Identification of target genes for a prolactin family paralog in mouse decidua

in Reproduction

Prolactin family 8, subfamily a, member 2 (PRL8A2; also called decidual prolactin-related protein; dPRP) is a member of the expanded prolactin family. PRL8A2 is expressed in the uterine decidua and contributes to pregnancy-dependent adaptations to hypoxia. The purpose of this study was to identify gene targets for PRL8A2 action within the uteroplacental compartment. Affymetrix DNA microarray analysis was performed for RNA samples from WT and Prl8a2 null tissues. Validation of the DNA microarray was performed using quantitative RT-PCR. Nine genes were confirmed with decreased expression in Prl8a2 null tissues (e.g. Klk7, Rimklb, Arhgef6, Calm4, Sprr2h, Prl4a1, Ccl27, Lipg, and Htra3). These include potential decidual, endothelial and trophoblast cell targets positively regulated by PRL8A2. A significant upregulation of Derl3, Herpud1, Creld2, Hsp90b1, Ddit3 and Hspa5 was identified in Prl8a2 null tissues, reflecting an increased endoplasmic reticulum (ER) stress response. ER stress genes were prominently expressed in the uterine decidua. We propose that PRL8A2 is a mediator of progesterone-dependent modulation of intrauterine responses to physiological stressors.

Abstract

Prolactin family 8, subfamily a, member 2 (PRL8A2; also called decidual prolactin-related protein; dPRP) is a member of the expanded prolactin family. PRL8A2 is expressed in the uterine decidua and contributes to pregnancy-dependent adaptations to hypoxia. The purpose of this study was to identify gene targets for PRL8A2 action within the uteroplacental compartment. Affymetrix DNA microarray analysis was performed for RNA samples from WT and Prl8a2 null tissues. Validation of the DNA microarray was performed using quantitative RT-PCR. Nine genes were confirmed with decreased expression in Prl8a2 null tissues (e.g. Klk7, Rimklb, Arhgef6, Calm4, Sprr2h, Prl4a1, Ccl27, Lipg, and Htra3). These include potential decidual, endothelial and trophoblast cell targets positively regulated by PRL8A2. A significant upregulation of Derl3, Herpud1, Creld2, Hsp90b1, Ddit3 and Hspa5 was identified in Prl8a2 null tissues, reflecting an increased endoplasmic reticulum (ER) stress response. ER stress genes were prominently expressed in the uterine decidua. We propose that PRL8A2 is a mediator of progesterone-dependent modulation of intrauterine responses to physiological stressors.

Introduction

The mouse possesses an expanded prolactin (PRL) gene family that encodes hormones/cytokines (Wiemers et al. 2003, Soares et al. 2007). In some species the expansion was robust such as occurred in the mouse, rat, guinea pig and cow (Wiemers et al. 2003, Alam et al. 2006, 2010, Ushizawa & Hashizume 2006), whereas evidence for an expansion in other species such as the human and dog is lacking (Cooke & Liebhaber 1995, Lindblad-Toh et al. 2005). These hormones and cytokines are associated with pregnancy and are produced by the anterior pituitary, uterine decidua and/or trophoblast cells (Soares 2004). The biological activities of PRL are well described and include profound effects on the reproductive axis and lactation (Horseman et al. 1997, Bole-Feysot et al. 1998, Horseman & Gregerson 2014); however, the actions of the remaining PRL family paralogs are less well appreciated. Roles for these PRL related proteins in regulating blood vessel and hematopoietic cell development have been demonstrated (Jackson et al. 1994, Lin & Linzer 1999, Bittorf et al. 2000). Based on mouse mutagenesis experiments, the biological activities of at least some expanded PRL family paralogs include modulation of uteroplacental adaptations to physiological stressors (Ain et al. 2004, Alam et al. 2007, Soares et al. 2007). PRL also participates in homeostatic responses to stress (Dorshkind & Horseman 2001).

Hemochorial placentation is associated with differentiation of uterine stromal cells into epithelial-like cells called decidual cells possessing extensive secretory capabilities and essential roles in the establishment and maintenance of pregnancy (Aplin 2000, Gellersen et al. 2007, Herington & Bany 2009, Teklenburg et al. 2010a,b). Decidual cells effectively create an environment within the uterus compatible with development of the placenta and fetus. Among the factors secreted by decidual cells are members of the PRL family (Orwig et al. 1997a, Jabbour & Critchley 2001). Human decidual cells produce PRL, while the mouse and rat produce PRL and an additional three PRL family paralogs (Soares 2004, Soares et al. 2007).

Biological roles for decidual PRL family hormones/cytokines are not well understood (Jabbour & Critchley 2001). Among the decidual PRL family paralogs in the mouse and rat is a protein referred to as PRL family 8, subfamily a, member 2 (PRL8A2; also referred to as decidual PRL-related protein dPRP; Roby et al. 1993). PRL8A2 is abundantly expressed in the uterine decidua (Roby et al. 1993, Gu et al. 1994, Rasmussen et al. 1996, 1997, Lin et al. 1997, Orwig et al. 1997a,b,c, Orwig & Soares 1999, Bany & Cross 2006, Alam et al. 2008), binds to heparin and although it is structurally similar to PRL it does not appear to signal through the PRL receptor (Rasmussen et al. 1996, Wang et al. 2000, Alam et al. 2008). PRL8A2 deficiency interferes with pregnancy-dependent adaptations to hypoxia resulting in pregnancy failure (Alam et al. 2007).

The purpose of this study was to identify candidate targets for PRL8A2 action within the uteroplacental compartment.

Materials and methods

Animals and tissue preparation

C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME, USA). Mice were housed in an environmentally controlled facility, with lights on from 0600 to 2000 h, and allowed free access to food and water. Timed matings of animals were conducted by placing females with fertile males. The day when a seminal plug was found in the vagina of female mice was designated as day 0.5 of pregnancy. Placentation sites, including uterus, decidual and placental tissues, were dissected from pregnant animals. Harvested tissues were snap-frozen in liquid nitrogen for RNA and protein analyses. For in situ hybridization analyses, tissues were frozen in dry ice-cooled heptane. All tissue samples were stored at −80 °C until used. Protocols for the preceding procedures have been described (Ain et al. 2006, Deb et al. 2006, Alam et al. 2007, 2008). The University of Kansas Medical Center Animal Care and Use Committee approved all procedures for handling and experimentation with rodents.

DNA microarray

WT and Prl8a2 null mice were mated and sacrificed on gestation day 7.5. Decidual–placental-embryonic tissues were dissected from implantation sites and homogenized. Total RNA was extracted using TRIzol reagent according to the manufacturer's protocol (Invitrogen). RNA extractions were pooled to form three groups of three for each group in nuclease-free water at a concentration of 1.0 μg/μl. RNA samples were hybridized to the Affymetrix 430 2.0 DNA microarray chip using the GeneChip Hybridization Oven 640 (Affymetrix, Santa Clara, CA, USA). Washing and staining of the hybridized chips were conducted using the GeneChip Fluidics Station 450 (Affymetrix). Chips were scanned using the Affymetrix GeneChip Scanner 3000 (Affymetrix) with autoloader by the KUMC Biotechnology Support Facility. Hybridization signals were normalized with internal controls. Expression data sets were analyzed using the expression analysis software GeneSpring 7.0 and R Statistics Software (http://www.r-project.org/) with BioConductor Software (http://www.bioconductor.org/) packages. The RMA method from the BioConductor Software was used for background correction, normalization and summarization of the DNA microarray data. Statistical comparisons of expression values between two groups were determined with a moderated t-test. Pathway analysis was performed with AltAnalyze (http://altanalyze.org) and PathVisio (http://www.pathvisio.org).

Quantitative RT-PCR

cDNAs were synthesized with total RNA (1 μg) from each sample using M-MLV reverse transcriptase (Invitrogen), diluted five times with water and subjected to quantitative RT-PCR (qRT-PCR) to quantify mRNA levels of the genes identified from the DNA microarray. Primers were designed using Primer Express 2.0 (Applied Biosystems). Primer sequences can be found in Table 1. Real-time PCR amplification of cDNAs was carried out in a reaction mixture (10 μl) containing SYBR GREEN PCR Master Mix (Applied Biosystems) and primers (600 nM each). Amplification and fluorescence detection were carried out using the ABI Prism 7500 Real Time PCR System (Applied Biosystems). Cycling conditions included an initial hold step (95 °C for 10 min) and 40 cycles of a two-step PCR (92 °C for 15 s, then 60 °C for 1 min), followed by a dissociation step (95 °C for 15 s, 60 °C for 15 s, and then 95 °C for 15 s). qRT-PCR for each query mRNA was validated, including determining amplification efficiencies and co-linearity of the query mRNAs and 18S rRNA. The comparative CT method was used for relative quantification of the amount of mRNA for each sample normalized to 18S RNA.

Table 1

Primer sequences for transcripts regulated by PRL8A2.

GeneGenBank accession no.Forward primerReverse primer
RimklbNM_027664TGAAGGCCAAATGTTGTGAATCTCCACTGATCCGAAGACC
Klk7NM_011872TCTGGCTCCTTTCCCTGATAGGTGCGAGCCTTCTTTACAT
Ccl27NM_001048179GACTGTCACCTCCAGGCTGTCTTTTCCCTTGGCGTTCTAA
Calm4NM_020036CAGAGATGTCTCACGGGTTTGTTCCTCGACGCTGATATGG
Prl4a1 NM_011165GGAGACCATAGAGAAGATTGCAAGAGTTCCAATTCAGA
LipgNM_010720CCAAACCAAAAACCTGCTTGCGCCGGGAAGTAACAATAGA
Htra3NM_001042615CCGATGTGGTGGAGAAGATTACTGGACAGCGGCACATT
Sprr2hNM_011474ACACTTGGTACTCAAGCTCTAAGGCTGCTTGCACTGCT
ArhgefbNM_152801TCCCCTAAGGCTATCAAAGGAGGCATATTCTTTTTCAGTGTCC
Derl3NM_024440GGGATTCGGCTTCTTTTTCAACATGAAAACGAAGTCAGCCTT
Herpud1NM_022331CCTCAGCATCCTTTACTTCTCTCTGTCTGAACGGAAACCA
Creld2NM_029720ACTGCACAGACGGCTTCTTCCTTGGACCAGAGCAGGTCTT
Hsp90b1NM_011631ATGGCACAGTGGAAGAGGACTGCGTTTAACCCATCCAACT
Ddit3NM_007837CACCTATATCTCATCCCCAGGATGTGCGTGTGACCTCT
Hspa5NM_0011634TGCAGCAGGACATCAAGTTCTTTCTTCTGGGGCAAATGTC
18SNR_003278GCAATTATTCCCCATGAACGGGCCTCACTAAACCATCCAA

In situ hybridization

The localization of mRNAs within tissues was performed as described previously (Ain et al. 2003, Wiemers et al. 2003). Cryosections (10 μm) of tissues were prepared and stored at −80 °C until used. Plasmids containing cDNAs for mouse Rimklb, Derl3, Hspa5 and Hsp90b1 were used as templates to synthesize sense and antisense digoxigenin labeled riboprobes according to the manufacturer's instructions (Roche Molecular Biochemicals). Images were captured using a Leica MZFIII stereomicroscope (Leica Microsystems GmbH, Welzlar, Germany) or a Nikon Eclipse 55i microscope (Nikon Instruments, Inc., Melville, NY, USA), both equipped with Leica CCD cameras (Leica).

Statistical analysis

Statistical analyses were performed using the R Statistical Software (http://www.r-project.org). Statistical comparisons between two means were determined with Student's t-test or Welch's t-test, depending on the homogeneity of variances.

Results

Mice possessing null mutations at the Prl8a2 locus reproduce within the normal range but unlike WT mice do not effectively adapt when exposed to hypoxic conditions during pregnancy (Alam et al. 2007). This mutant mouse model was used as a tool to identify downstream actions of PRL8A2 signaling. We used DNA microarray analysis to examine the consequences of PRL8A2 deficiency on gene expression at gestation day 7.5. Gestation day 7.5 is associated with robust Prl8a2 expression and represents a pivotal time point in decidual development and the establishment of the placenta. Probe sets for 57 transcripts exhibited a greater than or equal to twofold change in expression between Prl8a2 null and WT tissues. Thirty-four transcripts were significantly downregulated and 23 transcripts were significantly upregulated in the Prl8a2 null tissues (P<0.05, Tables 2 and 3). The complete dataset has been deposited at the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/; accession number GSE60220). Pathway analyses of the transcriptome data were not informative.

Table 2

List of transcripts downregulated (greater than or equal to twofold) in implantation sites of the PRL8A2 deficient mouse.

Gene nameSymbolGenBank accession no.FunctionRatio (null/WT)
Prolactin family 8, subfamily A, member 2Prl8a2NM_010088Hormone/cytokine0.00
Ribosomal modification protein rimK-like family member BRimklbAV271892ATP binding, amino acid ligase activity, glutathione synthase activity0.10
Kallikrein related peptidase 7Klk7BB283507Trypsin-like serine protease0.22
Midline 1Mid1BG073178Microtubule associated0.25
Chemokine (C-C motif) ligand 27aCcl27a NM_011336Chemokine, leukocyte recruitment0.28
Predicted gene, EG633640EG633640BG068672Unknown0.28
Proline rich 9A030004J04RikBB150166Unknown0.30
Orosomucoid 1Orm1BE628912Transporter activity/immune-related0.30
Calmodulin 4Calm4NM_020036Calcium signaling0.35
Porcupine homologPorcnAB036749Wnt signaling pathway0.35
Predicted gene 9780MGI:3710532AI508243Unknown0.36
Expressed sequence tagAV271189Unknown0.40
Orosomucoid 2Orm2NM_011016Transporter activity/immune-related0.40
Cellular retinoic acid binding proteinCrabp2BC018397Retinoic acid transport0.40
Expressed sequence tagBG083989Unknown0.40
Lipase, endothelialLipgBC020991Lipid metabolism0.41
A disintegrin-like and metalloproteinase with thrombospondin type 1 motif, 5Adamts5BB658835Integrin-mediated signaling, metalloproteinase0.41
Prolactin family 4, subfamily A, member 1Prl4a1NM_011165Hormone/cytokine0.42
HtrA serine peptidase 3Htra3NM_030127Serine protease0.43
Expressed sequence tagBM115786Unknown0.43
Small proline-rich protein 2HSprr2hNM_011474Epithelial barrier0.43
Neuromedin UNmuNM_019515Neuropeptide signaling0.43
PR domain containing 16Prdm16BB356786Transcription coregulator0.44
Endogenous retroviral sequence 3Erv3AK005451Unknown0.44
Carcinoembryonic antigen-related cell adhesion molecule 9Ceacam9NM_011927Immune-related0.44
Expressed sequence tagAU067772Unknown0.45
Expressed sequence tagBB712583Unknown0.45
Guanylate cyclase activator 2aGuca2aNM_008190Activator of guanylate cyclase0.45
Calmodulin-like 3Calml3NM_027416Calcium signaling0.46
Shisa homolog 3Shisa3AV277495FGF and WNT signaling0.46
Histidine ammonia lyaseHalL07645Histidine catabolism0.46
LRRN4 C-terminal likeLrrn4clBB783125Unknown0.46
Predicted gene 9746D14Ertd449eBG072279Unknown0.48
Rac/Cdc42 guanine nucleotide exchange factor 6Arhgef6NM_152801Rho GTPase guanine nucleotide exchange factor0.50
Table 3

List of transcripts upregulated (greater than or equal to twofold) in implantation sites of the PRL8A2 deficient mouse.

Gene nameSymbolGenBank accession no.FunctionRatio (null/WT)
Platelet-derived growth factor receptor-likePdgfrlAk004179Similarity to ligand binding domain of Pdgfr11.48
Der1-like domain family, member 3Derl3AK007348Endoplasmic reticulum stress response6.29
Expressed sequence tagAK007420Unknown4.65
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1Smarcb1BB820473Chromatin remodeling3.84
Nicotinamide nucleotide transhydrogenaseNntBB205930Mitochondrial enzyme, production of NADPH3.20
CDC14 cell division cycle 14 homolog BCdc14bAK013228Protein tyrosine phosphatase, cell cycle control3.10
Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1Herpud1NM_022331Endoplasmic reticulum stress response3.00
EF-hand calcium binding domain 7Efcab7BC020077Calcium binding2.91
Expressed sequence tagBB629079Unknown2.84
Cysteine-rich with EGF-like domains 2Creld2AK017880Endoplasmic reticulum stress response/calcium binding2.75
Expressed sequence tagAK007420Unknown2.69
Rab9 effector protein with kelch motifsRabepkAA217054Facilitates transport of mannose 6-phosphate receptor2.60
Arrestin domain containing 3Arrdc3AW556597Associated with G protein-coupled receptor signaling2.44
γ-aminobutyric acid A receptor, subunit α 2Gabra2BB339336GABA-A receptor, ligand-gated chloride channel2.39
Immunoglobulin κ constantIgkcAV057155Light chain of antibodies2.38
HemochromatosisHfeAJ306425Iron transport2.38
Predicted gene, EG665955EG665955BF580235Unknown2.23
DNA segment, Chr 13, ERATO Doi 666, expressedD13Ertd666eBG070282Unknown2.17
DNA-damage inducible transcript 3Ddit3NM_007837Endoplasmic reticulum stress response2.13
Heat shock protein 5Hspa5AJ002387Endoplasmic reticulum stress response2.07
Uroplakin 1BUpk1bBB427704Member of the tetraspanin family, signal transduction2.06
Expressed sequence tagBG862223Unknown2.04
Heat shock protein 90, β, member 1Hsp90b1NM_011631Endoplasmic reticulum stress response2.00

Nine genes were confirmed with decreased expression in gestation day 7.5 Prl8a2 null implantation sites (e.g. Klk7, Rimklb, Ccl27, Calm4, Prl4a1, Lipg, Sprr2h, Htra3, Arhgef6; Table 2, Fig. 1). These include potential decidual, endothelial and trophoblast cell targets positively regulated by PRL8A2. Rmklb transcripts were localized to a subset of cells within the anti-mesometrial decidual compartment of the gestation day 7.5 implantation site (Fig. 2).

Figure 1

Download Figure

Figure 1

Validation of expression profiles of genes downregulated in Prl8a2 null conceptus tissues. Total RNA samples from WT (+/+) and Prl8a2 (−/−) null gestation day 7.5 implantation sites were subjected to quantitative RT-PCR (SYBR Green, ΔΔCt method) with transcript specific primer sets. Reactions were performed in duplicate. 18S rRNA served as an internal control. Please note the significant downregulation genes in the Prl8a2 null tissues. Asterisks denote significant differences between WT and Prl8a2 null samples, P<0.05.

Citation: REPRODUCTION 149, 6; 10.1530/REP-15-0107

Figure 2

Download Figure

Figure 2

In situ detection of Rimklb mRNA within implantation sites on gestation day 7.5. (A) Schematic representation of implantation sites from day 7.5 of gestation. The black box indicates the region of images shown in (B) and (C). Gestation day 7.5 implantation sites of both WT (+/+, B) and Prl8a2 null (−/−, C) mice were subjected to in situ hybridization with a Rimklb specific antisense RNA probe. Please note the significant downregulation of Rimklb mRNA in the anti-mesometrial compartments of Prl8a2 null tissues.

Citation: REPRODUCTION 149, 6; 10.1530/REP-15-0107

Six genes were confirmed with increased expression in gestation day 7.5 Prl8a2 null implantation sites (Derl3, Herpud1, Creld2, Hsp90b1, Ddit3, and Hspa5; Table 3, Fig. 3). Each of these transcripts encodes proteins that participate in the endoplasmic reticulum (ER) stress response. Derl3, Hspa5, and Hsp90b1 transcripts were localized to the anti-mesometrial decidual compartment and were dramatically upregulated in the Prl8a2 null mouse (Fig. 4).

Figure 3

Download Figure

Figure 3

Validation of expression profiles of genes upregulated in Prl8a2 null conceptus tissues. Total RNA samples from WT (+/+) and Prl8a2 (−/−) null gestation day 7.5 implantation sites were subjected to quantitative RT-PCR (SYBR Green, ΔΔCt method) with transcript specific primer sets. Reactions were performed in duplicate. 18S rRNA served as an internal control. Please note the significant upregulation genes in the Prl8a2 null tissues. Asterisks denote significant differences between WT and Prl8a2 null samples, P<0.05.

Citation: REPRODUCTION 149, 6; 10.1530/REP-15-0107

Figure 4

Download Figure

Figure 4

In situ detection of Derl3, Hspa5, Hsp90b1 mRNA within implantation sites on gestation day 7.5. (A) Schematic representation of implantation sites from day 7.5 of gestation. The black box indicates the region of images shown in (B-C). Serial cryosections from gestation day 7.5 implantation sites of both WT (+/+, B, D and F) and Prl8a2 null (−/−, C, E and G) mice were subjected to in situ hybridization with a gene specific antisense RNA probes. Please note the significant upregulation of Derl3, Hspa5, and Hsp90b1 in the anti-mesometrial compartment of the Prl8a2 null uterus.

Citation: REPRODUCTION 149, 6; 10.1530/REP-15-0107

Discussion

The uterine deciduum is a transitory tissue with the responsibilities of modulating hemochorial placentation. A PRL-related cytokine, PRL8A2, is expressed in a temporally- and spatially-precise pattern within the uterine deciduum during the establishment of pregnancy. PRL8A2 facilitates pregnancy-associated uterine adaptations to physiological stressors (Alam et al. 2007). In this report, we identified potential targets of PRL8A2 action and determined that PRL8A2 acts in a pathway that restrains activation of decidual cell ER stress.

The ER stress response is a cellular process facilitating adaptations to harmful conditions, including cellular damage, and if severe or prolonged leads to cell death (Xu et al. 2005, Yoshida 2007, Zhang & Kaufman 2008). Implantation of the embryo within the uterus elicits many of the hallmarks of an inflammatory response (Finn 1986, Mor et al. 2011). Inflammation leads to cellular injury and activation of ER stress (Zhang & Kaufman 2008). An assortment of pregnancy-related disorders, including early pregnancy loss, preeclampsia and intrauterine growth restriction, are associated with increased decidual cell ER stress responses (Lian et al. 2011, Liu et al. 2011, Loset et al. 2011, Gao et al. 2012). Pregnancy related disease occurs when the harmful inflammatory stimuli are excessive or the decidual cell adaptations are inadequate. Consequently, during the establishment of a successful pregnancy mechanisms must exist to thwart excessive or prolonged ER stress responses, which could compromise embryo survival.

The PRL family is part of a conserved decidual cell adaptation regulatory pathway. PRL and a subgroup of PRL related genes are expressed in decidua cells of the rat, mouse, and human (Orwig et al. 1997a, Telgmann & Gellersen 1998). PRL has a decidua-protective role in the rat and mouse. It inhibits the expression of decidual genes that interfere with the maintenance of pregnancy (Tessier et al. 2001, Bao et al. 2007). Complementary observations are apparent in the human. PRL is produced by decidua and its production is impaired in decidua from patients with recurrent pregnancy loss (Salker et al. 2010, Teklenburg et al. 2010a,b) and correlates with failures in optimal embryo recognition (Brosens & Gellersen 2010, Weimar et al. 2012). PRL8A2, a PRL-related protein, is abundantly expressed in decidua of the mouse and rat, especially within anti-mesometrial decidua (Orwig et al. 1997a,b,c, Rasmussen et al. 1997). In the absence of PRL8A2, transcripts associated with ER stress are significantly upregulated in the anti-mesometrial decidua. Insights into the mechanism of PRL8A2 action are modest. PRL8A2 is a secreted heparin-binding cytokine (Rasmussen et al. 1996, Wang et al. 2000, Alam et al. 2008). Although PRL8A2 is structurally related to PRL, it does not bind the PRL receptor (Rasmussen et al. 1996). Collectively, the results suggest that the decidua-protective functions associated with PRL may extend to other members of the PRL family, including PRL8A2.

DDIT3 is a component of the ER stress response targeted by PRL8A2 and may represent a critical modulator of the integrity of decidual cells. DDIT3 is also known as CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP) and is a negative modulator of C/EBP transcriptional regulation (Ron & Habener 1992, Tang & Lane 2000). C/EBPβ is a key transcriptional mediator of the actions of progesterone on decidual cell differentiation (Bagchi et al. 2006, Mantena et al. 2006, Wang et al. 2010, Ramathal et al. 2011). Uterine stromal cells of C/EBPβ null female mice fail to undergo decidualization and are unresponsive to the actions of progesterone (Bagchi et al. 2006, Mantena et al. 2006). Progesterone signaling and C/EBPβ also synergize in the differentiation of primate endometrial stromal cells to decidual cells (Pohnke et al. 1999, Christian et al. 2002a,b, Kannan et al. 2010). This leads us to speculate that by restraining DDIT3 expression, PRL8A2 effectively facilitates the actions of progesterone and C/EBPβ on decidual cell development and integrity.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported in part by research grants from the National Institutes of Health (HD020676, HD055523, HD066406).

References

  • AinRCanhamLNSoaresMJ2003Gestation stage-dependent intrauterine trophoblast cell invasion in the rat and mouse: novel endocrine phenotype and regulation. Developmental Biology260176190. (doi:10.1016/S0012-1606(03)00210-0)

  • AinRDaiGDunmoreJHGodwinARSoaresMJ2004A prolactin family paralog regulates reproductive adaptations to a physiological stressor. PNAS1011654316548. (doi:10.1073/pnas.0406185101)

  • AinRKonnoTCanhamLNSoaresMJ2006Phenotypic analysis of the rat placenta. Methods in Molecular Medicine121295313. (doi:10.1385/1-59259-983-4:293)

  • AlamSMKAinRKonnoTHo-ChenJKSoaresMJ2006The rat prolactin gene family locus: species-specific gene family expansion. Mammalian Genome17858877. (doi:10.1007/s00335-006-0010-1)

  • AlamSMKKonnoTDaiGLuLWangDDunmoreJHGodwinARSoaresMJ2007A uterine decidual cell cytokine ensures pregnancy-dependent adaptations to a physiological stressor. Development134407415. (doi:10.1242/dev.02743)

  • AlamSMKKonnoTSahgalNLuLSoaresMJ2008Decidual cells produce a heparin-binding prolactin family cytokine with putative intrauterine regulatory actions. Journal of Biological Chemistry2831895718968. (doi:10.1074/jbc.M801826200)

  • AlamSMKonnoTRumiMADongYWeinerCPSoaresMJ2010Prolactin family of the guinea pig, Cavia porcellus. Endocrinology15139183928. (doi:10.1210/en.2010-0239)

  • AplinJ2000Maternal influences on placental development. Seminars in Cell & Developmental Biology11115125. (doi:10.1006/scdb.2000.0157)

  • BagchiMKMantenaSRKannanABagchiIC2006Control of uterine cell proliferation and differentiation by C/EBPβ. Cell Cycle5922925. (doi:10.4161/cc.5.9.2712)

  • BanyBMCrossJC2006Post-implantation mouse conceptuses produce paracrine signals that regulate the uterine endometrium undergoing decidualization. Developmental Biology294445456. (doi:10.1016/j.ydbio.2006.03.006)

  • BaoLTessierCPrigent-TessierALiFBuzzioOLCallegariEAHorsemanNDGiboriG2007Decidual prolactin silences the expression of genes detrimental to pregnancy. Endocrinology14823262334. (doi:10.1210/en.2006-1643)

  • BittorfTJasterRSoaresMJSeilerJBrockJFrieseKMüllerH2000Induction of erythroid proliferation and differentiation by a trophoblast-specific cytokine involves activation of the JAK/STAT pathway. Journal of Molecular Endocrinology25253262. (doi:10.1677/jme.0.0250253)

  • Bole-FeysotCGoffinVEderyMBinartNKellyPA1998Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews19225268. (doi:10.1210/edrv.19.3.0334)

  • BrosensJJGellersenB2010Something new about early pregnancy: decidual biosensoring and natural embryo selection. Ultrasound in Obstetrics & Gynecology3615. (doi:10.1002/uog.7714)

  • ChristianMPohnkeYKempfRGellersenBBrosensJJ2002aFunctional association of PR and CCAAT/enhancer-binding protein β isoforms: promoter-dependent cooperation between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory protein and PR-A in human endometrial stromal cells. Molecular Endocrinology16141154. (doi:10.1210/mend.16.1.0763)

  • ChristianMZhangXSchneider-MerckTUntermanTGGellersenBWhiteJOBrosensJJ2002bCyclic AMP-induced forkhead transcription factor, FKHR, cooperates with CCAAT/enhancer-binding protein β in differentiating human endometrial stromal cells. Journal of Biological Chemistry2772082520832. (doi:10.1074/jbc.M201018200)

  • CookeNELiebhaberSA1995Molecular biology of the growth hormone-prolactin gene system. Vitamins and Hormones50385459.

  • DebKReeseJPariaBC2006Methodologies to study implantation in mice. Methods in Molecular Medicine121934. (doi:10.1385/1-59259-983-4:007)

  • DorshkindKHorsemanND2001Anterior pituitary hormones, stress, and immune system homeostasis. Bioessays23288294. (doi:10.1002/1521-1878(200103)23:3<288::AID-BIES1039>3.0.CO;2-P)

  • FinnCA1986Implantation, menstruation and inflammation. Biological Reviews of the Cambridge Philosophical Society61313328. (doi:10.1111/j.1469-185X.1986.tb00657.x)

  • GaoH-JZhuY-MHeW-HLiuA-XDongM-YJinMShengJ-ZHuangH-F2012Endoplasmic reticulum stress induced by oxidative stress in decidual cells: a possible mechanism of early pregnancy loss. Molecular Biology Reports3991799186. (doi:10.1007/s11033-012-1790-x)

  • GellersenBBrosensIABrosensJJ2007Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Seminars in Reproductive Medicine25445453. (doi:10.1055/s-2007-991042)

  • GuYSoaresMJSrivastavaRKGiboriG1994Expression of decidual prolactin-related protein in the rat decidua. Endocrinology13514221427. (doi:10.1210/endo.135.4.7925104)

  • HeringtonJLBanyBM2009Do molecular signals from the conceptus influence endometrium decidualization in rodents?Journal of Experimental Zoology. Part B Molecular and Developmental Evolution312797816. (doi:10.1002/jez.b.21308)

  • HorsemanNDGregersonKA2014Prolactin actions. Journal of Molecular Endocrinology52R95R106. (doi:10.1530/JME-13-0220)

  • HorsemanNDZhaoWMontecino-RodriguezETanakaMNakashimaKEngleSJSmithFMarkoffEDorshkindK1997Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO Journal1669266935. (doi:10.1093/emboj/16.23.6926)

  • JabbourHNCritchleyHOD2001Potential roles of decidual prolactin in early pregnancy. Reproduction121197205. (doi:10.1530/rep.0.1210197)

  • JacksonDVolpertOVBouckNLinzerDI1994Stimulation and inhibition of angiogenesis by placental proliferin and proliferin-related protein. Science26615811584. (doi:10.1126/science.7527157)

  • KannanAFazleabasATBagchiICBagchiMK2010The transcription factor C/EBPβ is a marker of uterine receptivity and expressed at the implantation site in the primate. Reproductive Sciences17434443. (doi:10.1177/1933719110361384)

  • LianIALosetMMundalSBFenstadMHJohnsonMPEideIPBjorgeLFreedKAMosesEKAustgulenR2011Increased endoplasmic reticulum stress in decidual tissue from pregnancies complicated by fetal growth restriction with and without pre-eclampsia. Placenta32823829. (doi:10.1016/j.placenta.2011.08.005)

  • LinJLinzerDI1999Induction of megakaryocyte differentiation by a novel pregnancy-specific hormone. Journal of Biological Chemistry2742148521489. (doi:10.1074/jbc.274.30.21485)

  • LinJPooleJLinzerDIH1997Three new members of the mouse prolactin/growth hormone family are homologous to proteins expressed in the rat. Endocrinology13855415549. (doi:10.1210/endo.138.12.5626)

  • Lindblad-TohKWadeCMMikkelsenTSKarlssonEKJaffeDBKamalMClampMChangJLKulbokasEJIIIZodyMC2005Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature438803819. (doi:10.1038/nature04338)

  • LiuA-XHeW-HYinL-JLvP-PZhangYShengJ-ZLeungPCKHuangH-F2011Sustained endoplasmic stress as a cofactor of oxidative stress in decidual cells from patients with early pregnancy loss. Journal of Clinical Endocrinology and Metabolism96E493E497. (doi:10.1210/jc.2010-2192)

  • LosetMMundalSBJohnsonMPFenstadMHFreedKALianIAEideIPBjorgeLBlangeroJMosesEK2011A transcriptional profile of the decidua in preeclampsia. American Journal of Obstetrics and Gynecology204e1e27. (doi:10.1016/j.ajog.2010.08.043)

  • MantenaSRKannanACheonYPLiQJohnsonPFBagchiICBagchiMK2006C/EBPβ is a critical mediator of steroid hormone-regulated cell proliferation and differentiation in the uterine epithelium and stroma. PNAS10318701875. (doi:10.1073/pnas.0507261103)

  • MorGCardenasIAbrahamsVGullerS2011Inflammation and pregnancy: the role of the immune system at the implantation site. Annals of the New York Academy of Sciences12218087. (doi:10.1111/j.1749-6632.2010.05938.x)

  • OrwigKESoaresMJ1999Transcriptional activation of the decidual/trophoblast prolactin-related protein gene. Endocrinology14040324039. (doi:10.1210/endo.140.9.6954)

  • OrwigKERasmussenCASoaresMJ1997aDecidual signals in the establishment of pregnancy: the prolactin family. Trophoblast Research10329343.

  • OrwigKEDaiGRasmussenCASoaresMJ1997bDecidual/trophoblast prolactin related protein: characterization of gene structure and cell-specific expression. Endocrinology13824912500. (doi:10.1210/endo.138.6.5155)

  • OrwigKEIshimuraRMüllerHLiuBSoaresMJ1997cIdentification and characterization of a mouse homolog for decidual/trophoblast prolactin-related protein. Endocrinology13955115517. (doi:10.1210/endo.138.12.5628)

  • PohnkeYKempfRGellersenB1999CCAAT/enhancer-binding proteins are mediators in the protein kinase A-dependent activation of the decidual prolactin promoter. Journal of Biological Chemistry2742480824818. (doi:10.1074/jbc.274.35.24808)

  • RamathalCWangWHuntEBagchiICBagchiMK2011Transcription factor CCAAT enhancer-binding protein β (C/EBPβ) regulates the formation of a unique extracellular matrix that controls uterine stromal differentiation and embryo implantation. Journal of Biological Chemistry2861986019871. (doi:10.1074/jbc.M110.191759)

  • RasmussenCAHashizumeKOrwigKEXuLSoaresMJ1996Decidual prolactin-related protein: heterologous expression and characterization. Endocrinology13755585566. (doi:10.1210/endo.137.12.8940384)

  • RasmussenCAOrwigKEVellucciSSoaresMJ1997Dual expression of prolactin-related protein in decidua and trophoblast tissues during pregnancy. Biology of Reproduction55647654. (doi:10.1095/biolreprod56.3.647)

  • RobyKFDebSGiboriGSzpirerCLevanGKwokSCMSoaresMJ1993Decidual prolactin related protein: identification, molecular cloning and characterization. Journal of Biological Chemistry26831363142.

  • RonDHabenerJF1992CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes and Development6439453. (doi:10.1101/gad.6.3.439)

  • SalkerMTeklenburgGMolokhiaMLaverySTrewGAojanepongTMardonHJLokugamageAURaiRLandlesC2010Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS ONE5e10287. (doi:10.1371/journal.pone.0010287)

  • SoaresMJ2004The prolactin and growth hormone families: pregnancy-specific hormones/cytokines at the maternal–fetal interface. Reproductive Biology and Endocrinology251. (doi:10.1186/1477-7827-2-51)

  • SoaresMJKonnoTAlamSMK2007The prolactin family: effectors of pregnancy-specific adaptations. Trends in Endocrinology and Metabolism18114121. (doi:10.1016/j.tem.2007.02.005)

  • TangQ-QLaneMD2000Role of C/EBP homologous protein (CHOP-10) in the programmed activation of CCAAT/enhancer-binding protein-β during adipogenesis. PNAS971244612450. (doi:10.1073/pnas.220425597)

  • TeklenburgGSalkerMHeijnenCMacklonNSBrosensJJ2010aThe molecular basis of recurrent pregnancy loss: impaired natural embryo selection. Molecular Human Reproduction16886895. (doi:10.1093/molehr/gaq079)

  • TeklenburgGSalkerMMolokhiaMLaverySTrewGAojanepongTMardonHJLokugamageAURaiRLandlesC2010bNatural selection of human embryos: decidualizing endometrial stromals cells serve as sensors of embryo quality upon implantation. PLoS ONE5e10258. (doi:10.1371/journal.pone.0010258)

  • TelgmannRGellersenB1998Marker genes of decidualization: activation of the decidual prolactin gene. Human Reproduction Update4472479. (doi:10.1093/humupd/4.5.472)

  • TessierCPrigent-TessierAFerguson-GottschallSGuYGiboriG2001PRL antiapoptotic effect in the rat decidua involves the PI3K/protein kinase B-mediated inhibition of caspase-3 activity. Endocrinology14240864094. (doi:10.1210/endo.142.9.8381)

  • UshizawaKHashizumeK2006Biology of the prolactin family in bovine placenta, II. Bovine prolactin-related proteins: their expression, structure, and proposed roles. Animal Science Journal771827. (doi:10.1111/j.1740-0929.2006.00315.x)

  • WangDIshimuraRWaliaDSMüllerHDaiGHuntJSLeeNALeeJJSoaresMJ2000Eosinophils are cellular targets of the novel uteroplacental heparin-binding cytokine, decidual/trophoblast prolactin-related protein. Journal of Endocrinology1671529. (doi:10.1677/joe.0.1670015)

  • WangWLiQBagchiICBagchiMK2010The CCAAT/enhancer binding protein β is a critical regulator of steroid-induced mitotic expansion of uterine stromal cells during decidualization. Endocrinology15139293940. (doi:10.1210/en.2009-1437)

  • WeimarCHEKavelaarsABrosensJJGellersenBde Vreeden-ElbertseJMTHeijnenCJMacklonNS2012Endometrial stromal cells of women with recurrent miscarriage fail to discriminate between high- and low-quality human embryos. PLoS ONE7e41424. (doi:10.1371/journal.pone.0041424)

  • WiemersDOShaoL-JAinRDaiGSoaresMJ2003The mouse prolactin gene family locus. Endocrinology144313325. (doi:10.1210/en.2002-220724)

  • XuCBailly-MaitreBReedJC2005Endoplasmic reticulum stress: cell life and death decisions. Journal of Clinical Investigation11526562664. (doi:10.1172/JCI26373)

  • YoshidaH2007ER stress and diseases. FEBS Journal274630658. (doi:10.1111/j.1742-4658.2007.05639.x)

  • ZhangKKaufmanRJ2008From endoplasmic-reticulum stress to the inflammatory response. Nature454455462. (doi:10.1038/nature07203)

S M K Alam is now at Department of Biochemistry, Bagabandhu Sheikh Mujib Medical University, Dhaka, Bangladesh

T Konno is now at Department of Agro-Environmental Sciences, Faculty of Agriculture, University of the Ryukyus, 1 Senbaru, Nishihara, Okinawa 903-0213, Japan

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 359 359 61
PDF Downloads 107 107 11

Altmetrics

Figures

  • View in gallery

    Validation of expression profiles of genes downregulated in Prl8a2 null conceptus tissues. Total RNA samples from WT (+/+) and Prl8a2 (−/−) null gestation day 7.5 implantation sites were subjected to quantitative RT-PCR (SYBR Green, ΔΔCt method) with transcript specific primer sets. Reactions were performed in duplicate. 18S rRNA served as an internal control. Please note the significant downregulation genes in the Prl8a2 null tissues. Asterisks denote significant differences between WT and Prl8a2 null samples, P<0.05.

  • View in gallery

    In situ detection of Rimklb mRNA within implantation sites on gestation day 7.5. (A) Schematic representation of implantation sites from day 7.5 of gestation. The black box indicates the region of images shown in (B) and (C). Gestation day 7.5 implantation sites of both WT (+/+, B) and Prl8a2 null (−/−, C) mice were subjected to in situ hybridization with a Rimklb specific antisense RNA probe. Please note the significant downregulation of Rimklb mRNA in the anti-mesometrial compartments of Prl8a2 null tissues.

  • View in gallery

    Validation of expression profiles of genes upregulated in Prl8a2 null conceptus tissues. Total RNA samples from WT (+/+) and Prl8a2 (−/−) null gestation day 7.5 implantation sites were subjected to quantitative RT-PCR (SYBR Green, ΔΔCt method) with transcript specific primer sets. Reactions were performed in duplicate. 18S rRNA served as an internal control. Please note the significant upregulation genes in the Prl8a2 null tissues. Asterisks denote significant differences between WT and Prl8a2 null samples, P<0.05.

  • View in gallery

    In situ detection of Derl3, Hspa5, Hsp90b1 mRNA within implantation sites on gestation day 7.5. (A) Schematic representation of implantation sites from day 7.5 of gestation. The black box indicates the region of images shown in (B-C). Serial cryosections from gestation day 7.5 implantation sites of both WT (+/+, B, D and F) and Prl8a2 null (−/−, C, E and G) mice were subjected to in situ hybridization with a gene specific antisense RNA probes. Please note the significant upregulation of Derl3, Hspa5, and Hsp90b1 in the anti-mesometrial compartment of the Prl8a2 null uterus.

References

AinRCanhamLNSoaresMJ2003Gestation stage-dependent intrauterine trophoblast cell invasion in the rat and mouse: novel endocrine phenotype and regulation. Developmental Biology260176190. (doi:10.1016/S0012-1606(03)00210-0)

AinRDaiGDunmoreJHGodwinARSoaresMJ2004A prolactin family paralog regulates reproductive adaptations to a physiological stressor. PNAS1011654316548. (doi:10.1073/pnas.0406185101)

AinRKonnoTCanhamLNSoaresMJ2006Phenotypic analysis of the rat placenta. Methods in Molecular Medicine121295313. (doi:10.1385/1-59259-983-4:293)

AlamSMKAinRKonnoTHo-ChenJKSoaresMJ2006The rat prolactin gene family locus: species-specific gene family expansion. Mammalian Genome17858877. (doi:10.1007/s00335-006-0010-1)

AlamSMKKonnoTDaiGLuLWangDDunmoreJHGodwinARSoaresMJ2007A uterine decidual cell cytokine ensures pregnancy-dependent adaptations to a physiological stressor. Development134407415. (doi:10.1242/dev.02743)

AlamSMKKonnoTSahgalNLuLSoaresMJ2008Decidual cells produce a heparin-binding prolactin family cytokine with putative intrauterine regulatory actions. Journal of Biological Chemistry2831895718968. (doi:10.1074/jbc.M801826200)

AlamSMKonnoTRumiMADongYWeinerCPSoaresMJ2010Prolactin family of the guinea pig, Cavia porcellus. Endocrinology15139183928. (doi:10.1210/en.2010-0239)

AplinJ2000Maternal influences on placental development. Seminars in Cell & Developmental Biology11115125. (doi:10.1006/scdb.2000.0157)

BagchiMKMantenaSRKannanABagchiIC2006Control of uterine cell proliferation and differentiation by C/EBPβ. Cell Cycle5922925. (doi:10.4161/cc.5.9.2712)

BanyBMCrossJC2006Post-implantation mouse conceptuses produce paracrine signals that regulate the uterine endometrium undergoing decidualization. Developmental Biology294445456. (doi:10.1016/j.ydbio.2006.03.006)

BaoLTessierCPrigent-TessierALiFBuzzioOLCallegariEAHorsemanNDGiboriG2007Decidual prolactin silences the expression of genes detrimental to pregnancy. Endocrinology14823262334. (doi:10.1210/en.2006-1643)

BittorfTJasterRSoaresMJSeilerJBrockJFrieseKMüllerH2000Induction of erythroid proliferation and differentiation by a trophoblast-specific cytokine involves activation of the JAK/STAT pathway. Journal of Molecular Endocrinology25253262. (doi:10.1677/jme.0.0250253)

Bole-FeysotCGoffinVEderyMBinartNKellyPA1998Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews19225268. (doi:10.1210/edrv.19.3.0334)

BrosensJJGellersenB2010Something new about early pregnancy: decidual biosensoring and natural embryo selection. Ultrasound in Obstetrics & Gynecology3615. (doi:10.1002/uog.7714)

ChristianMPohnkeYKempfRGellersenBBrosensJJ2002aFunctional association of PR and CCAAT/enhancer-binding protein β isoforms: promoter-dependent cooperation between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory protein and PR-A in human endometrial stromal cells. Molecular Endocrinology16141154. (doi:10.1210/mend.16.1.0763)

ChristianMZhangXSchneider-MerckTUntermanTGGellersenBWhiteJOBrosensJJ2002bCyclic AMP-induced forkhead transcription factor, FKHR, cooperates with CCAAT/enhancer-binding protein β in differentiating human endometrial stromal cells. Journal of Biological Chemistry2772082520832. (doi:10.1074/jbc.M201018200)

CookeNELiebhaberSA1995Molecular biology of the growth hormone-prolactin gene system. Vitamins and Hormones50385459.

DebKReeseJPariaBC2006Methodologies to study implantation in mice. Methods in Molecular Medicine121934. (doi:10.1385/1-59259-983-4:007)

DorshkindKHorsemanND2001Anterior pituitary hormones, stress, and immune system homeostasis. Bioessays23288294. (doi:10.1002/1521-1878(200103)23:3<288::AID-BIES1039>3.0.CO;2-P)

FinnCA1986Implantation, menstruation and inflammation. Biological Reviews of the Cambridge Philosophical Society61313328. (doi:10.1111/j.1469-185X.1986.tb00657.x)

GaoH-JZhuY-MHeW-HLiuA-XDongM-YJinMShengJ-ZHuangH-F2012Endoplasmic reticulum stress induced by oxidative stress in decidual cells: a possible mechanism of early pregnancy loss. Molecular Biology Reports3991799186. (doi:10.1007/s11033-012-1790-x)

GellersenBBrosensIABrosensJJ2007Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Seminars in Reproductive Medicine25445453. (doi:10.1055/s-2007-991042)

GuYSoaresMJSrivastavaRKGiboriG1994Expression of decidual prolactin-related protein in the rat decidua. Endocrinology13514221427. (doi:10.1210/endo.135.4.7925104)

HeringtonJLBanyBM2009Do molecular signals from the conceptus influence endometrium decidualization in rodents?Journal of Experimental Zoology. Part B Molecular and Developmental Evolution312797816. (doi:10.1002/jez.b.21308)

HorsemanNDGregersonKA2014Prolactin actions. Journal of Molecular Endocrinology52R95R106. (doi:10.1530/JME-13-0220)

HorsemanNDZhaoWMontecino-RodriguezETanakaMNakashimaKEngleSJSmithFMarkoffEDorshkindK1997Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO Journal1669266935. (doi:10.1093/emboj/16.23.6926)

JabbourHNCritchleyHOD2001Potential roles of decidual prolactin in early pregnancy. Reproduction121197205. (doi:10.1530/rep.0.1210197)

JacksonDVolpertOVBouckNLinzerDI1994Stimulation and inhibition of angiogenesis by placental proliferin and proliferin-related protein. Science26615811584. (doi:10.1126/science.7527157)

KannanAFazleabasATBagchiICBagchiMK2010The transcription factor C/EBPβ is a marker of uterine receptivity and expressed at the implantation site in the primate. Reproductive Sciences17434443. (doi:10.1177/1933719110361384)

LianIALosetMMundalSBFenstadMHJohnsonMPEideIPBjorgeLFreedKAMosesEKAustgulenR2011Increased endoplasmic reticulum stress in decidual tissue from pregnancies complicated by fetal growth restriction with and without pre-eclampsia. Placenta32823829. (doi:10.1016/j.placenta.2011.08.005)

LinJLinzerDI1999Induction of megakaryocyte differentiation by a novel pregnancy-specific hormone. Journal of Biological Chemistry2742148521489. (doi:10.1074/jbc.274.30.21485)

LinJPooleJLinzerDIH1997Three new members of the mouse prolactin/growth hormone family are homologous to proteins expressed in the rat. Endocrinology13855415549. (doi:10.1210/endo.138.12.5626)

Lindblad-TohKWadeCMMikkelsenTSKarlssonEKJaffeDBKamalMClampMChangJLKulbokasEJIIIZodyMC2005Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature438803819. (doi:10.1038/nature04338)

LiuA-XHeW-HYinL-JLvP-PZhangYShengJ-ZLeungPCKHuangH-F2011Sustained endoplasmic stress as a cofactor of oxidative stress in decidual cells from patients with early pregnancy loss. Journal of Clinical Endocrinology and Metabolism96E493E497. (doi:10.1210/jc.2010-2192)

LosetMMundalSBJohnsonMPFenstadMHFreedKALianIAEideIPBjorgeLBlangeroJMosesEK2011A transcriptional profile of the decidua in preeclampsia. American Journal of Obstetrics and Gynecology204e1e27. (doi:10.1016/j.ajog.2010.08.043)

MantenaSRKannanACheonYPLiQJohnsonPFBagchiICBagchiMK2006C/EBPβ is a critical mediator of steroid hormone-regulated cell proliferation and differentiation in the uterine epithelium and stroma. PNAS10318701875. (doi:10.1073/pnas.0507261103)

MorGCardenasIAbrahamsVGullerS2011Inflammation and pregnancy: the role of the immune system at the implantation site. Annals of the New York Academy of Sciences12218087. (doi:10.1111/j.1749-6632.2010.05938.x)

OrwigKESoaresMJ1999Transcriptional activation of the decidual/trophoblast prolactin-related protein gene. Endocrinology14040324039. (doi:10.1210/endo.140.9.6954)

OrwigKERasmussenCASoaresMJ1997aDecidual signals in the establishment of pregnancy: the prolactin family. Trophoblast Research10329343.

OrwigKEDaiGRasmussenCASoaresMJ1997bDecidual/trophoblast prolactin related protein: characterization of gene structure and cell-specific expression. Endocrinology13824912500. (doi:10.1210/endo.138.6.5155)

OrwigKEIshimuraRMüllerHLiuBSoaresMJ1997cIdentification and characterization of a mouse homolog for decidual/trophoblast prolactin-related protein. Endocrinology13955115517. (doi:10.1210/endo.138.12.5628)

PohnkeYKempfRGellersenB1999CCAAT/enhancer-binding proteins are mediators in the protein kinase A-dependent activation of the decidual prolactin promoter. Journal of Biological Chemistry2742480824818. (doi:10.1074/jbc.274.35.24808)

RamathalCWangWHuntEBagchiICBagchiMK2011Transcription factor CCAAT enhancer-binding protein β (C/EBPβ) regulates the formation of a unique extracellular matrix that controls uterine stromal differentiation and embryo implantation. Journal of Biological Chemistry2861986019871. (doi:10.1074/jbc.M110.191759)

RasmussenCAHashizumeKOrwigKEXuLSoaresMJ1996Decidual prolactin-related protein: heterologous expression and characterization. Endocrinology13755585566. (doi:10.1210/endo.137.12.8940384)

RasmussenCAOrwigKEVellucciSSoaresMJ1997Dual expression of prolactin-related protein in decidua and trophoblast tissues during pregnancy. Biology of Reproduction55647654. (doi:10.1095/biolreprod56.3.647)

RobyKFDebSGiboriGSzpirerCLevanGKwokSCMSoaresMJ1993Decidual prolactin related protein: identification, molecular cloning and characterization. Journal of Biological Chemistry26831363142.

RonDHabenerJF1992CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes and Development6439453. (doi:10.1101/gad.6.3.439)

SalkerMTeklenburgGMolokhiaMLaverySTrewGAojanepongTMardonHJLokugamageAURaiRLandlesC2010Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS ONE5e10287. (doi:10.1371/journal.pone.0010287)

SoaresMJ2004The prolactin and growth hormone families: pregnancy-specific hormones/cytokines at the maternal–fetal interface. Reproductive Biology and Endocrinology251. (doi:10.1186/1477-7827-2-51)

SoaresMJKonnoTAlamSMK2007The prolactin family: effectors of pregnancy-specific adaptations. Trends in Endocrinology and Metabolism18114121. (doi:10.1016/j.tem.2007.02.005)

TangQ-QLaneMD2000Role of C/EBP homologous protein (CHOP-10) in the programmed activation of CCAAT/enhancer-binding protein-β during adipogenesis. PNAS971244612450. (doi:10.1073/pnas.220425597)

TeklenburgGSalkerMHeijnenCMacklonNSBrosensJJ2010aThe molecular basis of recurrent pregnancy loss: impaired natural embryo selection. Molecular Human Reproduction16886895. (doi:10.1093/molehr/gaq079)

TeklenburgGSalkerMMolokhiaMLaverySTrewGAojanepongTMardonHJLokugamageAURaiRLandlesC2010bNatural selection of human embryos: decidualizing endometrial stromals cells serve as sensors of embryo quality upon implantation. PLoS ONE5e10258. (doi:10.1371/journal.pone.0010258)

TelgmannRGellersenB1998Marker genes of decidualization: activation of the decidual prolactin gene. Human Reproduction Update4472479. (doi:10.1093/humupd/4.5.472)

TessierCPrigent-TessierAFerguson-GottschallSGuYGiboriG2001PRL antiapoptotic effect in the rat decidua involves the PI3K/protein kinase B-mediated inhibition of caspase-3 activity. Endocrinology14240864094. (doi:10.1210/endo.142.9.8381)

UshizawaKHashizumeK2006Biology of the prolactin family in bovine placenta, II. Bovine prolactin-related proteins: their expression, structure, and proposed roles. Animal Science Journal771827. (doi:10.1111/j.1740-0929.2006.00315.x)

WangDIshimuraRWaliaDSMüllerHDaiGHuntJSLeeNALeeJJSoaresMJ2000Eosinophils are cellular targets of the novel uteroplacental heparin-binding cytokine, decidual/trophoblast prolactin-related protein. Journal of Endocrinology1671529. (doi:10.1677/joe.0.1670015)

WangWLiQBagchiICBagchiMK2010The CCAAT/enhancer binding protein β is a critical regulator of steroid-induced mitotic expansion of uterine stromal cells during decidualization. Endocrinology15139293940. (doi:10.1210/en.2009-1437)

WeimarCHEKavelaarsABrosensJJGellersenBde Vreeden-ElbertseJMTHeijnenCJMacklonNS2012Endometrial stromal cells of women with recurrent miscarriage fail to discriminate between high- and low-quality human embryos. PLoS ONE7e41424. (doi:10.1371/journal.pone.0041424)

WiemersDOShaoL-JAinRDaiGSoaresMJ2003The mouse prolactin gene family locus. Endocrinology144313325. (doi:10.1210/en.2002-220724)

XuCBailly-MaitreBReedJC2005Endoplasmic reticulum stress: cell life and death decisions. Journal of Clinical Investigation11526562664. (doi:10.1172/JCI26373)

YoshidaH2007ER stress and diseases. FEBS Journal274630658. (doi:10.1111/j.1742-4658.2007.05639.x)

ZhangKKaufmanRJ2008From endoplasmic-reticulum stress to the inflammatory response. Nature454455462. (doi:10.1038/nature07203)

Cited By

PubMed

Google Scholar