Integrins functioning in uterine endometrial stromal and epithelial cells in estrus

in Reproduction

Here, as a basic study in the construction of a non-cellular niche that supports artificial organization of three-dimensional endometrial tissue, we defined the types of integrin heterodimers that are expressed transcriptionally, translationally and functionally in endometrial stromal (ES) and endometrial epithelial (EE) cells isolated from the mouse uterus in estrus. Gene and protein expression of integrin subunits were analyzed at the transcriptional and translational level by real-time PCR and fluorescent immunoassay, respectively. Moreover, the functionality of integrin heterodimers was confirmed by attachment and antibody inhibition assays. Itga2, Itga5, Itga6, Itga9, Itgav, Itgb1, Itgb3 and Itgb5 in ES cells, and Itga2, Itga5, Itga6, Itga7, Itga9, Itgav, Itgb1, Itgb3, Itgb4, Itgb5 and Itga6 and in EE cells showed significantly higher transcriptional levels than the other integrin subunits. Furthermore, translational expression of the total integrin α and β subunit genes that showed increased transcription was determined in ES and EE cells. ES cells showed significantly increased adhesion to collagen I, fibronectin and vitronectin, and functional blocking of integrin α2, α5 or αV significantly inhibited adhesion to these molecules. Moreover, EE cells showed significantly increased adhesion to collagen I, fibronectin, laminin and vitronectin, and functional blocking of integrin α2, α5, α6 or αV significantly inhibited adhesion to these molecules. Accordingly, we confirmed that integrin α2β1, α5β1, αVβ1, αVβ3 and/or αVβ5, and integrin α2β1, α5β1, α6β1 and/or α6β4, αVβ1, αVβ3 and/or αVβ5, actively function on the surface of ES and EE cells from mouse uterus in estrus phase, respectively.

Abstract

Here, as a basic study in the construction of a non-cellular niche that supports artificial organization of three-dimensional endometrial tissue, we defined the types of integrin heterodimers that are expressed transcriptionally, translationally and functionally in endometrial stromal (ES) and endometrial epithelial (EE) cells isolated from the mouse uterus in estrus. Gene and protein expression of integrin subunits were analyzed at the transcriptional and translational level by real-time PCR and fluorescent immunoassay, respectively. Moreover, the functionality of integrin heterodimers was confirmed by attachment and antibody inhibition assays. Itga2, Itga5, Itga6, Itga9, Itgav, Itgb1, Itgb3 and Itgb5 in ES cells, and Itga2, Itga5, Itga6, Itga7, Itga9, Itgav, Itgb1, Itgb3, Itgb4, Itgb5 and Itga6 and in EE cells showed significantly higher transcriptional levels than the other integrin subunits. Furthermore, translational expression of the total integrin α and β subunit genes that showed increased transcription was determined in ES and EE cells. ES cells showed significantly increased adhesion to collagen I, fibronectin and vitronectin, and functional blocking of integrin α2, α5 or αV significantly inhibited adhesion to these molecules. Moreover, EE cells showed significantly increased adhesion to collagen I, fibronectin, laminin and vitronectin, and functional blocking of integrin α2, α5, α6 or αV significantly inhibited adhesion to these molecules. Accordingly, we confirmed that integrin α2β1, α5β1, αVβ1, αVβ3 and/or αVβ5, and integrin α2β1, α5β1, α6β1 and/or α6β4, αVβ1, αVβ3 and/or αVβ5, actively function on the surface of ES and EE cells from mouse uterus in estrus phase, respectively.

Introduction

Uterine endometrial stromal (ES) and endometrial epithelial (EE) cells undergo dynamic periodic alterations during the reproductive period (Chan et al. 2004, Schwab et al. 2005). This is particularly evident during the estrus cycle, when the endometrium undergoes histological and functional remodeling (Tang et al. 2005, Arai et al. 2013), resulting in an increase in the receptivity of the endometrium to embryos (Ponsuksili et al. 2012, Chadchan et al. 2016). Therefore, during estrus, the endometrial microenvironment plays an important role in successful embryo implantation and pregnancy maintenance.

Endometrial tissue is structured as a three-dimensional (3D) microenvironment in vivo that consists of extracellular matrix (ECM) components and a number of distinct cell populations (Jokimaa et al. 2002, Yamada et al. 2002). The specificity of cells that constitute endometrial tissue at each stage of the estrus cycle is regulated by the alteration of 3D communication networks formed by the integration of cell-to-cell and cell-to-ECM contacts (Burghardt et al. 2002). To date, the endometrial microenvironment has been primarily constructed on two-dimensional culture plates rather than in 3D (Arnold et al. 2001), making it difficult to evaluate the effects of specific stimulations on endometrial tissue in vitro. Therefore, an in vitro mimic of the 3D endometrial microenvironment equivalent to endometrial tissue at each stage of the estrus cycle in vivo will be important for future studies.

The ECM, a non-cellular 3D macromolecular network composed of diverse fibrous ECM proteins, proteoglycans and glycoproteins (Kim et al. 2011, Theocharis et al. 2016) provides not only a physical scaffold to structure the 3D microenvironment but also signals a variety of cellular responses (Strauss 2013, Leppert et al. 2014). In particular, ECM-derived signals are transported to the cytoplasm through integrins that directly recognize components of the ECM (Rosso et al. 2004, Byron & Frame 2016), resulting in cytological alterations (Gronthos et al. 2001,Vitillo et al. 2016). Therefore, the stimulation of ECM protein-derived signals through integrins makes it possible to accurately regulate the specificity of endometrial cells at each stage of the estrus cycle, which requires detailed information on the integrins that are functionally expressed on the membranes of cells that make up the endometrium.

As a step toward developing a defined non-cellular niche that uses integrin signaling to construct artificial and stereoscopic 3D endometrial tissues in mice, we examined the types of integrin heterodimers expressed on the membranes of ES and EE cells derived from the mouse uterus in estrus. Integrin subunits expressed in ES and EE cells were identified at the transcriptional and translational level, and the combinations of α and β integrin subunits were determined with functional assays.

Materials and methods

Animals

Six- or seven-week-old female ICR mice in estrus identified through vaginal cytological evaluation described previously (McLean et al. 2012) were used as uterus endometrium cell donors. All animal housing, handling and experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Kangwon National University (IACUC approval No. KW-150327-3) and conducted according to the Animal Care and Use Guidelines of Kangwon National University.

Isolation of ES and EE cells from uterus

Uterine horns washed with Hank’s balanced salt solution (HBSS; Invitrogen) supplemented with 2% (v/v) antibiotic–antimycotic solution (Welgene Inc., Daegu, Korea) were split longitudinally and the tissue fragmented into fine pieces by surgical scissors was digested using 1.5 mg/mL collagenase (Sigma-Aldrich) in HBSS at 37°C for 45 min. Then, the digested cells were filtered through 100 μm nylon mesh (SPL, Pocheon, Korea). A sedimentation step collected cell clumps in the tube bottom after separating the filtrated cells under unit gravity by incubating in a 15 mL tube at room temperature for 15 min. This procedure was repeated three times to remove debris included in cell clump. Subsequently, an adherent step separated attached ES and suspended EE cells by incubating the cell clumps on a 100 mm culture plate at 37°C for 10 min that was repeated twice. Subsequently, two types of cells were isolated and counted using a hemocytometer.

Real-time polymerase chain reaction

According to the manufacturer’s instructions, the Dynabeads mRNA Direct Kit (Ambion) was used for extracting total mRNA from the cells and cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix with gDNA remover kit (Toyobo, Osaka, Japan). Then, the quantification of the specific gene expression was conducted using a THUNDERBIRD SYBR qPCR Mix (Toyobo) under the 7500 Real-time PCR system (Applied Biosystems), and melting curve date was analyzed for identifying PCR specificity. The mRNA level was presented as 2−ΔCt, where Ct = threshold cycle for target amplification, ΔCt = Cttarget gene (specific genes for each sample) − Ctinternal reference (β-actin for each sample). Design of primer sequences by Primer3 software (Whitehead Institute/MIT Center for Genome Research) was performed with information of cDNA sequences obtained from GenBank for mouse, and Table 1 shows general information and sequences of primers.

Table 1

Oligonucleotide primers and PCR cycling conditions.

Primer sequence
GenesGenBank numberSense (5′ > 3′)Anti-sense (5′ > 3′)Size (bp)Tempa
ActbX03672TACCACAGGCATTGTGATGGTCTTTGATGTCACGCACGATT20060
Itga1NM_001033228TGGCCAACCCAAAGCAAGAAAGGGCCCACATGCCAGAAAT20060
Itga2NM_008396TGTGCACCCCCAGAGCACTTTGTTCACTTGAAGGCCCGGA18160
Itga3NM_013565AGCAACCTGCAGATGCGAGCCTCATGCGCATCTTCCCCAG15860
Itga4NM_010576AGCAAAAAGGCATAGCGGGGAACGCTGGCTTCCTTCCCAC16060
Itga5NM_010577AGGCTGCGCTGTGAGTTTGGTGCCGAGGCAGGATCTGGTA17860
Itga6X63251AGGTTCGAGTGACGGTGTTTGTATCGGGGAATGCTGTCAT18560
Itga7NM_008398GCTTCCCAGACATTGCCGTGTCCATCCACATCCAGGCCAC18260
Itga8NM_001001309GCATTCTTGACGTGGGCTGGATCCTCTGGGGAGGCAGCAG15460
Itga9NM_133721GGGGCAGGTCACCGTCTACCAGCCACATCTGGGAACCCGT15660
Itga10BC115770GCTGTCTCCATGCCACAGGCGTGGGGAGGCATCACATCCA18660
Itga11NM_176922TCCGGTAACCCAGGGCAACTGCTTCCACACTCGTGCGACC17260
ItgavNM_008402AAGGCGCAGAATCAAGGGGACCAGCCTTCATCGGGTTTCC19460
ItgalNM_008400GGAAGCCTGGTGGGCTCAGTAGCTCAGCACAACCACCCGA18060
ItgamNM_008401CTTTGCAATTGAGGGCACGCGAAGGCTCCACCTGCCCAGT15060
ItgadNM_001029872TGTGGAGAAGCCCGTCGTGTAGTGGCAGGCGCACAGTCAT15760
ItgaxNM_021334GCTAGGGGACGTGAATGGGGGGAGGGGATCTGGGATGCTG16560
ItgaeNM_008399ACACAAGCCAAAGCCCTTCTCAGGCTCTTGACTCTGGGTG18660
Itgb1NM_010578CTGGTCCCGACATCATCCCACCGTGTCCCACTTGGCATTC16760
Itgb2NM_008404GGTGGCTCAGATCGGGGTTCTGCACCTGTTGCATTGGCAG16560
Itgb3NM_016780CCCCACCACAGGCAATCAAACCCTCTGGGGCATCTCGATT16660
Itgb4Bbib80751GGCCAGTGGCTCTCTCAGCAGTGGTCAGCAAGCTCGTGGG15160
Itgb5NM_010580AGGGCGTCCTATGCTCAGGCAGACACAACGGCCTCGGTCA16160
Itgb6NM_021359GTCCAAGGTGGCTGTGCCTGTGCGGGAGACAGGGTTTTCA19960
Itgb7NM_013566AAGGAGGGCTCTGCAGTGGGTACAGTTGGCTGCCAGGGGA18260
Itgb8BC125343GCCTCAAGGTGCGCTCTCAAAGGCTGCCCCAAGAACCAAG18160

Temp, Temperature.

Immunocytochemistry

The cells fixed with 4% (v/v) paraformaldehyde (Junsei, Tokyo, Japan) for 10 min were washed with Dulbecco’s phosphate-buffered saline (DPBS; Welgene), and the fixed cells were stained for 16 h  at 4°C with fluorescence-conjugated anti-integrin antibodies diluted in DPBS. Table 2 describes the detailed information and dilution rate of the used antibodies. After rinsing with DPBS, the stained cells counterstained with mounting medium for fluorescence with DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) were monitored under fluorescence microscope (BX53, Olympus).

Table 2

Antibodies used in experiments.

Antibody nameCatalog numberCompanyApplicationDilution rate
FITC-conjugated American hamster anti-mouse integrin α2103503BioLegendFIa1:100
ICCc1:50
FITC-conjugated rabbit anti-mouse integrin α5orb222105BiorbytFIa1:100
PE-conjugated American hamster anti-mouse integrin α512-0493eBioscienceICCc1:50
Alexa Fluor488-conjugated rat anti-human/mouse integrin α6313608BioLegendFIa1:100
ICCc1:50
FITC-conjugated mouse anti-mouse integrin α7LS-C179570LSBioFIa1:100
ICCc1:50
FITC-conjugated rabbit anti-mouse integrin α9orb188618BiorbytFIa1:100
PE-conjugated goat anti-mouse integrin α9FAB3827PR&D SystemsICCc1:50
FITC-conjugated rabbit anti-mouse integrin αVorb7231BiorbytFIa1:100
ICCc1:50
FITC-conjugated rat anti-mouse integrin β1FAB2405FR&D SystemsFIa1:100
ICCc1:50
FITC-conjugated American hamster anti-mouse integrin β3104305BioLegendFIa1:100
ICCc1:50
FITC-conjugated rat anti-mouse integrin β4FAB4054FR&D SystemsFIa1:100
ICCc1:50
FITC-conjugated mouse anti-mouse integrin β511-0497eBioscienceFIa1:100
ICCc1:50
LEAF purified American hamster anti-mouse integrin α2103507BioLegendAIAb1:10
LEAF purified rat anti-mouse integrin α5103807BioLegendAIAb1:10
Rat anti-mouse integrin α6MAB1378MilliporeAIAb1:10
LEAF purified rat anti-mouse integrin αV104107BioLegendAIAb1:10

FI, fluorescence immunoassay

AIA, antibody inhibition assay

ICC, immunocytochemisty.

Fluorescence immunoassay

The fixed cells were produced by incubating living cells in 4% (v/v) paraformaldehyde for 10 min. After washing twice with DPBS, they were stained for 2 h at room temperature with fluorescence-conjugated anti-integrin antibodies diluted in DPBS. Table 2 describes the detailed information and dilution rate of the used antibodies. Subsequently, the stained cells was washed with DPBS and fluorescence intensity was measured using SoftMax Pro 6.2.2. (Molecular Devices Cooperation, Sunnyvale, CA, USA) after adding 100 μL DPBS to the stained cells.

Attachment assay

In order to prepare ECM substrate for cell adhesion, 96-well tissue culture plates were, respectively, coated with following concentrations of the purified ECM proteins: 0, 5 and 10 μg/mL collagen I (Sigma-Aldrich) interacting with integrin α1β1, α2β1 (White et al. 2004, Znoyko et al. 2006, Heino 2007); 0, 40 and 80 μg/mL fibronectin (Millipore) interacting with integrin α3β1, α4β1, α5β1 and α8β1 (Sanchez-Aparicio et al. 1994, Muller et al. 1995, Su et al. 2016, Veqa & Schwarzbauer 2016); 0, 200 and 400 μg/mL laminin (Sigma-Aldrich) interacting with integrin α3β1, α6β1, α6β4 and α7β1 (Kikkawa et al. 2000, Nishiuchi et al. 2006); 0, 20 and 40 μg/mL tenascin C (R&D systems) interacting with integrin α9β1 (Yokosaki et al. 1994, Fiorilli et al. 2008); and 0, 5 and 10 μg/mL vitronectin (R&D Systems) interacting with integrin αVβ1, αVβ3 and αVβ5 (Bodary & McLean 1990, Wayner et al. 1991, Delannet et al. 1994, Horton 1997) overnight at 4°C. Subsequently, for inhibiting non-specific binding of cells, each well was blocked with 1% (w/v) bovine serum albumin (BSA; Sigma-Aldrich) at 4°C for 1 h and washed three times with DPBS. Dulbecco’s modified Eagle’s medium: nutrient mixture F-12 (DMEM/F12; Invitrogen) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Welgene) and 1% (v/v) antibiotic–antimycotic solution was used as the culture medium to resuspend 5 × 104 cells. The resuspended cells were plated on to each well. After incubating at 37°C for 2 h, the removal of non-adherent cells were conducted by washing sufficiently each well and adherent cells were fixed in 4% (v/v) paraformaldehyde at room temperature for 10 min. Then, the fixed adherent cells were stained with 0.1% (w/v) crystal violet (Sigma-Aldrich) in 20% (v/v) methanol (Sigma-Aldrich) for 5 min. After washing twice with distilled water, the amount of adherent cells were quantified at 570 nm using a microplate reader (Epoch Microplate Spectrophotometer; BioTek Instruments Inc.,) after adding 50 μL of 0.2% (v/v) triton X-100 (Biopure, Cambridge, MA, USA) diluted with distilled water.

Antibody inhibition assay

Each well of 96-well tissue culture plate was coated with 5 μg/mL collagen I, 40 μg/mL fibronectin, 200 μg/mL laminin or 5 μg/mL vitronectin overnight at 4°C, and the coated wells was blocked with 1% (w/v) BSA for 1 h at 4°C. Subsequently, function of integrins was inhibited by incubating 5 × 104 cells in DMEM/F12 culture medium including anti-integrin α2 (HMα2), anti-integrin α5 (5H10-27 (MFR5)), anti-integrin α6 (NKI-GoH3) or anti-integrin αV (RMV-7) blocking antibody for 2 h at 37°C, and the detailed information regarding the used antibodies is described in Table 2. Next, the functionally blocked cells was plated on the each well and incubated at 37°C for 8 h. The non-adherent cells were removed by washing extensively with DPBS, the adherent cells were fixed in 4% (v/v) paraformaldehyde for 10 min at room temperature and the fixed adherent cells was stained with 0.1% (w/v) crystal violet in 20% (v/v) methanol for 5 min. Finally, the wells washed twice with distilled water were supplemented with 50 μL 0.2% (v/v) triton X-100 diluted with distilled water and the amount of dye was measured at 570 nm using a microplate reader.

Statistical analysis

The Statistical Analysis System (SAS) program was used for analyzing statistically all the numerical data shown in each experiment. Comparison among treatment groups were performed by the least-square or DUNCAN method, when significance of the main effects through variance (ANOVA) analysis was detected in the SAS package. Moreover, significant differences among treatments were determined when P value was less than 0.05.

Results

Characterization of the integrin subunits expressed on the membranes of ES and EE cells derived from the mouse uterine endometrium in estrus

To determine the types of integrin heterodimers expressed on the membranes of ES and EE cells in the uterine endometrium in estrus, we investigated the transcriptional and translational expression of integrin subunits. Transcriptional analysis of the genes encoding 17 α and 8 β integrin subunits revealed that ES cells showed significantly higher expression of integrin α2, α5, α6, α9 and αV (Fig. 1A), and integrin β1, β3 and β5 (Fig. 1B) subunit genes. EE cells showed significantly higher expression of integrin α2, α5, α6 and αV (Fig. 1C), and integrin β1, β3, β4, β5 and β6 (Fig. 1D) subunit genes. The minimum level of expression was detected for the integrin subunit genes α1, α3, α4, α7, α8, α10, α11, αD, αE, αL, αM and αX (Fig. 1A), and β2, β4, β6, β7 and β8 (Fig. 1B) in ES cells, and for α1, α3, α4, α7, α9, α10, α11, αE, αL, αM and αX (Fig. 1C), and β2 and β7 (Fig. 1D) in EE cells. Moreover, in EE cells, the expression of the integrin α7 and α9 subunit genes with no significant difference from integrin α2 subunit gene was higher than the other integrin subunit genes with minimum expression (Fig. 1C). No transcription of the subunits α8, αD (Fig. 1C) or β8 (Fig. 1D) was detected in EE cells.

Figure 1
Figure 1

Transcriptional levels of α and β integrin subunit genes in endometrial stromal (ES) and endometrial epithelial (EE) cells of mouse uterine tissue. Endometrial cells were retrieved enzymatically from uterus derived from imprinting control region (ICR) mice, and the isolation of ES and EE cells was conducted using a sedimentation-adherence method. mRNA levels of α and β integrin subunit genes in the isolated ES or EE cells were quantitatively monitored by real-time PCR. Among the total 17 α and 8 β integrin subunit genes, 5 α (α2, α5, α6, α9, and αV) (A) and 3 β (β1, β3, and β5) (B) subunits in ES cells, and 4 α (α2, α5, α6 and αV) (C) and 5 β (β1, β3, β4, β5, and β6) (D) subunits in EE cells showed significantly increased transcription compared with the other integrin subunit genes. Moreover, 2 α (α7 and α9) subunits in EE cells showed stronger transcription than 9 α (α1, α3, α4, α10, α11, αE, αL, αM and αX) subunits showing the minimum transcription, with no significant difference in the transcriptional level from integrin α2 subunit (C). All data shown are mean ± standard deviation (s.d.) of three independent experiments. a–d P < 0.05. ND = not detected.

Citation: Reproduction 153, 3; 10.1530/REP-16-0516

We also examined translational regulation of the α and β integrin subunits that showed increased transcription. In ES cells, the expression of integrin α2, α5, α6, α9, αV, β1, β3 and β5 subunit proteins was observed on the surface of cells (Fig. 2A, B, C, D, E, F, G and H), and the integrin subunit proteins α5 (Fig. 3A) and β3 (Fig. 3B) had the strongest expression among the five α (α2, α5, α6, α9 and αV) and three β (β1, β3 and β5) integrin subunits. In addition, among the α (α2, α6, α9 and αV) and β (β1 and β5) subunits with significantly weaker expression than α5 and β3, significantly stronger expression was detected in integrin α9 and αV subunit proteins (Fig. 3A) compared with α2 and α6, and no significant difference in the expression of β1 and β5 subunits was observed (Fig. 3B). In EE cells, the localization of integrin α2, α5, α6, α7, α9, αV, β1, β3 β4 and β5 subunit proteins was identified on the surface of cells (Fig. 2I, J, K, L, M, N, O, P, Q and R). The strongest expression among the six α (α2, α5, α6, α7, α9, and αV) and four β (β1, β3, β4, and β5) integrin subunits was detected for α5 (Fig. 3C) and β3 (Fig. 3D), whereas significantly lower expression was observed for the other integrin α (α2, α6, α7, α9, and αV) and β (β1, β4, and β5) subunits. The expression of α integrin subunits did not show any significant differences among the α2, α6, α7, α9 and αV subunits (Fig. 3C), and the integrin β1 subunit showed the highest significant expression among the β1, β4 and β5 subunits (Fig. 3D). These results indicate that ES cells present α2, α5, α6, α9 and αV, and β1, β3 and β5 integrin subunits, and EE cells present α2, α5, α6, α7, α9 and αV, and β1, β3, β4 and β5 integrin subunits on the cell surface.

Figure 2
Figure 2

Translational expression of α and β integrin subunit genes highly expressed in ES and EE cells of mouse uterine tissue. Using a sedimentation-adherence method, ES and EE cells were isolated from endometrial cells retrieved enzymatically from uterus derived from ICR mice. Translational expression of α and β integrin subunit genes in the sorted ES and EE cells were identified by immunocytochemistry. As a result, integrin α2, α5, α6, α9, αV, β1, β3 and β5 subunit proteins (A, B, C, D, E, F, G and H) were localized on the surface of ES cells, and the surface of EE cells showed the expression of integrin α2, α5, α6, α7, α9, αV, β1, β3, β4 and β5 subunit proteins (I, J, K, L, M, N, O, P, Q and R). All figures are representative immunocytochemistry images of integrin subunit proteins expressed on the surface of ES and EE cells, respectively. n = 3. Scale bars represent 20 μm.

Citation: Reproduction 153, 3; 10.1530/REP-16-0516

Figure 3
Figure 3

Translational levels of α and β integrin subunit genes highly expressed in ES and EE cells of mouse uterine tissue. Using a sedimentation-adherence method, ES and EE cells were isolated from endometrial cells retrieved enzymatically from uterus derived from ICR mice. Translational levels of α and β integrin subunit genes in the sorted ES and EE cells were quantified by fluorescence immunoassays. Among the total of five α and three β integrin subunits in ES cells, significantly strong expression of three α (α5, α9 and αV) (A) and β3 (B) subunits was detected, whereas two α (α2 and α6) (A) and two β (β1 and β5) (B) subunits were weakly expressed. Among the total of six α and four β integrin subunits in EE cells, α5 and β3 subunits were strongly expressed, whereas significantly weak expression of five α (α2, α6, α7, α9 and αV) (C) and three β (β1, β4 and β5) (D) subunits was detected. All data shown are mean ± s.d. of three independent experiments. *,***P < 0.05.

Citation: Reproduction 153, 3; 10.1530/REP-16-0516

Functional identification of integrin heterodimers expressed on the membranes of ES and EE cells derived from mouse uterine endometrium in estrus

Based on the identification of the α and β integrin subunits expressed on the membranes of ES and EE cells derived from mouse uterine endometrium in estrus, we surmised that ES cells possess α2β1, α5β1, α6β1, α9β1, αVβ1, αVβ3 and αVβ5, and EE cells possess α2β1, α5β1, α6β1, α6β4, α7β1, α9β1, αVβ1, αVβ3 and αVβ5 as active forms of integrin heterodimers, as described previously (Lessey 1988, Reddy & Mangale 2003). The presence of these integrin heterodimers was investigated by estimating levels of adherent ES and EE cells cultured on purified ECM proteins that interact specifically with each integrin heterodimer. Post-culture adherent levels of ES and EE cells treated with antibodies specifically blocking the function of each integrin were determined.

Compared with purified ECM protein-free culture plates, ES cells showed significantly improved adhesion to collagen I- (Fig. 4A), fibronectin- (Fig. 4B) and vitronectin-coated (Fig. 4E) culture plates, and EE cells to collagen I- (Fig. 4F), fibronectin- (Fig. 4G), laminin- (Fig. 4H) and vitronectin-coated (Fig. 4J) culture plates. Moreover, no significant differences in adhesion levels were observed in ES cells cultured on laminin- (Fig. 4C) or EE cells cultured on tenascin C-coated (Fig. 4I) culture plates. Rather, ES cells cultured on tenascin C-coated culture plates showed a significant decrease in the level of adhesion, compared to those cultured on purified ECM protein-free culture plates (Fig. 4D). These results suggest the presence of the collagen I-specific integrin α2β1, fibronectin-specific integrin α5β1 and vitronectin-specific integrin αVβ1, αVβ3 or αVβ5 on the cell membrane of mouse ES cells, with the presence of individual integrin subunits α6 and α9. Simultaneously, we speculate the presence of the collagen I-specific integrin α2β1; fibronectin-specific integrin α5β1; laminin-specific integrins α6β1, α6β4 and/or α7β1; and vitronectin-specific integrins αVβ1, αVβ3 and/or αVβ5 on the cell membrane of mouse EE cells, with the presence of the individual integrin subunit α9.

Figure 4
Figure 4

Identification of integrin heterodimers that interact with fibronectin, laminin and vitronectin on the membrane of ES and EE cells derived from the mouse uterus. A 96-well tissue culture plate was coated with collagen I, fibronectin, laminin, tenascin C, vitronectin, and ES or EE cells resuspended in culture medium were plated in each well. Subsequently, adherent cells were stained with crystal violet, and the level of adhesion was quantified using a microplate reader. The percentage of maximum adhesion is represented as the optical density of cells plated on extracellular matrix (ECM) protein-free plates. Both mouse ES and EE cells cultured on collagen I- (A, F), fibronectin- (B, G) and vitronectin-coated (E, J) culture plates showed significantly higher levels of adhesion than those on ECM protein-free culture plates. However, no significant difference or significant decrease in adhesion level was detected in ES cells cultured on laminin- (C) and tenascin C-coated (D) culture plates, respectively. In addition, EE cells cultured on laminin- (H) or tenascin C-coated (I) culture plates showed significant improvement, or no significant difference, in adhesion levels compared to those on ECM protein-free culture plates. All data shown are mean ± s.d. of three independent experiments. *,**P < 0.05.

Citation: Reproduction 153, 3; 10.1530/REP-16-0516

These specific integrin function-blocked mouse ES or EE cells were incubated on 5 μg/mL collagen I, 40 μg/mL fibronectin, 200 μg/mL laminin or 5 μg/mL vitronectin as the minimum concentration among those seen in the ECM showing significantly improved adhesion of ES or EE cells (Fig. 5). Significantly lower adhesion was detected in ES cells with blockage of the integrin subunit α2 (Fig. 5A), α5 (Fig. 5B) or αV (Fig. 5C), and in EE cells with blockage of the integrin subunit α2 (Fig. 5D), α5 (Fig. 5E), α6 (Fig. 5F) or αV (Fig. 5G), compared with cells without blockage of those integrin heterodimers. From these results, we could confirm that the mouse endometrial ES cells derived from the uterus in estrus simultaneously express the functional integrins α2β1, α5β1, αVβ1, αVβ3 and/or αVβ5 on the cell membrane, and integrins α2β1, α5β1, α6β1 and/or α6β4, and αVβ1, αVβ3 and/or αVβ5 on the membrane of mouse uterine endometrial EE cells.

Figure 5
Figure 5

Functional analysis of integrin heterodimers on the membrane of ES and EE cells derived from the mouse uterus. Mouse ES and EE cells incubated in the absence or presence of anti-integrin α2, anti-integrin α5, anti-integrin α6 or anti-integrin αV blocking antibodies were plated on 5 μg/mL collagen I-, 40 μg/mL fibronectin-, 200 μg/mL laminin- and 5 μg/mL vitronectin-coated wells, and incubated for 2 h at 37°C. After staining adherent cells with crystal violet, the level of adherence was quantified using a microplate reader. As the parameter of functional blocking by antibodies, the percentage of maximum adhesion, represented by the optical density of cells plated on each ECM protein-coated well in the absence of blocking antibodies was determined. Mouse ES cells treated with integrin α2 (A), α5 (B) and αV (C) subunit blocking antibodies showed significantly lower rates of attachment to collagen I, fibronectin and vitronectin compared with those without blocking antibodies, respectively. Moreover, compared with those not treated with blocking antibodies, functional blocking of integrin α2 (D), α5 (E), α6 (F) and αV (G) subunits in EE cells significantly decreased the rates of attachment to collagen I, fibronectin, laminin and vitronectin, respectively. All data shown are mean ± s.d. of three independent experiments. *P < 0.05.

Citation: Reproduction 153, 3; 10.1530/REP-16-0516

Discussion

Knowledge of the ECM-derived signals that mediate intracytoplasmic transduction through cell surface receptors that belong to the integrin family will be essential in the construction of an artificial microenvironment that accurately reflects the in vitro organization of the endometrium, including in terms of ES and EE cells. Identification of the integrins expressed in ES and EE cells will be particularly important. Here, we report the types of integrin heterodimers expressed on the surface of ES and EE cells derived from the mouse endometrium during estrus. Transcriptional analysis of 17 α and 8 β integrin subunits, followed by confirmation of their expression at the translational level, attachment to ECM proteins and inhibition with blocking antibodies revealed the presence of integrin α2β1, α5β1, αVβ1, αVβ3 and/or αVβ5 as heterodimers, and α6 and α9 as individual subunits on the ES cell membrane. EE cells expressed the integrin heterodimers α2β1, α5β1, α6β1 and/or α6β4, and αVβ1, αVβ3 and/or αVβ5, and the individual subunits α7 and α9 on the cell membrane. These results suggest that the collagen I-specific integrin α2β1, fibronectin-specific integrin α5β1 and vitronectin-specific integrins αVβ1, αVβ3 or αVβ5 in ES cells, and the collagen I-specific integrin α2β1, fibronectin-specific integrin α5β1, laminin-specific integrins α6β1 or α6β4 and vitronectin-specific integrins αVβ1, αVβ3 or αVβ5 in EE cells may be important for the transmission of extracellular signals that organize endometrial tissue. Moreover, collagen I, fibronectin, laminin and vitronectin analogs will be important for the construction of niches customized to the organization of endometrial tissue. In addition, we speculate that the integrin subunits α6 and α9 in ES cells, or α7 and α9 in EE cells, may play an important role in the cytological changes of ES or EE cells generated during the estrus cycle.

Generally, functional integrins are organized as heterodimers of α and β subunits (Multhaupt et al. 2016, Pan et al. 2016). These heterodimeric transmembrane receptors are activated by direct interaction with a binding motif embedded in ECM proteins (Brizzi et al. 2012, Seguin et al. 2015) and they induce a variety of biological responses (Hynes 2009, Schaefer & Reinhardt 2016). Therefore, despite the transcriptional and translational expression of the α6 and α9 integrin subunit genes in ES cells (Figs 1, 2 and 3), the lack of a significant increase in the adhesion of ES cells to laminin (Fig. 4C) or tenascin C (Fig. 4D) was observed. These results indicate that α6 or α9 are localized in the inactive form as an individual subunit, and not as the active heterodimer, on the surface of the cell membrane. Furthermore, EE cells with the α6 and α7 subunits that recognize laminin exhibited a significant decrease in adhesion resulting from blockade of the α6 subunit (Fig. 5F), indicating that α6 is present as a heterodimer and α7 as an individual subunit. There was also no significant difference in the adhesion level of EE cells to tenascin C (Fig. 4I), indicating that α9 is present as an individual subunit on the cell membrane. These results are strongly supported by previous studies reporting the absence of laminin in ES tissue (Faber et al. 1986) and tenascin C in both ES (Julian et al. 1994, Michie & Head 1994) and EE tissue (Michie & Head 1994).

Interestingly, integrins α6β1 and α6β4, heterodimers that interact specifically with laminin were only observed on the surface of EE cells in estrus, and α6, identified as an individual subunit in the inactive form, are localized on the membrane of ES cells in estrus. This suggests that laminin-specific integrin heterodimers may play an important role in endometrial receptivity for implantation, which is supported by reports on the expression of laminin in the trophectoderm (Klaffky et al. 2006) and failed pregnancy in the laminin-deficient mouse (Zhang et al. 2000). Furthermore, the expression of laminin-specific integrin heterodimers in mouse EE cells has also been shown in humans (Koks et al. 2000, Park et al. 2000). Accordingly, at the clinical level, the presence of functional integrin heterodimers with the α6 subunit may be important for the diagnosis of healthy uterine epithelium.

The uterine endometrium experiences physical and physiological alterations during implantation (Kao et al. 2002). The presence of inactive integrin subunits prior to implantation of the embryo can induce dramatic changes in the uterine endometrium through post-adhesion activation of embryos. In this study, specific integrin subunits (α6 and α9 in ES cells, and α7 and α9 in EE cells) were present in an inactive form on the cell membrane, indicating that signals derived from laminin (interacting with heterodimers with integrin α6 or α7 subunits) and tenascin C (interacting with heterodimers with integrin α9 subunits) may be important in the remodeling of ES and EE tissue following embryo contact with EE cells. This is supported by the endometrial identification of laminin and tenascin C during pregnancy (Michie & Head 1994, Kaloglu & Onarlioglu 2010). Accordingly, research on the expression of inactive integrin subunits in specific cells may be useful in the generation of specific microenvironments.

In conclusion, the co-expression of integrin α2β1, α5β1, αVβ1, αVβ3 and/or αVβ5, and integrin α2β1, α5β1, α6β1 and/or α6β4, αVβ1, αVβ3 and/or αVβ5, on the surface of ES and EE cells derived from mouse endometrium in estrus, respectively, was confirmed. Integrin α6 and α9 or α7 and α9 were also identified as individual subunits on the membranes of ES or EE cells. Identification of the integrin heterodimers or subunits expressed on ES and EE cells will be useful for determining the type of ECM analogs that specifically activate each integrin heterodimer to generate synthetic niches to represent endometrial tissue in vivo. Moreover, the generation of synthetic endometrial tissue based on this knowledge will contribute to our understanding of the mechanism of implantation, and aid in the study of uterine receptivity and endometrial hormonal responses.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research was supported by a grant of the Korea Health Technology R&D Project (HI12C1404(A121515)), Ministry of Health and Welfare, Republic of Korea.

References

  • AraiMYoshiokaSTasakiYOkudaK2013Remodeling of bovine endometrium throughout the estrous cycle. Animal Reproduction Science14219. (doi:10.1016/j.anireprosci.2013.08.003)

    • Search Google Scholar
    • Export Citation
  • ArnoldJTKaufmanDGSeppalaMLesseyBA2001Endometrial stromal cells regulate epithelial cell growth in vitro: a new co-culture model. Human Reproduction16836845. (doi:10.1093/humrep/16.5.836)

    • Search Google Scholar
    • Export Citation
  • BodarySCMcLeanJW1990The integrin beta 1 subunit associated with the vitronectin receptor alpha v subunit to form a novel vitronectin receptor in a human embryonic kidney cell line. Journal of Biological Chemistry26559385941.

    • Search Google Scholar
    • Export Citation
  • BrizziMFTaroneGDefilippiP2012Extracellular matrix, integrins, and growth factor as tailors of the stem cell niche. Current Opinion in Cell Biology24645651. (doi:10.1016/j.ceb.2012.07.001)

    • Search Google Scholar
    • Export Citation
  • BurghardtRCJohnsonGAJaegerLAKaHGarlowJESpencerTEBazerFW2002Integrins and extracellular matrix proteins at the maternal-fetal interface in domestic animals. Cells Tissues and Organs172202217. (doi:10.1159/000066969)

    • Search Google Scholar
    • Export Citation
  • ByronAFrameMC2016Adhesion protein networks reveal functions proximal and distal to cell-matrix contacts. Current Opinion in Cell Biology3993100. (doi:10.1016/j.ceb.2016.02.013)

    • Search Google Scholar
    • Export Citation
  • ChadchanSBKumarVMauryaVKSoniUKJhaRK2016Endoglin (CD105) coordinates the process of endometrial receptivity for embryo implantation. Molecular and Cellular Endocrinology4256983. (doi:10.1016/j.mce.2016.01.014)

    • Search Google Scholar
    • Export Citation
  • ChanRWSchwabKEGargettCE2004Clonogenicity of human endometrial epithelial and stromal cells. Biology of Reproduction7017381750. (doi:10.1095/biolreprod.103.024109)

    • Search Google Scholar
    • Export Citation
  • DelannetMMartinFBossyBChereshDAReichardtLFDubandJL1994Specific roles of the alpha V beta1, alpha V beta 3 and alpha V beta 5 integrins in avian neural crest cell adhesion and migration on vitronectin. Development12026872702.

    • Search Google Scholar
    • Export Citation
  • FaberMWewerUMBerthelsenJGLiottaLAAlbrechtsenR1986Laminin production by human endometrial stromal cells relates to the cyclic and pathologic state of the endometrium. American Journal of Pathology124384391.

    • Search Google Scholar
    • Export Citation
  • FiorilliPPartridgeDStaniszewskaIWangJYGrabackaMSoKMarcinkiewiczCReissKKhaliliKCroulSE2008Integrins mediate adhesion of medulloblastoma cells to tenascin and activate pathways associated with survival and proliferation. Laboratory Investigation8811431156. (doi:10.1038/labinvest.2008.89)

    • Search Google Scholar
    • Export Citation
  • GronthosSSimmonsPJGravesSERobeyPG2001Integrin-mediated interactions between human bone marrow stromal precursor cells and the extracellular matrix. Bone28174181. (doi:10.1016/S8756-3282(00)00424-5)

    • Search Google Scholar
    • Export Citation
  • HeinoJ2007The collagen family members as cell adhesion proteins. BioEssays2910011010. (doi:10.1002/bies.20636)

  • HortonMA1997The αvβ3 integrin ‘vitronectin receptor’. International Journal of Biochemistry and Cell Biology29721725. (doi:10.1016/S1357-2725(96)00155-0)

    • Search Google Scholar
    • Export Citation
  • HynesRO2009The extracellular matrix: not just pretty fibrils. Science32612161219 (doi:10.1126/science.1176009)

  • JokimaaVOksjokiSKujariHVuorioEAnttilaL2002Altered expression of genes involved in the production and degradation of endometrial extracellular matrix in patients with unexplained infertility and recurrent miscarriages. Molecular Human Reproduction1211111116. (doi:10.1093/molehr/8.12.1111)

    • Search Google Scholar
    • Export Citation
  • JulianJChiquet-EhrismannREricksonHPCarsonDD1994Tenascin is induced at implantation sites in the mouse uterus and interferes with epithelial cell adhesion. Development120661671.

    • Search Google Scholar
    • Export Citation
  • KalogluCOnarliogluB2010Extracellular matrix remodelling in rat endometrium during early pregnancy: the role of fibronectin and laminin. Tissue and Cell42301306. (doi:10.1016/j.tice.2010.07.004)

    • Search Google Scholar
    • Export Citation
  • KaoLCTulacSLoboSImaniBYangJPGermeyerAOsteenKTaylorRNLesseyBAGiudiceLC2002Global gene profiling in human endometrium during the window of implantation. Endocrinology14321192138. (doi:10.1210/endo.143.6.8885)

    • Search Google Scholar
    • Export Citation
  • KikkawaYSanzenNFujiwaraHSonnenbergASekiguchiK2000Integrin binding specificity of laminin-10/11: laminin-10/11 are recognized by alpha3beta1, alpha6beta1 and alpha6beta4 integrins. Journal of Cell Science113869876.

    • Search Google Scholar
    • Export Citation
  • KimSHTurnbullJGuimondS2011Extracellular matrix and cell signaling: the dynamic cooperation of integrin, proteoglycan and growth factor receptor. Journal of Endocrinology209139151. (doi:10.1530/JOE-10-0377)

    • Search Google Scholar
    • Export Citation
  • KlaffkyEJGonzalesIMSutherlandAE2006Trophoblast cells exhibit differential responses to laminin isoforms. Developmental Biology292277289. (doi:10.1016/j.ydbio.2005.12.033)

    • Search Google Scholar
    • Export Citation
  • KoksCAGroothuisPGDunselmanGAde GoeijAFEversJL2000Adhesion of menstrual endometrium to extracellular matrix: the possible role of integrin alpha(6)beta(1) and laminin interaction. Molecular Human Reproduction6170177. (doi:10.1093/molehr/6.2.170)

    • Search Google Scholar
    • Export Citation
  • LeppertPCJayesFLSegarsJH2014The extracellular matrix contributes to mechanotransduction in uterine fibroids. Obstetrics and Gynecology International2014783289. (doi:10.1155/2014/783289)

    • Search Google Scholar
    • Export Citation
  • LesseyBA1988Endometrial integrins and the establishment of uterine receptivity. Human Reproduction13247258.

  • McLeanACValenzuelaNFaiSBennettSA2012Performing vaginal lavage, crystal violet staining, and vaginal cytological evaluation for mouse estrous cycle staging identification. Journal of Visualized Experiments15e4389. (doi:10.3791/4389)

    • Search Google Scholar
    • Export Citation
  • MichieHJHeadJR1994Tenascin in pregnant and non-pregnant rat uterus: unique spatio-temporal expression during decidualization. Biology of Reproduction5012771286. (doi:10.1095/biolreprod50.6.1277)

    • Search Google Scholar
    • Export Citation
  • MullerUBossyBVenstromKReichardtLF1995Integrin alpha8 beta1 promotes attachment, cell spreading, and neurite outgrowth on fibronectin. Molecular Biology of the Cell6433448.

    • Search Google Scholar
    • Export Citation
  • MulthauptHALeitingerBGullbergDCouchmanJR2016Extracellular matrix component signaling in cancer. Advanced Drug Delivery Reviews972840. (doi:10.1016/j.addr.2015.10.013)

    • Search Google Scholar
    • Export Citation
  • NishiuchiRTakagiJHayashiMIdoHYagiYSanzenNTsujiTYamadaMSekiguchiK2006Ligand-binding specificities of laminin-binding integrins: a comprehensive survey of laminin-integrin interactions using recombinant alpha3beta1, alpha6beta1, alpha7beta1 and alpha6beta4 integrins. Matrix Biology25189197. (doi:10.1016/j.matbio.2005.12.001)

    • Search Google Scholar
    • Export Citation
  • PanLZhaoYYuanZQinG2016Research advances on structure and biological functions of integrins. Springerplus51094. (doi:10.1186/s40064-016-2502-0)

    • Search Google Scholar
    • Export Citation
  • ParkKRInoueTUedaMHiranoTHiguchiTMaedaMKonishiIFujiwaraHFujiiS2000CD9 is expressed on human endometrial epithelial cells in association with integrins alpha(6), alpha(3) and beta(1). Molecular Human Reproduction6252257. (doi:10.1093/molehr/6.3.252)

    • Search Google Scholar
    • Export Citation
  • PonsuksiliSMuraniESchwerinMSchellanderKTesfayeDWimmersK2012Gene expression and DNA-methylation of bovine pretransfer endometrium depending on its receptivity after in vitro-produced embryo transfer. PLoS ONE7e42402. (doi:10.1371/journal.pone.0042402)

    • Search Google Scholar
    • Export Citation
  • ReddyKVMangaleSS2003Integrin receptors: the dynamic modulators of endometrial function. Tissue and Cell35260273. (doi:10.1016/S0040-8166(03)00039-9)

    • Search Google Scholar
    • Export Citation
  • RossoFGiordanoABarbarisiMBarbarisiA2004From cell-ECM interactions to tissue engineering. Journal of Cellular Physiology199174180. (doi:10.1002/jcp.10471)

    • Search Google Scholar
    • Export Citation
  • Sanchez-AparicioPDominquez-JimenezCGarcia-PardoA1994Activation of the alpha4 beta1 integrin through the beta1 subunit induces recognition of the RGDS sequencing in fibronectin. Journal of Cell Biology126271279.

    • Search Google Scholar
    • Export Citation
  • SchaeferLReinhardtDP2016Special issue: extracellular matrix: therapeutic tools and targets in cancer treatment. Advanced Drug Delivery Reviews9713. (doi:10.1016/j.addr.2016.01.001)

    • Search Google Scholar
    • Export Citation
  • SchwabKEChanRWGargettCE2005Putative stem cell activity of human endometrial epithelial and stromal cells during the menstrual cycle. Fertility and Sterility8411241130. (doi:10.1016/j.fertnstert.2005.02.056)

    • Search Google Scholar
    • Export Citation
  • SeguinLDesgrosellierJSWeisSMChereshDA2015Integrins and cancer: regulators of cancer stemness, metastasis, and drug resistance. Trends in Cell Biology25234240. (doi:10.1016/j.tcb.2014.12.006)

    • Search Google Scholar
    • Export Citation
  • StraussJF2013Extracellular matrix dynamics and fetal membrane rupture. Reproduction Sciences20140153. (doi:10.1177/1933719111424454)

  • SuYXiaWLiJWalzTHumphriesMJVestweberDCabanasCLuCSpringerTA2016Relating conformation to function in integrin α5β1. PNAS113E3872E3881. (doi:10.1073/pnas.1605074113v)

    • Search Google Scholar
    • Export Citation
  • TangMXuYJulianJCarsonDTabibzadehS2005Lefty is expressed in mouse endometrium in estrous cycle and peri-implantation period. Human Reproduction20872880. (doi:10.1093/humrep/deh717)

    • Search Google Scholar
    • Export Citation
  • TheocharisADSkandalisSSGialeliCKaramanosNK2016Extracellular matrix structure. Advanced Drug Delivery Reviews97427. (doi:10.1016/j.addr.2015.11.001)

    • Search Google Scholar
    • Export Citation
  • VeqaMESchwarzbauerJE2016Collaboration of fibronectin matrix with other extracellular signals in morphogenesis and differentiation. Current Opinion in Cell Biology4216. (doi:10.1016/j.ceb.2016.03.014)

    • Search Google Scholar
    • Export Citation
  • VitilloLBaxterMIskenderBWhitingPKimberSJ2016Integrin-associated focal adhesion kinase protects human embryonic stem cells from apoptosis, detachment, and differentiation. Stem Cell Reports7167176. (doi:10.1016/j.stemcr.2016.07.006)

    • Search Google Scholar
    • Export Citation
  • YamadaOTodorokiJTakahashiTHashizumeK2002The dynamic expression of extracellular matrix in the bovine endometrium at implantation. Journal of Veterinary Medical Science64207214. (doi:10.1292/jvms.64.207)

    • Search Google Scholar
    • Export Citation
  • YokosakiYPalmerELPrietoALCrossinKLBourdonMAPytelaRSheppardD1994The integrin alpha9 beta1 mediates cell attachment to a non-RGD site in the third fibronectin type III repeat of tenascin. Journal of Biological Chemistry2692669126696.

    • Search Google Scholar
    • Export Citation
  • WaynerEAOrlandoRAChereshDA1991Integrins alpha v beta 3 and alpha v beta 5 contribute to cell attachment to vitronectin but differentially distribute on the cell surface. Journal of Cell Biology113919929.

    • Search Google Scholar
    • Export Citation
  • WhiteDJPuranenSJohnsonMSHeinoJ2004The collagen receptor subfamily of the integrins. International Journal of Biochemistry and Cell Biology3614051410. (doi:10.1016/j.biocel.2003.08.016)

    • Search Google Scholar
    • Export Citation
  • ZhangCDuanECaoYJiangGZengG2000Effect of 32/67 kDa laminin-binding protein antibody on mouse embryo implantation. Journal of Reproduction and Fertility119137142. (doi:10.1530/jrf.0.1190137)

    • Search Google Scholar
    • Export Citation
  • ZnoykoITrojanowskaMReubenA2006Collagen binding alpha2beta1 and alpha1beta1 integrins play contrasting roles in regulation of Ets-1 expression in human liver myofibroblasts. Molecular and Cellular Biochemistry2828999. (doi:10.1007/s11010-006-1400-0)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

    Society for Reproduction and Fertility

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1027 1027 47
PDF Downloads 263 263 23

Altmetrics

Figures

  • View in gallery

    Transcriptional levels of α and β integrin subunit genes in endometrial stromal (ES) and endometrial epithelial (EE) cells of mouse uterine tissue. Endometrial cells were retrieved enzymatically from uterus derived from imprinting control region (ICR) mice, and the isolation of ES and EE cells was conducted using a sedimentation-adherence method. mRNA levels of α and β integrin subunit genes in the isolated ES or EE cells were quantitatively monitored by real-time PCR. Among the total 17 α and 8 β integrin subunit genes, 5 α (α2, α5, α6, α9, and αV) (A) and 3 β (β1, β3, and β5) (B) subunits in ES cells, and 4 α (α2, α5, α6 and αV) (C) and 5 β (β1, β3, β4, β5, and β6) (D) subunits in EE cells showed significantly increased transcription compared with the other integrin subunit genes. Moreover, 2 α (α7 and α9) subunits in EE cells showed stronger transcription than 9 α (α1, α3, α4, α10, α11, αE, αL, αM and αX) subunits showing the minimum transcription, with no significant difference in the transcriptional level from integrin α2 subunit (C). All data shown are mean ± standard deviation (s.d.) of three independent experiments. a–d P < 0.05. ND = not detected.

  • View in gallery

    Translational expression of α and β integrin subunit genes highly expressed in ES and EE cells of mouse uterine tissue. Using a sedimentation-adherence method, ES and EE cells were isolated from endometrial cells retrieved enzymatically from uterus derived from ICR mice. Translational expression of α and β integrin subunit genes in the sorted ES and EE cells were identified by immunocytochemistry. As a result, integrin α2, α5, α6, α9, αV, β1, β3 and β5 subunit proteins (A, B, C, D, E, F, G and H) were localized on the surface of ES cells, and the surface of EE cells showed the expression of integrin α2, α5, α6, α7, α9, αV, β1, β3, β4 and β5 subunit proteins (I, J, K, L, M, N, O, P, Q and R). All figures are representative immunocytochemistry images of integrin subunit proteins expressed on the surface of ES and EE cells, respectively. n = 3. Scale bars represent 20 μm.

  • View in gallery

    Translational levels of α and β integrin subunit genes highly expressed in ES and EE cells of mouse uterine tissue. Using a sedimentation-adherence method, ES and EE cells were isolated from endometrial cells retrieved enzymatically from uterus derived from ICR mice. Translational levels of α and β integrin subunit genes in the sorted ES and EE cells were quantified by fluorescence immunoassays. Among the total of five α and three β integrin subunits in ES cells, significantly strong expression of three α (α5, α9 and αV) (A) and β3 (B) subunits was detected, whereas two α (α2 and α6) (A) and two β (β1 and β5) (B) subunits were weakly expressed. Among the total of six α and four β integrin subunits in EE cells, α5 and β3 subunits were strongly expressed, whereas significantly weak expression of five α (α2, α6, α7, α9 and αV) (C) and three β (β1, β4 and β5) (D) subunits was detected. All data shown are mean ± s.d. of three independent experiments. *,***P < 0.05.

  • View in gallery

    Identification of integrin heterodimers that interact with fibronectin, laminin and vitronectin on the membrane of ES and EE cells derived from the mouse uterus. A 96-well tissue culture plate was coated with collagen I, fibronectin, laminin, tenascin C, vitronectin, and ES or EE cells resuspended in culture medium were plated in each well. Subsequently, adherent cells were stained with crystal violet, and the level of adhesion was quantified using a microplate reader. The percentage of maximum adhesion is represented as the optical density of cells plated on extracellular matrix (ECM) protein-free plates. Both mouse ES and EE cells cultured on collagen I- (A, F), fibronectin- (B, G) and vitronectin-coated (E, J) culture plates showed significantly higher levels of adhesion than those on ECM protein-free culture plates. However, no significant difference or significant decrease in adhesion level was detected in ES cells cultured on laminin- (C) and tenascin C-coated (D) culture plates, respectively. In addition, EE cells cultured on laminin- (H) or tenascin C-coated (I) culture plates showed significant improvement, or no significant difference, in adhesion levels compared to those on ECM protein-free culture plates. All data shown are mean ± s.d. of three independent experiments. *,**P < 0.05.

  • View in gallery

    Functional analysis of integrin heterodimers on the membrane of ES and EE cells derived from the mouse uterus. Mouse ES and EE cells incubated in the absence or presence of anti-integrin α2, anti-integrin α5, anti-integrin α6 or anti-integrin αV blocking antibodies were plated on 5 μg/mL collagen I-, 40 μg/mL fibronectin-, 200 μg/mL laminin- and 5 μg/mL vitronectin-coated wells, and incubated for 2 h at 37°C. After staining adherent cells with crystal violet, the level of adherence was quantified using a microplate reader. As the parameter of functional blocking by antibodies, the percentage of maximum adhesion, represented by the optical density of cells plated on each ECM protein-coated well in the absence of blocking antibodies was determined. Mouse ES cells treated with integrin α2 (A), α5 (B) and αV (C) subunit blocking antibodies showed significantly lower rates of attachment to collagen I, fibronectin and vitronectin compared with those without blocking antibodies, respectively. Moreover, compared with those not treated with blocking antibodies, functional blocking of integrin α2 (D), α5 (E), α6 (F) and αV (G) subunits in EE cells significantly decreased the rates of attachment to collagen I, fibronectin, laminin and vitronectin, respectively. All data shown are mean ± s.d. of three independent experiments. *P < 0.05.

References

  • AraiMYoshiokaSTasakiYOkudaK2013Remodeling of bovine endometrium throughout the estrous cycle. Animal Reproduction Science14219. (doi:10.1016/j.anireprosci.2013.08.003)

    • Search Google Scholar
    • Export Citation
  • ArnoldJTKaufmanDGSeppalaMLesseyBA2001Endometrial stromal cells regulate epithelial cell growth in vitro: a new co-culture model. Human Reproduction16836845. (doi:10.1093/humrep/16.5.836)

    • Search Google Scholar
    • Export Citation
  • BodarySCMcLeanJW1990The integrin beta 1 subunit associated with the vitronectin receptor alpha v subunit to form a novel vitronectin receptor in a human embryonic kidney cell line. Journal of Biological Chemistry26559385941.

    • Search Google Scholar
    • Export Citation
  • BrizziMFTaroneGDefilippiP2012Extracellular matrix, integrins, and growth factor as tailors of the stem cell niche. Current Opinion in Cell Biology24645651. (doi:10.1016/j.ceb.2012.07.001)

    • Search Google Scholar
    • Export Citation
  • BurghardtRCJohnsonGAJaegerLAKaHGarlowJESpencerTEBazerFW2002Integrins and extracellular matrix proteins at the maternal-fetal interface in domestic animals. Cells Tissues and Organs172202217. (doi:10.1159/000066969)

    • Search Google Scholar
    • Export Citation
  • ByronAFrameMC2016Adhesion protein networks reveal functions proximal and distal to cell-matrix contacts. Current Opinion in Cell Biology3993100. (doi:10.1016/j.ceb.2016.02.013)

    • Search Google Scholar
    • Export Citation
  • ChadchanSBKumarVMauryaVKSoniUKJhaRK2016Endoglin (CD105) coordinates the process of endometrial receptivity for embryo implantation. Molecular and Cellular Endocrinology4256983. (doi:10.1016/j.mce.2016.01.014)

    • Search Google Scholar
    • Export Citation
  • ChanRWSchwabKEGargettCE2004Clonogenicity of human endometrial epithelial and stromal cells. Biology of Reproduction7017381750. (doi:10.1095/biolreprod.103.024109)

    • Search Google Scholar
    • Export Citation
  • DelannetMMartinFBossyBChereshDAReichardtLFDubandJL1994Specific roles of the alpha V beta1, alpha V beta 3 and alpha V beta 5 integrins in avian neural crest cell adhesion and migration on vitronectin. Development12026872702.

    • Search Google Scholar
    • Export Citation
  • FaberMWewerUMBerthelsenJGLiottaLAAlbrechtsenR1986Laminin production by human endometrial stromal cells relates to the cyclic and pathologic state of the endometrium. American Journal of Pathology124384391.

    • Search Google Scholar
    • Export Citation
  • FiorilliPPartridgeDStaniszewskaIWangJYGrabackaMSoKMarcinkiewiczCReissKKhaliliKCroulSE2008Integrins mediate adhesion of medulloblastoma cells to tenascin and activate pathways associated with survival and proliferation. Laboratory Investigation8811431156. (doi:10.1038/labinvest.2008.89)

    • Search Google Scholar
    • Export Citation
  • GronthosSSimmonsPJGravesSERobeyPG2001Integrin-mediated interactions between human bone marrow stromal precursor cells and the extracellular matrix. Bone28174181. (doi:10.1016/S8756-3282(00)00424-5)

    • Search Google Scholar
    • Export Citation
  • HeinoJ2007The collagen family members as cell adhesion proteins. BioEssays2910011010. (doi:10.1002/bies.20636)

  • HortonMA1997The αvβ3 integrin ‘vitronectin receptor’. International Journal of Biochemistry and Cell Biology29721725. (doi:10.1016/S1357-2725(96)00155-0)

    • Search Google Scholar
    • Export Citation
  • HynesRO2009The extracellular matrix: not just pretty fibrils. Science32612161219 (doi:10.1126/science.1176009)

  • JokimaaVOksjokiSKujariHVuorioEAnttilaL2002Altered expression of genes involved in the production and degradation of endometrial extracellular matrix in patients with unexplained infertility and recurrent miscarriages. Molecular Human Reproduction1211111116. (doi:10.1093/molehr/8.12.1111)

    • Search Google Scholar
    • Export Citation
  • JulianJChiquet-EhrismannREricksonHPCarsonDD1994Tenascin is induced at implantation sites in the mouse uterus and interferes with epithelial cell adhesion. Development120661671.

    • Search Google Scholar
    • Export Citation
  • KalogluCOnarliogluB2010Extracellular matrix remodelling in rat endometrium during early pregnancy: the role of fibronectin and laminin. Tissue and Cell42301306. (doi:10.1016/j.tice.2010.07.004)

    • Search Google Scholar
    • Export Citation
  • KaoLCTulacSLoboSImaniBYangJPGermeyerAOsteenKTaylorRNLesseyBAGiudiceLC2002Global gene profiling in human endometrium during the window of implantation. Endocrinology14321192138. (doi:10.1210/endo.143.6.8885)

    • Search Google Scholar
    • Export Citation
  • KikkawaYSanzenNFujiwaraHSonnenbergASekiguchiK2000Integrin binding specificity of laminin-10/11: laminin-10/11 are recognized by alpha3beta1, alpha6beta1 and alpha6beta4 integrins. Journal of Cell Science113869876.

    • Search Google Scholar
    • Export Citation
  • KimSHTurnbullJGuimondS2011Extracellular matrix and cell signaling: the dynamic cooperation of integrin, proteoglycan and growth factor receptor. Journal of Endocrinology209139151. (doi:10.1530/JOE-10-0377)

    • Search Google Scholar
    • Export Citation
  • KlaffkyEJGonzalesIMSutherlandAE2006Trophoblast cells exhibit differential responses to laminin isoforms. Developmental Biology292277289. (doi:10.1016/j.ydbio.2005.12.033)

    • Search Google Scholar
    • Export Citation
  • KoksCAGroothuisPGDunselmanGAde GoeijAFEversJL2000Adhesion of menstrual endometrium to extracellular matrix: the possible role of integrin alpha(6)beta(1) and laminin interaction. Molecular Human Reproduction6170177. (doi:10.1093/molehr/6.2.170)

    • Search Google Scholar
    • Export Citation
  • LeppertPCJayesFLSegarsJH2014The extracellular matrix contributes to mechanotransduction in uterine fibroids. Obstetrics and Gynecology International2014783289. (doi:10.1155/2014/783289)

    • Search Google Scholar
    • Export Citation
  • LesseyBA1988Endometrial integrins and the establishment of uterine receptivity. Human Reproduction13247258.

  • McLeanACValenzuelaNFaiSBennettSA2012Performing vaginal lavage, crystal violet staining, and vaginal cytological evaluation for mouse estrous cycle staging identification. Journal of Visualized Experiments15e4389. (doi:10.3791/4389)

    • Search Google Scholar
    • Export Citation
  • MichieHJHeadJR1994Tenascin in pregnant and non-pregnant rat uterus: unique spatio-temporal expression during decidualization. Biology of Reproduction5012771286. (doi:10.1095/biolreprod50.6.1277)

    • Search Google Scholar
    • Export Citation
  • MullerUBossyBVenstromKReichardtLF1995Integrin alpha8 beta1 promotes attachment, cell spreading, and neurite outgrowth on fibronectin. Molecular Biology of the Cell6433448.

    • Search Google Scholar
    • Export Citation
  • MulthauptHALeitingerBGullbergDCouchmanJR2016Extracellular matrix component signaling in cancer. Advanced Drug Delivery Reviews972840. (doi:10.1016/j.addr.2015.10.013)

    • Search Google Scholar
    • Export Citation
  • NishiuchiRTakagiJHayashiMIdoHYagiYSanzenNTsujiTYamadaMSekiguchiK2006Ligand-binding specificities of laminin-binding integrins: a comprehensive survey of laminin-integrin interactions using recombinant alpha3beta1, alpha6beta1, alpha7beta1 and alpha6beta4 integrins. Matrix Biology25189197. (doi:10.1016/j.matbio.2005.12.001)

    • Search Google Scholar
    • Export Citation
  • PanLZhaoYYuanZQinG2016Research advances on structure and biological functions of integrins. Springerplus51094. (doi:10.1186/s40064-016-2502-0)

    • Search Google Scholar
    • Export Citation
  • ParkKRInoueTUedaMHiranoTHiguchiTMaedaMKonishiIFujiwaraHFujiiS2000CD9 is expressed on human endometrial epithelial cells in association with integrins alpha(6), alpha(3) and beta(1). Molecular Human Reproduction6252257. (doi:10.1093/molehr/6.3.252)

    • Search Google Scholar
    • Export Citation
  • PonsuksiliSMuraniESchwerinMSchellanderKTesfayeDWimmersK2012Gene expression and DNA-methylation of bovine pretransfer endometrium depending on its receptivity after in vitro-produced embryo transfer. PLoS ONE7e42402. (doi:10.1371/journal.pone.0042402)

    • Search Google Scholar
    • Export Citation
  • ReddyKVMangaleSS2003Integrin receptors: the dynamic modulators of endometrial function. Tissue and Cell35260273. (doi:10.1016/S0040-8166(03)00039-9)

    • Search Google Scholar
    • Export Citation
  • RossoFGiordanoABarbarisiMBarbarisiA2004From cell-ECM interactions to tissue engineering. Journal of Cellular Physiology199174180. (doi:10.1002/jcp.10471)

    • Search Google Scholar
    • Export Citation
  • Sanchez-AparicioPDominquez-JimenezCGarcia-PardoA1994Activation of the alpha4 beta1 integrin through the beta1 subunit induces recognition of the RGDS sequencing in fibronectin. Journal of Cell Biology126271279.

    • Search Google Scholar
    • Export Citation
  • SchaeferLReinhardtDP2016Special issue: extracellular matrix: therapeutic tools and targets in cancer treatment. Advanced Drug Delivery Reviews9713. (doi:10.1016/j.addr.2016.01.001)

    • Search Google Scholar
    • Export Citation
  • SchwabKEChanRWGargettCE2005Putative stem cell activity of human endometrial epithelial and stromal cells during the menstrual cycle. Fertility and Sterility8411241130. (doi:10.1016/j.fertnstert.2005.02.056)

    • Search Google Scholar
    • Export Citation
  • SeguinLDesgrosellierJSWeisSMChereshDA2015Integrins and cancer: regulators of cancer stemness, metastasis, and drug resistance. Trends in Cell Biology25234240. (doi:10.1016/j.tcb.2014.12.006)

    • Search Google Scholar
    • Export Citation
  • StraussJF2013Extracellular matrix dynamics and fetal membrane rupture. Reproduction Sciences20140153. (doi:10.1177/1933719111424454)

  • SuYXiaWLiJWalzTHumphriesMJVestweberDCabanasCLuCSpringerTA2016Relating conformation to function in integrin α5β1. PNAS113E3872E3881. (doi:10.1073/pnas.1605074113v)

    • Search Google Scholar
    • Export Citation
  • TangMXuYJulianJCarsonDTabibzadehS2005Lefty is expressed in mouse endometrium in estrous cycle and peri-implantation period. Human Reproduction20872880. (doi:10.1093/humrep/deh717)

    • Search Google Scholar
    • Export Citation
  • TheocharisADSkandalisSSGialeliCKaramanosNK2016Extracellular matrix structure. Advanced Drug Delivery Reviews97427. (doi:10.1016/j.addr.2015.11.001)

    • Search Google Scholar
    • Export Citation
  • VeqaMESchwarzbauerJE2016Collaboration of fibronectin matrix with other extracellular signals in morphogenesis and differentiation. Current Opinion in Cell Biology4216. (doi:10.1016/j.ceb.2016.03.014)

    • Search Google Scholar
    • Export Citation
  • VitilloLBaxterMIskenderBWhitingPKimberSJ2016Integrin-associated focal adhesion kinase protects human embryonic stem cells from apoptosis, detachment, and differentiation. Stem Cell Reports7167176. (doi:10.1016/j.stemcr.2016.07.006)

    • Search Google Scholar
    • Export Citation
  • YamadaOTodorokiJTakahashiTHashizumeK2002The dynamic expression of extracellular matrix in the bovine endometrium at implantation. Journal of Veterinary Medical Science64207214. (doi:10.1292/jvms.64.207)

    • Search Google Scholar
    • Export Citation
  • YokosakiYPalmerELPrietoALCrossinKLBourdonMAPytelaRSheppardD1994The integrin alpha9 beta1 mediates cell attachment to a non-RGD site in the third fibronectin type III repeat of tenascin. Journal of Biological Chemistry2692669126696.

    • Search Google Scholar
    • Export Citation
  • WaynerEAOrlandoRAChereshDA1991Integrins alpha v beta 3 and alpha v beta 5 contribute to cell attachment to vitronectin but differentially distribute on the cell surface. Journal of Cell Biology113919929.

    • Search Google Scholar
    • Export Citation
  • WhiteDJPuranenSJohnsonMSHeinoJ2004The collagen receptor subfamily of the integrins. International Journal of Biochemistry and Cell Biology3614051410. (doi:10.1016/j.biocel.2003.08.016)

    • Search Google Scholar
    • Export Citation
  • ZhangCDuanECaoYJiangGZengG2000Effect of 32/67 kDa laminin-binding protein antibody on mouse embryo implantation. Journal of Reproduction and Fertility119137142. (doi:10.1530/jrf.0.1190137)

    • Search Google Scholar
    • Export Citation
  • ZnoykoITrojanowskaMReubenA2006Collagen binding alpha2beta1 and alpha1beta1 integrins play contrasting roles in regulation of Ets-1 expression in human liver myofibroblasts. Molecular and Cellular Biochemistry2828999. (doi:10.1007/s11010-006-1400-0)

    • Search Google Scholar
    • Export Citation

Cited By

PubMed

Google Scholar