Wt1 deficiency causes undifferentiated spermatogonia accumulation and meiotic progression disruption in neonatal mice

in Reproduction
Authors:
Qiao-Song ZhengState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Qiao-Song Zheng in
Current site
Google Scholar
PubMed
Close
,
Xiao-Na WangState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Xiao-Na Wang in
Current site
Google Scholar
PubMed
Close
,
Qing WenState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Qing Wen in
Current site
Google Scholar
PubMed
Close
,
Yan ZhangState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Yan Zhang in
Current site
Google Scholar
PubMed
Close
,
Su-Ren ChenState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Su-Ren Chen in
Current site
Google Scholar
PubMed
Close
,
Jun ZhangState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Jun Zhang in
Current site
Google Scholar
PubMed
Close
,
Xi-Xia LiState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Xi-Xia Li in
Current site
Google Scholar
PubMed
Close
,
Ri-Na ShaState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
State Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Ri-Na Sha in
Current site
Google Scholar
PubMed
Close
,
Zhao-Yuan HuState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Zhao-Yuan Hu in
Current site
Google Scholar
PubMed
Close
,
Fei GaoState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Fei Gao in
Current site
Google Scholar
PubMed
Close
, and
Yi-Xun LiuState Key Laboratory of Reproductive Biology, Graduate School of the Chinese Academy of Sciences, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China

Search for other papers by Yi-Xun Liu in
Current site
Google Scholar
PubMed
Close
View More View Less

Free access

Spermatogenesis is a complex process involving the regulation of multiple cell types. As the only somatic cell type in the seminiferous tubules, Sertoli cells are essential for spermatogenesis throughout the spermatogenic cycle. The Wilms tumor gene, Wt1, is specifically expressed in the Sertoli cells of the mouse testes. In this study, we demonstrated that Wt1 is required for germ cell differentiation in the developing mouse testes. At 10 days post partum, Wt1-deficient testes exhibited clear meiotic arrest and undifferentiated spermatogonia accumulation in the seminiferous tubules. In addition, the expression of claudin11, a marker and indispensable component of Sertoli cell integrity, was impaired in Wt1 −/flox ; Cre-ER TM testes. This observation was confirmed in in vitro testis cultures. However, the basal membrane of the seminiferous tubules in Wt1-deficient testes was not affected. Based on these findings, we propose that Sertoli cells' status is affected in Wt1-deficient mice, resulting in spermatogenesis failure.

Abstract

Spermatogenesis is a complex process involving the regulation of multiple cell types. As the only somatic cell type in the seminiferous tubules, Sertoli cells are essential for spermatogenesis throughout the spermatogenic cycle. The Wilms tumor gene, Wt1, is specifically expressed in the Sertoli cells of the mouse testes. In this study, we demonstrated that Wt1 is required for germ cell differentiation in the developing mouse testes. At 10 days post partum, Wt1-deficient testes exhibited clear meiotic arrest and undifferentiated spermatogonia accumulation in the seminiferous tubules. In addition, the expression of claudin11, a marker and indispensable component of Sertoli cell integrity, was impaired in Wt1−/flox; Cre-ERTM testes. This observation was confirmed in in vitro testis cultures. However, the basal membrane of the seminiferous tubules in Wt1-deficient testes was not affected. Based on these findings, we propose that Sertoli cells' status is affected in Wt1-deficient mice, resulting in spermatogenesis failure.

Introduction

Spermatogenesis is a continuous and highly organized process that requires the participation of multiple cell types. Sertoli cells, which interact directly with developing germ cells in the testis throughout spermatogenesis, play an indispensable role in germ cell development (Mruk & Cheng 2004). Wt1 functions as a transcriptional regulator and is essential for the development of several organs, such as the kidney, heart, and gonads (Chamindrani Mendis-Handagama & Siril Ariyaratne 2001). Previous studies have demonstrated that Wt1 is required during the earliest stage of gonad development, prior to sexual differentiation, in mice (Luo et al. 1994, Klattig et al. 2007). Studies have also shown that Wt1 may be essential for later gonad development. The specific deletion of Wt1 in Sertoli cells during E12.5–E14.5 resulted in testicular cord disruption and testis dysgenesis (Gao et al. 2006). Intriguingly, the Wt1 mRNA levels in the testes still increased steadily after birth and reached their highest expression at 8 days post partum (dpp; Pelletier et al. 1991). Moreover, immunohistochemical studies confirmed that the WT1 protein is strongly expressed in the Sertoli cells associated with early spermatogonia, but not in the cells associated with late spermatogonia (Suzuki & Saga 2008). The spatiotemporal expression pattern of Wt1 suggests a potential role in the developing testis. However, the postnatal function of Wt1 has not been elucidated due to embryonic stage lethality in Wt1−/− mice (Bacon et al. 2003).

The objective of this study was to examine the function of Wt1 in the neonatal testes. Wt1−/flox; Cre-ERTM (tamoxifen-inducible) mice were treated with tamoxifen at 5 dpp to inactivate Wt1 expression, and their phenotypes were examined at 10 dpp (5 days after tamoxifen treatment). To exclude the potential effects of other organs after Wt1 inactivation, an in vitro testis culture model was employed to confirm the in vivo phenotype. The evidence showed that Wt1 deficiency caused undifferentiated spermatogonia accumulation to undergo a meiotic progression disruption and that claudin11 expression was impaired in the Wt1−/flox; Cre-ERTM testes. Therefore, we suggest that Wt1 is essential for germ cell differentiation in the neonatal testes.

Materials and methods

Animals

All the mice were maintained on a C57BL/6; 129/SvEv mixed genetic background. Wt1flox/flox (Gao et al. 2006) mice were mated with mice carrying the Wt1-null allele (Wt1+/; Kreidberg et al. 1993) and Cre-ERTM (Hayashi & McMahon 2002) transgenic mice to produce Wt1−/flox; Cre-ERTM offspring. Tail DNA was used for PCR genotyping, as described previously (Harada et al. 1999, Gao et al. 2006). The mice were housed in cages under a 12 h light:12 h darkness cycle. Two females were placed in a cage with one male in the evening and were examined for vaginal plugs the next morning. The day on which a vaginal plug was detected was designated as E0.5. All the animal procedures were approved by the committee of animal care at the Institute of Zoology, Chinese Academy of Sciences.

Tamoxifen treatment

Tamoxifen (Sigma) was dissolved in corn oil at a final concentration of 20 mg/ml. Wt1−/flox; Cre-ERTM and Wt1−/flox (control) mice at 5 dpp were treated with tamoxifen by i.p. injection at a dose of 9 mg/40 g body weight.

Immunohistochemistry and immunofluorescence

Wt1−/flox; Cre-ERTM and Wt1−/flox (control) mice at 5 dpp were treated with tamoxifen. Five days after tamoxifen treatment, the mice were killed by cervical dislocation. The testes were dissected and immediately fixed in 4% paraformaldehyde for up to 24 h. The samples were then stored in 70% ethanol and embedded in paraffin. The paraffin-embedded samples were sectioned at a 5 μm thickness and mounted on glass slides.

For immunohistochemistry, the tissue sections (5 μm thick) were deparaffinized and rehydrated, followed by antigen retrieval in 10 mM sodium citrate buffer for 15 min. After washing the sections in PBS for 5 min, BSA was added to the sections to block nonspecific binding for 1 h. Next, specific primary antibodies were added and incubated overnight at 4 °C. The sections were then washed three times with PBS, and a secondary antibody was added to the sections for 1 h at room temperature. The sections were then washed three times in PBS prior to staining using a DAB substrate kit (Zhong Shan Technology, Beijing, China) and were counterstained with hematoxylin.

For immunofluorescence, 0.3% Triton X-100 in PBS was used as the blocking buffer. Specific primary antibodies were added and incubated overnight at 4 °C. The next day, the sections were washed three times with PBS and incubated with FITC- or TRITC-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA, USA) for 1 h at room temperature. The sections were then washed three times with PBS and counterstained with DAPI (Sigma) to visualize nuclei.

The following antibodies were used in this study: rabbit anti-Wt1 (1:200; Epitomics, Burlingame, CA, USA; 2797-1), mouse anti-Plzf (1:200; Abcam, Cambridge, UK; ab104854), rabbit anti-claudin11 (1:200; Abcam, ab53041), rabbit anti-laminin (1:400; Abcam, ab11575), and mouse anti-vimentin (1:500; Abcam, ab20346).

Testis culture

Testes from Wt1−/flox; Cre-ERTM and Wt1−/flox (control) mice at 5 dpp were decapsulated and gently separated using two forceps into four to six pieces of 1–3 mm in diameter. The tissue fragments were then positioned on stands made of 1.5% agarose gel that were placed in a 24-well plate, as described previously (Sato et al. 2011) and pre-balanced to soak in culture medium overnight. The culture medium consisted of DMEM/F-12 (1:1; HyClone, Logan, UT, USA; SH30023.01B) with 10% fetal bovine serum (for embryonic stem cell use; Gibco). Next, 4-OH tamoxifen (Sigma, H7904) was added to the culture medium at a final concentration of 1 μM. The culture medium was replaced every 2 days, and the cells were cultured in 5% carbon dioxide in air and maintained at 33 °C.

Real-time PCR

Wt1−/flox; Cre-ERTM and Wt1−/flox mice were injected with tamoxifen at 5 dpp. Five days later, the testes were dissected, and total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen) with random hexamers. Real-time PCR was performed using the SYBR Green Kit (Tiangen, Beijing, China) on a C1000 Thermal Cycler (Bio-Rad Laboratories). The primers used for real-time PCR amplification are listed in Table 1.

Table 1

The primers used for real-time PCR amplification.

Wt1CCAGTGTAAAACTTGTCAGCGAAA
ATGAGTCCTGGTGTGGGTCTTC
PlzfCTGGGACTTTGTGCGATGTG
CGGTGGAAGAGGATCTCAAACA
Neurog3AGTGCTCAGTTCCAATTCCAC
CGGCTTCTTCGCTTTTTGCTG
Gfrα1GTACAGGTCCGCCTACATCAC
GGCTGGAACTTTGTCGAAGAA
RetGCATGTCAGACCCGAACTGG
CGCTGAGGGTGAAACCATCC
Nanos2CTGCAAGCACAATGGGGAGT
CGTCGGTAGAGAGACTGCTG
GDNFCCAGTGACTCCAATATGCCTG
CTCTGCGACCTTTCCCTCTG
GAPDHTTGTCTCCTGCGACTTCAACA
ACCAGGAAATGAGCTTGACAAA

Western blotting

Wt1−/flox; Cre-ERTM and Wt1−/flox mice were injected with tamoxifen at 5 dpp. Five days later, the testes were lysed in radio immunoprecipitation assay lysis buffer containing Complete Mini Protease Inhibitor Cocktail Tablets (Roche). The protein concentration in the supernatants was estimated using the Bradford assay (Bio-Rad Laboratories). The proteins were electrophoresed under reducing conditions in 10% SDS–PAGE gels and then transferred onto nitrocellulose membranes. The blots were incubated overnight at 4 °C with primary antibody, followed by 1 h of incubation at room temperature with HRP-labeled secondary antibody. Specific signals were detected using the ECL western blotting detection system.

The following antibodies were used in this study: mouse anti-E-cadherin (BD, 610181), rabbit anti-N-cadherin (Santa Cruz, SC-7939), rabbit anti-β-catenin (Sigma, C2206), rabbit anti-occludin (Abcam, ab31721), and rabbit anti-PAR6β (Sigma, B8062).

Statistical analysis

The experiments were repeated at least three times. For the immunohistochemistry and immunofluorescence experiments, one representative image of the results of three independent experiments is presented. The data were evaluated for significant differences using Student's t-test. A P value <0.05 was considered significant. Bar graphs were plotted using GraphPad Prism 6 (La Jolla, CA, USA).

Results

Wt1 is specifically expressed in Sertoli cells in the seminiferous tubules of the developing testes

To better understand the functions of Wt1 in developing testes, we first determined the spatiotemporal expression pattern of Wt1 protein in the WT mice from E16.5 to 14 dpp at six time points (E16.5, 1, 3, 7, 10, and 14 dpp). Testes from WT mice were embedded in paraffin and sectioned at a 5 μm thickness. The tissue sections were then immunostained with anti-Wt1 antibody. As shown in Fig. 1, Wt1 is specifically expressed in Sertoli cells throughout the developmental stages.

Figure 1
Figure 1

Wt1 is specifically expressed in Sertoli cells in the seminiferous tubules of the developing testes. The testes of WT mice at E16.5, 1, 3, 7, 10, and 14 dpp were immunostained with anti-Wt1 antibody. Scale bar=50 μm.

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Wt1 is efficiently inactivated in Wt1−/flox; Cre-ERTM testes after tamoxifen treatment

To inactivate Wt1 expression more efficiently, Wt1−/flox mice were mated with Wt+/−; Cre-ERTM mice to generate WT1−/flox; Cre-ERTM mice (KO group) and Wt1−/flox mice (control group). The littermate mice in both groups were indistinguishable, and the morphology and histology of the testes were normal compared with those of the WT testes (data not shown). To induce Cre-mediated recombinase activity, 5-dpp-old littermate mice from both groups were i.p. injected with tamoxifen at a dose of 9 mg/40 g (body weight). The use of the Wt1−/flox; Cre-ERTM mice allowed disruption of the Wt1 gene in an inducible manner, whereas the use of the Wt1−/flox mice did not. The testes were collected 5 days after tamoxifen injection. After Wt1 inactivation, the weight of both the body and the testis of the WT1−/flox; Cre-ERTM mice were significantly decreased compared with those of the control group (Fig. 2A and B), which was likely due to the negative effect of Wt1 inactivation on cardiovascular tissue and the kidney. However, the ratio of the testis weight:body weight was not affected (Fig. 2E).

Figure 2
Figure 2

Wt1 is mostly inactivated in Wt1−/flox; Cre-ERTM testes after tamoxifen treatment. (A and B) Comparison of the body and testis size of Wt1−/flox (control) and Wt1−/flox; Cre-ERTM. (C and D) Quantitative analysis of the body weight and testes weight of Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice. Both the body and the testis weights of the WT1−/flox; Cre-ERTM mice were decreased compared with those of the control group *P<0.05. (E) Quantitative analysis of the ratio of testis weight:body weight in Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice. (F) Real-time PCR was performed using RNA isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Wt1 and GAPDH. Both the control and the KO mice were injected with tamoxifen at 5 dpp. For each sample, RNA from at least three animals was pooled. (G) Quantitative real-time PCR analysis of Wt1 mRNA expression in control and KO testes. The mRNA levels were normalized to GAPDH, and the s.d.s from duplicate reactions are shown (**P=0.006).

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Wt1-specific real-time PCR was used to examine the efficiency of tamoxifen-induced Cre recombination. The primers were designed to target the eighth and ninth exons, and thus, normal Wt1 mRNA could be detected, whereas disrupted Wt1 mRNA could not. The real-time PCR results showed that only ∼20% of normal Wt1 mRNA was still present in the Wt1−/flox; Cre-ERTM testes compared with the control testes (Fig. 2G), indicating that Wt1 was mostly inactivated in the Wt1−/flox; Cre-ERTM testes after tamoxifen treatment.

Undifferentiated spermatogonia accumulate in Wt1-deficient testes

Promyelocytic leukemia-associated protein (Plzf) is a zinc finger transcription factor involved in germline stem cell self-renewal. Plzf expression is restricted to the gonocytes and undifferentiated spermatogonia (Starz-Gaiano & Lehmann 2001, Santos & Lehmann 2004). Prior to tamoxifen treatment, the number and distribution of Plzf-positive cells was nearly identical in the Wt1−/flox; Cre-ERTM and Wt1−/flox testes at 5 dpp. After tamoxifen treatment, the number of Plzf-positive cells clearly showed a significant difference between the two groups (Fig. 3A). The number of Plzf-positive cells per tubule section was ∼16 in the Wt1−/flox; Cre-ERTM testes at 10 dpp, whereas only approximately eight were observed in the control group (Fig. 3B and C), indicating that undifferentiated spermatogonia abnormally accumulated after Wt1 inactivation. Also, the number of Plzf-positive cells/1000 Sertoli cells was counted (Fig. 3D). Three control testes and three Wt1−/flox; Cre-ERTM testes were used. Approximately 20 tubular cross sections were counted per animal. The average number of undifferentiated spermatogonia/1000 Sertoli cells was 208 in control testes, while in Wt1−/flox; Cre-ERTM testes, the average number increased to 385.

Figure 3
Figure 3

Undifferentiated spermatogonia accumulation in Wt1-deficient testes. (A) Wt1−/flox (control) and Wt1−/flox; Cre-ERTM testes were immunostained for Plzf prior to tamoxifen treatment at 5 dpp and 5 days after treatment (10 dpp). Plzf-positive cells accumulated and formed cell clusters (arrowhead). Scale bar=50 μm. (B and C) The number of Plzf-positive cells per seminiferous tubule section was quantified. The data expressed as the mean±s.e.m. for at least three testes obtained from different mice (*P=0.065). (D) The number of Plzf-positive cells/1000 Sertoli cells was counted. The data are expressed as the mean±s.e.m. for three testes obtained from different mice.

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Once Wt1−/flox; Cre-ERTM mice were injected with tamoxifen, Wt1 was inactivated in all organs because of universal Cre expression. Wt1 has been reported to play an essential role in other organs, such as the kidney and heart. To eliminate the possible effect of other organs' Wt1 loss on testicular spermatogonia in vivo, the Wt1−/flox; Cre-ERTM testes were dissected at 5 dpp and cultured on 1.5% agarose gel with 4-OH tamoxifen to inactivate Wt1 expression. This method has a higher knockout efficiency and allows the direct observation of any alterations in the development of the seminiferous tubules.

The intermediate filaments in the Sertoli cells of postnatal mice consist of vimentin (Aumüller et al. 1992). Thus, vimentin immunostaining should reflect the Sertoli cell distribution in the seminiferous tubules. It was observed that in the Wt1−/flox; Cre-ERTM cultured testes, the number of Plzf-positive cells began to increase along the basal membrane from days 2–3. After 1 week in culture, the number of Plzf-positive cells exceeded the number in the control group (Fig. 4). The in vitro culture result confirmed our in vivo findings, with even more accumulation of undifferentiated spermatogonia.

Figure 4
Figure 4

Plzf-positive cell accumulation in cultured testes after Wt1 inactivation. (A) In vitro culture of a testis segment on 1.5% agarose gel in DMEM/F-12 medium in a 24-well plate. (B) Using an inverted microscope, the cultured testicular segment could be observed. (C) Immunostaining of vimentin (red), Plzf (green), and Hoechst (blue) in the cultured testis at days 3, 5, and 7. The arrowhead indicates undifferentiated spermatogonia. Scale bar=50 μm.

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

The expression of undifferentiated spermatogonia genes is upregulated after Wt1 inactivation

Based on the finding that the number of undifferentiated spermatogonia increased after Wt1 deletion, we examined whether the expression of the undifferentiated spermatogonia-related genes Plzf, Neurog3 (Ngn3), Gfrα1, Ret (C-Ret), and Nanos2 was also upregulated. Consistent with our anticipation, this gene expression increased remarkably compared with the expression in the control group (Fig. 5), indicating that the genes associated with undifferentiated spermatogonia were upregulated in the Wt1−/flox; Cre-ERTM testes. Glial cell line-derived neurotrophic factor (GDNF) is a molecule secreted by Sertoli cells that promotes the proliferation of spermatogonial stem cells (Meng et al. 2000, Kubota et al. 2004, He et al. 2008). Although both the cell number and the related gene expression of undifferentiated spermatogonia increased in the Wt1−/flox; Cre-ERTM testis, GDNF expression was maintained at the same level as in the control, indicating that the accumulation of undifferentiated spermatogonia may not have been caused by over-proliferation.

Figure 5
Figure 5

Expression of undifferentiated spermatogonia marker genes is increased after Wt1 inactivation. Real-time PCR was performed using RNA isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Plzf, Neurog3, Gfrα1, Ret, Nanos2, Gdnf, and Gapdh. Mice from both the control and the KO groups were injected with tamoxifen at 5 dpp. Each of the combined samples was pooled from at least three animals. The mRNA levels were normalized to GAPDH, and the s.d.s from duplicate reactions are shown (*P<0.05, **P<0.01).

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Germ cell differentiation is severely impaired after Wt1 inactivation

At 10 dpp, the first wave of spermatogenesis had already entered the stage of meiosis in the normal mouse testis, as revealed by the Scp3 staining. By contrast, in the Wt1−/flox; Cre-ERTM testes, the germ cells lacked or had very low levels of Scp3 expression (Fig. 6A).

Figure 6
Figure 6

Meiotic progression disruption in Wt1-deficient testes. (A) Testes from Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment were immunostained using antibodies against Scp3. Scale bar=50 μm. (B) RT-PCR was performed using RNAs isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Scp3, Dmc1, Pgk2, and Gapdh. Mice from both the control and the KO groups were injected with tamoxifen at 5 dpp. For each sample, RNA from at least three animals was pooled. The mRNA levels were normalized to Gapdh, and the s.d.s from duplicate reactions are shown (*P<0.05, **P<0.01).

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Scp3, Dmc1, and Pgk2 are expressed in spermatocytes during meiosis (Robinson et al. 1989, Yuan et al. 2000, Griswold et al. 2012). To examine the state of differentiation of the germ cells in the mouse testis after Wt1 inactivation, these marker genes were analyzed by real-time PCR (Fig. 6B). The statistical results showed that all the examined meiotic markers were markedly decreased in the Wt1−/flox; Cre-ERTM mice compared with the controls. Together, with Scp3 staining, the results demonstrated that normal germ cell differentiation in the testis is severely impaired after Wt1 inactivation.

The expression of claudin11 is severely impaired, whereas the integrity of the seminiferous tubules is not affected, in Wt1-deficient testes

Laminin expression in the basal laminae of the seminiferous tubules has been reported during the development of the mouse testis (Gelly et al. 1989, Enders et al. 1995). Our study showed that the expression and distribution of laminin in the seminiferous tubules did not obviously differ between the control and the Wt1-deficient mice (Fig. 7A). This finding indicated that the integrity of the seminiferous tubules is not affected by Wt1 loss in the developing testis. The phenotype observed in our study is different from that of the embryonic stage, during which a loss of Wt1 results in a disruption of seminiferous tubule development and a subsequent progressive loss of Sertoli and germ cells (Gao et al. 2006, Chen et al. 2013). This discrepancy might be explained by different effects of Wt1 at various stages of testicular development.

Figure 7
Figure 7

Expression of laminin and claudin11 in the testes from Wt1−/flox; Cre-ERTM and Wt1−/flox (control) at 10 dpp after tamoxifen treatment. (A and B) The testes of Wt1−/flox and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment were immunostained using antibodies against laminin. Laminin was expressed in the basal laminae of the seminiferous tubules, with no clear difference in the seminiferous tubules between Wt1−/flox; Cre-ERTM and Wt1−/flox mice. (C, D, E and F) The testes from Wt1−/flox and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment. Claudin11 was mainly expressed in the Sertoli cells' junctions in the Wt1−/flox testis, whereas only very little caudin11 (arrowhead) could be detected in the Wt1−/flox; Cre-ERTM testis. Scale bar=50 μm.

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Claudin11 is an obligatory protein in Sertoli cells for tight junction formation and blood–testis barrier integrity in the testis. Studies have shown that spermatogenesis does not proceed beyond meiosis in the absence of claudin11, resulting in male sterility (Gow et al. 1999, Mazaud-Guittot et al. 2010). Claudin11 was nearly absent in the Wt1-deficient testis (Fig. 7C and E), whereas the protein's expression and localization were normal in the control testis (Fig. 7D and F). Because of blood–testis barrier formation at ∼2 weeks after birth, a loss of claudin11 will result in the failure of Sertoli–Sertoli tight junction formation in Wt1-deficient testes, eventually leading to meiosis failure.

E-cadherin is downregulated in Wt1-deficient testes

To investigate the underlying mechanism underlying the phenotype of Wt1−/flox; Cre-ERTM testes, several potential target proteins of Wt1 were measured by western blotting. All the molecules examined, except E-cadherin, showed no obvious change at the protein level within 5 days. Downregulation of E-cadherin after Wt1 loss was observed in Wt1−/flox; Cre-ERTM testes (Fig. 8A), whereas the expression of N-cadherin, β-catenin, Par6b, and occludin remained the same in control testes.

Figure 8
Figure 8

E-cadherin expression is decreased in Wt1-deficient testes. (A) Western blot analysis using specific antibiotics for E-cadherin, N-cadherin, Par6b, and β-tubulin among the proteins isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes. The control and KO mice were injected with tamoxifen at 5 dpp. (B) Quantification of the relative levels of E-cadherin, N-cadherin, and Par6b (corrected to the total levels of their respective proteins) is shown (*P<0.05).

Citation: REPRODUCTION 147, 1; 10.1530/REP-13-0299

Discussion

Sertoli cells are the only cell type that interacts with developing germ cells in the seminiferous tubules during testis development. Hence, the status of Sertoli cells is closely related to spermatogenesis. Here, we showed that Wt1 is specifically expressed in Sertoli cells in the seminiferous tubules of the developing testes. This observation is consistent with the results of previous reports on fetal and newborn testes (Pelletier et al. 1991, Mundlos et al. 1993). The spatiotemporal expression of Wt1 in Sertoli cells indicates the essential role of Wt1. However, the exact role of Wt1 during testis development has not been illuminated. In this study, we carefully observed the phenotype of Wt1-deficient mice and found that Wt1 deficiency causes undifferentiated spermatogonia accumulation and meiotic progression disruption in neonatal mice.

The characterization of Wt1−/flox; Cre-ERTM mice

Wt1 has been reported to play an important role in gonad genesis and spermatogenesis (Gao et al. 2006, Klattig et al. 2007). Deletion of Wt1 in Sertoli cells at an early embryonic stage causes disruption of the testicular cord. Our recent study showed that inactivation of Wt1 in adult mice resulted in massive germ cell death and only Sertoli cells were present in most of the seminiferous tubules (Wang et al. 2013).

Immunohistochemical studies confirmed that the WT1 protein is strongly expressed in the Sertoli cells associated with the development of early spermatogonia, but not at a later stage of spermatogenesis (Suzuki & Saga 2008). Therefore, we decided to inactivate Wt1 at 5 dpp. Tamoxifen-inducible Cre recombination was effective as soon as 12 h, and the null allele in the Wt1−/flox; Cre-ERTM mice resulted in a high inactivate efficiency. Real-time PCR analysis showed that the Wt1 mRNA level decreased by only 20% at 10 dpp. However, the Wt1−/flox; Cre-ERTM mice revealed a low survival rate after tamoxifen treatment due to Wt1 loss-of-function in the kidney and heart. We injected tamoxifen at 5 dpp, and over 50% of Wt1−/flox; Cre-ERTM mice (10 of 19) did not survive for more than 1 week. Thus, it was difficult to examine the phenotype after 12 dpp. To overcome this lethality due to the effects of Wt1 on other organs, we performed an in vitro testis culture on an agarose gel using a method developed by Sato et al. (2011).

A tissue-specific RNAi study revealed that mice depleted of WT1 in Sertoli cells suffered from increased germ cell apoptosis, loss of adherens junctions, and impaired fertility (Rao et al. 2006). In Rao's study, the mouse Pem (Rhox5) gene-driven promoter started expressing at 8 dpp, and Wt1 was inactivated thereafter. We speculate that the difference between our study and Rao's is mainly caused by different inactivation time. The first ten neonatal days are very crucial for Sertoli cell maturation and spermatogonia differentiation. Also, the phenotype in Rao's study was mainly observed at adult stage while our study focused on the developmental stage.

The accumulation of undifferentiated spermatogonia is likely due to germ cell differentiation failure but not over-proliferation

The undifferentiated spermatogonia increased in number and formed clusters after Wt1 inactivation. There might be two potential reasons for this phenomenon after Wt1 loss: differentiation arrest or over-proliferation of spermatogonia. Data obtained from our experiments showed that differentiation arrest might be the main reason. First, the total germ cell numbers within each tubule section showed no significant difference between the two groups. Secondly, there was clear meiotic arrest in the Wt1-deficient testes, which may have led to the increased number of undifferentiated spermatogonia. Moreover, the expression of GDNF (SSC self-renewal factor) in the Wt1−/flox; Cre-ERTM testis was comparable with the expression in the controls. These findings suggested that undifferentiated spermatogonia accumulation might be due to a failure in spermatogonia differentiation, rather than the cells' over-proliferation.

Wt1 may regulate Sertoli cells' mesenchymal–epithelial balance via E-cadherin

Many phenotypes in cancer and Wt1-deficient mice may be attributed to the proteins that regulate the mesenchymal–epithelial balance (Hohenstein & Hastie 2006). In the first two neonatal weeks, Sertoli cells undergo a polarity establishment process for tight junction formation between cells, during which an apical–basal polarity is formed. Consequently, Sertoli cells adopt a more epithelial phenotype in the mesenchymal–epithelial balance during this period.

Cadherins are Ca2+-dependent cell adhesion molecules that play an essential role in organogenesis (Raz 2004). E-cadherin is one of the cadherin family members that is involved in epithelial–mesenchymal transitions during cell development and tumor invasion (Donovan et al. 1986, Enders & May 1994). Although E-cadherin is usually regarded as a specific marker for undifferentiated spermatogonia (Raz 2004, Kanatsu-Shinohara et al. 2008), E-cadherin expression in Sertoli cells is highest at 1 week after birth (Raz 2004). Previous studies have demonstrated that E-cadherin is a Wt1 target gene that regulates E-cadherin expression in NIH 3T3 cells and epicardial cells (Shinohara et al. 1999, Sharpe et al. 2003).

Wt1 might also regulate the mesenchymal–epithelial balance of Sertoli cells through E-cadherin in the neonatal testis given that upon Wt1 deletion, the mesenchymal–epithelial transition of Sertoli cells was impaired in the developing testis, resulting in meiotic arrest. Thus, we propose that Wt1 may affect Sertoli cells' mesenchymal–epithelial balance via upregulation of E-cadherin. However, the precise role of Wt1 in the developing testis needs to be further studied.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the Major Research Plan ‘973’ Project (2011CB944300, 2012CB944702), the National Technology Support Project (2012BAI31B08), and the National Nature Science Foundation of China (nos: 31171380, 31071018, and 31071271).

References

  • Aumüller G, Schulze C & Viebahn C 1992 Intermediate filaments in Sertoli cells. Microscopy Research and Technique 20 5072. (doi:10.1002/jemt.1070200107)

    • Search Google Scholar
    • Export Citation
  • Bacon K, Baggiolini M, Broxmeyer H, Horuk R, Lindley I, Mantovani A, Matsushima K, Murphy P, Nomiyama N & Oppenheim J et al. 2003 Chemokine/chemokine receptor nomenclature. Cytokine 21 4849. (doi:10.1016/S1043-4666(02)00493-3)

    • Search Google Scholar
    • Export Citation
  • Chamindrani Mendis-Handagama SML & Siril Ariyaratne HB 2001 Differentiation of the adult Leydig cell population in the postnatal testis. Biology of Reproduction 65 660671. (doi:10.1095/biolreprod65.3.660)

    • Search Google Scholar
    • Export Citation
  • Chen S-R, Chen M, Wang X-N, Zhang J, Wen Q, Ji S-Y, Zheng Q-S, Gao F & Liu Y-X 2013 The Wilms tumor gene, Wt1, maintains testicular cord integrity by regulating the expression of Col4a1 and Col4a2. BMC Biology 11 22. (doi:10.1186/1741-7007-11-22)

    • Search Google Scholar
    • Export Citation
  • Donovan P, Stott D, Cairns L, Heasman J & Wylie C 1986 Migratory and postmigratory mouse primordial germ cells behave differently in culture. Cell 44 831838. (doi:10.1016/0092-8674(86)90005-X)

    • Search Google Scholar
    • Export Citation
  • Enders G & May J 1994 Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Developmental Biology 163 331340. (doi:10.1006/dbio.1994.1152)

    • Search Google Scholar
    • Export Citation
  • Enders GC, Kahsai TZ, Lian G, Funabiki K, Killen PD & Hudson BG 1995 Developmental changes in seminiferous tubule extracellular matrix components of the mouse testis: α3(IV) collagen chain expressed at the initiation of spermatogenesis. Biology of Reproduction 53 14891499. (doi:10.1095/biolreprod53.6.1489)

    • Search Google Scholar
    • Export Citation
  • Gao F, Maiti S, Alam N, Zhang Z, Deng JM, Behringer RR, Lecureuil C, Guillou F & Huff V 2006 The Wilms tumor gene, Wt1, is required for Sox9 expression and maintenance of tubular architecture in the developing testis. PNAS 103 1198711992. (doi:10.1073/pnas.0600994103)

    • Search Google Scholar
    • Export Citation
  • Gelly JL, Richoux JP, Leheup BP & Grignon G 1989 Immunolocalization of type IV collagen and laminin during rat gonadal morphogenesis and postnatal development of the testis and epididymis. Histochemistry 93 3137. (doi:10.1007/BF00266844)

    • Search Google Scholar
    • Export Citation
  • Gow A, Southwood CM, Li JS, Pariali M, Riordan GP, Brodie SE, Danias J, Bronstein JM, Kachar B & Lazzarini RA 1999 CNS myelin and Sertoli cell tight junction strands are absent in Osp/claudin-11 null mice. Cell 99 649659. (doi:10.1016/S0092-8674(00)81553-6)

    • Search Google Scholar
    • Export Citation
  • Griswold MD, Hogarth CA, Bowles J & Koopman P 2012 Initiating meiosis: the case for retinoic acid. Biology of Reproduction 35 3137. (doi:10.1095/biolreprod.111.096610)

    • Search Google Scholar
    • Export Citation
  • Harada N, Tamai Y, Ishikawa T, Sauer B, Takaku K, Oshima M & Taketo MM 1999 Intestinal polyposis in mice with a dominant stable mutation of the β-catenin gene. EMBO Journal 18 59315942. (doi:10.1093/emboj/18.21.5931)

    • Search Google Scholar
    • Export Citation
  • Hayashi S & McMahon AP 2002 Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Developmental Biology 244 305318. (doi:10.1006/dbio.2002.0597)

    • Search Google Scholar
    • Export Citation
  • He Z, Jiang J, Kokkinaki M, Golestaneh N, Hofmann M-C & Dym M 2008 Gdnf upregulates c-Fos transcription via the Ras/Erk1/2 pathway to promote mouse spermatogonial stem cell proliferation. Stem Cells 26 266278. (doi:10.1634/stemcells.2007-0436)

    • Search Google Scholar
    • Export Citation
  • Hohenstein P & Hastie ND 2006 The many facets of the Wilms' tumour gene, WT1. Human Molecular Genetics 15 R196R201. (doi:10.1093/hmg/ddl196)

    • Search Google Scholar
    • Export Citation
  • Kanatsu-Shinohara M, Takehashi M, Takashima S, Lee J, Morimoto H, Chuma S, Raducanu A, Nakatsuji N, Fassler R & Shinohara T 2008 Homing of mouse spermatogonial stem cells to germline niche depends on β1-integrin. Cell Stem Cell 3 533542. (doi:10.1016/j.stem.2008.08.002)

    • Search Google Scholar
    • Export Citation
  • Klattig J, Sierig R, Kruspe D, Makki MS & Englert C 2007 WT1-mediated gene regulation in early urogenital ridge development. Sexual Development 1 238254. (doi:10.1159/000104774)

    • Search Google Scholar
    • Export Citation
  • Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D & Jaenisch R 1993 WT-1 is required for early kidney development. Cell 74 679691. (doi:10.1016/0092-8674(93)90515-R)

    • Search Google Scholar
    • Export Citation
  • Kubota H, Avarbock MR & Brinster RL 2004 Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. PNAS 101 1648916494. (doi:10.1073/pnas.0407063101)

    • Search Google Scholar
    • Export Citation
  • Luo X, Ikeda Y & Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77 481490. (doi:10.1016/0092-8674(94)90211-9)

    • Search Google Scholar
    • Export Citation
  • Mazaud-Guittot S, Meugnier E, Pesenti S, Wu X, Vidal H, Gow A & Le Magueresse-Battistoni B 2010 Claudin 11 deficiency in mice results in loss of the Sertoli cell epithelial phenotype in the testis. Biology of Reproduction 82 202213. (doi:10.1095/biolreprod.109.078907)

    • Search Google Scholar
    • Export Citation
  • Meng X, Lindahl M, Hyvönen ME, Parvinen M, de Rooij DG, Hess MW, Raatikainen-Ahokas A, Sainio K, Rauvala H & Lakso M et al. 2000 Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 287 14891493. (doi:10.1126/science.287.5457.1489)

    • Search Google Scholar
    • Export Citation
  • Mruk DD & Cheng CY 2004 Sertoli–Sertoli and Sertoli–germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endocrine Reviews 25 747806. (doi:10.1210/er.2003-0022)

    • Search Google Scholar
    • Export Citation
  • Mundlos S, Pelletier J, Darveau A, Bachmann M, Winterpacht A & Zabel B 1993 Nuclear localization of the protein encoded by the Wilms' tumor gene WT1 in embryonic and adult tissues. Development 119 13291341.

    • Search Google Scholar
    • Export Citation
  • Pelletier J, Schalling M, Buckler AJ, Rogers A, Haber DA & Housman D 1991 Expression of the Wilms' tumor gene WT1 in the murine urogenital system. Genes and Development 5 13451356. (doi:10.1101/gad.5.8.1345)

    • Search Google Scholar
    • Export Citation
  • Rao MK, Pham J, Imam JS, MacLean JA, Murali D, Furuta Y, Sinha-Hikim AP & Wilkinson MF 2006 Tissue-specific RNAi reveals that WT1 expression in nurse cells controls germ cell survival and spermatogenesis. Genes and Development 20 147152. (doi:10.1101/gad1367806)

    • Search Google Scholar
    • Export Citation
  • Raz E 2004 Guidance of primordial germ cell migration. Current Opinion in Cell Biology 16 169173. (doi:10.1016/j.ceb.2004.01.004)

  • Robinson MO, McCarrey JR & Simon MI 1989 Transcriptional regulatory regions of testis-specific PGK2 defined in transgenic mice. PNAS 86 84378441. (doi:10.1073/pnas.86.21.8437)

    • Search Google Scholar
    • Export Citation
  • Santos A & Lehmann R 2004 Germ cell specification and migration in Drosophila and beyond. Current Biology 14 R578R589. (doi:10.1016/j.cub.2004.07.018)

    • Search Google Scholar
    • Export Citation
  • Sato T, Katagiri K, Gohbara A, Inoue K, Ogonuki N, Ogura A, Kubota Y & Ogawa T 2011 In vitro production of functional sperm in cultured neonatal mouse testes. Nature 471 504507. (doi:10.1038/nature09850)

    • Search Google Scholar
    • Export Citation
  • Sharpe R, McKinnell C, Kivlin C & Fisher J 2003 Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 125 769784. (doi:10.1530/rep.0.1250769)

    • Search Google Scholar
    • Export Citation
  • Shinohara T, Avarbock MR & Brinster RL 1999 β1- and α6-integrin are surface markers on mouse spermatogonial stem cells. PNAS 96 55045509. (doi:10.1073/pnas.96.10.5504)

    • Search Google Scholar
    • Export Citation
  • Starz-Gaiano M & Lehmann R 2001 Moving towards the next generation. Mechanisms of Development 105 518. (doi:10.1016/S0925-4773(01)00392-6)

    • Search Google Scholar
    • Export Citation
  • Suzuki A & Saga Y 2008 Nanos2 suppresses meiosis and promotes male germ cell differentiation. Genes and Development 22 430435. (doi:10.1101/gad.1612708)

    • Search Google Scholar
    • Export Citation
  • Wang XN, Li ZS, Ren Y, Jiang T, Wang YQ, Chen M, Zhang J, Hao JX, Wang YB & Sha RN et al. 2013 The Wilms tumor gene, Wt1, is critical for mouse spermatogenesis via regulation of Sertoli cell polarity and is associated with non-obstructive azoospermia in humans. PLoS Genetics 9 e1003645. (doi:10.1371/journal.pgen.1003645)

    • Search Google Scholar
    • Export Citation
  • Yuan L, Liu J-G, Zhao J, Brundell E, Daneholt B & Höög C 2000 The murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility. Molecular Cell 5 7383. (doi:10.1016/S1097-2765(00)80404-9)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • View in gallery

    Wt1 is specifically expressed in Sertoli cells in the seminiferous tubules of the developing testes. The testes of WT mice at E16.5, 1, 3, 7, 10, and 14 dpp were immunostained with anti-Wt1 antibody. Scale bar=50 μm.

  • View in gallery

    Wt1 is mostly inactivated in Wt1−/flox; Cre-ERTM testes after tamoxifen treatment. (A and B) Comparison of the body and testis size of Wt1−/flox (control) and Wt1−/flox; Cre-ERTM. (C and D) Quantitative analysis of the body weight and testes weight of Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice. Both the body and the testis weights of the WT1−/flox; Cre-ERTM mice were decreased compared with those of the control group *P<0.05. (E) Quantitative analysis of the ratio of testis weight:body weight in Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice. (F) Real-time PCR was performed using RNA isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Wt1 and GAPDH. Both the control and the KO mice were injected with tamoxifen at 5 dpp. For each sample, RNA from at least three animals was pooled. (G) Quantitative real-time PCR analysis of Wt1 mRNA expression in control and KO testes. The mRNA levels were normalized to GAPDH, and the s.d.s from duplicate reactions are shown (**P=0.006).

  • View in gallery

    Undifferentiated spermatogonia accumulation in Wt1-deficient testes. (A) Wt1−/flox (control) and Wt1−/flox; Cre-ERTM testes were immunostained for Plzf prior to tamoxifen treatment at 5 dpp and 5 days after treatment (10 dpp). Plzf-positive cells accumulated and formed cell clusters (arrowhead). Scale bar=50 μm. (B and C) The number of Plzf-positive cells per seminiferous tubule section was quantified. The data expressed as the mean±s.e.m. for at least three testes obtained from different mice (*P=0.065). (D) The number of Plzf-positive cells/1000 Sertoli cells was counted. The data are expressed as the mean±s.e.m. for three testes obtained from different mice.

  • View in gallery

    Plzf-positive cell accumulation in cultured testes after Wt1 inactivation. (A) In vitro culture of a testis segment on 1.5% agarose gel in DMEM/F-12 medium in a 24-well plate. (B) Using an inverted microscope, the cultured testicular segment could be observed. (C) Immunostaining of vimentin (red), Plzf (green), and Hoechst (blue) in the cultured testis at days 3, 5, and 7. The arrowhead indicates undifferentiated spermatogonia. Scale bar=50 μm.

  • View in gallery

    Expression of undifferentiated spermatogonia marker genes is increased after Wt1 inactivation. Real-time PCR was performed using RNA isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Plzf, Neurog3, Gfrα1, Ret, Nanos2, Gdnf, and Gapdh. Mice from both the control and the KO groups were injected with tamoxifen at 5 dpp. Each of the combined samples was pooled from at least three animals. The mRNA levels were normalized to GAPDH, and the s.d.s from duplicate reactions are shown (*P<0.05, **P<0.01).

  • View in gallery

    Meiotic progression disruption in Wt1-deficient testes. (A) Testes from Wt1−/flox (control) and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment were immunostained using antibodies against Scp3. Scale bar=50 μm. (B) RT-PCR was performed using RNAs isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes and specific primer pairs against Scp3, Dmc1, Pgk2, and Gapdh. Mice from both the control and the KO groups were injected with tamoxifen at 5 dpp. For each sample, RNA from at least three animals was pooled. The mRNA levels were normalized to Gapdh, and the s.d.s from duplicate reactions are shown (*P<0.05, **P<0.01).

  • View in gallery

    Expression of laminin and claudin11 in the testes from Wt1−/flox; Cre-ERTM and Wt1−/flox (control) at 10 dpp after tamoxifen treatment. (A and B) The testes of Wt1−/flox and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment were immunostained using antibodies against laminin. Laminin was expressed in the basal laminae of the seminiferous tubules, with no clear difference in the seminiferous tubules between Wt1−/flox; Cre-ERTM and Wt1−/flox mice. (C, D, E and F) The testes from Wt1−/flox and Wt1−/flox; Cre-ERTM mice at 10 dpp after tamoxifen treatment. Claudin11 was mainly expressed in the Sertoli cells' junctions in the Wt1−/flox testis, whereas only very little caudin11 (arrowhead) could be detected in the Wt1−/flox; Cre-ERTM testis. Scale bar=50 μm.

  • View in gallery

    E-cadherin expression is decreased in Wt1-deficient testes. (A) Western blot analysis using specific antibiotics for E-cadherin, N-cadherin, Par6b, and β-tubulin among the proteins isolated from 10 dpp Wt1−/flox (control) and Wt1−/flox; Cre-ERTM (KO) testes. The control and KO mice were injected with tamoxifen at 5 dpp. (B) Quantification of the relative levels of E-cadherin, N-cadherin, and Par6b (corrected to the total levels of their respective proteins) is shown (*P<0.05).

  • Aumüller G, Schulze C & Viebahn C 1992 Intermediate filaments in Sertoli cells. Microscopy Research and Technique 20 5072. (doi:10.1002/jemt.1070200107)

    • Search Google Scholar
    • Export Citation
  • Bacon K, Baggiolini M, Broxmeyer H, Horuk R, Lindley I, Mantovani A, Matsushima K, Murphy P, Nomiyama N & Oppenheim J et al. 2003 Chemokine/chemokine receptor nomenclature. Cytokine 21 4849. (doi:10.1016/S1043-4666(02)00493-3)

    • Search Google Scholar
    • Export Citation
  • Chamindrani Mendis-Handagama SML & Siril Ariyaratne HB 2001 Differentiation of the adult Leydig cell population in the postnatal testis. Biology of Reproduction 65 660671. (doi:10.1095/biolreprod65.3.660)

    • Search Google Scholar
    • Export Citation
  • Chen S-R, Chen M, Wang X-N, Zhang J, Wen Q, Ji S-Y, Zheng Q-S, Gao F & Liu Y-X 2013 The Wilms tumor gene, Wt1, maintains testicular cord integrity by regulating the expression of Col4a1 and Col4a2. BMC Biology 11 22. (doi:10.1186/1741-7007-11-22)

    • Search Google Scholar
    • Export Citation
  • Donovan P, Stott D, Cairns L, Heasman J & Wylie C 1986 Migratory and postmigratory mouse primordial germ cells behave differently in culture. Cell 44 831838. (doi:10.1016/0092-8674(86)90005-X)

    • Search Google Scholar
    • Export Citation
  • Enders G & May J 1994 Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Developmental Biology 163 331340. (doi:10.1006/dbio.1994.1152)

    • Search Google Scholar
    • Export Citation
  • Enders GC, Kahsai TZ, Lian G, Funabiki K, Killen PD & Hudson BG 1995 Developmental changes in seminiferous tubule extracellular matrix components of the mouse testis: α3(IV) collagen chain expressed at the initiation of spermatogenesis. Biology of Reproduction 53 14891499. (doi:10.1095/biolreprod53.6.1489)

    • Search Google Scholar
    • Export Citation
  • Gao F, Maiti S, Alam N, Zhang Z, Deng JM, Behringer RR, Lecureuil C, Guillou F & Huff V 2006 The Wilms tumor gene, Wt1, is required for Sox9 expression and maintenance of tubular architecture in the developing testis. PNAS 103 1198711992. (doi:10.1073/pnas.0600994103)

    • Search Google Scholar
    • Export Citation
  • Gelly JL, Richoux JP, Leheup BP & Grignon G 1989 Immunolocalization of type IV collagen and laminin during rat gonadal morphogenesis and postnatal development of the testis and epididymis. Histochemistry 93 3137. (doi:10.1007/BF00266844)

    • Search Google Scholar
    • Export Citation
  • Gow A, Southwood CM, Li JS, Pariali M, Riordan GP, Brodie SE, Danias J, Bronstein JM, Kachar B & Lazzarini RA 1999 CNS myelin and Sertoli cell tight junction strands are absent in Osp/claudin-11 null mice. Cell 99 649659. (doi:10.1016/S0092-8674(00)81553-6)

    • Search Google Scholar
    • Export Citation
  • Griswold MD, Hogarth CA, Bowles J & Koopman P 2012 Initiating meiosis: the case for retinoic acid. Biology of Reproduction 35 3137. (doi:10.1095/biolreprod.111.096610)

    • Search Google Scholar
    • Export Citation
  • Harada N, Tamai Y, Ishikawa T, Sauer B, Takaku K, Oshima M & Taketo MM 1999 Intestinal polyposis in mice with a dominant stable mutation of the β-catenin gene. EMBO Journal 18 59315942. (doi:10.1093/emboj/18.21.5931)

    • Search Google Scholar
    • Export Citation
  • Hayashi S & McMahon AP 2002 Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Developmental Biology 244 305318. (doi:10.1006/dbio.2002.0597)

    • Search Google Scholar
    • Export Citation
  • He Z, Jiang J, Kokkinaki M, Golestaneh N, Hofmann M-C & Dym M 2008 Gdnf upregulates c-Fos transcription via the Ras/Erk1/2 pathway to promote mouse spermatogonial stem cell proliferation. Stem Cells 26 266278. (doi:10.1634/stemcells.2007-0436)

    • Search Google Scholar
    • Export Citation
  • Hohenstein P & Hastie ND 2006 The many facets of the Wilms' tumour gene, WT1. Human Molecular Genetics 15 R196R201. (doi:10.1093/hmg/ddl196)

    • Search Google Scholar
    • Export Citation
  • Kanatsu-Shinohara M, Takehashi M, Takashima S, Lee J, Morimoto H, Chuma S, Raducanu A, Nakatsuji N, Fassler R & Shinohara T 2008 Homing of mouse spermatogonial stem cells to germline niche depends on β1-integrin. Cell Stem Cell 3 533542. (doi:10.1016/j.stem.2008.08.002)

    • Search Google Scholar
    • Export Citation
  • Klattig J, Sierig R, Kruspe D, Makki MS & Englert C 2007 WT1-mediated gene regulation in early urogenital ridge development. Sexual Development 1 238254. (doi:10.1159/000104774)

    • Search Google Scholar
    • Export Citation
  • Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D & Jaenisch R 1993 WT-1 is required for early kidney development. Cell 74 679691. (doi:10.1016/0092-8674(93)90515-R)

    • Search Google Scholar
    • Export Citation
  • Kubota H, Avarbock MR & Brinster RL 2004 Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. PNAS 101 1648916494. (doi:10.1073/pnas.0407063101)

    • Search Google Scholar
    • Export Citation
  • Luo X, Ikeda Y & Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77 481490. (doi:10.1016/0092-8674(94)90211-9)

    • Search Google Scholar
    • Export Citation
  • Mazaud-Guittot S, Meugnier E, Pesenti S, Wu X, Vidal H, Gow A & Le Magueresse-Battistoni B 2010 Claudin 11 deficiency in mice results in loss of the Sertoli cell epithelial phenotype in the testis. Biology of Reproduction 82 202213. (doi:10.1095/biolreprod.109.078907)

    • Search Google Scholar
    • Export Citation
  • Meng X, Lindahl M, Hyvönen ME, Parvinen M, de Rooij DG, Hess MW, Raatikainen-Ahokas A, Sainio K, Rauvala H & Lakso M et al. 2000 Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 287 14891493. (doi:10.1126/science.287.5457.1489)

    • Search Google Scholar
    • Export Citation
  • Mruk DD & Cheng CY 2004 Sertoli–Sertoli and Sertoli–germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endocrine Reviews 25 747806. (doi:10.1210/er.2003-0022)

    • Search Google Scholar
    • Export Citation
  • Mundlos S, Pelletier J, Darveau A, Bachmann M, Winterpacht A & Zabel B 1993 Nuclear localization of the protein encoded by the Wilms' tumor gene WT1 in embryonic and adult tissues. Development 119 13291341.

    • Search Google Scholar
    • Export Citation
  • Pelletier J, Schalling M, Buckler AJ, Rogers A, Haber DA & Housman D 1991 Expression of the Wilms' tumor gene WT1 in the murine urogenital system. Genes and Development 5 13451356. (doi:10.1101/gad.5.8.1345)

    • Search Google Scholar
    • Export Citation
  • Rao MK, Pham J, Imam JS, MacLean JA, Murali D, Furuta Y, Sinha-Hikim AP & Wilkinson MF 2006 Tissue-specific RNAi reveals that WT1 expression in nurse cells controls germ cell survival and spermatogenesis. Genes and Development 20 147152. (doi:10.1101/gad1367806)

    • Search Google Scholar
    • Export Citation
  • Raz E 2004 Guidance of primordial germ cell migration. Current Opinion in Cell Biology 16 169173. (doi:10.1016/j.ceb.2004.01.004)

  • Robinson MO, McCarrey JR & Simon MI 1989 Transcriptional regulatory regions of testis-specific PGK2 defined in transgenic mice. PNAS 86 84378441. (doi:10.1073/pnas.86.21.8437)

    • Search Google Scholar
    • Export Citation
  • Santos A & Lehmann R 2004 Germ cell specification and migration in Drosophila and beyond. Current Biology 14 R578R589. (doi:10.1016/j.cub.2004.07.018)

    • Search Google Scholar
    • Export Citation
  • Sato T, Katagiri K, Gohbara A, Inoue K, Ogonuki N, Ogura A, Kubota Y & Ogawa T 2011 In vitro production of functional sperm in cultured neonatal mouse testes. Nature 471 504507. (doi:10.1038/nature09850)

    • Search Google Scholar
    • Export Citation
  • Sharpe R, McKinnell C, Kivlin C & Fisher J 2003 Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 125 769784. (doi:10.1530/rep.0.1250769)

    • Search Google Scholar
    • Export Citation
  • Shinohara T, Avarbock MR & Brinster RL 1999 β1- and α6-integrin are surface markers on mouse spermatogonial stem cells. PNAS 96 55045509. (doi:10.1073/pnas.96.10.5504)

    • Search Google Scholar
    • Export Citation
  • Starz-Gaiano M & Lehmann R 2001 Moving towards the next generation. Mechanisms of Development 105 518. (doi:10.1016/S0925-4773(01)00392-6)

    • Search Google Scholar
    • Export Citation
  • Suzuki A & Saga Y 2008 Nanos2 suppresses meiosis and promotes male germ cell differentiation. Genes and Development 22 430435. (doi:10.1101/gad.1612708)

    • Search Google Scholar
    • Export Citation
  • Wang XN, Li ZS, Ren Y, Jiang T, Wang YQ, Chen M, Zhang J, Hao JX, Wang YB & Sha RN et al. 2013 The Wilms tumor gene, Wt1, is critical for mouse spermatogenesis via regulation of Sertoli cell polarity and is associated with non-obstructive azoospermia in humans. PLoS Genetics 9 e1003645. (doi:10.1371/journal.pgen.1003645)

    • Search Google Scholar
    • Export Citation
  • Yuan L, Liu J-G, Zhao J, Brundell E, Daneholt B & Höög C 2000 The murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility. Molecular Cell 5 7383. (doi:10.1016/S1097-2765(00)80404-9)

    • Search Google Scholar
    • Export Citation