SMAD7 antagonizes key TGFβ superfamily signaling in mouse granulosa cells in vitro

in Reproduction

Transforming growth factor β (TGFβ) superfamily signaling is essential for female reproduction. Dysregulation of the TGFβ signaling pathway can cause reproductive diseases. SMA and MAD (mothers against decapentaplegic) (SMAD) proteins are downstream signaling transducers of the TGFβ superfamily. SMAD7 is an inhibitory SMAD that regulates TGFβ signaling in vitro. However, the function of SMAD7 in the ovary remains poorly defined. To determine the signaling preference and potential role of SMAD7 in the ovary, we herein examined the expression, regulation, and function of SMAD7 in mouse granulosa cells. We showed that SMAD7 was expressed in granulosa cells and subject to regulation by intraovarian growth factors from the TGFβ superfamily. TGFB1 (TGFβ1), bone morphogenetic protein 4, and oocyte-derived growth differentiation factor 9 (GDF9) were capable of inducing Smad7 expression, suggesting a modulatory role of SMAD7 in a negative feedback loop. Using a small interfering RNA approach, we further demonstrated that SMAD7 was a negative regulator of TGFB1. Moreover, we revealed a link between SMAD7 and GDF9-mediated oocyte paracrine signaling, an essential component of oocyte–granulosa cell communication and folliculogenesis. Collectively, our results suggest that SMAD7 may function during follicular development via preferentially antagonizing and/or fine-tuning essential TGFβ superfamily signaling, which is involved in the regulation of oocyte–somatic cell interaction and granulosa cell function.

Abstract

Transforming growth factor β (TGFβ) superfamily signaling is essential for female reproduction. Dysregulation of the TGFβ signaling pathway can cause reproductive diseases. SMA and MAD (mothers against decapentaplegic) (SMAD) proteins are downstream signaling transducers of the TGFβ superfamily. SMAD7 is an inhibitory SMAD that regulates TGFβ signaling in vitro. However, the function of SMAD7 in the ovary remains poorly defined. To determine the signaling preference and potential role of SMAD7 in the ovary, we herein examined the expression, regulation, and function of SMAD7 in mouse granulosa cells. We showed that SMAD7 was expressed in granulosa cells and subject to regulation by intraovarian growth factors from the TGFβ superfamily. TGFB1 (TGFβ1), bone morphogenetic protein 4, and oocyte-derived growth differentiation factor 9 (GDF9) were capable of inducing Smad7 expression, suggesting a modulatory role of SMAD7 in a negative feedback loop. Using a small interfering RNA approach, we further demonstrated that SMAD7 was a negative regulator of TGFB1. Moreover, we revealed a link between SMAD7 and GDF9-mediated oocyte paracrine signaling, an essential component of oocyte–granulosa cell communication and folliculogenesis. Collectively, our results suggest that SMAD7 may function during follicular development via preferentially antagonizing and/or fine-tuning essential TGFβ superfamily signaling, which is involved in the regulation of oocyte–somatic cell interaction and granulosa cell function.

Introduction

The transforming growth factor β (TGFβ) superfamily, one of the largest and most important growth factor families in mammals, is implicated in the regulation of a wide spectrum of reproductive events (Dong et al. 1996, Hayashi et al. 1999, Galloway et al. 2000, Juengel & McNatty 2005, Diaz et al. 2007, Dragovic et al. 2007, Lee et al. 2007, Li et al. 2008b, Gong & McGee 2009). Accumulating evidence suggests that TGFβ signaling is indispensable for female reproduction (Chang et al. 2002, Edson et al. 2009). Disruption of TGFβ signaling results in reproductive disorders and cancer development (Matzuk et al. 1992, Li et al. 2007, Pangas et al. 2008, Middlebrook et al. 2009).

To initiate signal transduction and elicit cellular responses, TGFβ ligands bind to their type 2 and type 1 receptors and activate intracellular SMA and MAD (mothers against decapentaplegic) SMAD proteins. Activation of SMAD2/3 or SMAD1/5/8 is generally associated with the respective TGFβ/activin signaling and bone morphogenetic protein (BMP) signaling (Chang et al. 2002). SMAD proteins are intracellular components of the TGFβ signaling pathway. In mammalian species, eight SMAD proteins have been identified and are classified into receptor-regulated SMADs (SMAD1, 2, 3, 5, and 8), the common SMAD (SMAD4), and inhibitory SMADs (SMAD6 and SMAD7).

Expression of SMADs in the ovary has been documented. In rats, SMAD2 and SMAD3 are strongly localized to the granulosa cells of preantral and small antral follicles. However, expression of SMAD2 and SMAD3 is low in large antral follicles (Xu et al. 2002). Phospho-SMAD2 (pSMAD2) is present in mouse granulosa cells of small and medium preantral follicles. Expression of pSMAD2, pSMAD3, and pSMAD1/5/8 is more uniform or stronger in the cumulus cells than in the mural granulosa cells (Tian et al. 2010), which suggests the involvement of oocyte paracrine factors in the regulation of SMADs. A recent study showed that SMAD6 is mainly localized to the oocyte, while SMAD7 is expressed in oocytes and granulosa cells from preantral and antral follicles (Quezada et al. 2012). In addition, a number of SMADs, including SMAD4, are expressed in the oocyte (Xu et al. 2002, Pangas et al. 2006, Tian et al. 2010, Quezada et al. 2012). The aforementioned studies point to a likely role of SMADs in folliculogenesis and/or oocyte development. However, the specific functions of these SMADs in the ovary remained elusive until cell-specific knockout mice for SMADs were generated. Conditional ablation of Smad1 and Smad5 in ovarian granulosa cells leads to the development of metastatic granulosa cell tumors, which resemble human juvenile granulosa cell tumors (Pangas et al. 2008, Middlebrook et al. 2009). Thus, SMAD1 and SMAD5 act as tumor suppressors in the ovary. Mechanistically, tumor development is at least partially associated with the upregulation of platelet-derived growth factor alpha (PDGFA), which is controlled by SMAD1/5 and the trans-acting transcription factor 1 (SP1) (Tripurani et al. 2012). In contrast to SMAD1 and SMAD5, conditional deletion of Smad2 and Smad3 in granulosa cells causes fertility disorders including reduced ovulation and cumulus cell expansion. These defects are partially caused by the disruption of oocyte paracrine signaling that is mediated by growth differentiation factor 9 (GDF9) and its target genes associated with cumulus expansion (Li et al. 2008b). SMAD3 was reported to be required for normal follicle growth and ovarian cell differentiation and response to FSH when a different targeting construct was utilized (Tomic et al. 2002, Gong & McGee 2009). Interestingly, disruption of the signaling of the common SMAD, SMAD4, in ovarian granulosa cells results in subfertility and premature luteinization of granulosa cells, which is accompanied by defects in cumulus cell expansion and ovulation (Pangas et al. 2006). However, oocyte-specific knockout of Smad4 only causes a slight reduction in litter size, challenging a major role for TGFβ signaling in female germ cells (Li et al. 2012).

Despite the well-characterized functions of receptor-regulated SMADs and the common SMAD in the ovary, the role of inhibitory SMADs in female reproduction remains poorly defined. It has been suggested that SMAD6 preferentially inhibits BMP signaling (Hata et al. 1998, Ishisaki et al. 1999), whereas SMAD7 is capable of targeting TGFβ or both TGFβ and BMP pathways (Nakao et al. 1997, Souchelnytskyi et al. 1998, Ishisaki et al. 1999). The functions of inhibitory SMADs are being revealed by knockout mouse models. The Smad6 mutant mice showed partial lethality due to cardiovascular abnormalities (Galvin et al. 2000). In contrast, Smad7 knockout mice demonstrated variable phenotypes ranging from defective B cell response to renal fibrosis (Li et al. 2006, Chung et al. 2009, Chen et al. 2011), impaired cardiac functions (Chen et al. 2009), growth retardation, and a reduction in viability (Tojo et al. 2012).

As an initial effort to probe the reproductive function of SMAD7, we examined the expression and regulation of SMAD7 by intraovarian growth factors. Furthermore, we explored the role of SMAD7 in regulating TGFβ superfamily signaling in ovarian granulosa cells using a small interfering RNA (siRNA) approach. These studies identify SMAD7 as a negative regulator of key TGFβ superfamily signaling in mouse granulosa cells.

Materials and methods

Animals

The experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Texas A&M University (protocol number 2011-0007). Mice were maintained on C57BL/6/129S6/SvEv genetic background and were allowed to feed and drink ad libitum. All necessary procedures were taken to minimize the discomfort, distress, and pain to the mice.

Gonadotropin treatment

Mice (21 day) received injections of 5 IU PMSG for 48 h (n=4) or both PMSG (48 h) and hCG (5 IU) (48 h; n=3). Ovaries from age-matched untreated mice (n=4 for each group) were used as controls. Collection of ovaries was performed under a stereomicroscope. The ovaries were used for immunohistochemical and RNA analyses as detailed below.

Granulosa cell isolation and culture

Primary mouse granulosa cell culture was described previously (Pangas et al. 2007, Li et al. 2009, 2011). Briefly, granulosa cells were collected in collection medium (DMEM containing 0.1% BSA (Sigma), 100 U/ml penicillin–streptomycin, and 10 mM HEPES) by puncturing large antral follicles using 26 gauge needles under a stereomicroscope. The cell suspension was filtered through a 40 μm nylon cell strainer (BD) to remove oocytes and debris. The cell pellet was then washed, resuspended, and cultured for the following experiments: i) recombinant protein treatment: granulosa cells were treated with control buffer, BMP4 (50 ng/ml; R&D), TGFB1 (10 ng/ml; R&D, Minneapolis, MN, USA), and GDF9 (50 ng/ml) to examine Smad7 regulation and target gene induction. The production and purification of recombinant GDF9 were carried out as described previously (Li et al. 2009, 2011). For TGFB1 treatment, granulosa cells were cultured overnight and then serum-starved for 24 h before addition of recombinant TGFB1. The serum starvation procedure was included to eliminate the potential basal activity of TGFβ in the serum. ii) Small-molecule inhibitor assay: granulosa cells were pre-treated for 1 h with ALK2/3/6 inhibitor dorsomorphin (4 μM; Sigma) or ALK4/5/7 inhibitor SB-505124 (1 μM; Sigma). The cells were then incubated with recombinant BMP4 or GDF9 and collected after 5 h. Selection of the doses of the growth factors and incubation time was based on our pilot dose–response and time-course experiments and/or the published literature (Matsubara et al. 2000, Dahlqvist et al. 2003, Li et al. 2008b, 2009). Total RNA was isolated and quantitative PCR was performed to analyze Smad7 mRNA expression. iii) siRNA knockdown experiments, described below. All culture experiments were repeated at least three times.

RNA isolation and RT

Total RNA was extracted from the ovaries using RNA isolation reagent (TRI reagent; Sigma) or from mouse granulosa cells using an RNeasy Micro Kit (Qiagen) according to the manufacturer's instructions (Li et al. 2009). RNA concentration was measured using a NanoDrop Spectrophotometer ND 1000 (NanoDrop Technologies, Wilmington, DE, USA). DNase I (Invitrogen) treatment was performed when using TRI reagent-derived RNA. On-column DNase (Qiagen) digestion was included during RNA isolation when using the RNeasy Micro Kit. For RT, 1 μg or 200 ng of the respective ovary and granulosa cell total RNA, random hexamers/oligo dT primers (Invitrogen), and superscript III (Invitrogen) reverse transcriptase were used. As negative controls, reactions where superscript III was substituted with water were included to monitor potential genomic DNA contamination.

Conventional PCR and quantitative real-time PCR

Smad7 was amplified from ovary cDNA by conventional RT-PCR using Jumpstart Taq polymerase (Sigma) and gene-specific primers (forward: AAAGTGTTCCCTGGTTTCTCCAT CAAGGC; reverse: CTACCGGCTGTTGAAGATGACCTCCAGCCAGCAC) (Kitamura et al. 2000). The following PCR program was used: 95 °C for 2 min, 40 cycles of 95 °C for 30 s, 65 °C for 30 s, and 72 °C for 1 min and an extra extension of 10 min at 72 °C. The resultant PCR product (∼207 bp) was separated and visualized on 1% agarose gel (Sigma) containing ethidium bromide. The image of the gel was acquired under u.v. light and then reversed for presentation.

Quantitative real-time PCR (qPCR) was carried out as described previously with slight modifications (Li et al. 2011). Briefly, qPCR assays were conducted in a 384-well plate (Bio-Rad) using a CFX384 Real-time PCR Detection System (Bio-Rad) with a program consisting of 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Gene expression analyses were performed in duplicate using SYBR Green PCR master mix (Applied Biosystems) and gene-specific primers (Table 1) or Taqman gene expression assays (Tnfaip6, Mm00493736_m1; Inhbb, Mm01286587_m1; and Gapdh, 4352339E) and Taqman Universal PCR Master Mix (Applied Biosystems). Gapdh was used as an internal control (Li et al. 2008b, 2009) and fold changes were calculated using the ΔΔCT method (Livak & Schmittgen 2001).

Table 1

Primers for SYBR green-based real-time PCR.

NameSequence (5′–3′)Reference
Smad7Forward: GGGCTTTCAGATTCCCAACTTNA
Reverse: CACGCGAGTCTTCTCCTCC
TgfbiForward: CGCCAAGTCACCCTACCAGPrimerBank ID158508598c1
Reverse: TGCACAGCACATACATTGGGG
Ptgs2Forward: TGAGCAACTATTCCAAACCAGCPrimerBank ID31981525a1
Reverse: GCACGTAGTCTTCGATCACTATC
Ptx3Forward: CCTGCGATCCTGCTTTGTGPrimerBank ID31982085a1
Reverse: GGTGGGATGAAGTCCATTGTC
Id1Forward: ACGACATGAACGGCTGCTACBirkenkamp et al. (2007)
Reverse: CAGGATCTCCACCTTGCTCAC
Id2Forward: ATGAAAGCCTTCAGTCCGGTGPrimerBank ID6754276a1
Reverse: AGCAGACTCATCGGGTCGT
Id3Forward: CTGCTACGAGGCGGTGTGRTPrimerDB ID3261
Reverse: CACCTGGCTAAGCTGAGTGC
GapdhForward: CAATGTGTCCGTCGTGGATCTLi et al. (2011)
Reverse: GCCTGCTTCACCACCTTCTT

Immunohistochemistry

Immunohistochemistry was performed using an ABC kit (Vector Labs, Burlingame, CA, USA) as described elsewhere (Li et al. 2011). In brief, sections (5 μm) were prepared from paraffin-embedded tissue blocks and then deparaffinized in xylene and rehydrated in graded alcohol. To expose the antigen, antigen retrieval was carried out by boiling the sections in 10 mM citrate buffer (pH 6.0) for 20 min. The slides were treated with 0.3% (v/v) hydrogen peroxide to eliminate endogenous peroxidase activity. The sections were then blocked with 3% goat serum for 30 min and incubated with rabbit anti-SMAD7 antibody (Imgenex; 1:300) (Reynolds et al. 2008) at 4 °C overnight. After primary antibody incubation, the sections were washed and sequentially incubated with biotinylated anti-rabbit IgG (1 h) and ABC reagent (1 h; Vector Labs) at room temperature. Subsequently, the immunoreactive signals were developed using a DAB substrate kit (Vector Labs), and sections were counterstained with hematoxylin and mounted with Permount (Fisher, Fair Lawn, NJ, USA).

Small interfering RNA

Freshly prepared mouse granulosa cells were seeded onto 24-well plates (∼1×105 cells/well) in growth medium containing 5% fetal bovine serum (PAA Laboratories, Dartmouth, MA, USA) and insulin–transferrin–selenite (Sigma). The cells were cultured overnight before siRNA/vehicle transfection. Gapdh siRNA (Ambion, Carlsbad, CA, USA) was included as a positive control whereas an siRNA that has no significant sequence similarity to the mouse gene was used as a negative control (Ambion). A substantial knockdown of Smad7 was achieved using X-tremeGENE siRNA Transfection Reagent (Roche) and Smad7 silencer siRNA (73 nM; Ambion) in our granulosa cell culture system. Transfection of siRNA was conducted according to the manufacture's protocol. After 48 h of transfection, granulosa cells were treated with BMP4 (50 ng/ml), TGFB1 (10 ng/ml), and GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were serum-starved for 24 h before adding TGFB1. After 5 h treatment, the cells were collected in RNA lysis tissue buffer, RNA was isolated using a Qiagen RNeasy Micro Kit, and gene expression was analyzed by qPCR.

Statistical analyses

One-way ANOVA was performed to determine the difference among groups. When a significant difference was detected by ANOVA, the difference between means was further assessed by a post hoc Tukey's HSD test. Comparison of means between two groups was made by t-test. Data are shown as mean±s.e.m. Statistical significance was defined at P<0.05.

Results

SMAD7 is expressed in mouse granulosa cells

As a first step to define the potential ovarian function of SMAD7, we examined the expression of SMAD7 in mouse granulosa cells. RT-PCR analysis revealed that mouse granulosa cells expressed Smad7 transcripts (Fig. 1A). In agreement with the RT-PCR result (Fig. 1A), SMAD7 was detected in primary, secondary, and antral follicles by immunohistochemistry (Fig. 1B). Furthermore, ovarian Smad7 mRNA abundance was reduced after 48 h of pregnant mare's serum gonadotropin (PMSG) injection and 48 h of PMSG plus 48 h of human chorionic gonadotropin (hCG) injection compared with age-matched non-treated controls (Fig. 1F). Immunoreactive SMAD7 staining remained detectable in granulosa cells after gonadotropin injection compared with those in the follicles (Fig. 1D and E).

Figure 1

Download Figure

Figure 1

Expression and localization of SMAD7 in mouse ovary. (A) Smad7 mRNA was expressed in mouse granulosa cells. RT Neg, no reverse transcriptase. (B, C, D, and E) Immunostaining of SMAD7 using ovaries from untreated immature mice (B) and PMSG (48 h)+hCG (48 h)-treated mice (D) and controls (E). Negative control without primary antibody is depicted in (C). Note that omission of the primary antibody abolished the SMAD7 signals. GC, granulosa cell; CL, corpus luteum. Arrows indicate follicles. Scale bar=50 μm (B and C) and 100 μm (D and E). (F) Gonadotropin administration reduced Smad7 mRNA levels in the ovary. Total RNA was isolated from ovaries of age-matched untreated controls (CTRL; n=4/group), PMSG (48 h)-treated (n=4), and PMSG (48 h)/hCG (48 h)-treated mice (n=3). Gene expression was analyzed by qPCR using the ΔΔCT method. Smad7 mRNA levels in the treatment group were expressed as fold change of the corresponding age-matched controls. Gapdh was used as an internal control. Data represent means±s.e.m. *P<0.05 vs the corresponding CTRL.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

TGFβ superfamily ligands induce Smad7 in mouse granulosa cells

Real-time PCR demonstrated that TGFB1 (TGFβ1) (10 ng/ml) induced Smad7 mRNA expression in mouse granulosa cells within 5 h after treatment (Fig. 2A). BMP4 (50 ng/ml), a thecal cell-secreted protein, increased Smad7 transcript levels more than fivefold in granulosa cells compared with vehicle-treated controls (Fig. 2B). Incubation of mouse granulosa cells with 50 ng/ml of GDF9, an oocyte-derived factor, resulted in significantly higher Smad7 mRNA levels than controls (Fig. 2C). To gain further mechanistic understanding of Smad7 induction by the aforementioned TGFβ family ligands, we performed small-molecule inhibitor assays. The small-molecule compound 2-(5-benzo[1,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6-methylpyridine hydrochloride (SB-505124) selectively inhibits activin-like kinase (ALK)4, ALK5, and ALK7 activity and blocks the activation of SMAD2/3 (DaCosta Byfield et al. 2004). Dorsomorphin is a selective inhibitor of BMP type I receptors ALK2, ALK3, and ALK6 and suppresses BMP-induced SMAD1/5/8 phosphorylation (Yu et al. 2008). Using these small-molecule inhibitors, we demonstrated that SB505124 (1 μM) suppressed GDF9-induced Smad7 expression (Fig. 2D). Similarly, dorsomorphin (4 μM) significantly reduced BMP4-promoted Smad7 transcript expression (Fig. 2E).

Figure 2

Download Figure

Figure 2

Induction of Smad7 mRNA by TGFβ family proteins in mouse granulosa cells. (A, B, and C) Induction of Smad7 mRNA in mouse granulosa cells by TGFB1 (A), BMP4 (B), and GDF9 (C). Mouse granulosa cells were freshly isolated and treated with vehicle (CTRL), TGFB1 (10 ng/ml), BMP4 (50 ng/ml), and GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were cultured overnight and serum-starved for 24 h before ligand addition. (D and E) Effect of small-molecule inhibitors for TGFβ/BMP type 1 receptors on GDF9 and BMP4-induced Smad7 mRNA expression. Note that the ALK4/5/7 inhibitor SB505124 (SB; 1 μM) significantly reduced GDF9 (50 ng/ml)-induced Smad7 expression (D). Similarly, the ALK2/3/6 inhibitor dorsomorphin (DM; 4 μM) mitigated BMP4 (50 ng/ml)-promoted expression of Smad7 transcripts (E). Granulosa cells were harvested after 5 h of treatment and processed for qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three to five independent culture experiments. *P<0.05.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

Knockdown of Smad7 did not affect BMP4-induced inhibitor of DNA binding (Id) gene and inhibin beta-B (Inhbb) expression

TGFB1 significantly increased pentraxin 3 (Ptx3), prostaglandin-endoperoxide synthase 2 (Ptgs2), and tumor necrosis factor alpha-induced protein 6 (Tnfaip6) mRNA transcript expression in mouse granulosa cells (Fig. 3A). Upregulation of Id1, Id2, and Id3 mRNA by BMP4 in mouse granulosa cells was demonstrated (Fig. 3B). Moreover, Ptx3 (Li et al. 2011), Tnfaip6, and Ptgs2 were upregulated by purified GDF9 recombinant proteins in our culture system (Fig. 3C). Among the aforementioned genes, Ptx3, Ptgs2, and Tnfaip6 are critical regulators of cumulus cell expansion (Pangas & Matzuk 2005, Li et al. 2008b, 2011). Id genes are known to be downstream targets of BMPs and they are well characterized (Korchynskyi & ten Dijke 2002). Thus, the above genes were selected for the following siRNA-based assays.

Figure 3

Download Figure

Figure 3

Target genes of TGFB1, BMP4, and GDF9 in mouse granulosa cells. (A) TGFB1 induced Ptx3, Ptgs2, and Tnfaip6 expression in mouse granulosa cells. (B) BMP4 increased the expression of mRNAs for Id1, Id2, and Id3 in granulosa cells. (C) Induction of Ptx3, Ptgs2, and Tnfaip6 expression by GDF9 in mouse granulosa cells. Mouse granulosa cells were freshly isolated and treated with vehicle (CTRL), TGFB1 (10 ng/ml), BMP4 (50 ng/ml), or GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were cultured overnight and serum-starved for 24 h before ligand addition. Cells were harvested after 5 h of treatment and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three to five independent culture experiments. *P<0.05 vs CTRL.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

To define the role of SMAD7 in the regulation of TGFβ superfamily signaling in mouse granulosa cells, we transfected the cells with Smad7 siRNA to knock-down Smad7 and examined the effect on TGFβ family ligand-induced gene expression. Figure 4A depicts the primary granulosa cell culture assay utilized in this study. A substantial reduction of Smad7 in mouse granulosa cells was demonstrated using Smad7 siRNA (Fig. 4B; P<0.05). To determine the inhibitory effects of SMAD7 on BMP4, TGFB1, and GDF9 signaling, we incubated granulosa cells that had been treated with vehicle (control) or Smad7 siRNA in the presence or absence of different ligands. Interestingly, we found that knockdown of Smad7 in granulosa cells had no significant effect on BMP4-induced mRNA expression of Id1, Id2, and Id3 (Fig. 4C, D, and E) as well as inhibin beta-B (Inhbb; Fig. 4F).

Figure 4

Download Figure

Figure 4

Knockdown of Smad7 did not affect BMP4-promoted Id gene and Inhbb expression in granulosa cells. (A) Schematic representation of experimental procedure utilized to determine the effect of Smad7 siRNA knockdown on BMP4-induced gene expression in granulosa cells. (B) Smad7 siRNA dramatically reduced expression of Smad7 in granulosa cells after 48 h of transfection. (C, D, E, and F) Effect of Smad7 siRNA on BMP4-induced target gene expression in mouse granulosa cells. Note that knockdown of Smad7 in granulosa cells did not significantly alter BMP4-induced expression of Id1, Id2, Id3, and Inhbb compared with BMP4-treated negative siRNA controls. Granulosa cells were harvested after 5 h of BMP4 stimulation and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three independent culture experiments. *P<0.05.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

Role of SMAD7 in TGFβ signaling in mouse granulosa cells

In contrast to the effect of Smad7 knockdown on BMP4 signaling, we found that stimulation of Smad7 siRNA-treated granulosa cells with TGFB1 enhanced TGFB1-induced gene expression (Fig. 5). Figure 5A and B depicts the experimental protocol utilized and the validation of Smad7 knockdown respectively. As expected, granulosa cells treated with TGFB1 and negative siRNA showed increased Ptx3, Ptgs2, and Tnfaip6 mRNA levels (Fig. 5C, D, and E). Interestingly, a further increase in Ptx3, Ptgs2, and Tnfaip6 transcript levels was found in TGFB1-treated granulosa cells that were incubated with Smad7 siRNA (P<0.05; Fig. 5C, D, and E). However, a similar effect of Smad7 siRNA on TGFB1-induced Serpine1/plasminogen activator inhibitor-1 (PAI1) was not detected (data not shown).

Figure 5

Download Figure

Figure 5

SMAD7 antagonizes TGFB1 and GDF9 signaling in mouse granulosa cells. (A) Schematic representation of experimental procedure utilized to determine the effect of Smad7 siRNA knockdown on TGFB1 and GDF9-induced gene expression in granulosa cells. (B, C, D, and E) Effect of Smad7 siRNA knockdown (B) on TGFB1-induced expression of Ptx3 (C), Ptgs2 (D), and Tnfaip6 (E) in mouse granulosa cells. (F, G, H, and I) Effect of Smad7 siRNA knockdown (F) on GDF9-induced expression of Ptx3 (G), Ptgs2 (H), and Tnfaip6 (I) in mouse granulosa cells. Note that knockdown of Smad7 in granulosa cells resulted in a significant increase in TGFB1 and GDF9-induced Ptx3 (C and G), Ptgs2 (D and H), and Tnfaip6 (E and I) mRNA expression compared with the respective ligand-treated negative siRNA controls. Granulosa cells were harvested after 5 h of stimulation and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three independent culture experiments. *P<0.05.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

SMAD7 negatively influences GDF9-mediated oocyte paracrine signaling

To test the hypothesis that SMAD7 antagonizes GDF9 signaling in mouse granulosa cells, we performed siRNA assays using mouse primary granulosa cell culture (Fig. 5A). As anticipated, Ptx3 was induced by GDF9 in the presence of negative siRNA (Fig. 5G). We demonstrated that knockdown of Smad7 (Fig. 5F) caused a significant increase in GDF9-induced Ptx3 mRNA expression compared with controls (P<0.05; Fig. 5G). A similar effect of Smad7 knockdown on GDF9-induced Ptgs2 (Fig. 5H) and Tnfaip6 (Fig. 5I) expression was also found. A role of SMAD7 in modulating growth factor signaling in granulosa cells is proposed in Fig. 6.

Figure 6

Download Figure

Figure 6

Hypothetical model depicting the role of SMAD7 in ovarian granulosa cells. In mouse granulosa cells, TGFβ family ligands such as TGFB1, BMP4, and GDF9 are key regulators of granulosa cell function and follicular development. BMP4 and TGFB1/GDF9 signal through ALK2/3/6 and ALK4/5/7 to regulate granulosa cell gene expression and cellular responses/functions. Our data suggest that SMAD7, an inhibitory SMAD, may preferentially inhibit TGFB1/GDF9-induced cumulus expansion-related transcripts in mouse granulosa cells. SMAD7 induced by TGFB1/GDF9 probably acts as a negative feedback to limit TGFB1/GDF9 signaling, although its direct role in mediating gene expression and cellular functions remains to be elucidated.

Citation: REPRODUCTION 146, 1; 10.1530/REP-13-0093

Discussion

TGFβ ligands signal through type 2 and type 1 receptors and downstream SMAD proteins, which regulate gene transcription in concert with co-activators and co-repressors (Massague 2000). TGFβ signaling is regulated at multiple levels including ligand traps (e.g. Chordin and Noggin), inhibitory SMADs (i.e. SMAD6 and SMAD7), and interactive pathways such as the MAP kinase (MAPK) pathway (Massague 2000, Attisano & Wrana 2002, Derynck & Zhang 2003, Yan et al. 2009, Yan & Chen 2011). Researchers, including the authors, have recently identified key roles of receptor-regulated SMADs and the common SMAD in ovarian function and female fertility using knockout and conditional knockout approaches (Tomic et al. 2002, 2004, Pangas et al. 2006, 2008, Li et al. 2008b, Gong & McGee 2009). However, the role of inhibitory SMADs remains a missing piece of the puzzle in this field. Therefore, the current study was aimed at delineating the function of SMAD7 in the context of TGFβ signaling in the ovary. We provide compelling evidence that SMAD7 acts as a negative regulator of key TGFβ superfamily ligand signaling in mouse granulosa cells. Importantly, our results reveal a link between SMAD7 and GDF9 signaling, which is an essential element for oocyte–granulosa cell communication and folliculogenesis (Dong et al. 1996).

SMAD7 is an inhibitory SMAD that antagonizes TGFβ and BMP signaling in vitro (Nakao et al. 1997, Yanagisawa et al. 2001). SMAD7 is functionally distinct from SMAD6 (Yan et al. 2009, Yan & Chen 2011). We demonstrated the expression of SMAD7 in mouse granulosa cells, which confirmed findings by Quezada et al. (2012). As gonadotropins are key regulatory signals for follicular development, we examined the effect of exogenous gonadotropin administration on Smad7 gene expression. We showed that Smad7 mRNA was downregulated in the ovary by gonadotropin administration. It is plausible that the reduced Smad7 expression by gonadotropin exposure could potentially facilitate follicular development and/or luteal formation. However, regulation of Smad7 by FSH was not observed in mouse granulosa cells cultured in vitro (Quezada et al. 2012). Thus, the physiological significance of this finding remains to be identified.

SMAD7 is induced by TGFβ signaling in several cell types (Nakao et al. 1997, Afrakhte et al. 1998, Stopa et al. 2000). As the ovary is a rich source of a variety of TGFβ ligands that are produced from distinct cellular compartments and are essential regulators of ovarian function, we sought to determine whether Smad7 is induced by these growth factors in ovarian granulosa cells. Smad7 is known to be induced by TGFβ ligands (Afrakhte et al. 1998), and we were able to confirm that Smad7 is a target of TGFB1 in mouse granulosa cells (Quezada et al. 2012). We also showed that Smad7 was induced by BMP4 in mouse granulosa cells. Moreover, Smad7 mRNA levels were rapidly increased by GDF9, which is an oocyte-secreted TGFβ family protein and a key regulator of granulosa cell function (Dong et al. 1996, Yan et al. 2001, Otsuka et al. 2011). These data suggest that SMAD7 may modulate GDF9-mediated oocyte paracrine signaling essential for coordinating the cross talk between ovarian somatic cells and germ cells. It has been shown that the ALK4/5/7 inhibitor SB431542 attenuates TGFB1-induced Smad7 mRNA expression in mouse granulosa cells (Quezada et al. 2012). We further demonstrated that TGFβ and BMP type 1 receptors were involved in the induction of Smad7 by GDF9 and BMP4 respectively. In contrast to the aforementioned findings, Smad6 mRNA was not affected by GDF9 treatment (data not shown), suggesting a distinct role of the two inhibitory SMADs in GDF9-mediated signaling. As further support, Smad6 is induced by BMP15 but not TGFB1 in granulosa cells (Li et al. 2009, Quezada et al. 2012). Collectively, these results suggest that SMAD7 may act as a negative regulator of TGFβ superfamily signaling in mouse granulosa cells. Thus, the preference of SMAD7 in antagonizing TGFβ superfamily signaling was further exploited in this study.

Although major functions of the BMP and TGFβ signaling pathways in mouse granulosa cells have been identified (Li et al. 2008b, Pangas et al. 2008), the role of SMAD7 in each signaling cascade remains elusive. Id genes are direct targets of BMPs (Hollnagel et al. 1999, Korchynskyi & ten Dijke 2002). Although BMP4 potently induced Smad7 expression, we did not find a significant effect of Smad7 knockdown on BMP4-stimulated Id gene expression in the current study, which suggests that SMAD7 may not act as a direct antagonist for BMP4 signaling in mouse granulosa cells. However, the role of SMAD6 in regulating BMP4 signaling in mouse granulosa cells remains to be elucidated. In contrast to the findings from the BMP4 studies, we found that TGFB1-induced expression of the Ptx3, Ptgs2, and Tnfaip6 genes was potentiated in Smad7 siRNA-treated granulosa cells, which implies an inhibitory role of SMAD7 in TGFβ signaling in mouse granulosa cells. Based on the fact that SMAD7 forms a complex with activated type 1 receptors to inhibit receptor-regulated SMAD (R-SMAD) phosphorylation (Hayashi et al. 1997, Nakao et al. 1997, Mochizuki et al. 2004), it is plausible that reduction of SMAD7 may enhance TGFβ type 1 receptor-SMAD2/3 signaling activity in granulosa cells. Intriguingly, a similar effect of Smad7 knockdown on TGFB1-induced Serpine1/PAI1, a known TGFβ target gene, was not detected. However, a p38 inhibitor significantly reduced TGFB1-induced PAI1 expression (Y Gao and Q Li 2012, unpublished observations), suggesting that the p38 MAPK pathway is involved in TGFB1-induced PAI1 expression in mouse granulosa cells. Involvement of p38 MAPK in TGFβ-induced PAI1 expression has been observed in other cell types (Liao et al. 2001, Vayalil et al. 2007). Collectively, these results suggest a possible role for SMAD7 in controlling TGFβ type 1 receptor-SMAD2/3 signaling activity in mouse granulosa cells.

Of particular interest is the finding that GDF9 signaling is modulated by SMAD7 in granulosa cells, because oocyte-derived TGFβ superfamily ligands (e.g. BMP15 and GDF9) are pivotal mediators of oocyte paracrine signaling essential for folliculogenesis and oocyte developmental competence (Hussein et al. 2006, Li et al. 2008a, Yeo et al. 2008). Within a follicle, bidirectional intercellular communications between the oocyte and companion somatic cells are established via gap junctions and paracrine signaling and are indispensable to normal ovarian function (Eppig et al. 1997, Eppig 2001, Gilchrist et al. 2008, Li et al. 2008a). GDF9 and BMP15 are oocyte paracrine factors whose functions in follicular development have been well elaborated (Dong et al. 1996, Vitt et al. 2000, Otsuka et al. 2001, Yan et al. 2001, Otsuka & Shimasaki 2002, Shimasaki et al. 2004, McNatty et al. 2005, Gilchrist et al. 2006, Yoshino et al. 2006, Sugiura et al. 2007, Edwards et al. 2008, Su et al. 2008). GDF9 is expressed in oocytes in mice and humans (McGrath et al. 1995, Aaltonen et al. 1999) and plays a key role in normal follicular development (Elvin et al. 1999, Orisaka et al. 2006). Interestingly, our data indicated that knockdown of Smad7 in mouse granulosa cells significantly enhanced GDF9-induced expression of Ptx3, which is a cumulus expansion-related transcript as well as a potential granulosa cell marker of oocyte competence (Zhang et al. 2005). In addition, induction of Tnfaip6 and Ptgs2 by GDF9 was potentiated in Smad7 siRNA-treated granulosa cells, suggesting increased GDF9 signaling activity in the absence of SMAD7. As enhanced oocyte paracrine signaling in ovarian somatic cells could promote oocyte competence during in vitro maturation (IVM; Hussein et al. 2006), it is tempting to speculate that targeting Smad7 in a temporal and spatial manner could be potentially utilized to benefit oocyte development in assisted reproductive technology clinics.

Despite the above findings, the functional requirement for SMAD7 in mouse granulosa cells warrants further investigation using Smad7 mutant mouse models. Currently, there are conflicting reports on the phenotype of Smad7 knockout mice, which is potentially due to incomplete SMAD7 loss-of-function in some mutant mice. Four Smad7 mutant mouse lines have been established (Li et al. 2006, Chen et al. 2009, Kleiter et al. 2010, Tojo et al. 2012). Deletion of exon 1 of Smad7 gene (Li et al. 2006) results in a fertile phenotype. Another Smad7 knockout model was generated by deletion of exon 4 encoding the entire MH2 domain (Chen et al. 2009). Unlike the exon 1 knockout mice, the majority of Smad7 exon 4 knockouts died in utero because of defective cardiovascular development (Chen et al. 2009). Two of the Smad7 mutant mouse lines were recently described (Kleiter et al. 2010, Tojo et al. 2012). In one report, the promoter region and exon 1 of the Smad7 gene were flanked by LoxP sites and could be deleted upon Cre-mediated recombination. In contrast to the previous reports, Smad7 homozygous mice generated by this targeting strategy display complete embryonic mortality, which suggests that deletion of the promoter region and exon 1 of the Smad7 gene probably creates a null mutation (Kleiter et al. 2010). In the other report, disruption of both the MH2 domain and poly (A) signal sequence of Smad7 in mice causes either early postnatal mortality or growth retardation depending on the genetic background of the mice (Tojo et al. 2012). Despite the phenotypic variability of Smad7 mutant mouse models, the overall results point to a role for SMAD7 in the essential processes of growth and development. Results from the current study provide a rationale for further functional analysis, which would allow for an unequivocal assessment of the role of SMAD7 and its functional redundancy with SMAD6, if any, in ovarian somatic cells.

In summary, our findings, together with a recent report that SMAD7 mediates TGFβ-induced apoptosis in ovarian granulosa cells (Quezada et al. 2012), highlight SMAD7 as a potential regulator of ovarian function. Results of this study suggest that SMAD7 may function during follicular development through antagonizing and/or fine-tuning essential TGFβ superfamily signaling, which is involved in the regulation of oocyte–somatic cell interaction and granulosa cell function. Therefore, targeting inhibitory SMAD signaling may represent a strategic approach to manipulate the TGFβ signaling pathway in female reproduction.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work is supported by Texas A&M College of Veterinary Medicine (CVM) graduate student award (to Y Gao) and Texas A&M New Faculty Start-up Funds (to Q Li).

Acknowledgements

The authors thank Dr Gregory A Johnson for critical reading and editing of this manuscript.

References

  • AaltonenJLaitinenMPVuojolainenKJaatinenRHorelli-KuitunenNSeppaLLouhioHTuuriTSjobergJButzowR1999Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. Journal of Clinical Endocrinology and Metabolism8427442750. (doi:10.1210/jc.84.8.2744)

  • AfrakhteMMorenAJossanSItohSSampathKWestermarkBHeldinCHHeldinNEten DijkeP1998Induction of inhibitory Smad6 and Smad7 mRNA by TGF-β family members. Biochemical and Biophysical Research Communications249505511. (doi:10.1006/bbrc.1998.9170)

  • AttisanoLWranaJL2002Signal transduction by the TGF-β superfamily. Science29616461647. (doi:10.1126/science.1071809)

  • BirkenkampKUEssafiAvan der VosKEda CostaMHuiRCHolstegeFKoendermanLLamEWCofferPJ2007FOXO3a induces differentiation of Bcr-Abl-transformed cells through transcriptional down-regulation of Id1. Journal of Biological Chemistry28222112220. (doi:10.1074/jbc.M606669200)

  • ChangHBrownCWMatzukMM2002Genetic analysis of the mammalian transforming growth factor-β superfamily. Endocrine Reviews23787823. (doi:10.1210/er.2002-0003)

  • ChenQChenHYZhengDWKuangCZFangHZouBYZhuWQBuGXJinTWangZZ2009Smad7 is required for the development and function of the heart. Journal of Biological Chemistry284292300. (doi:10.1074/jbc.M807233200)

  • ChenHYHuangXRWangWSLiJHHeuchelRLChungACKLanHY2011The protective role of Smad7 in diabetic kidney disease: mechanism and therapeutic potential. Diabetes60590601. (doi:10.2337/db10-0403)

  • ChungACKHuangXRZhouLHeuchelRLaiKNLanHY2009Disruption of the Smad7 gene promotes renal fibrosis and inflammation in unilateral ureteral obstruction (UUO) in mice. Nephrology Dialysis Transplantation2414431454. (doi:10.1093/ndt/gfn699)

  • DaCosta ByfieldSMajorCLapingNJRobertsAB2004SB-505124 is a selective inhibitor of transforming growth factor-β type I receptors ALK4, ALK5, and ALK7. Molecular Pharmacology65744752. (doi:10.1124/mol.65.3.744)

  • DahlqvistCBlokzijlAChapmanGFalkADannaeusKIbanezCFLendahlU2003Functional notch signaling is required for BMP4-induced inhibition of myogenic differentiation. Development13060896099. (doi:10.1242/dev.00834)

  • DerynckRZhangYE2003Smad-dependent and Smad-independent pathways in TGF-β family signalling. Nature425577584. (doi:10.1038/nature02006)

  • DiazFJWigglesworthKEppigJJ2007Oocytes determine cumulus cell lineage in mouse ovarian follicles. Journal of Cell Science12013301340. (doi:10.1242/jcs.000968)

  • DongJAlbertiniDFNishimoriKKumarTRLuNMatzukMM1996Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature383531535. (doi:10.1038/383531a0)

  • DragovicRARitterLJSchulzSJAmatoFThompsonJGArmstrongDTGilchristRB2007Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion. Biology of Reproduction76848857. (doi:10.1095/biolreprod.106.057471)

  • EdsonMANagarajaAKMatzukMM2009The mammalian ovary from genesis to revelation. Endocrine Reviews30624712. (doi:10.1210/er.2009-0012)

  • EdwardsSJReaderKLLunSWesternALawrenceSMcNattyKPJuengelJL2008The cooperative effect of growth and differentiation factor-9 and bone morphogenetic protein (BMP)-15 on granulosa cell function is modulated primarily through BMP receptor II. Endocrinology14910261030. (doi:10.1210/en.2007-1328)

  • ElvinJAClarkATWangPWolfmanNMMatzukMM1999Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Molecular Endocrinology1310351048. (doi:10.1210/me.13.6.1035)

  • EppigJJ2001Oocyte control of ovarian follicular development and function in mammals. Reproduction122829838. (doi:10.1530/rep.0.1220829)

  • EppigJJChesnelFHiraoYO'BrienMJPendolaFLWatanabeSWigglesworthK1997Oocyte control of granulosa cell development: how and why. Human Reproduction12127132.

  • GallowaySMMcNattyKPCambridgeLMLaitinenMPEJuengelJLJokirantaTSMcLarenRJLuiroKDoddsKGMontgomeryGW2000Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genetics25279283. (doi:10.1038/77033)

  • GalvinKMDonovanMJLynchCAMeyerRIPaulRJLorenzJNFairchild-HuntressVDixonKLDunmoreJHGimbroneMAJr2000A role for smad6 in development and homeostasis of the cardiovascular system. Nature Genetics24171174. (doi:10.1038/72835)

  • GilchristRBRitterLJMyllymaaSKaivo-OjaNDragovicRAHickeyTERitvosOMottersheadDG2006Molecular basis of oocyte-paracrine signalling that promotes granulosa cell proliferation. Journal of Cell Science11938113821. (doi:10.1242/jcs.03105)

  • GilchristRBLaneMThompsonJG2008Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Human Reproduction Update14159177. (doi:10.1093/humupd/dmm040)

  • GongXMcGeeEA2009Smad3 is required for normal follicular follicle-stimulating hormone responsiveness in the mouse. Biology of Reproduction81730738. (doi:10.1095/biolreprod.108.070086)

  • HataALagnaGMassagueJHemmati-BrivanlouA1998Smad6 inhibits BMP/Smad1 signaling by specifically competing with the Smad4 tumor suppressor. Genes and Development12186197. (doi:10.1101/gad.12.2.186)

  • HayashiHAbdollahSQiuYCaiJXuYYGrinnellBWRichardsonMATopperJNGimbroneMAJrWranaJL1997The MAD-related protein Smad7 associates with the TGFβ receptor and functions as an antagonist of TGFβ signaling. Cell8911651173. (doi:10.1016/S0092-8674(00)80303-7)

  • HayashiMMcGeeEAMinGKleinCRoseUMvan DuinMHsuehAJ1999Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology14012361244. (doi:10.1210/en.140.3.1236)

  • HollnagelAOehlmannVHeymerJRutherUNordheimA1999Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. Journal of Biological Chemistry2741983819845. (doi:10.1074/jbc.274.28.19838)

  • HusseinTSThompsonJGGilchristRB2006Oocyte-secreted factors enhance oocyte developmental competence. Developmental Biology296514521. (doi:10.1016/j.ydbio.2006.06.026)

  • IshisakiAYamatoKHashimotoSNakaoATamakiKNonakaKten DijkePSuginoHNishiharaT1999Differential inhibition of Smad6 and Smad7 on bone morphogenetic protein- and activin-mediated growth arrest and apoptosis in B cells. Journal of Biological Chemistry2741363713642. (doi:10.1074/jbc.274.19.13637)

  • JuengelJLMcNattyKP2005The role of proteins of the transforming growth factor-β superfamily in the intraovarian regulation of follicular development. Human Reproduction Update11144161. (doi:10.1093/humupd/dmh061)

  • KitamuraKAotaSSakamotoRYoshikawaSIOkazakiK2000Smad7 selectively interferes with different pathways of activin signaling and inhibits erythroid leukemia cell differentiation. Blood9533713379.

  • KleiterISongJLukasDHasanMNeumannBCroxfordALPedreXHovelmeyerNYogevNMildnerA2010Smad7 in T cells drives T helper 1 responses in multiple sclerosis and experimental autoimmune encephalomyelitis. Brain13310671081. (doi:10.1093/brain/awq039)

  • KorchynskyiOten DijkeP2002Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. Journal of Biological Chemistry27748834891. (doi:10.1074/jbc.M111023200)

  • LeeKYJeongJWWangJMaLMartinJFTsaiSYLydonJPDeMayoFJ2007Bmp2 is critical for the murine uterine decidual response. Molecular and Cellular Biology2754685478. (doi:10.1128/MCB.00342-07)

  • LiRRosendahlABrodinGChengAMAhgrenASundquistCKulkarniSPawsonTHeldinCHHeuchelRL2006Deletion of exon I of SMAD7 in mice results in altered B cell responses. Journal of Immunology17667776784.

  • LiQGraffJMO'ConnorAELovelandKLMatzukMM2007SMAD3 regulates gonadal tumorigenesis. Molecular Endocrinology2124722486. (doi:10.1210/me.2007-0147)

  • LiQMcKenzieLJMatzukMM2008aRevisiting oocyte–somatic cell interactions: in search of novel intrafollicular predictors and regulators of oocyte developmental competence. Molecular Human Reproduction14673678. (doi:10.1093/molehr/gan064)

  • LiQPangasSAJorgezCJGraffJMWeinsteinMMatzukMM2008bRedundant roles of SMAD2 and SMAD3 in ovarian granulosa cells in vivo. Molecular and Cellular Biology2870017011. (doi:10.1128/MCB.00732-08)

  • LiQRajanahallySEdsonMAMatzukMM2009Stable expression and characterization of N-terminal tagged recombinant human bone morphogenetic protein 15. Molecular Human Reproduction15779788. (doi:10.1093/molehr/gap062)

  • LiQAgnoJEEdsonMANagarajaAKNagashimaTMatzukMM2011Transforming growth factor β receptor type 1 is essential for female reproductive tract integrity and function. PLoS Genetics7e1002320. (doi:10.1371/journal.pgen.1002320)

  • LiXTripuraniSKJamesRPangasSA2012Minimal fertility defects in mice deficient in oocyte-expressed Smad4. Biology of Reproduction8616. (doi:10.1095/biolreprod.111.094375)

  • LiaoJHChenJSChaiMQZhaoSSongJG2001The involvement of p38 MAPK in transforming growth factor β1-induced apoptosis in murine hepatocytes. Cell Research118994. (doi:10.1038/sj.cr.7290072)

  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods25402408. (doi:10.1006/meth.2001.1262)

  • MassagueJ2000How cells read TGF-β signals. Nature Reviews. Molecular Cell Biology1169178. (doi:10.1038/35043051)

  • MatsubaraHIkutaKOzakiYSuzukiYSuzukiNSatoTSuzumoriK2000Gonadotropins and cytokines affect luteal function through control of apoptosis in human luteinized granulosa cells. Journal of Clinical Endocrinology and Metabolism8516201626. (doi:10.1210/jc.85.4.1620)

  • MatzukMMFinegoldMJSuJGHsuehAJBradleyA1992α-Inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature360313319. (doi:10.1038/360313a0)

  • McGrathSAEsquelaAFLeeSJ1995Oocyte-specific expression of growth/differentiation factor-9. Molecular Endocrinology9131136. (doi:10.1210/me.9.1.131)

  • McNattyKPJuengelJLReaderKLLunSMyllymaaSLawrenceSBWesternAMeerasahibMFMottersheadDGGroomeNP2005Bone morphogenetic protein 15 and growth differentiation factor 9 co-operate to regulate granulosa cell function. Reproduction129473480. (doi:10.1530/rep.1.0511)

  • MiddlebrookBSEldinKLiXShivasankaranSPangasSA2009Smad1–Smad5 ovarian conditional knockout mice develop a disease profile similar to the juvenile form of human granulosa cell tumors. Endocrinology15052085217. (doi:10.1210/en.2009-0644)

  • MochizukiTMiyazakiHHaraTFuruyaTImamuraTWatabeTMiyazonoK2004Roles for the MH2 domain of Smad7 in the specific inhibition of transforming growth factor-β superfamily signaling. Journal of Biological Chemistry2793156831574. (doi:10.1074/jbc.M313977200)

  • NakaoAAfrakhteMMorenANakayamaTChristianJLHeuchelRItohSKawabataMHeldinNEHeldinCH1997Identification of Smad7, a TGFβ-inducible antagonist of TGF-β signalling. Nature389631635. (doi:10.1038/39369)

  • OrisakaMOrisakaSJiangJYCraigJWangYFKotsujiFTsangBK2006Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage. Molecular Endocrinology2024562468. (doi:10.1210/me.2005-0357)

  • OtsukaFShimasakiS2002A negative feedback system between oocyte bone morphogenetic protein 15 and granulosa cell kit ligand: Its role in regulating granulosa cell mitosis. PNAS9980608065. (doi:10.1073/pnas.122066899)

  • OtsukaFYamamotoSEricksonGFShimasakiS2001Bone morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) action by suppressing FSH receptor expression. Journal of Biological Chemistry2761138711392. (doi:10.1074/jbc.M010043200)

  • OtsukaFMcTavishKJShimasakiS2011Integral role of GDF-9 and BMP-15 in ovarian function. Molecular Reproduction and Development78921. (doi:10.1002/mrd.21265)

  • PangasSAMatzukMM2005The art and artifact of GDF9 activity: cumulus expansion and the cumulus expansion-enabling factor. Biology of Reproduction73582585. (doi:10.1095/biolreprod.105.042127)

  • PangasSALiXRobertsonEJMatzukMM2006Premature luteinization and cumulus cell defects in ovarian-specific Smad4 knockout mice. Molecular Endocrinology2014061422. (doi:10.1210/me.2005-0462)

  • PangasSAJorgezCJTranMAgnoJLiXBrownCWKumarTRMatzukMM2007Intraovarian activins are required for female fertility. Molecular Endocrinology2124582471. (doi:10.1210/me.2007-0146)

  • PangasSALiXUmansLZwijsenAHuylebroeckDGutierrezCWangDMartinJFJaminSPBehringerRR2008Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Molecular and Cellular Biology28248257. (doi:10.1128/MCB.01404-07)

  • QuezadaMWangJHoangVMcGeeEA2012Smad7 is a transforming growth factor-β-inducible mediator of apoptosis in granulosa cells. Fertility and Sterility971452.e14561459.e1456. (doi:10.1016/j.fertnstert.2012.03.024)

  • ReynoldsLEContiFJSilvaRRobinsonSDIyerVRudlingRCrossBNyeEHartIRDipersioCM2008alpha3beta1 integrin-controlled Smad7 regulates reepithelialization during wound healing in mice. Journal of Clinical Investigation118965974. (doi:10.1172/JCI33538)

  • ShimasakiSMooreRKOtsukaFEricksonGF2004The bone morphogenetic protein system in mammalian reproduction. Endocrine Reviews2572101. (doi:10.1210/er.2003-0007)

  • SouchelnytskyiSNakayamaTNakaoAMorenAHeldinCHChristianJLten DijkeP1998Physical and functional interaction of murine and Xenopus Smad7 with bone morphogenetic protein receptors and transforming growth factor-β receptors. Journal of Biological Chemistry2732536425370. (doi:10.1074/jbc.273.39.25364)

  • StopaMAnhufDTerstegenLGatsiosPGressnerAMDooleyS2000Participation of Smad2, Smad3, and Smad4 in transforming growth factor β (TGF-β)-induced activation of Smad7. THE TGF-β response element of the promoter requires functional Smad binding element and E-box sequences for transcriptional regulation. Journal of Biological Chemistry2752930829317. (doi:10.1074/jbc.M003282200)

  • SuYQSugiuraKWigglesworthKO'BrienMJAffourtitJPPangasSAMatzukMMEppigJJ2008Oocyte regulation of metabolic cooperativity between mouse cumulus cells and oocytes: BMP15 and GDF9 control cholesterol biosynthesis in cumulus cells. Development135111121. (doi:10.1242/dev.009068)

  • SugiuraKSuY-QDiazFJPangasSASharmaSWigglesworthKO'BrienMJMatzukMMShimasakiSEppigJJ2007Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development13425932603. (doi:10.1242/dev.006882)

  • TianXHalfhillANDiazFJ2010Localization of phosphorylated SMAD proteins in granulosa cells, oocytes and oviduct of female mice. Gene Expression Patterns10105112. (doi:10.1016/j.gep.2010.02.003)

  • TojoMTakebeATakahashiSTanakaKImamuraTMiyazonoKChibaT2012Smad7-deficient mice show growth retardation with reduced viability. Journal of Biochemistry151621631. (doi:10.1093/jb/mvs022)

  • TomicDBrodieSGDengCHickeyRJBabusJKMalkasLHFlawsJA2002Smad3 may regulate follicular growth in the mouse ovary. Biology of Reproduction66917923. (doi:10.1095/biolreprod66.4.917)

  • TomicDMillerKPKennyHAWoodruffTKHoyerPFlawsJA2004Ovarian follicle development requires Smad3. Molecular Endocrinology1822242240. (doi:10.1210/me.2003-0414)

  • TripuraniSKCookRWEldinKWPangasSABMP-specific SMADs function as novel repressors of PDGFA and modulate its expression in ovarian granulosa cells and tumorsOncogene2012[in press]doi:10.1038/onc.2012.392)

  • VayalilPKIlesKEChoiJYiAKPostlethwaitEMLiuRM2007Glutathione suppresses TGF-β-induced PAI-1 expression by inhibiting p38 and JNK MAPK and the binding of AP-1, SP-1, and Smad to the PAI-1 promoter. American Journal of Physiology. Lung Cellular and Molecular Physiology293L1281L1292. (doi:10.1152/ajplung.00128.2007)

  • VittUAHayashiMKleinCHsuehAJW2000Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biology of Reproduction62370377. (doi:10.1095/biolreprod62.2.370)

  • XuJOakleyJMcGeeEA2002Stage-specific expression of Smad2 and Smad3 during folliculogenesis. Biology of Reproduction6615711578. (doi:10.1095/biolreprod66.6.1571)

  • YanXHChenYG2011Smad7: not only a regulator, but also a cross-talk mediator of TGF-β signalling. Biochemical Journal434110. (doi:10.1042/BJ20101827)

  • YanCWangPDeMayoJDeMayoFJElvinJACarinoCPrasadSVSkinnerSSDunbarBSDubeJL2001Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Molecular Endocrinology15854866. (doi:10.1210/me.15.6.854)

  • YanXLiuZChenY2009Regulation of TGF-β signaling by Smad7. Acta Biochimica et Biophysica Sinica41263272. (doi:10.1093/abbs/gmp018)

  • YanagisawaMNakashimaKTakedaKOchiaiWTakizawaTUenoMTakizawaMShibuyaHTagaT2001Inhibition of BMP2-induced, TAK1 kinase-mediated neurite outgrowth by Smad6 and Smad7. Genes to Cells610911099. (doi:10.1046/j.1365-2443.2001.00483.x)

  • YeoCXGilchristRBThompsonJGLaneM2008Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Human Reproduction236773. (doi:10.1093/humrep/dem140)

  • YoshinoOMcMahonHESharmaSShimasakiS2006A unique preovulatory expression pattern plays a key role in the physiological functions of BMP-15 in the mouse. PNAS1031067810683. (doi:10.1073/pnas.0600507103)

  • YuPBHongCCSachidanandanCBabittJLDengDYHoyngSALinHYBlochKDPetersonRT2008Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nature Chemical Biology43341. (doi:10.1038/nchembio.2007.54)

  • ZhangXJafariNBarnesRBConfinoEMiladMKazerRR2005Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertility and Sterility83 (Suppl 1) 11691179. (doi:10.1016/j.fertnstert.2004.11.030)

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

An official journal of

Society for Reproduction and Fertility

Sections

Figures

  • View in gallery

    Expression and localization of SMAD7 in mouse ovary. (A) Smad7 mRNA was expressed in mouse granulosa cells. RT Neg, no reverse transcriptase. (B, C, D, and E) Immunostaining of SMAD7 using ovaries from untreated immature mice (B) and PMSG (48 h)+hCG (48 h)-treated mice (D) and controls (E). Negative control without primary antibody is depicted in (C). Note that omission of the primary antibody abolished the SMAD7 signals. GC, granulosa cell; CL, corpus luteum. Arrows indicate follicles. Scale bar=50 μm (B and C) and 100 μm (D and E). (F) Gonadotropin administration reduced Smad7 mRNA levels in the ovary. Total RNA was isolated from ovaries of age-matched untreated controls (CTRL; n=4/group), PMSG (48 h)-treated (n=4), and PMSG (48 h)/hCG (48 h)-treated mice (n=3). Gene expression was analyzed by qPCR using the ΔΔCT method. Smad7 mRNA levels in the treatment group were expressed as fold change of the corresponding age-matched controls. Gapdh was used as an internal control. Data represent means±s.e.m. *P<0.05 vs the corresponding CTRL.

  • View in gallery

    Induction of Smad7 mRNA by TGFβ family proteins in mouse granulosa cells. (A, B, and C) Induction of Smad7 mRNA in mouse granulosa cells by TGFB1 (A), BMP4 (B), and GDF9 (C). Mouse granulosa cells were freshly isolated and treated with vehicle (CTRL), TGFB1 (10 ng/ml), BMP4 (50 ng/ml), and GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were cultured overnight and serum-starved for 24 h before ligand addition. (D and E) Effect of small-molecule inhibitors for TGFβ/BMP type 1 receptors on GDF9 and BMP4-induced Smad7 mRNA expression. Note that the ALK4/5/7 inhibitor SB505124 (SB; 1 μM) significantly reduced GDF9 (50 ng/ml)-induced Smad7 expression (D). Similarly, the ALK2/3/6 inhibitor dorsomorphin (DM; 4 μM) mitigated BMP4 (50 ng/ml)-promoted expression of Smad7 transcripts (E). Granulosa cells were harvested after 5 h of treatment and processed for qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three to five independent culture experiments. *P<0.05.

  • View in gallery

    Target genes of TGFB1, BMP4, and GDF9 in mouse granulosa cells. (A) TGFB1 induced Ptx3, Ptgs2, and Tnfaip6 expression in mouse granulosa cells. (B) BMP4 increased the expression of mRNAs for Id1, Id2, and Id3 in granulosa cells. (C) Induction of Ptx3, Ptgs2, and Tnfaip6 expression by GDF9 in mouse granulosa cells. Mouse granulosa cells were freshly isolated and treated with vehicle (CTRL), TGFB1 (10 ng/ml), BMP4 (50 ng/ml), or GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were cultured overnight and serum-starved for 24 h before ligand addition. Cells were harvested after 5 h of treatment and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three to five independent culture experiments. *P<0.05 vs CTRL.

  • View in gallery

    Knockdown of Smad7 did not affect BMP4-promoted Id gene and Inhbb expression in granulosa cells. (A) Schematic representation of experimental procedure utilized to determine the effect of Smad7 siRNA knockdown on BMP4-induced gene expression in granulosa cells. (B) Smad7 siRNA dramatically reduced expression of Smad7 in granulosa cells after 48 h of transfection. (C, D, E, and F) Effect of Smad7 siRNA on BMP4-induced target gene expression in mouse granulosa cells. Note that knockdown of Smad7 in granulosa cells did not significantly alter BMP4-induced expression of Id1, Id2, Id3, and Inhbb compared with BMP4-treated negative siRNA controls. Granulosa cells were harvested after 5 h of BMP4 stimulation and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three independent culture experiments. *P<0.05.

  • View in gallery

    SMAD7 antagonizes TGFB1 and GDF9 signaling in mouse granulosa cells. (A) Schematic representation of experimental procedure utilized to determine the effect of Smad7 siRNA knockdown on TGFB1 and GDF9-induced gene expression in granulosa cells. (B, C, D, and E) Effect of Smad7 siRNA knockdown (B) on TGFB1-induced expression of Ptx3 (C), Ptgs2 (D), and Tnfaip6 (E) in mouse granulosa cells. (F, G, H, and I) Effect of Smad7 siRNA knockdown (F) on GDF9-induced expression of Ptx3 (G), Ptgs2 (H), and Tnfaip6 (I) in mouse granulosa cells. Note that knockdown of Smad7 in granulosa cells resulted in a significant increase in TGFB1 and GDF9-induced Ptx3 (C and G), Ptgs2 (D and H), and Tnfaip6 (E and I) mRNA expression compared with the respective ligand-treated negative siRNA controls. Granulosa cells were harvested after 5 h of stimulation and processed for RNA isolation and qPCR analysis using the ΔΔCT method. Gapdh was used as an internal control. Data represent means±s.e.m. of three independent culture experiments. *P<0.05.

  • View in gallery

    Hypothetical model depicting the role of SMAD7 in ovarian granulosa cells. In mouse granulosa cells, TGFβ family ligands such as TGFB1, BMP4, and GDF9 are key regulators of granulosa cell function and follicular development. BMP4 and TGFB1/GDF9 signal through ALK2/3/6 and ALK4/5/7 to regulate granulosa cell gene expression and cellular responses/functions. Our data suggest that SMAD7, an inhibitory SMAD, may preferentially inhibit TGFB1/GDF9-induced cumulus expansion-related transcripts in mouse granulosa cells. SMAD7 induced by TGFB1/GDF9 probably acts as a negative feedback to limit TGFB1/GDF9 signaling, although its direct role in mediating gene expression and cellular functions remains to be elucidated.

References

AaltonenJLaitinenMPVuojolainenKJaatinenRHorelli-KuitunenNSeppaLLouhioHTuuriTSjobergJButzowR1999Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. Journal of Clinical Endocrinology and Metabolism8427442750. (doi:10.1210/jc.84.8.2744)

AfrakhteMMorenAJossanSItohSSampathKWestermarkBHeldinCHHeldinNEten DijkeP1998Induction of inhibitory Smad6 and Smad7 mRNA by TGF-β family members. Biochemical and Biophysical Research Communications249505511. (doi:10.1006/bbrc.1998.9170)

AttisanoLWranaJL2002Signal transduction by the TGF-β superfamily. Science29616461647. (doi:10.1126/science.1071809)

BirkenkampKUEssafiAvan der VosKEda CostaMHuiRCHolstegeFKoendermanLLamEWCofferPJ2007FOXO3a induces differentiation of Bcr-Abl-transformed cells through transcriptional down-regulation of Id1. Journal of Biological Chemistry28222112220. (doi:10.1074/jbc.M606669200)

ChangHBrownCWMatzukMM2002Genetic analysis of the mammalian transforming growth factor-β superfamily. Endocrine Reviews23787823. (doi:10.1210/er.2002-0003)

ChenQChenHYZhengDWKuangCZFangHZouBYZhuWQBuGXJinTWangZZ2009Smad7 is required for the development and function of the heart. Journal of Biological Chemistry284292300. (doi:10.1074/jbc.M807233200)

ChenHYHuangXRWangWSLiJHHeuchelRLChungACKLanHY2011The protective role of Smad7 in diabetic kidney disease: mechanism and therapeutic potential. Diabetes60590601. (doi:10.2337/db10-0403)

ChungACKHuangXRZhouLHeuchelRLaiKNLanHY2009Disruption of the Smad7 gene promotes renal fibrosis and inflammation in unilateral ureteral obstruction (UUO) in mice. Nephrology Dialysis Transplantation2414431454. (doi:10.1093/ndt/gfn699)

DaCosta ByfieldSMajorCLapingNJRobertsAB2004SB-505124 is a selective inhibitor of transforming growth factor-β type I receptors ALK4, ALK5, and ALK7. Molecular Pharmacology65744752. (doi:10.1124/mol.65.3.744)

DahlqvistCBlokzijlAChapmanGFalkADannaeusKIbanezCFLendahlU2003Functional notch signaling is required for BMP4-induced inhibition of myogenic differentiation. Development13060896099. (doi:10.1242/dev.00834)

DerynckRZhangYE2003Smad-dependent and Smad-independent pathways in TGF-β family signalling. Nature425577584. (doi:10.1038/nature02006)

DiazFJWigglesworthKEppigJJ2007Oocytes determine cumulus cell lineage in mouse ovarian follicles. Journal of Cell Science12013301340. (doi:10.1242/jcs.000968)

DongJAlbertiniDFNishimoriKKumarTRLuNMatzukMM1996Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature383531535. (doi:10.1038/383531a0)

DragovicRARitterLJSchulzSJAmatoFThompsonJGArmstrongDTGilchristRB2007Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion. Biology of Reproduction76848857. (doi:10.1095/biolreprod.106.057471)

EdsonMANagarajaAKMatzukMM2009The mammalian ovary from genesis to revelation. Endocrine Reviews30624712. (doi:10.1210/er.2009-0012)

EdwardsSJReaderKLLunSWesternALawrenceSMcNattyKPJuengelJL2008The cooperative effect of growth and differentiation factor-9 and bone morphogenetic protein (BMP)-15 on granulosa cell function is modulated primarily through BMP receptor II. Endocrinology14910261030. (doi:10.1210/en.2007-1328)

ElvinJAClarkATWangPWolfmanNMMatzukMM1999Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Molecular Endocrinology1310351048. (doi:10.1210/me.13.6.1035)

EppigJJ2001Oocyte control of ovarian follicular development and function in mammals. Reproduction122829838. (doi:10.1530/rep.0.1220829)

EppigJJChesnelFHiraoYO'BrienMJPendolaFLWatanabeSWigglesworthK1997Oocyte control of granulosa cell development: how and why. Human Reproduction12127132.

GallowaySMMcNattyKPCambridgeLMLaitinenMPEJuengelJLJokirantaTSMcLarenRJLuiroKDoddsKGMontgomeryGW2000Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genetics25279283. (doi:10.1038/77033)

GalvinKMDonovanMJLynchCAMeyerRIPaulRJLorenzJNFairchild-HuntressVDixonKLDunmoreJHGimbroneMAJr2000A role for smad6 in development and homeostasis of the cardiovascular system. Nature Genetics24171174. (doi:10.1038/72835)

GilchristRBRitterLJMyllymaaSKaivo-OjaNDragovicRAHickeyTERitvosOMottersheadDG2006Molecular basis of oocyte-paracrine signalling that promotes granulosa cell proliferation. Journal of Cell Science11938113821. (doi:10.1242/jcs.03105)

GilchristRBLaneMThompsonJG2008Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Human Reproduction Update14159177. (doi:10.1093/humupd/dmm040)

GongXMcGeeEA2009Smad3 is required for normal follicular follicle-stimulating hormone responsiveness in the mouse. Biology of Reproduction81730738. (doi:10.1095/biolreprod.108.070086)

HataALagnaGMassagueJHemmati-BrivanlouA1998Smad6 inhibits BMP/Smad1 signaling by specifically competing with the Smad4 tumor suppressor. Genes and Development12186197. (doi:10.1101/gad.12.2.186)

HayashiHAbdollahSQiuYCaiJXuYYGrinnellBWRichardsonMATopperJNGimbroneMAJrWranaJL1997The MAD-related protein Smad7 associates with the TGFβ receptor and functions as an antagonist of TGFβ signaling. Cell8911651173. (doi:10.1016/S0092-8674(00)80303-7)

HayashiMMcGeeEAMinGKleinCRoseUMvan DuinMHsuehAJ1999Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology14012361244. (doi:10.1210/en.140.3.1236)

HollnagelAOehlmannVHeymerJRutherUNordheimA1999Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. Journal of Biological Chemistry2741983819845. (doi:10.1074/jbc.274.28.19838)

HusseinTSThompsonJGGilchristRB2006Oocyte-secreted factors enhance oocyte developmental competence. Developmental Biology296514521. (doi:10.1016/j.ydbio.2006.06.026)

IshisakiAYamatoKHashimotoSNakaoATamakiKNonakaKten DijkePSuginoHNishiharaT1999Differential inhibition of Smad6 and Smad7 on bone morphogenetic protein- and activin-mediated growth arrest and apoptosis in B cells. Journal of Biological Chemistry2741363713642. (doi:10.1074/jbc.274.19.13637)

JuengelJLMcNattyKP2005The role of proteins of the transforming growth factor-β superfamily in the intraovarian regulation of follicular development. Human Reproduction Update11144161. (doi:10.1093/humupd/dmh061)

KitamuraKAotaSSakamotoRYoshikawaSIOkazakiK2000Smad7 selectively interferes with different pathways of activin signaling and inhibits erythroid leukemia cell differentiation. Blood9533713379.

KleiterISongJLukasDHasanMNeumannBCroxfordALPedreXHovelmeyerNYogevNMildnerA2010Smad7 in T cells drives T helper 1 responses in multiple sclerosis and experimental autoimmune encephalomyelitis. Brain13310671081. (doi:10.1093/brain/awq039)

KorchynskyiOten DijkeP2002Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. Journal of Biological Chemistry27748834891. (doi:10.1074/jbc.M111023200)

LeeKYJeongJWWangJMaLMartinJFTsaiSYLydonJPDeMayoFJ2007Bmp2 is critical for the murine uterine decidual response. Molecular and Cellular Biology2754685478. (doi:10.1128/MCB.00342-07)

LiRRosendahlABrodinGChengAMAhgrenASundquistCKulkarniSPawsonTHeldinCHHeuchelRL2006Deletion of exon I of SMAD7 in mice results in altered B cell responses. Journal of Immunology17667776784.

LiQGraffJMO'ConnorAELovelandKLMatzukMM2007SMAD3 regulates gonadal tumorigenesis. Molecular Endocrinology2124722486. (doi:10.1210/me.2007-0147)

LiQMcKenzieLJMatzukMM2008aRevisiting oocyte–somatic cell interactions: in search of novel intrafollicular predictors and regulators of oocyte developmental competence. Molecular Human Reproduction14673678. (doi:10.1093/molehr/gan064)

LiQPangasSAJorgezCJGraffJMWeinsteinMMatzukMM2008bRedundant roles of SMAD2 and SMAD3 in ovarian granulosa cells in vivo. Molecular and Cellular Biology2870017011. (doi:10.1128/MCB.00732-08)

LiQRajanahallySEdsonMAMatzukMM2009Stable expression and characterization of N-terminal tagged recombinant human bone morphogenetic protein 15. Molecular Human Reproduction15779788. (doi:10.1093/molehr/gap062)

LiQAgnoJEEdsonMANagarajaAKNagashimaTMatzukMM2011Transforming growth factor β receptor type 1 is essential for female reproductive tract integrity and function. PLoS Genetics7e1002320. (doi:10.1371/journal.pgen.1002320)

LiXTripuraniSKJamesRPangasSA2012Minimal fertility defects in mice deficient in oocyte-expressed Smad4. Biology of Reproduction8616. (doi:10.1095/biolreprod.111.094375)

LiaoJHChenJSChaiMQZhaoSSongJG2001The involvement of p38 MAPK in transforming growth factor β1-induced apoptosis in murine hepatocytes. Cell Research118994. (doi:10.1038/sj.cr.7290072)

LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods25402408. (doi:10.1006/meth.2001.1262)

MassagueJ2000How cells read TGF-β signals. Nature Reviews. Molecular Cell Biology1169178. (doi:10.1038/35043051)

MatsubaraHIkutaKOzakiYSuzukiYSuzukiNSatoTSuzumoriK2000Gonadotropins and cytokines affect luteal function through control of apoptosis in human luteinized granulosa cells. Journal of Clinical Endocrinology and Metabolism8516201626. (doi:10.1210/jc.85.4.1620)

MatzukMMFinegoldMJSuJGHsuehAJBradleyA1992α-Inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature360313319. (doi:10.1038/360313a0)

McGrathSAEsquelaAFLeeSJ1995Oocyte-specific expression of growth/differentiation factor-9. Molecular Endocrinology9131136. (doi:10.1210/me.9.1.131)

McNattyKPJuengelJLReaderKLLunSMyllymaaSLawrenceSBWesternAMeerasahibMFMottersheadDGGroomeNP2005Bone morphogenetic protein 15 and growth differentiation factor 9 co-operate to regulate granulosa cell function. Reproduction129473480. (doi:10.1530/rep.1.0511)

MiddlebrookBSEldinKLiXShivasankaranSPangasSA2009Smad1–Smad5 ovarian conditional knockout mice develop a disease profile similar to the juvenile form of human granulosa cell tumors. Endocrinology15052085217. (doi:10.1210/en.2009-0644)

MochizukiTMiyazakiHHaraTFuruyaTImamuraTWatabeTMiyazonoK2004Roles for the MH2 domain of Smad7 in the specific inhibition of transforming growth factor-β superfamily signaling. Journal of Biological Chemistry2793156831574. (doi:10.1074/jbc.M313977200)

NakaoAAfrakhteMMorenANakayamaTChristianJLHeuchelRItohSKawabataMHeldinNEHeldinCH1997Identification of Smad7, a TGFβ-inducible antagonist of TGF-β signalling. Nature389631635. (doi:10.1038/39369)

OrisakaMOrisakaSJiangJYCraigJWangYFKotsujiFTsangBK2006Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage. Molecular Endocrinology2024562468. (doi:10.1210/me.2005-0357)

OtsukaFShimasakiS2002A negative feedback system between oocyte bone morphogenetic protein 15 and granulosa cell kit ligand: Its role in regulating granulosa cell mitosis. PNAS9980608065. (doi:10.1073/pnas.122066899)

OtsukaFYamamotoSEricksonGFShimasakiS2001Bone morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) action by suppressing FSH receptor expression. Journal of Biological Chemistry2761138711392. (doi:10.1074/jbc.M010043200)

OtsukaFMcTavishKJShimasakiS2011Integral role of GDF-9 and BMP-15 in ovarian function. Molecular Reproduction and Development78921. (doi:10.1002/mrd.21265)

PangasSAMatzukMM2005The art and artifact of GDF9 activity: cumulus expansion and the cumulus expansion-enabling factor. Biology of Reproduction73582585. (doi:10.1095/biolreprod.105.042127)

PangasSALiXRobertsonEJMatzukMM2006Premature luteinization and cumulus cell defects in ovarian-specific Smad4 knockout mice. Molecular Endocrinology2014061422. (doi:10.1210/me.2005-0462)

PangasSAJorgezCJTranMAgnoJLiXBrownCWKumarTRMatzukMM2007Intraovarian activins are required for female fertility. Molecular Endocrinology2124582471. (doi:10.1210/me.2007-0146)

PangasSALiXUmansLZwijsenAHuylebroeckDGutierrezCWangDMartinJFJaminSPBehringerRR2008Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Molecular and Cellular Biology28248257. (doi:10.1128/MCB.01404-07)

QuezadaMWangJHoangVMcGeeEA2012Smad7 is a transforming growth factor-β-inducible mediator of apoptosis in granulosa cells. Fertility and Sterility971452.e14561459.e1456. (doi:10.1016/j.fertnstert.2012.03.024)

ReynoldsLEContiFJSilvaRRobinsonSDIyerVRudlingRCrossBNyeEHartIRDipersioCM2008alpha3beta1 integrin-controlled Smad7 regulates reepithelialization during wound healing in mice. Journal of Clinical Investigation118965974. (doi:10.1172/JCI33538)

ShimasakiSMooreRKOtsukaFEricksonGF2004The bone morphogenetic protein system in mammalian reproduction. Endocrine Reviews2572101. (doi:10.1210/er.2003-0007)

SouchelnytskyiSNakayamaTNakaoAMorenAHeldinCHChristianJLten DijkeP1998Physical and functional interaction of murine and Xenopus Smad7 with bone morphogenetic protein receptors and transforming growth factor-β receptors. Journal of Biological Chemistry2732536425370. (doi:10.1074/jbc.273.39.25364)

StopaMAnhufDTerstegenLGatsiosPGressnerAMDooleyS2000Participation of Smad2, Smad3, and Smad4 in transforming growth factor β (TGF-β)-induced activation of Smad7. THE TGF-β response element of the promoter requires functional Smad binding element and E-box sequences for transcriptional regulation. Journal of Biological Chemistry2752930829317. (doi:10.1074/jbc.M003282200)

SuYQSugiuraKWigglesworthKO'BrienMJAffourtitJPPangasSAMatzukMMEppigJJ2008Oocyte regulation of metabolic cooperativity between mouse cumulus cells and oocytes: BMP15 and GDF9 control cholesterol biosynthesis in cumulus cells. Development135111121. (doi:10.1242/dev.009068)

SugiuraKSuY-QDiazFJPangasSASharmaSWigglesworthKO'BrienMJMatzukMMShimasakiSEppigJJ2007Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development13425932603. (doi:10.1242/dev.006882)

TianXHalfhillANDiazFJ2010Localization of phosphorylated SMAD proteins in granulosa cells, oocytes and oviduct of female mice. Gene Expression Patterns10105112. (doi:10.1016/j.gep.2010.02.003)

TojoMTakebeATakahashiSTanakaKImamuraTMiyazonoKChibaT2012Smad7-deficient mice show growth retardation with reduced viability. Journal of Biochemistry151621631. (doi:10.1093/jb/mvs022)

TomicDBrodieSGDengCHickeyRJBabusJKMalkasLHFlawsJA2002Smad3 may regulate follicular growth in the mouse ovary. Biology of Reproduction66917923. (doi:10.1095/biolreprod66.4.917)

TomicDMillerKPKennyHAWoodruffTKHoyerPFlawsJA2004Ovarian follicle development requires Smad3. Molecular Endocrinology1822242240. (doi:10.1210/me.2003-0414)

TripuraniSKCookRWEldinKWPangasSABMP-specific SMADs function as novel repressors of PDGFA and modulate its expression in ovarian granulosa cells and tumorsOncogene2012[in press]doi:10.1038/onc.2012.392)

VayalilPKIlesKEChoiJYiAKPostlethwaitEMLiuRM2007Glutathione suppresses TGF-β-induced PAI-1 expression by inhibiting p38 and JNK MAPK and the binding of AP-1, SP-1, and Smad to the PAI-1 promoter. American Journal of Physiology. Lung Cellular and Molecular Physiology293L1281L1292. (doi:10.1152/ajplung.00128.2007)

VittUAHayashiMKleinCHsuehAJW2000Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biology of Reproduction62370377. (doi:10.1095/biolreprod62.2.370)

XuJOakleyJMcGeeEA2002Stage-specific expression of Smad2 and Smad3 during folliculogenesis. Biology of Reproduction6615711578. (doi:10.1095/biolreprod66.6.1571)

YanXHChenYG2011Smad7: not only a regulator, but also a cross-talk mediator of TGF-β signalling. Biochemical Journal434110. (doi:10.1042/BJ20101827)

YanCWangPDeMayoJDeMayoFJElvinJACarinoCPrasadSVSkinnerSSDunbarBSDubeJL2001Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Molecular Endocrinology15854866. (doi:10.1210/me.15.6.854)

YanXLiuZChenY2009Regulation of TGF-β signaling by Smad7. Acta Biochimica et Biophysica Sinica41263272. (doi:10.1093/abbs/gmp018)

YanagisawaMNakashimaKTakedaKOchiaiWTakizawaTUenoMTakizawaMShibuyaHTagaT2001Inhibition of BMP2-induced, TAK1 kinase-mediated neurite outgrowth by Smad6 and Smad7. Genes to Cells610911099. (doi:10.1046/j.1365-2443.2001.00483.x)

YeoCXGilchristRBThompsonJGLaneM2008Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Human Reproduction236773. (doi:10.1093/humrep/dem140)

YoshinoOMcMahonHESharmaSShimasakiS2006A unique preovulatory expression pattern plays a key role in the physiological functions of BMP-15 in the mouse. PNAS1031067810683. (doi:10.1073/pnas.0600507103)

YuPBHongCCSachidanandanCBabittJLDengDYHoyngSALinHYBlochKDPetersonRT2008Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nature Chemical Biology43341. (doi:10.1038/nchembio.2007.54)

ZhangXJafariNBarnesRBConfinoEMiladMKazerRR2005Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertility and Sterility83 (Suppl 1) 11691179. (doi:10.1016/j.fertnstert.2004.11.030)

Index Card

Cited By

PubMed

Google Scholar

Related Articles

Altmetrics

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 235 235 46
PDF Downloads 21 21 3