Abstract
Bisphenol A (BPA) and diethylstilbestrol (DES) are xenoestrogens, which have been associated with altered effects on reproduction. We hypothesized that neonatal xenoestrogen exposure affects the ovarian functionality in lambs. Thus, we evaluated the ovarian response to exogenous ovine FSH (oFSH) administered from postnatal day 30 (PND30) to PND32 in female lambs previously exposed to low doses of DES or BPA (BPA50: 50 μg/kg per day, BPA0.5: 0.5 μg/kg per day) from PND1 to PND14. We determined: i) follicular growth, ii) circulating levels of 17β-estradiol (E2), iii) steroid receptors (estrogen receptor alpha, estrogen receptor beta, and androgen receptor (AR)) and atresia, and iv) mRNA expression levels of the ovarian bone morphogenetic protein (BMPs) system (BMP6, BMP15, BMPR1B, and GDF9) and FSH receptor (FSHR). Lambs neonatally exposed to DES or BPA showed an impaired ovarian response to oFSH with a lower number of follicles ≥2 mm in diameter together with a lower number of atretic follicles and no increase in E2 serum levels in response to oFSH treatment. In addition, AR induction by oFSH was disrupted in granulosa and theca cells of lambs exposed to DES or BPA. An increase in GDF9 mRNA expression levels was observed in oFSH-primed lambs previously treated with DES or BPA50. In contrast, a decrease in BMPR1B was observed in BPA0.5-postnatally exposed lambs. The modifications in AR, GDF9, and BMPR1B may be associated with the altered ovarian function due to neonatal xenoestrogen exposure in response to an exogenous gonadotropin stimulus. These alterations may be the pathophysiological basis of subfertility syndrome in adulthood.
Introduction
Numerous chemicals in the environment possess estrogenic activity and are classified as endocrine-disrupting compounds (EDCs; McLachlan et al. 1984). Some of these chemicals may alter gonadal morphogenesis and functional differentiation, affecting reproduction if exposure occurs during critical periods of development (Colborn et al. 1993).
Both diethylstilbestrol (DES) and bisphenol A (BPA) are EDCs that have been extensively studied using different animal models. DES is a synthetic estrogen with a stronger bioactivity than 17β-estradiol (E2) (McLachlan et al. 1984). In the past, DES was widely used in human and veterinary medicine, and significant levels were reported in the environment, mainly related to feedlot areas (McLachlan et al. 1984). On the other hand, BPA is one of the highest volume chemicals produced worldwide, as it is used in polycarbonate plastics, resins, papers, implanted medical devices, and other medical equipment (Welshons et al. 2006, Shelby 2008). BPA has also been detected in a variety of environmental samples, including water, sewage leach, indoor and outdoor air samples, and dust (Vandenberg et al. 2007). As BPA has been shown to leach from containers into food and beverage products and proved to be one of the multiple contaminants included in the soil, this compound should be considered a potential health risk for animals and humans (Welshons et al. 2006).
The lamb ovary is sensitive to disruption by EDC exposure during intrauterine life (Adams et al. 1988, Adams 1995, Savabieasfahani et al. 2006, Fowler et al. 2008) or during early postnatal life (Rivera et al. 2011). In sheep, a precocial species, we have previously demonstrated that low doses of s.c. BPA or DES injections from birth to postnatal day 14 (PND14) cause a decline in the stock of primordial follicles by stimulating follicular development and increasing follicular atresia (Rivera et al. 2011). We also found that exposure to BPA results in a lower weight of the lamb ovaries and a higher incidence of multiovular follicles (MOFs) on PND30 (Rivera et al. 2011). These adverse effects may be mediated through abnormal early protein levels of ovarian estrogen receptors (ERs) and could alter ovarian function and female fertility (Rivera et al. 2011). Nagel & Bromfield (2013) suggested that BPA can directly bind to both ERs and increase endogenous estrogen levels via upregulation of aromatase enzyme, increasing the overall estrogenic effects during development.
Various models have been used to test endocrine disruption of ovarian function in rodents, primates, and other species. One of the most widely used ovarian endocrine-disruption models is the immature animal primed with exogenous hormones (Petroff et al. 2000, Sekiguchi et al. 2003). This animal model allows detecting dysfunctions in the development of growing follicles that will reach the pre-ovulatory stage, the number of corpora lutea and ova shed, and the levels of ovarian hormones. In addition, the use of this procedure to investigate female reproductive toxicity certainly simplifies and reduces the time-consuming properties of routine experiments (such as evaluation of the estrous cycle, spontaneously ovulated ova, etc.) and allows the development of toxicological procedures to elucidate the mechanisms of toxicants, which impair the female reproductive system (Sekiguchi et al. 2003). Based on these reasons, we selected the ovarian response to an exogenous gonadotropin treatment as a tool to study ovarian functionality in immature lambs neonatally exposed to xenoestrogens. In this study, we investigated whether the neonatal exposure to low doses of BPA or DES adversely affects the ovarian response to an exogenous treatment of ovine follicle-stimulating hormone (oFSH) in prepubertal lambs and examined its possible association with abnormalities in steroid receptor pathways. Moreover, as one of the potential mechanisms underlying the ovarian response to oFSH treatment may reside in the bone morphogenetic protein (BMP) system that controls follicular dynamics and ovulation rate (Fabre et al. 2006), the mRNA expression of BMP6 and BMP15, growth and differentiation factor 9 (GDF9), and BMP receptor 1B (BMPR1B) was also evaluated.
Material and methods
Animals and experimental design
All the procedures were revised and authorized by the Institutional Committee of Animal Use and Care of Universidad Nacional del Litoral (Santa Fe, Argentina). The experiments were conducted in an experimental farm belonging to the Universidad Nacional de Lomas de Zamora (Buenos Aires, Argentina). Corriedale ewes (2–4 years old) grazed pasture with a low rate of clover. During the breading season, they were mated with Hampshire Down rams. No supplementary feeding was required along pregnancy and lactation. Female lambs selected for the experiments were born during August and September from a single delivery (no twins were used). The phytoestrogen concentration in the pasture was not evaluated; however, because food intake in control and treated animals was equivalent, we assumed that all animals were exposed to the same levels of phytoestrogens. Mothers and offspring remained under natural conditions during the experiment.
After birth, female lambs were randomly assigned to one of the following postnatal daily treatments (Fig. 1), from PND1 (this being the day of birth) to PND14, by s.c. injections in the nape of the neck: i) corn oil vehicle (controls; n=18), ii) DES (Sigma–Aldrich) at 5 μg/kg per day (n=13), iii) BPA50 (99% purity, Sigma–Aldrich) at 50 μg/kg per day (n=16), and iv) BPA0.5 at 0.5 μg/kg per day (n=9). Although the s.c. route of administration for EDC is not the natural mode of exposure, we selected this method to be certain of the dose administered to the animals. The postnatal model of exposure to xenoestrogens has been extensively used in our laboratory in both rodents (Monje et al. 2007, 2009, 2010, Ramos et al. 2007, Varayoud et al. 2008, Bosquiazzo et al. 2010, Rodríguez et al. 2010) and lambs (Rivera et al. 2011) and has been demonstrated as a persuasive paradigm to study short- and long-term consequences of neonatal exposure to hormonally active substances. On the other hand, the route of administration is an important issue to determine BPA health risks in animal models. In fetuses and neonates, Taylor et al. (2008) observed low levels of the enzyme that conjugate BPA (uridine diphosphate-glucuronosyl-transferase), implying that both oral and non-oral administration of BPA during neonatal life provide the same internal active dose.
Schematic representation of the experimental protocol used to study the effects of early postnatal diethylstilbestrol (DES) or bisphenol A (BPA) exposure on the ovary of lambs. Daily administration was carried out by s.c. injections. PND, postnatal day; IHC, immunohistochemistry; qRT-PCR: quantitative real-time PCR.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Schematic representation of the experimental protocol used to study the effects of early postnatal diethylstilbestrol (DES) or bisphenol A (BPA) exposure on the ovary of lambs. Daily administration was carried out by s.c. injections. PND, postnatal day; IHC, immunohistochemistry; qRT-PCR: quantitative real-time PCR.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Schematic representation of the experimental protocol used to study the effects of early postnatal diethylstilbestrol (DES) or bisphenol A (BPA) exposure on the ovary of lambs. Daily administration was carried out by s.c. injections. PND, postnatal day; IHC, immunohistochemistry; qRT-PCR: quantitative real-time PCR.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
The EPA-National Toxicology Program's Report of the Endocrine Disruptors-USA (U.S.EPA 1993) has defined the LOAEL dose for BPA as 50 mg/kg per day and the ‘safe dose’ as 1000 times lower (50 μg/kg per day) (Melnick et al. 2002, Shelby 2008). In this work, we used the safe dose of BPA and a dose 100 times lower. DES was used as a positive control because it has been reported that developmental exposure to low doses of this compound induces MOFs and activates the primordial-to-primary follicle transition in mice (Iguchi et al. 1986, Wordinger & Derrenbacker 1989), rats (Rodríguez et al. 2010), and lambs (Rivera et al. 2011). The dose of 5 μg/kg per day of DES used in this study is considered a low dose (Newbold 2004), being 20-fold lower than that given therapeutically to pregnant women.
On PND30, lamb ovaries from the experimental groups (control n=6; DES n=4; BPA50 n=5) were removed via a midline abdominal incision under ketamine (20 mg/kg, i.m.) and xylazine (0.1–0.2 mg/kg, i.m.) anesthesia. The remaining lambs from each experimental group (control n=12; DES n=9; BPA50 n=11; BPA0.5 n=9) were treated with multiple doses of oFSH (Ovagen, ICPbio Ltd, Auckland, New Zealand) starting on PND30. Each lamb received a total dose of 8.8 mg of oFSH. oFSH was administered every 12 h by i.m. injection for 3 consecutive days (at 0800 and 2000 h, PND30, PND31, and PND32). This treatment protocol was adapted, with minor modifications, from that described previously by Kelly et al. (2005). Forty hours after the last oFSH injection (PND34), ovaries were exhibited by medial laparotomy under general anesthesia (ketamine+xylazine). Follicles ≥2 mm in diameter on the ovarian surface were counted under a stereomicroscope (Olympus) to establish the oFSH response. Then, ovaries were collected, cut into halves, and processed for different experimental purposes. For immunohistochemistry, ovarian halves were fixed in 10% buffered formalin for 6 h at room temperature and paraffin embedded. For RNA extraction, the other ovarian halves were immediately frozen in liquid nitrogen and stored at −80 °C. Peripheral blood was collected by jugular venipuncture before the first oFSH administration (PND30 at 0800 h) and before the last one (PND32 at 2000 h). Serum was separated and stored at −20 °C until hormone assay.
Hormone assays
Blood samples were allowed to clot for 1 h at room temperature. Serum was then collected and stored at −20 °C for hormone analysis. Serum E2 levels were determined by a double-antibody RIA procedure (DSL-4800; Beckman Coulter Ultra-Sensitive Estradiol RIA, Inc., Webster, TX, USA) (Taylor et al. 2000, Carpenter et al. 2003), validated for use with ovine samples. The RIA used rabbit anti-E2 (polyclonal) serum and iodinated estradiol. The primary antiserum cross-reacts 2.4% with estrone, 0.64% with estriol, 0.21% with 17α-estradiol, 2.56% with 17β-estradiol-3-glucuronide, 0.17% with estradiol-3-sulfate, and 3.4% with d-equilenin. Goat anti-rabbit gamma globulin serum and polyethylene glycol were used as the precipitating second antibody reagent. The sensitivity of the assay was 2.2 pg/ml. The intra- and interassay coefficient of variation values were 8.9 and 12.2% respectively.
Immunohistochemistry and TUNEL assay
Ovarian sections (5 μm thick) on PND30 and PND34 (40 h after the last oFSH administration) were used to evaluate protein levels of estrogen receptor alpha (ESR1), estrogen receptor beta (ESR2), androgen receptor (AR), and Ki67, following protocols published by our laboratory (Rivera et al. 2011). To evaluate follicular atresia, we used two different approaches: i) the determination of granulosa cell proliferation by Ki67 immunodetection and ii) the evaluation of granulosa cell apoptosis by TUNEL assay.
Steroid receptors were immunostained using anti-ESR1 (NCL-ER-LH2, clone CC4-5, 1:50 dilution, Novocastra, Newcastle-upon-Tyne, UK), anti-ESR2 (NCL-ER-beta, clone EMR02, 1:25 dilution, Novocastra), and anti-AR (sc-816, 1:400 dilution, Santa Cruz Biotechnology, Inc.) antibodies. For granulosa cell proliferation, we used an anti-Ki67 affinity-purified rabbit polyclonal antibody generated and tested in our laboratory (Varayoud et al. 2008, Rivera et al. 2011). The specificity of each antibody was tested using western blot analysis of protein extracts (Rodríguez et al. 2003) obtained from intact uterine or gonad samples of ewes (data not shown). Each immunohistochemical run included positive tissues and negative controls replacing the primary antibody with nonimmune serum (Sigma–Aldrich).
Apoptotic cells in follicular sections were evaluated by TUNEL assay using the In Situ Cell Death Detection Kit, POD (Roche), following the manufacturer's instructions. To minimize autofluorescence, tissue sections were blocked with 10 mg/ml sodium borohydride (Sigma–Aldrich) and then pretreated with microwave at 350 W (Citrate 0.01 M pH 6). Thereafter, sections were rinsed in PBS, immersed in a buffer containing 3% BSA (Sigma–Aldrich), and 20% normal horse serum for 20 min to block non-specific binding sites. Then, samples were incubated with TUNEL reaction mixture: terminal deoxynucleotidyl transferase (TdT) and fluorescein (FITC)-labeled nucleotide mixture (fluorescein-dUTP) for 60 min at 37 °C in a humidified chamber in the dark. After rinsing with PBS, sections were mounted in Vectashield (Vector Laboratories, Inc., Burlingame, CA, USA) with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Fluka, Sigma–Aldrich) and stored in the dark at 4 °C. The detection of DNA fragmentation was conducted using an Olympus BX-51 microscope equipped for epifluorescence with the appropriate filters (Olympus). Cells containing fragmented nuclear chromatin exhibited green nuclear staining. Images were recorded using a High-resolution USB 2.0 Digital Color Camera (QImaging Go-3, QImaging, Surrey, BC, Canada). As a negative control, sections were processed without TdT. For positive control, the involuting rat prostate after the second day of castration was processed in the same way as the experimental samples (Ramos et al. 2002).
Evaluation of immunohistochemistry
To study the protein levels of ESR1, ESR2, and AR, we selected three sections, 800 μm apart from each other (Rivera et al. 2011). No significant differences regarding the immunohistochemistry pattern were found between sections of the same ovary. The steroid receptors were evaluated in the cortical and medullar regions. Cortical stroma was recognizable by the presence of densely packed stromal cells, the presence of primordial and early growing follicles, and a low density of small blood vessels (Delgado-Rosas et al. 2009). In the analysis of the cortical region, protein levels were assessed in the stroma and in different cellular compartments of the follicles (theca cells, granulosa cells, and oocytes). Immunostaining was evaluated using the following score: negative (−), slightly positive (−/+), weakly positive (+), positive (++), and strongly positive (+++).
Evaluation of atretic follicles
Follicles classified as healthy showed a granulosa cell layer that appeared compact and well organized, with closely apposed cells, numerous mitotic figures, and only occasional or rare pyknotic cells. Although follicular atresia could be characterized by histomorphological features, atretic follicles were defined as those with ≤2% Ki67-positive granulosa cells in this study (Jolly et al. 1997, Rivera et al. 2011). To confirm the percentage of atretic follicles, the granulosa apoptotic cells detected by TUNEL were counted on the whole area of each ovarian section. Follicles were considered atretic if they contained more than 2% of TUNEL/positive granulosa cells (Jolly et al. 1997).
Quantitative real-time PCR
An optimized RT-qRT-PCR protocol was used to analyze the relative expression levels of BMP6, BMP15, BMPR1B, GDF9, and FSH receptor (FSHR) mRNA in ovaries obtained on PND30 or after stimulation with oFSH on PND34. Ovaries from each experimental group (control, BPA0.5, BPA50, and DES) were individually homogenized in TRIzol (Life Technologies), and RNA was prepared according to the manufacturer's protocol. The concentration of total RNA was assessed by A260, and RNA was stored at −80 °C until use. Equal quantities (4 μg) of total RNA were reverse transcribed into cDNA according to Ramos et al. (2007). Primer pairs used to amplify BMP6, BMP15, BMPR1B, GDF9, FSHR and the ribosomal protein 18S (housekeeping gene) cDNAs are shown in Table 1. cDNA levels were detected by qRT-PCR using a Rotor-Gene Q cycler (Qiagen Instruments AG) and HOT FIRE Pol EvaGreen Qpcr Mix PlusS (Solis BioDyne; Biocientifica, Rosario, Argentina). After initial denaturation at 95 °C for 15 min, the reaction mixture was subjected to successive cycles of denaturation at 95 °C for 15 s, annealing at 59 °C (for BMP6), 54 °C (for BMP15), 52 °C (for BMPR1B), 53 °C (for FSHR and GDF9), or 55 °C (for r18S) for 15 s, and extension at 72 °C for 15 s. The product purity was confirmed by dissociation curves, and random samples were subjected to agarose gel electrophoresis. All PCR products were cloned using a TA cloning kit (Invitrogen) and specificity was confirmed by DNA sequencing (data not shown). Controls containing no template DNA were included in all assays, yielding no consistent amplification. A sample without reverse transcriptase was included to detect contamination by genomic DNA. For each analysis, a standard curve was prepared from eight serial dilutions of a standard sample containing equal amounts of cDNA from the different experimental groups as reported previously (Varayoud et al. 2008). All standards and samples of each independent experiment were assayed in triplicate.
Primers and PCR products for real-time quantitative PCR.
| Genes | Primer sequence (5′–3′) | Product size (pb) | GenBank accession number |
|---|---|---|---|
| BMP6 | Forward: CTCTACGTGAGCTTCCAGGACCT | 83 | |
| Reverse: TCTCCGTCACAGTAGTTGGCAGC | |||
| BMP15 | Forward: ATGGTCCTCCTGAGCATCCTTAG | 87 | |
| Reverse: CTGCCCTACCTGTGTCATTTGG | |||
| BMPR1B | Forward: TCTACACTTTGGTTATCAGC | 95 | |
| Reverse: TTTGTATCCTCTCTTGTCAT | |||
| GDF9 | Forward: TAGAGGTTCTGTATGATGGG | 90 | |
| Reverse: ATGCCTTATAGAGCCTCTTC | |||
| FSHR | Forward: CCAACAACCTGCTATACATC | 103 | |
| Reverse: GTGCTTAATACCTGTGTTGG |
BMP6, bone morphogenetic protein 6; BMP15, bone morphogenetic protein 15; BMPR1B, BMP receptor 1B; GDF9, growth and differentiation factor 9; FSHR, follicle-stimulating hormone receptor.
Statistical analysis
All data are expressed as mean±s.e.m. We performed a one-way ANOVA to assess the overall significance, and differences between the treatments and the control group were determined using Dunnett's post test. For hormone measurement, and as data were not normally distributed, we use the Kruskal–Wallis followed by Dunn's post-hoc test. P<0.05 was considered statistically significant.
Results
Ovarian response to exogenous oFSH treatment
Control prepubertal lambs responded to oFSH treatment on PND34, showing a mean of 78 follicles ≥2 mm (Fig. 2). Lambs exposed to both doses of BPA or DES and treated with oFSH showed a significantly lower number of follicles ≥2 mm on the ovarian surface (C=77.6±8.8 vs BPA50=27.5±10.7 vs BPA0.5=28.2±9.3 vs DES=43.5±11.9) (Fig. 2). The percentage of antral atretic follicles in all xenoestrogen-exposed lambs was lower than that in controls (Fig. 3). Figure 4 illustrates the ovarian surface of representative samples in the different experimental groups. The ovaries from prepubertal lambs on PND30, without oFSH treatment, showed the expected atrophic small size (Fig. 4A). As expected, the ovaries from lambs treated with oFSH showed larger and highly hemorrhagic follicles (Fig. 4B). The ovaries from lambs treated neonatally with DES or BPA were unable to respond to stimulation with exogenous oFSH, as evidenced by a lower number of large follicles in the ovary (Fig. 4C and D).
Effect of exogenous treatment (oFSH) on ovarian follicular response on PND34 in neonatally xenoestrogen-exposed lambs. Follicles ≥2 mm were recorded on the ovarian surface. Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Effect of exogenous treatment (oFSH) on ovarian follicular response on PND34 in neonatally xenoestrogen-exposed lambs. Follicles ≥2 mm were recorded on the ovarian surface. Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Effect of exogenous treatment (oFSH) on ovarian follicular response on PND34 in neonatally xenoestrogen-exposed lambs. Follicles ≥2 mm were recorded on the ovarian surface. Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Effect of exogenous treatment (oFSH) on the number of antral atretic follicles on PND34 in neonatally xenoestrogen-exposed lambs. Percentage of antral atretic follicles detected by Ki67 proliferation marker in granulosa cells (A) or granulosa cell apoptosis by TUNEL assay (B). In (C), an antral atretic follicle and a healthy antral follicle detected by Ki67 proliferation marker are shown; compare the high proliferation index in the granulosa of the healthy follicle (right) with the low percentage in the granulosa of the antral atretic follicle (left). Photomicrographs showing in situ TUNEL assay with DAPI nuclear blue fluorescence (D) and apoptotic cells displaying green fluorescence (E). TUNEL was positive predominantly within the granulosa of atretic follicles (left) (E) and negative within the granulosa of healthy follicles (right). Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control. Scale bars, 50 μm for all panels. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Effect of exogenous treatment (oFSH) on the number of antral atretic follicles on PND34 in neonatally xenoestrogen-exposed lambs. Percentage of antral atretic follicles detected by Ki67 proliferation marker in granulosa cells (A) or granulosa cell apoptosis by TUNEL assay (B). In (C), an antral atretic follicle and a healthy antral follicle detected by Ki67 proliferation marker are shown; compare the high proliferation index in the granulosa of the healthy follicle (right) with the low percentage in the granulosa of the antral atretic follicle (left). Photomicrographs showing in situ TUNEL assay with DAPI nuclear blue fluorescence (D) and apoptotic cells displaying green fluorescence (E). TUNEL was positive predominantly within the granulosa of atretic follicles (left) (E) and negative within the granulosa of healthy follicles (right). Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control. Scale bars, 50 μm for all panels. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Effect of exogenous treatment (oFSH) on the number of antral atretic follicles on PND34 in neonatally xenoestrogen-exposed lambs. Percentage of antral atretic follicles detected by Ki67 proliferation marker in granulosa cells (A) or granulosa cell apoptosis by TUNEL assay (B). In (C), an antral atretic follicle and a healthy antral follicle detected by Ki67 proliferation marker are shown; compare the high proliferation index in the granulosa of the healthy follicle (right) with the low percentage in the granulosa of the antral atretic follicle (left). Photomicrographs showing in situ TUNEL assay with DAPI nuclear blue fluorescence (D) and apoptotic cells displaying green fluorescence (E). TUNEL was positive predominantly within the granulosa of atretic follicles (left) (E) and negative within the granulosa of healthy follicles (right). Bars represent mean values±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 or **P<0.01 vs control. Scale bars, 50 μm for all panels. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Representative photographs of ovaries from prepubertal lambs. Ovaries from control lambs without any treatment on PND30 (A) and following oFSH administration on PND34 (B). Lambs neonatally exposed to DES (C) or BPA50 (D) and treated with oFSH at PND34. Arrows indicate the ovaries.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Representative photographs of ovaries from prepubertal lambs. Ovaries from control lambs without any treatment on PND30 (A) and following oFSH administration on PND34 (B). Lambs neonatally exposed to DES (C) or BPA50 (D) and treated with oFSH at PND34. Arrows indicate the ovaries.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Representative photographs of ovaries from prepubertal lambs. Ovaries from control lambs without any treatment on PND30 (A) and following oFSH administration on PND34 (B). Lambs neonatally exposed to DES (C) or BPA50 (D) and treated with oFSH at PND34. Arrows indicate the ovaries.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
We have also investigated the ovarian steroidogenic response to oFSH treatment by measuring the serum E2 levels. In control lambs, not exposed to xenoestrogens, E2 levels increased significantly in response to oFSH (PND30 2.5±0.7 pg/ml vs PND32 44.9±18.8) (Fig. 5). Basal E2 levels on PND30 were not affected by the xenoestrogen treatment (PND30; C=2.5±0.7 pg/ml vs DES=5.3±0.6 vs BPA50=5.3±1.9 vs BPA0.5=3.8±1.1; P>0.05), although the response to oFSH stimulation was impaired. In accordance with the alteration in the follicular development in xenoestrogen-exposed lambs described earlier in this study, characterized by a lower number of large follicles, no increase was found in the serum levels of E2 following oFSH treatment (Fig. 5).
Serum E2 levels in lambs neonatally exposed to xenoestrogens and treated with exogenous oFSH. Serum levels in samples on PND30 before the first dose of oFSH and before the last injection on PND32. All experimental groups were treated with six doses of oFSH. Kruskal–Wallis followed by Dunn's post-hoc test, comparisons were made between PND30 vs PND32, *P<0.05.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Serum E2 levels in lambs neonatally exposed to xenoestrogens and treated with exogenous oFSH. Serum levels in samples on PND30 before the first dose of oFSH and before the last injection on PND32. All experimental groups were treated with six doses of oFSH. Kruskal–Wallis followed by Dunn's post-hoc test, comparisons were made between PND30 vs PND32, *P<0.05.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Serum E2 levels in lambs neonatally exposed to xenoestrogens and treated with exogenous oFSH. Serum levels in samples on PND30 before the first dose of oFSH and before the last injection on PND32. All experimental groups were treated with six doses of oFSH. Kruskal–Wallis followed by Dunn's post-hoc test, comparisons were made between PND30 vs PND32, *P<0.05.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Potential mechanisms underlying impaired ovarian response to oFSH treatment
To gain insight into the mechanisms that impaired the follicular response to oFSH treatment in lambs exposed to xenoestrogens, protein levels of sexual steroid receptors were compared between ovaries obtained on PND30 and PND34 by immunohistochemistry. In PND30 ovaries, ESR1 was not detected, whereas ESR2 and AR were highly expressed in granulosa and theca cells of antral follicles. DES or BPA exposure did not change the protein level pattern of steroid receptors observed in controls (Table 2), thus demonstrating that DES or BPA themselves are unable to disrupt the protein level of these receptors in PND30 ovaries. In PND34 ovaries, we found no detectable level of ESR1 protein in response to exogenous oFSH, whereas ESR2 was highly expressed in both granulosa and theca cells of antral follicles (Table 2); however, no differences were found in the protein level pattern observed following stimulation with oFSH (Fig. 6). In contrast, oFSH treatment increased AR protein level in small antral follicles in PND34 control lambs (Fig. 6 and Table 2). However, oFSH induction of AR was impaired in ovaries from lambs previously exposed to xenoestrogens (Table 2). Representative immunohistochemical photomicrographs of AR in ovaries from DES- or BPA-exposed lambs showed disruptive protein level of this steroid receptor in both theca and granulosa cells (Fig. 6).
Expression of ESR1, ESR2, and AR in antral follicles in ovaries from lambs neonatally exposed to xenoestrogens (PND30) and following treatment with oFSH (PND34).
| PND30 | PND34 | ||||||
|---|---|---|---|---|---|---|---|
| C | DES | BPA50 | C+oFSH | DES+oFSH | BPA50+oFSH | BPA0.5+oFSH | |
| ESR1 | |||||||
| Granulosa | − | − | − | − | − | − | − |
| Theca | − | − | − | − | − | − | − |
| ESR2 | |||||||
| Granulosa | +++ | +++ | +++ | +++ | +++ | +++ | +++ |
| Theca | ++ | ++ | ++ | ++ | ++ | ++ | ++ |
| AR | |||||||
| Granulosa | ++ | ++ | ++ | ++++ | ++ | ++ | ++ |
| Theca | + | + | + | ++ | + | + | + |
From birth to postnatal day 14 (PND14), lambs were exposed to DES (5 μg/kg per day), BPA (50 μg/kg per day or 0.5 μg/kg per day), or vehicle (C). Another group of exposed lambs were stimulated with oFSH (described in M&M). On PND30 and PND34, steroid receptors were immunohistochemically analyzed. Immunostaining was qualitatively evaluated in at least three sections/ovary, as follows: negative (−), slightly positive (−/+), weakly positive (+), positive (++), and strongly positive (+++). At least three lambs were evaluated at each time point.
Representative photomicrographs of ovarian sections showing AR (A, B, C, D, E, F, G, and H) and ERB (I, J, K, L, M, N, O, and P) immunostaining in neonatally xenoestrogen-exposed lambs treated with exogenous oFSH. (A and E) Control lambs on PND30 (non-treated with oFSH) show AR-positive nuclear immunostaining in granulosa and/or theca cells of antral follicles. (B and F) Control lambs following oFSH administration on PND34 show increased AR protein levels. DES- (C and G) or BPA50- (D and H) neonatally exposed lambs treated with oFSH on PND34 did not show any increase in AR protein level in either cellular compartment of antral follicles. ERB protein was highly expressed in both granulosa and theca cells of antral follicles in controls not treated with oFSH (I and M); the protein level showed no differences in controls treated with oFSH (J and N) and in BPA (K and O)- or DES (L and P)-exposed lambs. Scale bars: 60 μm for A, B, C, and D and I, J, K, and L, and 300 μm for E, F, G, and H and M, N, O, and P. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Representative photomicrographs of ovarian sections showing AR (A, B, C, D, E, F, G, and H) and ERB (I, J, K, L, M, N, O, and P) immunostaining in neonatally xenoestrogen-exposed lambs treated with exogenous oFSH. (A and E) Control lambs on PND30 (non-treated with oFSH) show AR-positive nuclear immunostaining in granulosa and/or theca cells of antral follicles. (B and F) Control lambs following oFSH administration on PND34 show increased AR protein levels. DES- (C and G) or BPA50- (D and H) neonatally exposed lambs treated with oFSH on PND34 did not show any increase in AR protein level in either cellular compartment of antral follicles. ERB protein was highly expressed in both granulosa and theca cells of antral follicles in controls not treated with oFSH (I and M); the protein level showed no differences in controls treated with oFSH (J and N) and in BPA (K and O)- or DES (L and P)-exposed lambs. Scale bars: 60 μm for A, B, C, and D and I, J, K, and L, and 300 μm for E, F, G, and H and M, N, O, and P. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Representative photomicrographs of ovarian sections showing AR (A, B, C, D, E, F, G, and H) and ERB (I, J, K, L, M, N, O, and P) immunostaining in neonatally xenoestrogen-exposed lambs treated with exogenous oFSH. (A and E) Control lambs on PND30 (non-treated with oFSH) show AR-positive nuclear immunostaining in granulosa and/or theca cells of antral follicles. (B and F) Control lambs following oFSH administration on PND34 show increased AR protein levels. DES- (C and G) or BPA50- (D and H) neonatally exposed lambs treated with oFSH on PND34 did not show any increase in AR protein level in either cellular compartment of antral follicles. ERB protein was highly expressed in both granulosa and theca cells of antral follicles in controls not treated with oFSH (I and M); the protein level showed no differences in controls treated with oFSH (J and N) and in BPA (K and O)- or DES (L and P)-exposed lambs. Scale bars: 60 μm for A, B, C, and D and I, J, K, and L, and 300 μm for E, F, G, and H and M, N, O, and P. g, granulosa; t, theca; star, antrum.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Another potential mechanism underlying impaired ovarian response to oFSH treatment in xenoestrogen-exposed lambs may reside in the BMP system. Therefore, we assessed the response of the BMP system and FSHR after stimulation with oFSH. We observed that previous exposure to DES or BPA did not change the mRNA levels of BMP6, BMP15, or FSHR after stimulation with oFSH. Instead, we found a significantly high level of GDF9 mRNA in ovaries from oFSH-stimulated lambs previously treated with DES or BPA50 (Fig. 7A). Then, to investigate whether the expression levels of GDF9 were abnormally high before oFSH stimulus, we measured mRNA levels of GDF9 in ovaries of 30-day-old lambs previously treated with DES or BPA50. We observed that GDF9 mRNA levels were already abnormally high on PND30 in BPA50-treated lambs (Fig. 7B) and that, following stimulation with oFSH, the significant differences prevailed (Fig. 7A). In DES-treated lambs, no difference with control in GDF9 was observed on PND30. In addition, we found, on PND34, a decreased expression of BMPR1B in ovaries from oFSH-stimulated lambs previously treated with the lowest dose of BPA tested (BPA0.5, Fig. 7A).
Quantitative real-time PCR analysis of the levels of BMP6, BMP15, BMPR1B, GDF9, and FSHR mRNA expression of ovaries from lambs neonatally exposed to xenoestrogens. (A) Ovaries from PND34 lamb after oFSH treatment. (B) PND30 lambs without oFSH treatment. The amounts of mRNA in each experimental group are indicated as values relative to those of control lambs (dashed line). The columns and error bars represent the means±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 vs controls.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Quantitative real-time PCR analysis of the levels of BMP6, BMP15, BMPR1B, GDF9, and FSHR mRNA expression of ovaries from lambs neonatally exposed to xenoestrogens. (A) Ovaries from PND34 lamb after oFSH treatment. (B) PND30 lambs without oFSH treatment. The amounts of mRNA in each experimental group are indicated as values relative to those of control lambs (dashed line). The columns and error bars represent the means±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 vs controls.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Quantitative real-time PCR analysis of the levels of BMP6, BMP15, BMPR1B, GDF9, and FSHR mRNA expression of ovaries from lambs neonatally exposed to xenoestrogens. (A) Ovaries from PND34 lamb after oFSH treatment. (B) PND30 lambs without oFSH treatment. The amounts of mRNA in each experimental group are indicated as values relative to those of control lambs (dashed line). The columns and error bars represent the means±s.e.m. One-way ANOVA followed by Dunnett's post-test. *P<0.05 vs controls.
Citation: REPRODUCTION 149, 6; 10.1530/REP-14-0567
Discussion
Most studies on the effects of environmental pollutants on ovarian development and function have relied on in vitro systems or rodent models (Rodríguez et al. 2010, Peretz et al. 2011) and thus need to be validated in other animal models (Veiga-Lopez et al. 2014). To conduct this experiment, we used sheep, a precocial species in which the reproductive developmental trajectory follows a timeline similar to that of humans (Padmanabhan et al. 2007, Padmanabhan & Veiga-Lopez 2013). In sheep and humans, full follicular differentiation occurs before birth, unlike in rodents, where it occurs postnatally (Padmanabhan et al. 2007, 2010, Padmanabhan & Veiga-Lopez 2013). In this study, we demonstrated that early postnatal exposure of lambs to BPA or DES decreased the ovarian response to exogenous oFSH in the prepubertal age, demonstrating decreased follicular development and decreased estradiol production. Moreover, present results allow us to postulate a link between these ovarian disorders and abnormalities of the BMP system and a deficient FSH-induced AR increase in the population of small antral follicles. These results indicate that lamb ovaries are sensitive to disruptions by EDC exposure in early postnatal life, and that these effects may be responsible for fertility problems, including a failure in the superstimulation response.
Previously, we showed a lower ovarian weight and altered follicular development in lambs postnatally exposed to BPA or DES from PND1 to PND14, and that both BPA and DES are able to reduce the primordial follicle pool by stimulating their initial recruitment and subsequent development until antral stage (Rivera et al. 2011). We reported similar results in a rodent model (Rodríguez et al. 2010). Herein, we found that follicles of lambs neonatally exposed to BPA or DES are unable to respond to the stimulatory effect of oFSH. Following oFSH stimulation, the ovaries from non-exposed lambs responded with a significant increase in follicular development, evidenced by the high number of follicles >2 mm in diameter. However, when lambs have been previously exposed to BPA, the follicular development was drastically reduced. Previously, we have also demonstrated that the same BPA or DES postnatal treatment induces a high incidence of MOFs, suggesting that follicular assembly may be active during early postnatal life in lambs. This was surprising as most studies have suggested that a defined and finite pool of primordial follicles exists at birth in lambs (Juengel et al. 2002, Padmanabhan et al. 2007). However, based on a recent report that has proposed a new mechanism for generation of MOFs in the postnatal rat ovary, we cannot rule out the possibility that MOFs in xenoestrogen-treated lambs are generated by fusion of adjacent growing follicles (Gaytán et al. 2014). It is interesting to note that a similar increase in the incidence of MOFs has been demonstrated in caimans (Stoker et al. 2008) and rats (Rodríguez et al. 2010) exposed to BPA, the rat being a species in which follicular assembly continues after birth. Both abnormal preantral folliculogenesis and high incidence of MOFs are potentially related to the appearance of fertility syndromes in human adulthood (Franks et al. 2008, Asimakopoulos et al. 2013).
Superovulation is a reproductive practice applied to many mammalian species whereby exogenous gonadotropins are used to increase follicular development or the ovulation rate with the expectation to generate greater numbers of embryos. This technique is used both in adults (multiple ovulation and embryo transfer (MOET)) (Wray & Goddard 1994) and in prepubertal females (juvenile in vitro embryo transfer (JIVET)) (Kelly et al. 2005). It has long been known that follicles of 4- to 8-week-old lambs are particularly sensitive to gonadotropin administration using protocols developed for adult animals (Worthington & Kennedy 1979, Armstrong et al. 1994, Ptak et al. 1999). On the other hand, ovarian stimulation has proved to be a simple and useful tool to detect alterations in rodent reproductive organs and to study likely changes in the mechanisms of hormonal action induced by certain substances (Sekiguchi et al. 2003). In this study, we applied a protocol of oFSH-ovarian stimulation in prepubertal lambs and demonstrated that early postnatal exposure of BPA or DES impaired the ovarian functional response to oFSH treatment. Moreover, lambs exposed to xenoestrogens showed an increased follicular atresia rate (measured by histomorphology, Ki67 proliferation, and TUNEL in situ apoptosis assay) after oFSH treatment. The failure of the lamb ovarian response to treatment was found using a ‘safe dose’ of BPA and a 100-fold lower dose at early postnatal exposure. Several factors, such as healthy, nutritional, and reproductive status, genetic factor, age, stress, hormone used, and dose, may affect the success of superovulatory treatment in females (Mapletoft et al. 2002). According to the present results, an additional factor such as the xenoestrogen exposure during a critical developmental period may affect the ovarian response to exogenous hormonal treatment. Despite improvements in superovulatory treatments, ovarian responsiveness remains highly variable between individuals and difficult to predict (Rico et al. 2009). This variability in the superovulatory response may be explained by different individual levels of exposure to xenoestrogens.
As ovarian dysfunctions associated with altered fertility have also been linked with alterations in the protein levels of sex steroid receptors (Britt & Findlay 2002, Drummond 2006, Prizant et al. 2014), we measured these molecules in the ovaries from the lambs exposed to DES or BPA. We found no changes in ovarian ESR1 or ESR2 protein levels in both unstimulated (PND30) and oFSH-stimulated (PND34) ovaries of vehicle-treated lambs vs xenoestrogen-treated lambs. On the other hand, AR protein level in antral follicles of lamb exposed to xenoestrogens showed a significant change. The induction of AR protein level in response to oFSH was lower when the lambs were previously exposed to DES or BPA. It is known that androgens have a stimulatory effect on follicular development in rodents and large farm animals, including ewes (Smith et al. 2009, Prizant et al. 2014). In fact, in the absence of functional ARs in granulosa cells, follicle progression from preantral to antral stage is inhibited and preantral follicles become atretic (Sen & Hammes 2010, Prizant et al. 2014). Therefore, the decreased AR induction in response to oFSH specifically observed in antral follicles of DES- and BPA-exposed lambs could explain the lower follicular development found in these animals. Unexpectedly, we simultaneously found a low percentage of atretic antral follicles. Two different AR-mediated pathways regulating follicular atresia and follicular development have been recently described in granulosa cells (Sen et al. 2014). On the other hand, given the disruption in AR induction in response to oFSH found in xenoestrogen-treated lambs, it is probable that any stimulatory effect on follicle growth acting through the AR pathway is at least attenuated. Some factors belonging to the BMP system are associated with follicular development and ovarian steroidogenesis (Fabre et al. 2006) and act through the AR pathway. In this sense, we found that both DES and BPA50 disrupt GDF9 mRNA expression, with higher expression from PND30 onwards. It has been reported that GDF9 controls ovarian follicular development from the preantral stage to the early antral stage by upregulating follicular androgen biosynthesis and that the specific AR antagonist flutamide suppresses GDF9-induced preantral follicle growth (Orisaka et al. 2009). Therefore, we can hypothesize that the increased levels of GDF9 found in the ovaries from xenoestrogen-treated lambs (assuming that protein and mRNA have the same pattern of expression) affected the expected stimulatory effect of oFSH on follicular development due to the low AR protein levels in antral follicles. Taken together, the present results suggest that the low protein levels of AR induced by BPA or DES exposure could adversely affect AR-mediated stimulatory effects on follicular development, without affecting follicular atresia.
Although it is known that mouse follicles exposed in vitro to BPA show altered ovarian steroidogenesis due to decreased levels of key enzymes that regulate estradiol biosynthesis pathway (Peretz et al. 2011), the complex mechanism causing these effects remains yet to be determined. Recently, a study conducted on sheep has demonstrated that prenatal BPA exposure alters fetal ovarian steroidogenic gene and microRNA expression in an age-dependent manner (Veiga-Lopez et al. 2013). In our experiment, although the basal levels of E2 were not affected in lambs neonatally exposed to BPA or DES, the stimulatory response to oFSH was impaired. Differences in experimental design may explain differences in the results. Interestingly, Vitt et al. (2000) demonstrated that GDF9 suppresses both FSH-induced progesterone and estradiol production in rat follicles. The high values of GDF9 expression detected in the present work in xenoestrogen-treated lamb ovaries could explain, at least in part, the failure of antral follicles to respond to oFSH. In addition, the low number of antral follicles could also explain the diminished capability of ovaries from lambs previously exposed to DES or BPA to synthesize estradiol. Moreover, ovaries from lambs exposed to the lowest dose of BPA and treated with oFSH showed a decreased expression of BMPR1B. BMPR1B is expressed by granulosa cells and oocytes from the primary to the late antral follicle stages and acts as a receptor for various BMP factors (ten Dijke et al. 2003, Fabre et al. 2006). It has been described that a single mutation in the coding sequence of BMPR1B is responsible for the hyperprolific phenotype of Booroola ewes (McNatty et al. 2001, Mulsant et al. 2001, Souza et al. 2001). Then, Campbell et al. (2003) reported that ovaries of FecB/− (Booroola) ewes contain mainly small follicles with a low number of medium-size follicles and no large follicles after 3 days of FSH infusion. Interestingly, mice deficient in BMPR1B are infertile and show impaired estradiol synthesis (Souza et al. 2002) and decreased Cyp19 expression (Yi et al. 2001). Our results indicate that the alterations in estradiol levels and folliculogenesis observed in response to oFSH in lambs previously exposed to the lowest dose of BPA could be explained by an attenuated action of some BMP factors due to the decreased expression of ovarian BMPR1B.
Although some researchers have shown that xenoestrogen exposure affects hypothalamic–hypophyseal function (Monje et al. 2010), it appears that xenoestrogen treatment may also affect the response to oFSH stimulus acting directly on the ovary. Xenoestrogen can interfere with endogenous estrogens by either mimicking or blocking their responses via non-genomic and/or genomic signaling mechanisms (Viña et al. 2012). As mentioned earlier in this study, the protein levels of ESR1 and ESR2 in ovaries of PND30 and PND34 did not differ between the experimental groups even following oFSH treatment. However, we cannot exclude that xenoestrogens are causing changes in the functionality of the receptors belonging to the genomic pathway or are acting on the non-genomic pathway (Viña et al. 2012). ESR1 was not detected in lamb ovaries at this age and our results are slightly different from those of other authors (Juengel et al. 2006) that show immunostaining in surface epithelium and granulosa cells of preantral and antral follicles. Differences may be due to the primary antiserum used. Disruption of estrogens' actions through the non-genomic pathway can alter functional end points such as cell proliferation, peptide hormone release, catecholamine transport, and apoptosis, among others. BPA has been found to be a ‘weak’ inducer of estrogenic activity via the genomic pathway; however, BPA is equipotent with E2 in its ability to initiate rapid non-genomic responses from membrane receptors (Wozniak et al. 2005). However, more studies are needed to know the mechanistic effects of xenoestrogens altering the ovarian function. The adverse effects of the neonatal exposure to xenoestrogens are usually observed later in the female life, impairing different reproductive events such as puberty onset, cyclicity, or implantation (Durando et al. 2007, Monje et al. 2010, Varayoud et al. 2014). If the changes observed in this study (failure in response to oFSH in ovarian follicular development, increased follicular atresia, and failure in steroidogenesis response) due to the disrupting effect of xenoestrogens were organizational (permanent), they could negatively affect the adult sheep reproductive function and the ovarian response to a superovulatory treatment in animal practice.
Organogenesis is a highly regulated process, including precise exposure to steroid hormones at specific times during development. The present results describing altered ovarian functions in response to an exogenous gonadotropin stimulus add to a growing body of evidence reporting xenoestrogen-induced abnormalities in sheep (Veiga-Lopez et al. 2013, 2014). In addition, recent studies have demonstrated that tall women treated with estrogens in adolescence are at increased risk of infertility in later life and their fecundity is reduced (Hendriks et al. 2012). Our results indicated signs of primary ovarian insufficiency with concomitant early follicle pool depletion. Taking into account that, in our model, xenoestrogen-exposed lambs showed similar results to that reported in women, we may suggest that the decreased fertility in domestic animals naturally exposed to xenoestrogens is due to an impaired ovarian response.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by Universidad Nacional del Litoral (Santa Fe, Argentina) (CAI+D program), the Argentine Council for Scientific and Technological Research (CONICET), and the Argentine Agency for the Promotion of Science and Technology (ANPCyT).
Acknowledgements
J Varayoud, H A Rodríguez, V L Bosquiazzo, and E H Luque are Career Investigators of the CONICET. The authors would like to thank the reviewers for their excellent suggestions and corrections, which have been incorporated into the final version of the manuscript.
References
Adams NR 1995 Detection of the effects of phytoestrogens on sheep and cattle. Journal of Animal Science 73 1509–1515.
Adams NR, Sanders MR & Ritas AJ 1988 Oestrogenic damage and reduced fertility in ewe flocks in South Western Australia. Australian Journal of Agricultural Research 39 71–77. (doi:10.1071/AR9880071)
Armstrong DT, Irvine BJ, Earl CR, McLean D & Seamark RF 1994 Gonadotropin stimulation regimens for follicular aspiration and in vitro embryo production from calf oocytes. Theriogenology 42 1227–1236.
Asimakopoulos B, Kotanidis L & Nikolettos N 2013 Binovular complexes after ovarian stimulation. A report of four cases. Hippokratia 2 169–170.
Bosquiazzo VL, Varayoud J, Muñoz-de-Toro M, Luque EH & Ramos JG 2010 Effects of neonatal exposure to bisphenol A on steroid regulation of vascular endothelial growth factor expression and endothelial cell proliferation in the adult rat uterus. Biology of Reproduction 82 86–95. (doi:10.1095/biolreprod.109.078543)
Britt KL & Findlay JK 2002 Estrogen actions in the ovary revisited. Journal of Endocrinology 175 269–276. (doi:10.1677/joe.0.1750269)
Campbell BK, Baird DT, Souza CJ & Webb R 2003 The FecB (Booroola) gene acts at the ovary: in vivo evidence. Reproduction 126 101–111. (doi:10.1530/rep.0.1260101)
Carpenter KD, Gray CA, Bryan TM, Welsh TH Jr & Spencer TE 2003 Estrogen and antiestrogen effects on neonatal ovine uterine development. Biology of Reproduction 69 708–717. (doi:10.1095/biolreprod.103.015990)
Colborn T, vom Saal FS & Soto AM 1993 Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environmental Health Perspectives 101 378–384. (doi:10.1289/ehp.93101378)
Delgado-Rosas F, Gaytan M, Morales C, Gomez R & Gaytan F 2009 Superficial ovarian cortex vascularization is inversely related to the follicle reserve in normal cycling ovaries and is increased in polycystic ovary syndrome. Human Reproduction 24 1142–1151. (doi:10.1093/humrep/dep008)
ten Dijke P, Korchynskyi O, Valdimarsdottir G & Goumans MJ 2003 Controlling cell fate by bone morphogenetic protein receptors. Molecular and Cellular Endocrinology 211 105–113. (doi:10.1016/j.mce.2003.09.016)
Drummond AE 2006 The role of steroids in follicular growth. Reproductive Biology and Endocrinology 4 16. (doi:10.1186/1477-7827-4-16)
Durando M, Kass L, Piva J, Sonnenschein C, Soto AM, Luque EH & Muñoz-de-Toro M 2007 Prenatal bisphenol A exposure induces preneoplastic lesions in the mammary gland in Wistar rats. Environmental Health Perspectives 115 80–86. (doi:10.1289/ehp.9282)
Fabre S, Pierre A, Mulsant P, Bodin L, Di Pasquale E, Persani L, Monget P & Monniaux D 2006 Regulation of ovulation rate in mammals: contribution of sheep genetic models. Reproductive Biology and Endocrinology 4 20. (doi:10.1186/1477-7827-4-20)
Fowler PA, Dora NJ, McFerran H, Amezaga MR, Miller DW, Lea RG, Cash P, McNeilly AS, Evans NP & Cotinot C et al. 2008 In utero exposure to low doses of environmental pollutants disrupts fetal ovarian development in sheep. Molecular Human Reproduction 14 269–280. (doi:10.1093/molehr/gan020)
Franks S, Stark J & Hardy K 2008 Follicle dynamics and anovulation in polycystic ovary syndrome. Human Reproduction Update 14 367–378. (doi:10.1093/humupd/dmn015)
Gaytán F, Morales C, Manfredi-Lozano M & Tena-Sempere M 2014 Generation of multi-oocyte follicles in the peripubertal rat ovary: link to the invasive capacity of granulosa cells? Fertility and Sterility 101 1467–1476. (doi:10.1016/j.fertnstert.2014.01.037)
Hendriks AE, Drop SL, Laven JS & Boot AM 2012 Fertility of tall girls treated with high-dose estrogen, a dose–response relationship. Journal of Clinical Endocrinology and Metabolism 97 3107–3114. (doi:10.1210/jc.2012-1078)
Iguchi T, Takasugi N, Bern HA & Mills KT 1986 Frequent occurrence of polyovular follicles in ovaries of mice exposed neonatally to diethylstilbestrol. Teratology 34 29–35. (doi:10.1002/tera.1420340105)
Jolly PD, Smith PR, Heath DA, Hudson NL, Lun S, Still LA, Watts CH & McNatty KP 1997 Morphological evidence of apoptosis and the prevalence of apoptotic versus mitotic cells in the membrane granulosa of ovarian follicles during spontaneous and induced atresia in ewes. Biology of Reproduction 56 837–846. (doi:10.1095/biolreprod56.4.837)
Juengel JL, Sawyer HR, Smith PR, Quirke LD, Heath DA, Lun S, Wakefield SJ & McNatty KP 2002 Origins of follicular cells and ontogeny of steroidogenesis in ovine fetal ovaries. Molecular and Cellular Endocrinology 191 1–10. (doi:10.1016/S0303-7207(02)00045-X)
Juengel JL, Heath DA, Quirke LD & McNatty KP 2006 Oestrogen receptor alpha and beta, androgen receptor and progesterone receptor mRNA and protein localisation within the developing ovary and in small growing follicles of sheep. Reproduction 131 81–92. (doi:10.1530/rep.1.00704)
Kelly JM, Kleemann DO & Walker SK 2005 Enhanced efficiency in the production of offspring from 4- to 8-week-old lambs. Theriogenology 63 1876–1890. (doi:10.1016/j.theriogenology.2004.09.010)
Mapletoft RJ, Steward KB & Adams GP 2002 Recent advances in the superovulation in cattle. Reproduction, Nutrition, Development 42 601–611. (doi:10.1051/rnd:2002046)
McLachlan JA, Newbold RR & Degen GH 1984 Diethylstilbestrol and other estrogens in the environment. Fundamental and Applied Toxicology 4 686–691. (doi:10.1016/0272-0590(84)90089-7)
McNatty KP, Juengel JL, Wilson T, Galloway SM & Davis GH 2001 Genetic mutations influencing ovulation rate in sheep. Reproduction, Fertility, and Development 13 549–555. (doi:10.1071/RD01078)
Melnick R, Lucier G, Wolfe M, Hall R, Stancel G, Prins G, Gallo M, Reuhl K, Ho SM & Brown T et al. 2002 Summary of the National Toxicology Program's report of the endocrine disruptors low-dose peer review. Environmental Health Perspectives 110 427–431. (doi:10.1289/ehp.02110427)
Monje LD, Varayoud J, Luque EH & Ramos JG 2007 Neonatal exposure to bisphenol A (BPA) modifies the abundance of estrogen receptor alpha (ERα) transcripts with alternative 5′ unstranslated regions in the female rat preoptic area. Journal of Endocrinology 194 201–212. (doi:10.1677/JOE-07-0014)
Monje LD, Varayoud J, Muñoz-de-Toro M, Luque EH & Ramos JG 2009 Neonatal exposure to bisphenol A alters estrogen-dependent mechanisms governing sexual behavior in the adult female rat. Reproductive Toxicology 28 435–442. (doi:10.1016/j.reprotox.2009.06.012)
Monje LD, Varayoud J, Muñoz-de-Toro M, Luque EH & Ramos JG 2010 Exposure of neonatal female rats to bisphenol A disrupts hypothalamic LHRHpre-mRNA processing and estrogen receptor α expression in nuclei controlling estrous cyclicity. Reproductive Toxicology 30 625–634. (doi:10.1016/j.reprotox.2010.08.004)
Mulsant P, Lecerf F, Fabre S, Schibler L, Monget P, Lanneluc I, Pisselet C, Riquet J, Monniaux D & Callebaut I et al. 2001 Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Mérino ewes. PNAS 98 5104–5109. (doi:10.1073/pnas.091577598)
Muñoz-de-Toro M, Maffini MV, Kass L & Luque EH 1998 Proliferative activity and steroid hormone receptor status in male breast carcinoma. Journal of Steroid Biochemistry and Molecular Biology 67 333–339.
Nagel SC & Bromfield JJ 2013 Bisphenol A: a model endocrine disrupting chemical with a new potential mechanism of action. Endocrinology 154 1962–1964. (doi:10.1210/en.2013-1370)
Newbold RR 2004 Lessons learned from perinatal exposure to diethylstilbestrol. Toxicology and Applied Pharmacology 199 142–150. (doi:10.1016/j.taap.2003.11.033)
Orisaka M, Jiang JY, Orisaka S, Kotsuji F & Tsang BK 2009 Growth differentiation factor 9 promotes rat preantral follicle growth by up-regulating follicular androgen biosynthesis. Endocrinology 150 2740–2748. (doi:10.1210/en.2008-1536)
Padmanabhan V & Veiga-Lopez A 2013 Sheep models of polycystic ovary syndrome phenotype. Molecular and Cellular Endocrinology 373 8–20. (doi:10.1016/j.mce.2012.10.005)
Padmanabhan V, Veiga-Lopez A, Abbott DH & Dumesic DA 2007 Developmental programming of ovarian disruption. In Novel Concepts in Ovarian Endocrinology, pp 329–352. Ed. Gonzalez-Bulnes A. Trivandrum, India: Research Signpost
Padmanabhan V, Sarma HN, Savabieasfahani M, Steckler TL & Veiga-Lopez A 2010 Developmental reprogramming of reproductive and metabolic dysfunction in sheep: native steroids vs environmental steroid receptor modulators. International Journal of Andrology 33 394–404. (doi:10.1111/j.1365-2605.2009.01024.x)
Peretz J, Gupta RK, Singh J, Hernandez-Ochoa I & Flaws JA 2011 Bisphenol A impairs follicle growth, inhibits steroidogenesis, and down regulates rate-limiting enzymes in the estradiol biosynthesis pathway. Toxicological Sciences 119 209–217. (doi:10.1093/toxsci/kfq319)
Petroff BK, Gao X, Rozman KK & Terranova PF 2000 Interaction of estradiol and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in an ovulation model: evidence for systemic potentiation and local ovarian effects. Reproductive Toxicology 14 247–255. (doi:10.1016/S0890-6238(00)00075-7)
Prizant H, Gleicher N & Sen A 2014 Androgen actions in the ovary: balance is key. Journal of Endocrinology 222 R141–R151. (doi:10.1530/JOE-14-0296)
Ptak G, Loi P, Dattena M, Tischner M & Cappai P 1999 Offspring from 1-month-old lambs: studies on the developmental capability of prepubertal oocytes. Biology of Reproduction 61 1568–1574. (doi:10.1095/biolreprod61.6.1568)
Ramos JG, Varayoud J, Bosquiazzo VL, Luque EH & Muñoz-de-Toro M 2002 Cellular turnover in the rat uterine cervix and its relationship to estrogen and progesterone receptor dynamics. Biology of Reproduction 67 735–742. (doi:10.1095/biolreprod.101.002402)
Ramos JG, Varayoud J, Monje LD, Moreno-Piovano G, Muñoz-de-Toro M & Luque EH 2007 Diethylstilbestrol alters the population dynamic of neural precursor cells in the neonatal male rat dentate gyrus. Brain Research Bulletin 71 619–627. (doi:10.1016/j.brainresbull.2006.12.004)
Rico C, Fabre S, Médigue C, di Clemente N, Clément F, Bontoux M, Touzé J-L, Dupont M, Briant E & Rémy B et al. 2009 Anti-mullerian hormone is an endocrine marker of ovarian gonadotropin-responsive follicles and can help to predict superovulatory responses in the cow. Biology of Reproduction 80 50–59. (doi:10.1095/biolreprod.108.072157)
Rivera OE, Varayoud J, Rodríguez H, Muñoz-de-Toro M & Luque EH 2011 Neonatal exposure to bisphenol A alters the ovarian follicular dynamics in the lamb. Reproductive Toxicology 32 304–312. (doi:10.1016/j.reprotox.2011.06.118)
Rodríguez HA, Kass L, Varayoud J, Ramos JG, Ortega HH, Durando M, Muñoz-de-Toro M & Luque EH 2003 Collagen remodelling in the guinea-pig uterine cervix is associated with a decreased in progesterone receptor expression. Molecular Human Reproduction 9 807–813. (doi:10.1093/molehr/gag099)
Rodríguez HA, Santambrosio N, Santamaría CG, Muñoz-de-Toro M & Luque EH 2010 Neonatal exposure to bisphenol A reduces the pool of primordial follicles in the rat ovary. Reproductive Toxicology 30 550–557. (doi:10.1016/j.reprotox.2010.07.008)
Savabieasfahani M, Kannan K, Astapova O, Evans NP & Padmanabhan V 2006 Developmental programming: differential effects of prenatal exposure to bisphenol-A or methoxychlor on reproductive function. Endocrinology 147 5956–5966. (doi:10.1210/en.2006-0805)
Sekiguchi S, Ito S & Honna T 2003 Experimental model to study reproductive toxicity of chemicals using induced ovulation in immature F344 Rats. Industrial Health 41 287–290. (doi:10.2486/indhealth.41.287)
Sen A & Hammes SR 2010 Granulosa cell-specific androgen receptors are critical regulators of ovarian development and function. Molecular Endocrinology 24 1393–1403. (doi:10.1210/me.2010-0006)
Sen A, Prizant H, Light A, Biswas A, Hayes E, Lee HJ, Barad D, Gleicher N & Hammes SR 2014 Androgens regulate ovarian follicular development by increasing follicle stimulating hormone receptor and microRNA-125b expression. PNAS 111 3008–3013. (doi:10.1073/pnas.1318978111)
Shelby MD 2008 NTP-CERHR monograph on the potential human reproductive and developmental effects of bisphenol A. NTP CERHR MON, vol 22, NTP-CERHR BPA monograph, pp i–III1
Smith P, Steckler TL, Veiga-Lopez A & Padmanabhan V 2009 Developmental programming: differential effects of prenatal testosterone and dihydrotestosterone on follicular recruitment, depletion of follicular reserve, and ovarian morphology in sheep. Biology of Reproduction 80 726–736. (doi:10.1095/biolreprod.108.072801)
Souza CJ, MacDougall C, MacDougall C, Campbell BK, McNeilly AS & Baird DT 2001 The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. Journal of Endocrinology 169 R1–R6. (doi:10.1677/joe.0.169R001)
Souza CJ, Campbell BK, McNeilly AS & Baird DT 2002 Effect of bone morphogenetic protein 2 (BMP2) on oestradiol and inhibin A production by sheep granulosa cells, and localization of BMP receptors in the ovary by immunohistochemistry. Reproduction 123 363–369. (doi:10.1530/rep.0.1230363)
Stoker C, Beldoménico PM, Bosquiazzo VL, Zayas MA, Rey F, Rodríguez H, Muñoz-de-Toro M & Luque EH 2008 Developmental exposure to endocrine disruptor chemicals alters follicular dynamics and steroid levels in Caiman latirostris. General and Comparative Endocrinology 156 603–612. (doi:10.1016/j.ygcen.2008.02.011)
Taylor KM, Gray CA, Joyce MM, Stewart MD, Bazer FW & Spencer TE 2000 Neonatal ovine uterine development involves alterations in expression of receptors for estrogen, progesterone, and prolactin. Biology of Reproduction 63 1192–1204. (doi:10.1095/biolreprod63.4.1192)
Taylor JA, Welshons WV & Vom Saal FS 2008 No effect of route of exposure (oral; subcutaneous injection) on plasma bisphenol A throughout 24h after administration in neonatal female mice. Reproductive Toxicology 25 169–176. (doi:10.1016/j.reprotox.2008.01.001)
Vandenberg LN, Hauser R, Marcus M, Olea N & Welshons WV 2007 Human exposure to bisphenol A (BPA). Reproductive Toxicology 24 139–177. (doi:10.1016/j.reprotox.2007.07.010)
Varayoud J, Ramos JG, Bosquiazzo VL, Muñoz-de-Toro M & Luque EH 2008 Developmental exposure to bisphenol A impairs the uterine response to ovarian steroids in the adult. Endocrinology 149 5848–5860. (doi:10.1210/en.2008-0651)
Varayoud J, Ramos JG, Muñoz-de-Toro M & Luque EH 2014 Long-lasting effects of neonatal bisphenol A exposure on the implantation process. Vitamins and Hormones 94 253–275. (doi:10.1016/B978-0-12-800095-3.00010-9)
Veiga-Lopez A, Luense LJ, Christenson LK & Padmanabhan V 2013 Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression. Endocrinology 154 1873–1884. (doi:10.1210/en.2012-2129)
Veiga-Lopez A, Beckett EM, Abi Salloum B, Ye W & Padmanabhan V 2014 Developmental programming: prenatal BPA treatment disrupts timing of LH surge and ovarian follicular wave dynamics in adult sheep. Toxicology and Applied Pharmacology 279 119–128. (doi:10.1016/j.taap.2014.05.016)
Viña R, Jeng Y-J & Watson CS 2012 Non-genomic effects of xenoestrogen mixtures. International Journal of Environmental Research and Public Health 9 2694–2714. (doi:10.3390/ijerph9082694)
Vitt UA, Hayashi M, Klein C & Hsueh AJ 2000 Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biology of Reproduction 62 370–377. (doi:10.1095/biolreprod62.2.370)
Welshons WV, Nagel SC & vom Saal FS 2006 Large effects from small exposures. III. Endocrine mechanisms mediating effects of bisphenol A at levels of human exposure. Endocrinology 147 (6 suppl) S56–S69. (doi:10.1210/en.2005-1159)
Wordinger RJ & Derrenbacker J 1989 In utero exposure of mice to diethylstilbestrol alters neonatal ovarian follicle growth and development. Acta Anatomica 134 312–318. (doi:10.1159/000146708)
Worthington CA & Kennedy JP 1979 Ovarian response to exogenous hormones in 6-week-old lambs. Australian Journal of Biological Sciences 33 91–95.
Wozniak AL, Bulayeva NN & Watson CS 2005 Xenoestrogens at picomolar to nanomolar concentrations trigger membrane estrogen receptor-α-mediated Ca2+ fluxes and prolactin release in GH3/B6 pituitary tumor cells. Environmental Health Perspectives 113 431–439. (doi:10.1289/ehp.7505)
Wray NR & Goddard ME 1994 MOET breeding schemes for wool sheep 1. Design alternatives. Animal Production 59 71–86. (doi:10.1017/S0003356100007522)
Yi SE, LaPolt PS, Yoon BS, Chen JY, Lu JK & Lyons KM 2001 The type I BMP receptor BmprIB is essential for female reproductive function. PNAS 98 7994–7999. (doi:10.1073/pnas.141002798)
