AvBD3–5, and AvBD12). Real-time PCR data were analyzed using the 2△△CT method to calculate the relative level of mRNA in each sample and are expressed as ratios in relation to the RPS17 housekeeping gene (Livak & Schmittgen 2001). The RNA samples obtained from unstimulated cells were used as standards.

Statistical analysis

The relative expression of IL1B, IL6, and AvBD1, AvBD3–5, AvBD10, and AvBD12 is expressed as the mean±s.e.m. (n=6). The significance of differences in the relative expression among different dose groups within LPS, CpG-ODN, IL1B, or IL6 treatments was examined by one-way ANOVA followed by Tukey's test or the Kruskal–Wallis test. Differences were considered significant at P<0.05.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science.

References

  • Abdel Mageed AM, Isobe N & Yoshimura Y 2008 Expression of avian β-defensins in the oviduct and effects of lipopolysaccharide on their expression in the vagina of hens. Poultry Science 87 979984. (doi:10.3382/ps.2007-00283)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdel Mageed AM, Isobe N & Yoshimura Y 2009 Immunolocalization of avian β-defensins in the hen oviduct and their changes in the uterus during eggshell formation. Reproduction 138 971978. (doi:10.1530/REP-09-0181)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdelsalam M, Isobe N & Yoshimura Y 2010 Changes in the localization of immunoreactive avian β-defensins -8, -10 and -12 in hen ovarian follicles during follicular growth. Journal of Poultry Science 47 7784. (doi:10.2141/jpsa.009083)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdelsalam M, Isobe N & Yoshimura Y 2012 Effects of lipopolysaccharide and interleukins on the expression of avian β-defensins in hen ovarian follicular tissue. Poultry Science 91 28772884. (doi:10.3382/ps.2012-02312)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Andersen JM, Al-Khairy D & Ingalls RR 2006 Innate immunity at the mucosal surface: role of Toll-like receptor 3 and Toll-like receptor 9 in cervical epithelial cell responses to microbial pathogens. Biology of Reproduction 74 824831. (doi:10.1095/biolreprod.105.048629)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Arend WP, Palmer G & Gabay C 2008 IL-1, IL-18, and IL-33 families of cytokines. Immunological Reviews 223 2038. (doi:10.1111/j.1600-065X.2008.00624.x)

  • Bauer S, Kirschning CJ, Hächer H, Redecke V, Hausmann S, Akira S, Wagner H & Lipford GB 2001 Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98 92379242. (doi:10.1073/pnas.161293498)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brownlie R & Allan B 2011 Avian Toll-like receptors. Cell and Tissue Research 343 121130. (doi:10.1007/s00441-010-1026-0)

  • Brownlie R, Zhu J, Allan B, Mutwiri GK, Babiuk LA, Potter A & Griebel P 2009 Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Molecular Immunology 46 31633170. (doi:10.1016/j.molimm.2009.06.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chomarat P, Banchereau J, Davoust J & Palucka AK 2000 IL-6 switches the differentiation of monocytes from dendritic cells to macrophages. Nature Immunology 1 510514. (doi:10.1038/82763)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ebers KL, Zhang CY, Zhang MZ, Bailey RH & Zhang S 2009 Transcriptional profiling avian β-defensins in chicken oviduct epithelial cells before and after infection with Salmonella enterica serovar Enteritidis. BMC Microbiology 9 153. (doi:10.1186/1471-2180-9-153)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ferro PJ, Swaggerty CL, Kaiser P, Pevzner IY & Kogut MH 2004 Heterophils isolated from chickens resistant to extraintestinal Salmonella enteritidis infection express higher levels of proinflattatory cytokine mRNA following infection than heterophils from susceptibla chickens. Epidemiology and Infection 132 10291037. (doi:10.1017/S0950268804002687)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gou Z, Liu R, Zhao G, Zheng M, Li P, Wang H, Zhu Y, Chen J & Wen J 2012 Epigenetic modification of TLRs in leukocytes is associated with increased susceptibility to Salmonella enteritidis in chickens. PLoS ONE 7 e33627. (doi:10.1371/journal.pone.0033627)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S & Schröder JM 2000 Mucoid Pseudomonas aeruginosa, TNF-α, and IL-1β, but not IL-6, induce human β-defensin 2 in respiratory epithelia. American Journal of Respiratory Cell and Molecular Biology 22 714721. (doi:10.1165/ajrcmb.22.6.4023)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • He H, Crippen TL, Farnell MB & Kogut MH 2003 Identification of CpG oligodeoxynucleotide motifs that stimulate nitric oxide and cytokine production in avian macrophage and peripheral blood mononuclear cells. Developmental and Comparative Immunology 27 621627. (doi:10.1016/S0145-305X(03)00013-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hemmi H, Takeushi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H & Takeda K et al. 2000 Toll-like receptor recognizes bacterial DNA. Nature 408 740745. (doi:10.1038/35047123)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA & Klinman DM 1995 CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374 546549. (doi:10.1038/374546a0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu AY, Destoumieux D, Wong AV, Park CH, Valore EV, Liu L & Ganz T 2002 Human β-defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. Journal of Investigative Dermatology 118 275281. (doi:10.1046/j.0022-202x.2001.01651.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25 402408. (doi:10.1006/meth.2001.1262)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lynn DJ, Higgs R, Lloyd AT, O'Farrelly C, Hervé-Grépinet V, Nys Y, Brinkman FS, Yu PL, Soulier A & Kaiser P et al. 2007 Avian β-defensin nomenclature: a community proposed update. Immunology Letters 220 8689. (doi:10.1016/j.imlet.2007.03.007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • McDermott AM, Redfern RL, Zhang B, Pei Y, Huang L & Proske RJ 2003 Defensin expression by the cornea: multiple signalling pathways mediate IL-1β stimulation of hBD-2 expression by human corneal epithelial cells. Investigative Ophthalmology & Visual Science 44 18591865. (doi:10.1167/iovs.02-0787)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Michailidis G, Theodoridis A & Avdi M 2011 Effects of sexual maturation and Salmonella infection on the expression of Toll-like receptors in the chicken vagina. Animal Reproduction Science 123 2342341. (doi:10.1016/j.anireprosci.2011.01.010)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nii T, Sonoda Y, Isobe N & Yoshimura Y 2011 Effects of lipopolysaccharide on the expression of proinflammatory cytokines and chemokines and the subsequent recruitment of immunocompetent cells in the oviduct of laying and molting hens. Poultry Science 90 23322341. (doi:10.3382/ps.2011-01596)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Okada M, Sakaguchi N, Yoshimura N, Hara H, Shimizu K, Yoshida N, Yoshizaki K, Kishimoto S, Yamamura Y & Kishimoto T 1983 B cell growth factors and B cell differentiation factor from human T hybridomas. Two distinct kinds of B cell growth factor and their synergism in B cell proliferation. Journal of Experimental Medicine 157 583590. (doi:10.1084/jem.157.2.583)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ozoe A, Isobe N & Yoshimura Y 2009 Expression of Toll-like receptors (TLRs) and TLR4 response to lipopolysaccharide in hen oviduct. Veterinary Immunology and Immunopathology 127 259268. (doi:10.1016/j.vetimm.2008.10.325)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Patel BA, Gomis S, Dar A, Willson PJ, Babiuk LA, Potter A, Mutwiri G & Tikoo SK 2008 Oligodeoxynucleotides containing CpG motifs (CpG-ODN) predominantly induce Th1-type immune response in neonatal chicks. Developmental and Comparative Immunology 32 10411049. (doi:10.1016/j.dci.2008.02.007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pioli PA, Weaver LK, Schaefer TM, Wright JA, Wira CR & Guyre PM 2006 Lipopolysaccharide-induced IL-1β production by human uterine macrophages up-regulates uterine epithelial cell expression of human β-defensin 2. Journal of Immunology 176 66476655.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rhee SH 2011 Basic and translational understandings of microbial recognition by Toll-like receptors in the intestine. Journal of Neurogastroenterology and Motility 17 2834. (doi:10.5056/jnm.2011.17.1.28)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Riley JK & Nelson DM 2010 Toll-like receptors in pregnancy disorders and placental dysfunction. Clinical Reviews in Allergy & Immunology 39 185193. (doi:10.1007/s12016-009-8178-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scharf S, Zahlten J, Szymanski K, Hippenstiel S, Suttorp N & N'Guessan PD 2012 Streptococcus pneumoniae induces human β-defensin-2 and -3 in human lung epithelium. Experimental Lung Research 38 100110. (doi:10.3109/01902148.2011.652802)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Selsted ME & Ouellette AJ 2005 Mammalian defensins in the antimicrobial immune response. Nature Immunology 6 551557. (doi:10.1038/ni1206)

  • Shin JS, Kim CW, Kwon YS & Kim JC 2004 Human β-defensin 2 is induced by interleukin-1β in the corneal epithelial cells. Experimental & Molecular Medicine 36 204210. (doi:10.1038/emm.2004.28)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Staeheli P, Puehler F, Schneider K, Göbel TW & Kaspers B 2001 Cytokines of birds: conserved function-A largely different look. Journal of Interferon & Cytokine Research 21 9931010. (doi:10.1089/107999001317205123)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Subedi K, Isobe N, Nishibori M & Yoshimura Y 2007 Changes in the expression of gallinacins, antimicrobial peptides, in ovarian follicles during follicular growth and in response to lipopolysaccharide in laying hens (Gallus domesticus). Reproduction 133 127133. (doi:10.1530/REP-06-0083)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sugiarto H & Yu PL 2004 Avian antimicrobial peptides: the defensing role of β-defensins. Biochemical and Biophysical Research Communications 323 721727. (doi:10.1016/j.bbrc.2004.08.162)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Symons A, Willis AC & Barclay AN 1999 Domain organization of the extracellular region of CD45. Protein Engineering 12 885892. (doi:10.1093/protein/12.10.885)

  • Van Dijk A, Veldhuizen EJ & Haagsman HP 2008 Avian defensins. Veterinary Immunology and Immunopathology 124 118. (doi:10.1016/j.vetimm.2007.12.006)

  • Wagner H 1999 Bacterial CpG DNA activates immune cells to signal infectious danger. Advance Immunology 73 329368.

  • Watanabe Y, Isobe N & Yoshimura Y 2011 Detection of avian β-defensins mRNA and proteins in male reproductive organs in chicken. Journal of Poultry Science 48 275280. (doi:10.2141/jpsa.011042)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang D, Biragyn A, Kwak LW & Oppenheim JJ 2002 Mammalian defensins in immunity. More than just microbicidal. Trends in Immunology 23 291296. (doi:10.1016/S1471-4906(02)02246-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yoshimura Y, Tsuchida M, Nakamura J, Saito T, Isobe N & Iijima N 2007 Preparation and application for immunocytochemistry of antibody to gallinacin-3, an antimicrobial peptide, in chicken. Journal of Poultry Science 44 433438. (doi:10.2141/jpsa.44.433)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang M, Nii T, Isobe N & Yoshimura Y 2012 Expression of Toll-like receptors and effects of lipopolysaccharide on the expression of proinflammatory cytokines and chemokine in the testis and epididymis of roosters. Poultry Science 91 19972003. (doi:10.3382/ps.2012-02236)

    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Profile of RT-PCR products for 14 avian β-defensins (AvBDs) (a), TLR4 and TLR21 (b), receptors of IL1 and IL6 (IL1R1 and IL6R) (c), and cell type identification (d and e) in the cultured vaginal cells. The PCR products of AvBDs, TLRs, and IL receptors were electrophoresed on 2% agarose gel containing ethidium bromide. M=100 bp DNA size marker. Micrographs of (d) and (e) show the cultured cells stained by Alciam blue (AB) and Periodic acid-Schiff reaction (PAS), and immunostained by anti-CD45 antibody respectively. In the micrograph of (d), AB-positive (short arrows) and PAS-positive (long arrows) epithelial cells and fibroblast-like cells (arrow heads) are observed. In the micrograph of (e), CD45-positive cells are indicated by arrows. Scale bars represent 50 μm.

  • Micrographs of the vagina immunostained for AvBD3, -10, and -12. Immunoreaction products for AvBD3 (a), AvBD10 (b), and AvBD12 (c) are localized in the mucosal epithelium (arrows). Control staining using normal rabbit IgG in place of primary antibodies shows no positive reaction product (d). E, mucosal epithelium; L, lamina propria. Scale bars represent 30 μm.

  • Changes in the expression of IL1B, IL6, and AvBDs in the cultured vaginal cells in response to different doses of LPS. The cultured vaginal cells were stimulated by 0–104 ng/ml LPS, and the relative expression of IL1B and IL6 (a and b) and AvBD1, 3, 4, 5, 10, and 12 (c, d, e, f, g, and h) was examined by real-time PCR. Values are mean±s.e.m. (n=6). a,b,cThe values with different letters are significantly different (P<0.05).

  • Changes in the expression of IL1B, IL6, and AvBDs in the cultured vaginal cells in response to different doses of CpG-ODN. The cultured vaginal cells were stimulated by 0–10 μg/ml CpG-ODN, and the relative expression of IL1B and IL6 (a and b) and AvBD1, -3, -4, -5, -10, and -12 (c, d, e, f, g, and h) was examined. Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

  • Changes in the expression of AvBDs in the cultured vaginal cells in response to different doses of IL1B. The cultured vaginal cells were stimulated by 0–103 ng/ml recombinant chicken IL1B and the relative expression of AvBD1, -3, -4, -5, -10, and -12 was examined (a–f). Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

  • Changes in the expression of AvBDs in the cultured vaginal cells in response to different doses of IL6. The cultured vaginal cells were stimulated by 0–103 ng/ml recombinant chicken IL6, and relative expression of AvBD1, -3, -4, -5, -10, and 12 was examined (a–f). Values are mean±s.e.m. (n=6). a,bThe values with different letters are significantly different (P<0.05).

  • Abdel Mageed AM, Isobe N & Yoshimura Y 2008 Expression of avian β-defensins in the oviduct and effects of lipopolysaccharide on their expression in the vagina of hens. Poultry Science 87 979984. (doi:10.3382/ps.2007-00283)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdel Mageed AM, Isobe N & Yoshimura Y 2009 Immunolocalization of avian β-defensins in the hen oviduct and their changes in the uterus during eggshell formation. Reproduction 138 971978. (doi:10.1530/REP-09-0181)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdelsalam M, Isobe N & Yoshimura Y 2010 Changes in the localization of immunoreactive avian β-defensins -8, -10 and -12 in hen ovarian follicles during follicular growth. Journal of Poultry Science 47 7784. (doi:10.2141/jpsa.009083)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Abdelsalam M, Isobe N & Yoshimura Y 2012 Effects of lipopolysaccharide and interleukins on the expression of avian β-defensins in hen ovarian follicular tissue. Poultry Science 91 28772884. (doi:10.3382/ps.2012-02312)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Andersen JM, Al-Khairy D & Ingalls RR 2006 Innate immunity at the mucosal surface: role of Toll-like receptor 3 and Toll-like receptor 9 in cervical epithelial cell responses to microbial pathogens. Biology of Reproduction 74 824831. (doi:10.1095/biolreprod.105.048629)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Arend WP, Palmer G & Gabay C 2008 IL-1, IL-18, and IL-33 families of cytokines. Immunological Reviews 223 2038. (doi:10.1111/j.1600-065X.2008.00624.x)

  • Bauer S, Kirschning CJ, Hächer H, Redecke V, Hausmann S, Akira S, Wagner H & Lipford GB 2001 Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98 92379242. (doi:10.1073/pnas.161293498)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brownlie R & Allan B 2011 Avian Toll-like receptors. Cell and Tissue Research 343 121130. (doi:10.1007/s00441-010-1026-0)

  • Brownlie R, Zhu J, Allan B, Mutwiri GK, Babiuk LA, Potter A & Griebel P 2009 Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Molecular Immunology 46 31633170. (doi:10.1016/j.molimm.2009.06.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chomarat P, Banchereau J, Davoust J & Palucka AK 2000 IL-6 switches the differentiation of monocytes from dendritic cells to macrophages. Nature Immunology 1 510514. (doi:10.1038/82763)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ebers KL, Zhang CY, Zhang MZ, Bailey RH & Zhang S 2009 Transcriptional profiling avian β-defensins in chicken oviduct epithelial cells before and after infection with Salmonella enterica serovar Enteritidis. BMC Microbiology 9 153. (doi:10.1186/1471-2180-9-153)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ferro PJ, Swaggerty CL, Kaiser P, Pevzner IY & Kogut MH 2004 Heterophils isolated from chickens resistant to extraintestinal Salmonella enteritidis infection express higher levels of proinflattatory cytokine mRNA following infection than heterophils from susceptibla chickens. Epidemiology and Infection 132 10291037. (doi:10.1017/S0950268804002687)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gou Z, Liu R, Zhao G, Zheng M, Li P, Wang H, Zhu Y, Chen J & Wen J 2012 Epigenetic modification of TLRs in leukocytes is associated with increased susceptibility to Salmonella enteritidis in chickens. PLoS ONE 7 e33627. (doi:10.1371/journal.pone.0033627)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S & Schröder JM 2000 Mucoid Pseudomonas aeruginosa, TNF-α, and IL-1β, but not IL-6, induce human β-defensin 2 in respiratory epithelia. American Journal of Respiratory Cell and Molecular Biology 22 714721. (doi:10.1165/ajrcmb.22.6.4023)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • He H, Crippen TL, Farnell MB & Kogut MH 2003 Identification of CpG oligodeoxynucleotide motifs that stimulate nitric oxide and cytokine production in avian macrophage and peripheral blood mononuclear cells. Developmental and Comparative Immunology 27 621627. (doi:10.1016/S0145-305X(03)00013-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hemmi H, Takeushi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H & Takeda K et al. 2000 Toll-like receptor recognizes bacterial DNA. Nature 408 740745. (doi:10.1038/35047123)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA & Klinman DM 1995 CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374 546549. (doi:10.1038/374546a0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu AY, Destoumieux D, Wong AV, Park CH, Valore EV, Liu L & Ganz T 2002 Human β-defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. Journal of Investigative Dermatology 118 275281. (doi:10.1046/j.0022-202x.2001.01651.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25 402408. (doi:10.1006/meth.2001.1262)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lynn DJ, Higgs R, Lloyd AT, O'Farrelly C, Hervé-Grépinet V, Nys Y, Brinkman FS, Yu PL, Soulier A & Kaiser P et al. 2007 Avian β-defensin nomenclature: a community proposed update. Immunology Letters 220 8689. (doi:10.1016/j.imlet.2007.03.007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • McDermott AM, Redfern RL, Zhang B, Pei Y, Huang L & Proske RJ 2003 Defensin expression by the cornea: multiple signalling pathways mediate IL-1β stimulation of hBD-2 expression by human corneal epithelial cells. Investigative Ophthalmology & Visual Science 44 18591865. (doi:10.1167/iovs.02-0787)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Michailidis G, Theodoridis A & Avdi M 2011 Effects of sexual maturation and Salmonella infection on the expression of Toll-like receptors in the chicken vagina. Animal Reproduction Science 123 2342341. (doi:10.1016/j.anireprosci.2011.01.010)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nii T, Sonoda Y, Isobe N & Yoshimura Y 2011 Effects of lipopolysaccharide on the expression of proinflammatory cytokines and chemokines and the subsequent recruitment of immunocompetent cells in the oviduct of laying and molting hens. Poultry Science 90 23322341. (doi:10.3382/ps.2011-01596)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Okada M, Sakaguchi N, Yoshimura N, Hara H, Shimizu K, Yoshida N, Yoshizaki K, Kishimoto S, Yamamura Y & Kishimoto T 1983 B cell growth factors and B cell differentiation factor from human T hybridomas. Two distinct kinds of B cell growth factor and their synergism in B cell proliferation. Journal of Experimental Medicine 157 583590. (doi:10.1084/jem.157.2.583)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ozoe A, Isobe N & Yoshimura Y 2009 Expression of Toll-like receptors (TLRs) and TLR4 response to lipopolysaccharide in hen oviduct. Veterinary Immunology and Immunopathology 127 259268. (doi:10.1016/j.vetimm.2008.10.325)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Patel BA, Gomis S, Dar A, Willson PJ, Babiuk LA, Potter A, Mutwiri G & Tikoo SK 2008 Oligodeoxynucleotides containing CpG motifs (CpG-ODN) predominantly induce Th1-type immune response in neonatal chicks. Developmental and Comparative Immunology 32 10411049. (doi:10.1016/j.dci.2008.02.007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pioli PA, Weaver LK, Schaefer TM, Wright JA, Wira CR & Guyre PM 2006 Lipopolysaccharide-induced IL-1β production by human uterine macrophages up-regulates uterine epithelial cell expression of human β-defensin 2. Journal of Immunology 176 66476655.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rhee SH 2011 Basic and translational understandings of microbial recognition by Toll-like receptors in the intestine. Journal of Neurogastroenterology and Motility 17 2834. (doi:10.5056/jnm.2011.17.1.28)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Riley JK & Nelson DM 2010 Toll-like receptors in pregnancy disorders and placental dysfunction. Clinical Reviews in Allergy & Immunology 39 185193. (doi:10.1007/s12016-009-8178-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scharf S, Zahlten J, Szymanski K, Hippenstiel S, Suttorp N & N'Guessan PD 2012 Streptococcus pneumoniae induces human β-defensin-2 and -3 in human lung epithelium. Experimental Lung Research 38 100110. (doi:10.3109/01902148.2011.652802)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Selsted ME & Ouellette AJ 2005 Mammalian defensins in the antimicrobial immune response. Nature Immunology 6 551557. (doi:10.1038/ni1206)

  • Shin JS, Kim CW, Kwon YS & Kim JC 2004 Human β-defensin 2 is induced by interleukin-1β in the corneal epithelial cells. Experimental & Molecular Medicine 36 204210. (doi:10.1038/emm.2004.28)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Staeheli P, Puehler F, Schneider K, Göbel TW & Kaspers B 2001 Cytokines of birds: conserved function-A largely different look. Journal of Interferon & Cytokine Research 21 9931010. (doi:10.1089/107999001317205123)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Subedi K, Isobe N, Nishibori M & Yoshimura Y 2007 Changes in the expression of gallinacins, antimicrobial peptides, in ovarian follicles during follicular growth and in response to lipopolysaccharide in laying hens (Gallus domesticus). Reproduction 133 127133. (doi:10.1530/REP-06-0083)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sugiarto H & Yu PL 2004 Avian antimicrobial peptides: the defensing role of β-defensins. Biochemical and Biophysical Research Communications 323 721727. (doi:10.1016/j.bbrc.2004.08.162)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Symons A, Willis AC & Barclay AN 1999 Domain organization of the extracellular region of CD45. Protein Engineering 12 885892. (doi:10.1093/protein/12.10.885)

  • Van Dijk A, Veldhuizen EJ & Haagsman HP 2008 Avian defensins. Veterinary Immunology and Immunopathology 124 118. (doi:10.1016/j.vetimm.2007.12.006)

  • Wagner H 1999 Bacterial CpG DNA activates immune cells to signal infectious danger. Advance Immunology 73 329368.

  • Watanabe Y, Isobe N & Yoshimura Y 2011 Detection of avian β-defensins mRNA and proteins in male reproductive organs in chicken. Journal of Poultry Science 48 275280. (doi:10.2141/jpsa.011042)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang D, Biragyn A, Kwak LW & Oppenheim JJ 2002 Mammalian defensins in immunity. More than just microbicidal. Trends in Immunology 23 291296. (doi:10.1016/S1471-4906(02)02246-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yoshimura Y, Tsuchida M, Nakamura J, Saito T, Isobe N & Iijima N 2007 Preparation and application for immunocytochemistry of antibody to gallinacin-3, an antimicrobial peptide, in chicken. Journal of Poultry Science 44 433438. (doi:10.2141/jpsa.44.433)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang M, Nii T, Isobe N & Yoshimura Y 2012 Expression of Toll-like receptors and effects of lipopolysaccharide on the expression of proinflammatory cytokines and chemokine in the testis and epididymis of roosters. Poultry Science 91 19972003. (doi:10.3382/ps.2012-02236)

    • PubMed
    • Search Google Scholar
    • Export Citation