Abstract
Human chorionic gonadotropin (hCG) is a known trigger of ovarian hyperstimulation syndrome (OHSS), a potentially life-threatening complication of assisted reproduction. Administration of hCG results in the release of vascular endothelial growth factor (VEGF) from the ovary. We have previously shown that expression of pigment epithelium-derived factor (PEDF) in granulosa cell line is regulated by hCG, reciprocally to VEGF, and that the PEDF–VEGF balance is impaired in OHSS. Our aim was to explore the signaling network by which hCG downregulates the expression of PEDF mRNA and protein in granulosa cells. We applied specific chemical inhibitors and stimuli to human primary granulosa cells and rat granulosa cell line. We found that PKA and protein kinase C, as well as EGFR, ERK1/2 and PI3K, participate in the signaling network. The finding that hCG-induced PEDF downregulation and VEGF upregulation are mediated by similar signaling cascades emphasizes the delicate regulation of ovarian angiogenesis.
Introduction
The physiological functions of the female ovaries are hormonally controlled, undergoing in each cycle tissue modifications, such as angiogenesis, that are regulated by steroid hormones (Reynolds & Redmer 1998). The ovary responds to the mid-cycle surge of luteinizing hormone (LH) by ovulation of mature oocytes followed by development of extensive microvasculature in the follicular wall and in the granulosa cells layer, leading to corpus luteum (CL) formation. If pregnancy does not occur, ovarian angiogenesis regresses (Reynolds & Redmer 1998). Vascular endothelial growth factor (VEGF) is a key regulator of ovarian vasculature (Mauro et al. 2014) upregulated by LH in granulosa cells (Herr et al. 2013).
Pigment epithelium-derived factor (PEDF) is a secreted 50-kDa glycoprotein that belongs to the non-inhibitory members of the serine protease inhibitors (serpin) and is defined as a natural angiogenesis inhibitor with neurotrophic and immune-modulating properties (Craword et al. 2013). The anti-angiogenic effect of PEDF was extensively investigated, showing that it can inhibit the stimulatory activity of several strong pro-angiogenic factors, and that it can hinder endothelial cell activity, both directly and indirectly, by inhibiting VEGF (Becerra & Notario 2013). We reported that PEDF is expressed in human and rodent ovaries, produced and secreted by granulosa cells in a hormonally dependent manner. The secreted PEDF exerts an anti-angiogenic effect, as demonstrated by in vitro inhibition of proliferation, migration, and tube formation of human umbilical vein endothelial cells (HUVECs) (Ninio-Many et al. 2013). We have further demonstrated that human chorionic gonadotropin (hCG), an LH analog, causes a decrease in the expression of PEDF, both in vivo and in vitro and that like in other tissues, the expression of PEDF is inverse to that of VEGF (Ninio-Many et al. 2013). Our preliminary studies indicated that PEDF–VEGF homeostasis is significant for maintaining intact ovarian function. This dynamic balance was shown to be modulated, at least in part, by hCG (Chuderland et al. 2013).
Several reproductive disorders are associated with impaired ovarian angiogenesis; two distinct ones are: polycystic ovarian syndrome (PCOS) that is characterized by an excessive formation of blood vessels (Gomez et al. 2011) and ovarian hyperstimulation syndrome (OHSS; Soares et al. 2008). OHSS is triggered by administration of hCG and is associated with unrestrained formation of blood vessels, as well as by increased capillary permeability; VEGF is considered as the main factor that causes increased vascular permeability and as an OHSS hallmark in humans and rodents (Soares et al. 2008). We have previously shown an impaired angiogenic balance in OHSS, where ovarian VEGF expression was high and PEDF expression low (Chuderland et al. 2013).
Whereas the signal transduction that governs hCG-induced VEGF biosynthesis is well documented and is known to be mediated by several factors, such as protein kinase C (PKC; Sriraman et al. 2008), PKA (van den Driesche et al. 2008), and amphiregulin (AREG; Karakida et al. 2011), hCG-mediated PEDF downregulation is not yet investigated. In the current study, we report the involvement of PKA and PKC as well as AREG and the downstream effectors ERK1/2 and PI3K, in the hCG-mediated PEDF downregulation.
Materials and methods
Study design
We used rat granulosa cell line (LH-15 cells) or primary human granulosa cells (PHGC) obtained from women undergoing IVF treatments.
Cell culture
LH-15 cells (a gift from Prof. A. Amsterdam, Weizmann Institute of Science, Israel; Suh et al. 1992) were cultured in hormone-free DMEM/Ham F12 1:1 (DMEM-F12) supplemented with penicillin and streptomycin (100 IU/ml and 100 mg/ml respectively; Biological Industries, Beit-Ha'emek, Israel) and 10% Charcoal-stripped fetal bovine serum (CS-FBS; Invitrogen; culture medium). Cells were serum-starved for 16 h (0 or 0.1% CS-FBS) prior to and during the various stimulations. PHGC (Helsinki IRB approval 167/09*1; AssafHarofeh Medical Centre, Israel) were obtained from women who fulfilled the following criteria: 22–38 years of age, infertility due to male factor, and retrieval of 4–15 oocytes per woman. Patients were treated according to the long protocol guidelines. PHGC were isolated from aspirated follicular fluids after oocyte retrieval. The follicular fluid was centrifuged at 300 g for 5 min at room temperature. The resulting pellets were re-suspended in 10 mM Tris, 0.84% NH4Cl, pH 7.4, to cause lysis of blood cells (15 min shaking at 37 °C) and were washed several times in PBS to eliminate debris. Cells were counted before seeding in order to reach equal confluence and make sure there is no contamination by leukocytes, plated in culture medium and washed every 24 h. On the fourth day after isolation, cells were serum-starved (0.1% CS-FBS) for 16 h prior to and during the various stimulations (Ninio-Many et al. 2013).
Activators and inhibitors
Activators – serum-starved (0 and 0.1% CS-FBS) LH-15 cells and PHGC, respectively, were incubated with i) PKC activator – Phorbol 12-myristate 13-acetate (PMA; P1585, Sigma; dissolved in DMSO), for 1 h; ii) human amphiregulin (AREG; 10558-HNAE, Sino Biological, Inc., Beijing, People's Republic China; dissolved in DDW) that interacts with the epidermal growth factor receptor (EGFR) and promotes cell growth, for 4 (LH-15 cells) or 16 (PHGC) hours. PEDF level (protein and mRNA) was detected at the end of the incubation period. Inhibitors – serum-starved (0.1% CS-FBS) LH-15 cells were incubated for 30 min with i) selective PKC inhibitor GF 109203X (GF, G2911, Sigma); ii) potent cAMP-dependent protein kinase inhibitor H89 dihydrochloride hydrate (H89, B1427, Sigma); iii) MEK (MKK1; MAPK kinase) inhibitor PD184352 (PD, PZ0181 Sigma); iv) phosphatidylinositol 3-kinase (PI3K) inhibitor wortmannin (W1628, Sigma) or v) EGFR inhibitor AG18 (AG; S8009, selleckchem.com, Houston, TX, USA). All inhibitors were dissolved in DMSO. Culture media were replaced after stimulation with fresh starvation media (0.1% CS-FBS), supplemented with hCG (1 IU) for additional 6 h of incubation, after which PEDF level (protein and mRNA) was detected.
Western blot analysis
Proteins of granulosa cells were separated by SDS–PAGE (10%; Bio-Rad) and transferred onto nitrocellulose membranes (Whatman GmbH, Wendlingen am Neckar, Germany) in a mini tank transfer unit (TE 22, Amersham, UK). Approximate molecular masses were determined by comparison with the migration of pre-stained protein standards (Bio-Rad). Blots were blocked for 1 h in TBST (10 mM Tris–HCl, pH=8.0, 150 mM NaCl, 0.05% Tween 20) containing 5% skim-milk (Alba, NY, USA) followed by an overnight incubation at 4 °C with primary antibodies. Primary antibodies: anti-PEDF (sc-25594; Santa Cruz Biotechnology) and anti-actin (MAB1501, Millipore, Temecula, CA, USA). Blots were washed three times in TBST and incubated for 1 h at room temperature with HRP-conjugated secondary antibodies. Secondary antibodies: HRP-conjugated monoclonal and polyclonal antibodies (Jackson Immunoresearch, West Grove, PA, USA). Immunoreactive bands were visualized by ECL (Thermo Scientific, Waltham, MA, USA) according to manufacturer's guidelines. Intensity of the protein bands was quantified by the open source software - Image J Software (NIH).
RNA isolation, reverse transcription, PCR, and real-time PCR (qPCR)
Total RNA was isolated from granulosa cells, using Trizol reagent (Invitrogen) according to manufacturer's instructions, and quantified with the Nano-Drop spectrophotometer (ND-1000; Thermo Scientific). First-strand cDNA was created by RT (Maxima TM Reverse transcriptase, Thermo Scientific) from a total of 1 μg RNA, using oligo-dt primers (Thermo Scientific). DNA was amplified using 1 μl RT reaction and 50 pmol gene-specific primers in ReadyMix mixture (Sigma). PCR products were separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining. Changes in the level of expression of mRNA were detected by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) along with 15 ng cDNA and specific primers, on a StepOnePlus Real-Time PCR System (Applied Biosystems).
RT-PCR primers
HPRT1 rat: Forward-5′ CTCATGGACTGATTATGGACAGGA3′; Reverse-5′ GCAGGTCAGCAAAGAACTTATAGCC3′; PEDF rat: Forward-5′ TTCACCCGGAGCAGTGAT3′; Reverse-5′ GCCTCCAGAATTGTGTTTGAG3′; HPRT1 human: Forward-5′ TGACACTGGCAAAACAATGCA3′; Reverse-5′GGTCCTTTTCACCAGCAAGCT′; PEDF human: Forward-5′CAACTTCGGCTATGACCTGTA3′; Reverse-5′AGTAGAGAGCCCGGTGAAGA3′
Statistical analysis
Differences in the RT-PCR arbitrary units were assessed using t-test, with a significance of P<0.05. In all experiments, RT-PCR outcome of experimental groups was expressed as percent of the ‘vehicle’ RT-PCR outcome that was arbitrarily set as 100% (control). When inhibitors were used in an experiment, T-TEST was performed between the experimental group of ‘inhibitor only’ and ‘inhibitor+hCG.’ When activators were used in an experiment, t-test was performed between the control and the ‘activator’ experimental groups. Each experiment was repeated at least three times.
All participants signed written informed consent forms.
Results
The role of PKA in hCG-induced PEDF downregulation
We showed that PEDF level in hCG-stimulated LH-15 cells reached a nadir within 6 h (Fig. 1A and B; P<0.05). The major signaling cascade downstream to LH receptor is the cAMP-PKA pathway (van den Driesche et al. 2008). To establish the putative role of PKA in hCG-mediated PEDF downregulation, serum-starved LH-15 cells were stimulated with hCG in the presence or absence of a PKA inhibitor (H89; 2 μM). We found that inhibition of PKA abrogated hCG ability to downregulate the expression of PEDF at both mRNA and protein levels (Fig. 1C and D; P>0.05), implying that PKA participates in hCG-mediated PEDF downregulation.
hCG mediates PEDF downregulation through PKA signaling pathway. Serum-starved LH-15 cells were exposed to (A and B) hCG (1 IU) for 6 h and (C and D) the PKA inhibitor H89 (2 μM) for 30 min. Culture medium was replaced with fresh 0.1% CS-FBS, supplemented with hCG (1IU); cells were incubated for 6 more hours. (A, B, and C) Changes in PEDF mRNA level were measured by qPCR analysis with specific primers for PEDF and calibrated with HPRT. Bars represent three independent experiments. The ratio between each treatment and control (DMSO) is plotted as Mean±s.e.m., (*P<0.05) – significantly different from control value. (B and D) Cells were lysed and their proteins were analyzed by western blotting with anti-PEDF antibody, using actin as a loading control. Representative blots are presented.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
The role of PKC in hCG-induced PEDF downregulation
There are considerable amounts of evidence indicating that LH can activate the PKC signaling pathway, though its function in this pathway is still controversial (Salvador et al. 2002). To evaluate whether PKC participates in hCG-mediated PEDF downregulation, serum-starved LH-15 cells were stimulated with hCG in the presence or absence of a PKC inhibitor (GF, 3 μM). We found that inhibition of PKC abrogated hCG-induced PEDF downregulation, at both mRNA and protein levels (Fig. 2A and B; P>0.05). To further establish the role of PKC in hCG-induced PEDF downregulation, serum-starved LH-15 cells were stimulated for 1 h with PMA (50 or 100 nM), a known PKC activator. Stimulation with PMA significantly decreased the expression of PEDF mRNA and protein (Fig. 2 C and D; P<0.05). The findings of this experiment were supported by an in vitro model of PHGC, where PMA treatment caused a more prominent decrease in the expression of PEDF mRNA and protein (Fig. 2E and F; P<0.05). Thus, we suggest that hCG-induced PEDF downregulation occurs downstream to the PKC signaling pathway.
hCG mediates PEDF downregulation through PKC signaling pathway. (A and B) Serum starved LH-15 cells were exposed to the PKC inhibitor, GF (3μM), for 30 min. Culture medium was then replaced with fresh 0.1% CS-FBS, supplemented with hCG (1IU) for a 6-hour incubation period. (C, D, E, and F) Serum-starved (C and D) LH-15 cells and (E–F) PHGC were exposed for 1 h to increasing doses of PMA (50-100 nM). (A, C, and E) Changes in PEDF mRNA level were measured by qPCR analysis with specific primers for PEDF (rat or human) and calibrated with HPRT. Bars represent three independent experiments. The ratio between each treatment and control is plotted as Mean±s.e.m., (*P<0.05; ** P<0.01) – significantly different from control value. (B, D, and F) Cells were lysed and their proteins were analyzed by western blotting with anti-PEDF antibody, using actin as a loading control. Representative blots are presented.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
The role of EGFR in hCG-induced downregulation of PEDF
EGF-like growth factors are produced in response to LH stimulation both in human and rat granulosa cells (Park et al. 2004). In an attempt to evaluate whether EGF-like growth factors are part of the hCG-PEDF signaling cascade, we pre-treated serum-starved LH-15 cells with an EGF receptor inhibitor (AG; 10 μM). We found that AG abolished the ability of hCG to decrease the levels of PEDF mRNA and protein (Fig. 3A and B; P>0.05). Stimulation of LH-15 cells (Fig. 3C and D) or PHGC (Fig. 3E and F) with AREG for 4 or 16 h (respectively; 20 ng/ml), decreased the levels of PEDF mRNA and protein in both cell types although PHGC were more sensitive to the treatment (P<0.05). Thus, we suggest that EGF-like growth factors may participate in the signaling cascade that mediates hCG-induced PEDF downregulation.
EGFR is involved in PEDF downregulation. (A and B) Serum-starved LH-15 cells were exposed to an EGFR inhibitor, AG (10 μM) for 30 min. Culture medium was then replaced with fresh 0.1% CS-FBS, supplemented with hCG (1 IU). Cells were incubated for 6 more hours. (C, D, E, and F) Serum-starved (C, D) LH-15 cells or (E and F) PHGC were exposed to AREG (20ng/ml) for 4 or 16 h respectively. (A, C, and E) Changes in PEDF mRNA level were measured by qPCR analysis with specific primers for PEDF (rat or human) and calibrated with HPRT. Bars represent three independent experiments. The ratio between each treatment and control is plotted as Mean±s.e.m., (*P<0.05) – significantly different from control value. (B, D, and F) Cells were lysed and their proteins were analyzed by western blotting with anti-PEDF antibody, using actin as a loading control. Representative blots are presented.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
It is accepted that transactivation of LH receptor is downstream of PKC cascade (Leserer et al. 2000, Cattaneo et al. 2014); it is also suggested that PKC can act downstream to EGF and that EGF-like growth factors can activate PKC directly (Li et al. 1991, Anne et al. 2013, Liu et al. 2014). To determine whether inhibition of PKC will hamper the ability of AREG to downregulate PEDF expression, we followed the expression of PEDF in AREG-stimulated LH-15 cells with or without pretreatment with a PKC inhibitor (GF; 10 μM). We found that the ability of AREG to downregulate the expression of PEDF mRNA and protein was not impaired (Fig. 4A and B; P<0.05). Therefore, we suggested that PKC is not involved in AERG-mediated PEDF downregulation.
PKC is not involved in AREG-mediated PEDF downregulation. Serum-starved LH-15 cells were exposed to the PKC inhibitor, GF (3 μM), for 30 min. Culture medium was then replaced with a fresh 0.1% CS-FBS, supplemented with AREG (20 ng/ml) for 4 h incubation period. (A) Changes in PEDF mRNA level were measured by qPCR analysis with specific primers for PEDF and calibrated with HPRT. Bars represent three independent experiments. The ratio between the value of each treatment and control value is plotted as Mean±s.e.m., (*P<0.05) – significantly different from control value. (B) Cells were lysed and their proteins were analyzed by western blotting with anti-PEDF antibody, using actin as a loading control. Representative blots are presented.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
The role of ERK and PI3K in hCG-induced PEDF downregulation
Our final aim was to evaluate whether ERK and PI3K, two signaling molecules located downstream to PKC and EGF, are part of the hCG-induced cascade of PEDF downregulation. LH-15 cells were pre-treated with a specific ERK inhibitor, PD (25 μM), or with a PI3K inhibitor, wortmannin (2 μM), before hCG stimulation. Both pathways were involved in hCG-induced PEDF downregulation (Fig. 5A, B, C, and D; P>0.05). Interestingly, inhibition of PI3K caused an elevation of PEDF mRNA basal level, which may point to the importance of PI3K as a PEDF regulator.
Inhibition of ERK or PI3K prevents hCG-induced PEDF downregulation. Serum-starved LH-15 cells were exposed for 30 min to (A and B) PD (an ERK inhibitor; 25 μM) or to (C and D) wortmannin (a PI3K inhibitor; 2 μM). Culture medium was replaced with fresh starvation medium (CS-FBS; 0.1%), supplemented with hCG (1 IU) for a 6-h incubation period. (A and C) Changes in PEDF mRNA level were measured by qPCR analysis with specific primers for PEDF; calibrated with HPRT. The ratio between each treatment and the control is plotted as Mean±s.e.m., (*P<0.05) – significantly different from control value. (B,D) Cells were lysed and their proteins were analyzed by western blotting with anti-PEDF antibody, using actin as a loading control. Representative blots are presented.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
Discussion
Ovarian angiogenesis is a hormonally regulated physiological process. We have already shown in both in vivo and in vitro models that PEDF, one of the most potent anti-angiogenicendogenous factors (Becerra & Notario 2013), regulates the expression of ovarian VEGF and ovarian angiogenesis (Chuderland et al. 2013) and that its expression in the ovary is downregulated by LH, estrogen, and progesterone (Ninio-Many et al. 2013).
The signaling pathway of LH in granulosa cells is well documented; LH initiates ovulation through activation of the LH receptor (LH-R), a G-protein coupled receptor that activates downstream effectors as adenylate cyclase, PKA (Selvaraj et al. 1996), and PKC (Woods & Johnson 2007). Furthermore, stimulation by LH induces transactivation of EGFR by EGF-like growth factors, as AREG (Panigone et al. 2008), which is mediated, at least in part, by the cAMP/PKA (Freimann et al. 2004) and the PKC (Sun et al. 2009) cascades. In the current study, we report that downregulation of PEDF by hCG occurs downstream to PKA and PKC because inhibition of PKA and PKC prevents hCG-induced PEDF downregulation, and stimulation with PKC agonist leads to PEDF downregulation (Fig. 6). Finally, hCG-induced PEDF downregulation occurs downstream to ERK1/2 and PI3K because their inhibition prevents downregulation of PEDF (Fig. 6).
Schematic representation of hCG-mediated PEDF downregulation.
Citation: REPRODUCTION 151, 2; 10.1530/REP-15-0478
Angiogenesis is a tightly controlled process, executed by pro- and anti-angiogenic factors (Abdollahi & Folkman 2010). In the current study, we illustrate the delicate physiological angiogenic balance in the ovary. VEGF, a key regulator of ovarian vasculature (Mauro et al. 2014) is upregulated by LH/hCG in granulosa cells (Herr et al. 2013). The signal transduction that governs hCG-induced VEGF biosynthesis is well documented and is known to be mediated by several factors as PKC (Sriraman et al. 2008), PKA (van den Driesche et al. 2008) and AREG (Karakida et al. 2011)). In this paper, we focus on the signal transduction that governs hCG-induced PEDF downregulation. We found that similar signaling cascades participate in both hCG-induced VEGF upregulation and PEDF downregulation. These findings emphasize the importance of angiogenesis regulation around the time of ovulation that is required to facilitate the fast formation of the highly vascularized CL. Thus, our results point out the unique regulation of the orchestrated PEDF-VEGF balance, reflecting the cyclic angiogenic dynamics in the ovary.
Various pathologies of the female reproductive organs, like ovarian carcinoma, PCOS, and OHSS, are associated with unrestrained angiogenesis, attributed, at least in part, to high level of VEGF. We have shown that impaired PEDF-VEGF balance lies at the core of OHSS pathophysiology and that administration of recombinant PEDF reverts the pathological balance to normalcy (Chuderland et al. 2013). The current therapeutic armamentarium for OHSS consists mainly of symptomatic managing; there are no available drugs to treat this pathological situation effectively. The results obtained in this paper may imply the possible use of specific signaling modulators that would restore the angiogenic balance by affecting concomitantly the expression of both PEDF and VEGF.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was partially supported by a grant from the Lau-Mintz Foundation (Tel-Aviv University) to R Shalgi and by a grant from the GIF, the German-Israeli Foundation for Scientific Research and Development to D Chuderland and the Israel Science Foundation Grant 1934/13 (to I Ben-Ami).
Acknowledgements
The authors are grateful to Ruth Kaplan-Kraicer from Sackler Faculty of Medicine, Tel Aviv University, for her help in preparing the manuscript. H Bar-Joseph, D Chuderland, and I Ben-Ami developed the concept, designed experiments, and prepared the manuscript. H Bar-Joseph also carried out most of the experiments, data organization, and statistical analyses and wrote the manuscript. R Ron-El discussed the manuscript. R Shalgi conceived the study, participated in its design and coordination, helped drafting the manuscript, and supervised the study. All authors read and approved the final version.
References
Abdollahi A & Folkman J 2010 Evading tumor evasion: current concepts and perspectives of anti-angiogenic cancer therapy. Drug Resistance Updates 13 16–28. (doi:10.1016/j.drup.2009.12.001)
Anne SL, Govek EE, Ayrault O, Kim JH, Zhu X, Murphy DA, Van Aelst L, Roussel MF & Hatten ME 2013 WNT3 inhibits cerebellar granule neuron progenitor proliferation and medulloblastoma formation via MAPK activation. PLoS ONE 8 e81769. (doi:10.1371/journal.pone.0081769)
Becerra SP & Notario V 2013 The effects of PEDF on cancer biology: mechanisms of action and therapeutic potential. Nature Reviews. Cancer 13 258–271. (doi:10.1038/nrc3484)
Berisha B, Schams D, Kosmann M, Amselgruber W & Einspanier R 2000 Expression and localisation of vascular endothelial growth factor and basic fibroblast growth factor during the final growth of bovine ovarian follicles. Journal of Endocrinology 167 371–382. (doi:10.1677/joe.0.1670371)
Cattaneo F, Guerra G, Parisi M, De Marinis M, Tafuri D, Cinelli M & Ammendola R 2014 Cell-surface receptors transactivation mediated by g protein-coupled receptors. International Journal of Molecular Sciences 15 19700–19728. (doi:10.3390/ijms151119700)
Chen SU, Chou CH, Lin CW, Lee H, Wu JC, Lu HF, Chen CD & Yang YS 2010 Signal mechanisms of vascular endothelial growth factor and interleukin-8 in ovarian hyperstimulation syndrome: dopamine targets their common pathways. Human Reproduction 25 757–767. (doi:10.1093/humrep/dep432)
Chuderland D, Hasky N, Ben-Ami I, Kaplan-Kraicer R, Grossman H & Shalgi R 2013 A physiological approach for treating endometriosis by recombinant pigment epithelium-derived factor (PEDF). Human Reproduction 28 1626–1634. (doi:10.1093/humrep/det027)
Craword SE, Fitchev P, Veliceasa D & Volpert OV 2013 The many facets of PEDF in drug discovery and disease: a diamond in the rough or split personality disorder? Expert Opinion on Drug Discovery 8 769–792. (doi:10.1517/17460441.2013.794781)
van den Driesche S, Myers M, Gay E, Thong KJ & Duncan WC 2008 HCG up-regulates hypoxia inducible factor-1 alpha in luteinized granulosa cells: implications for the hormonal regulation of vascular endothelial growth factor A in the human corpus luteum. Molecular Human Reproduction 14 455–464. (doi:10.1093/molehr/gan040)
Freimann S, Ben-Ami I, Dantes A, Ron-El R & Amsterdam A 2004 EGF-like factor epiregulin and amphiregulin expression is regulated by gonadotropins/cAMP in human ovarian follicular cells. Biochemical and Biophysical Research Communications 324 829–834. (doi:10.1016/j.bbrc.2004.09.129)
Gomez R, Ferrero H, Delgado-Rosas F, Gaytan M, Morales C, Zimmermann RC, Simon C, Gaytan F & Pellicer A 2011 Evidences for the existence of a low dopaminergic tone in polycystic ovarian syndrome: implications for OHSS development and treatment. Journal of Clinical Endocrinology and Metabolism 96 2484–2492. (doi:10.1210/jc.2011-0075)
Herr D, Fraser HM, Konrad R, Holzheu I, Kreienberg R & Wulff C 2013 Human chorionic gonadotropin controls luteal vascular permeability via vascular endothelial growth factor by down-regulation of a cascade of adhesion proteins. Fertility and Sterility 99 1749–1758. (doi:10.1016/j.fertnstert.2013.01.120)
Karakida S, Kawano Y, Utsunomiya Y, Furukawa Y, Sasaki T & Narahara H 2011 Effect of heparin-binding EGF-like growth factor and amphiregulin on the MAP kinase-induced production of vascular endothelial growth factor by human granulosa cells. Growth Factors 29 271–277. (doi:10.3109/08977194.2011.607136)
Leserer M, Gschwind A & Ullrich A 2000 Epidermal growth factor receptor signal transactivation. IUBMB Life 49 405–409. (doi:10.1080/152165400410254)
Li M, Morley P & Tsang BK 1991 Epidermal growth factor elevates intracellular pH in chicken granulosa cells by activating protein kinase C. Endocrinology 129 2957–2964. (doi:10.1210/endo-129-6-2957)
Liu ZC, Chen XH, Song HX, Wang HS, Zhang G, Wang H, Chen DY, Fang R, Liu H & Cai SH et al. 2014 Snail regulated by PKC/GSK-3beta pathway is crucial for EGF-induced epithelial-mesenchymal transition (EMT) of cancer cells. Cell and Tissue Research 358 491–502. (doi:10.1007/s00441-014-1953-2)
Mauro A, Martelli A, Berardinelli P, Russo V, Bernabo N, Di Giacinto O, Mattioli M & Barboni B 2014 Effect of antiprogesterone RU486 on VEGF expression and blood vessel remodeling on ovarian follicles before ovulation. PLoS ONE 9 e95910. (doi:10.1371/journal.pone.0095910)
Ninio-Many L, Grossman H, Shomron N, Chuderland D & Shalgi R 2013 microRNA-125a-3p reduces cell proliferation and migration by targeting Fyn. Journal of Cell Science 126 2867–2876. (doi:10.1242/jcs.123414)
Panigone S, Hsieh M, Fu M, Persani L & Conti M 2008 Luteinizing hormone signaling in preovulatory follicles involves early activation of the epidermal growth factor receptor pathway. Molecular Endocrinology 22 924–936. (doi:10.1210/me.2007-0246)
Park JY, Su YQ, Ariga M, Law E, Jin SL & Conti M 2004 EGF-like growth factors as mediators of LH action in the ovulatory follicle. Science 303 682–684. (doi:10.1126/science.1092463)
Reynolds LP & Redmer DA 1998 Expression of the angiogenic factors, basic fibroblast growth factor and vascular endothelial growth factor, in the ovary. Journal of Animal Science 76 1671–1681.
Salvador LM, Maizels E, Hales DB, Miyamoto E, Yamamoto H & Hunzicker-Dunn M 2002 Acute signaling by the LH receptor is independent of protein kinase C activation. Endocrinology 143 2986–2994. (doi:10.1210/endo.143.8.8976)
Selvaraj N, Dantes A, Limor R, Golander A & Amsterdam A 1996 Establishment of an in vitro bioassay and radio receptor assay for LH/CG in human sera using immortalized granulosa cells transfected with LH/CG receptor. Endocrine 5 275–283. (doi:10.1007/BF02739060)
Soares SR, Gomez R, Simon C, Garcia-Velasco JA & Pellicer A 2008 Targeting the vascular endothelial growth factor system to prevent ovarian hyperstimulation syndrome. Human Reproduction Update 14 321–333. (doi:10.1093/humupd/dmn008)
Sriraman V, Modi SR, Bodenburg Y, Denner LA & Urban RJ 2008 Identification of ERK and JNK as signaling mediators on protein kinase C activation in cultured granulosa cells. Molecular and Cellular Endocrinology 294 52–60. (doi:10.1016/j.mce.2008.07.011)
Suh BS, Sprengel R, Keren-Tal I, Himmelhoch S & Amsterdam A 1992 Introduction of a gonadotropin receptor expression plasmid into immortalized granulosa cells leads to reconstitution of hormone-dependent steroidogenesis. Journal of Cell Biology 119 439–450. (doi:10.1083/jcb.119.2.439)
Sun QY, Miao YL & Schatten H 2009 Towards a new understanding on the regulation of mammalian oocyte meiosis resumption. Cell Cycle 8 2741–2747. (doi:10.4161/cc.8.17.9471)
Woods DC & Johnson AL 2007 Protein kinase C activity mediates LH-induced ErbB/Erk signaling in differentiated hen granulosa cells. Reproduction 133 733–741. (doi:10.1530/REP-06-0261)
(R Shalgi and D Chuderland contributed equally to this work)
