Embryo culture in presence of oviductal fluid induces DNA methylation changes in bovine blastocysts

in Reproduction
Authors:
Antonio D BarreraDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain
Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET-UNT, and Instituto de Biología ‘Dr. Francisco D. Barbieri’, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, San Miguel de Tucumán, Tucumán, Argentina

Search for other papers by Antonio D Barrera in
Current site
Google Scholar
PubMed
Close
,
Elina V GarcíaDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain
Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET-UNT, and Instituto de Biología ‘Dr. Francisco D. Barbieri’, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, San Miguel de Tucumán, Tucumán, Argentina

Search for other papers by Elina V García in
Current site
Google Scholar
PubMed
Close
,
Meriem HamdiDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by Meriem Hamdi in
Current site
Google Scholar
PubMed
Close
,
María J Sánchez-CalabuigDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by María J Sánchez-Calabuig in
Current site
Google Scholar
PubMed
Close
,
Ángela P López-CardonaDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by Ángela P López-Cardona in
Current site
Google Scholar
PubMed
Close
,
Noelia Fonseca BalvísDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by Noelia Fonseca Balvís in
Current site
Google Scholar
PubMed
Close
,
Dimitrios RizosDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by Dimitrios Rizos in
Current site
Google Scholar
PubMed
Close
, and
Alfonso Gutiérrez-AdánDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain

Search for other papers by Alfonso Gutiérrez-Adán in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to A D Barrera; Email: abarrera@fbqf.unt.edu.ar
Free access

During the transit through the oviduct, the early embryo initiates an extensive DNA methylation reprogramming of its genome. Given that these epigenetic modifications are susceptible to environmental factors, components present in the oviductal milieu could affect the DNA methylation marks of the developing embryo. The aim of this study was to examine if culture of bovine embryos with oviductal fluid (OF) can induce DNA methylation changes at specific genomic regions in the resulting blastocysts. In vitro produced zygotes were cultured in medium with 3 mg/mL bovine serum albumin (BSA) or 1.25% OF added at the one- to 16-cell stage (OF1–16), one- to 8-cell stage (OF1–8) or 8- to 16-cell stage (OF8–16), and then were cultured until Day 8 in medium with 3 mg/mL BSA. Genomic regions in four developmentally important genes (MTERF2, ABCA7, OLFM1, GMDS) and within LINE-1 retrotransposons were selected for methylation analysis by bisulfite sequencing on Day 7–8 blastocysts. Blastocysts derived from OF1–16 group showed lower CpG methylation levels in MTERF2 and ABCA7 compared with the BSA group. However, CpG sites within MTERF2, ABCA7 and OLFM1 showed higher methylation levels in groups OF1–8 and OF8–16 than in OF1–16. For LINE-1 elements, higher CpG methylation levels were observed in blastocysts from the OF1–16 group than in the other experimental groups. In correlation with the methylation changes observed, mRNA expression level of MTERF2 was increased, while LINE-1 showed a decreased expression in blastocysts from OF1–16 group. Our results suggest that embryos show transient sensitivity to OF at early stages, which is reflected by specific methylation changes at the blastocyst stage.

Abstract

During the transit through the oviduct, the early embryo initiates an extensive DNA methylation reprogramming of its genome. Given that these epigenetic modifications are susceptible to environmental factors, components present in the oviductal milieu could affect the DNA methylation marks of the developing embryo. The aim of this study was to examine if culture of bovine embryos with oviductal fluid (OF) can induce DNA methylation changes at specific genomic regions in the resulting blastocysts. In vitro produced zygotes were cultured in medium with 3 mg/mL bovine serum albumin (BSA) or 1.25% OF added at the one- to 16-cell stage (OF1–16), one- to 8-cell stage (OF1–8) or 8- to 16-cell stage (OF8–16), and then were cultured until Day 8 in medium with 3 mg/mL BSA. Genomic regions in four developmentally important genes (MTERF2, ABCA7, OLFM1, GMDS) and within LINE-1 retrotransposons were selected for methylation analysis by bisulfite sequencing on Day 7–8 blastocysts. Blastocysts derived from OF1–16 group showed lower CpG methylation levels in MTERF2 and ABCA7 compared with the BSA group. However, CpG sites within MTERF2, ABCA7 and OLFM1 showed higher methylation levels in groups OF1–8 and OF8–16 than in OF1–16. For LINE-1 elements, higher CpG methylation levels were observed in blastocysts from the OF1–16 group than in the other experimental groups. In correlation with the methylation changes observed, mRNA expression level of MTERF2 was increased, while LINE-1 showed a decreased expression in blastocysts from OF1–16 group. Our results suggest that embryos show transient sensitivity to OF at early stages, which is reflected by specific methylation changes at the blastocyst stage.

Introduction

The embryo environment during the first stages of development can influence the developmental potential and physiology of the future conceptus, and this may have long-term consequences for the health of the offspring (Fazeli & Holt 2016). In mammalian species, including mice and cattle, the early cleavage stages in which the embryo transits through the oviduct represent a very dynamic developmental window, involving molecular events related to morphological and metabolic changes, embryonic genome activation (EGA) and epigenetic reprogramming of parental and embryonic genomes (Bell et al. 2008, Duranthon et al. 2008). Among these events, reprogramming of epigenetic marks is one of the most critical processes affecting the embryo potential. As an epigenetic mark, DNA methylation is essential for normal embryo development through mechanisms such as regulation of gene expression, differentiation, cell cycle control and maintenance of genome stability (Okano et al. 1999, Golding et al. 2011, Messerschmidt et al. 2014).

Studies in mouse zygotes and developing embryos have revealed that shortly after fertilization, parental genomes undergo an active global demethylation that continues up to blastocyst stage, after which cells of the inner cell mass and trophectoderm reacquire methylation marks (Smith et al. 2012, Gkountela & Clark 2014, Guo et al. 2014). In cattle, immunofluorescence analysis using specific 5-methylcytosine antibodies demonstrated that global DNA methylation decreases between the 2- and 8-cell stages, followed by a subsequent de novo DNA methylation that increases progressively from 8-cell to blastocyst stage (Dean et al. 2001, Dobbs et al. 2013). These findings suggest that, similar to mouse embryos, the DNA methylation pattern in bovine embryos changes dynamically during the first stages of preimplantation development.

Recent studies in bovine blastocysts developed in vivo from embryos that were previously cultured in vitro until zygote, 4-cell or 16-cell stage, have indicated that during early embryo development the in vitro culture conditions can also modify the methylation levels of the embryonic epigenome in a developmental stage-dependent manner (Salilew-Wondim et al. 2015). Given that the embryo environment in in vitro culture conditions lacks several maternally derived molecules, a fact that could contribute to the epigenetic modifications observed previously, an interesting question that arises is whether embryonic DNA methylation marks are influenced by maternal–embryo signals.

In the in vivo setting, luminal fluid of the oviduct is the first maternal microenvironment that makes contact with the embryo. The composition of OF is complex and changing both in the ampullary and isthmic region depending on the phases of the estrous cycle (Killian 2004, Seytanoglu et al. 2008). It contains growth factors, cytokines and other candidate macromolecules that act as pivotal mediators of maternal–embryo communication (Lee & Yeung 2006, Aviles et al. 2010). Moreover, gene expression of some of these factors in the oviduct seems to be induced by the presence of the embryo via specialized cross-talk (Maillo et al. 2015). Signaling pathways triggered by oviductal molecules not only help mediate the maternal effect on embryo survival, development, plasticity and quality (Buhi et al. 2000, Coy & Yanagimachi 2015), but may also exert a long-term impact through epigenetic modifications of the embryonic genome. Interestingly, the presence of OF in in vitro culture induces changes in mRNA levels of DNMT1 and DNMT3A genes both in bovine early embryos and blastocysts, suggesting that oviductal factors could affect DNA methyltransferase (DNMT) expression during preimplantation development (Barrera et al. 2013, Lopera-Vasquez et al. 2015). However, to date there is no experimental evidence of the impact of the oviductal milieu on DNA methylation marks in the preimplantation embryo.

Since epigenetic marks are susceptible to environmental influence, we hypothesized that OF can affect DNA methylation pattern at specific genomic regions in the developing embryo. To evaluate this hypothesis, bovine embryos produced in vitro were cultured in the presence or absence of OF at different time points during the first four days of embryo development (period when in vivo the embryo is still in the oviduct). The methylation state in specific genomic targets was determined by bisulfite sequencing at the blastocyst stage. The present study particularly focused on regions within CpG islands in developmentally significant genes (MTERF2, ABCA7, OLFM1 and GMDS) and in CpG sites within LINE-1 repetitive elements. Moreover, to evaluate the correlation between the DNA methylation pattern and the transcriptional levels, relative mRNA abundance of the selected genes and LINE-1 expression were determined in blastocysts derived from embryos cultured in the presence or absence of OF during the examined time points of the early embryogenesis.

Materials and methods

Chemicals

Unless stated otherwise, all chemicals were purchased from Sigma-Aldrich Quimica.

Experimental design

The experimental design was established with two purposes: (I) to evaluate if the exposure of the embryos to the OF during early stages of development can induce changes and have subsequent effect on the DNA methylation pattern at blastocyst stage; and (II) to evaluate if there are specific embryonic stages more sensitive to the influence of OF before (from the 1-cell to 8-cell stage) or during the main phase of the EGA (from the 8-cell to 16-cell stage) in bovine embryos (Gad et al. 2012, Graf et al. 2014). In total, 2047 presumptive zygotes were produced by in vitro maturation and fertilization. These presumptive zygotes were randomly assigned to different experimental groups: SOF supplemented with 3 mg/mL BSA (group BSA, n = 586) or SOF supplemented with 1.25% (v/v) OF for three different periods of time (Fig. 1): (i) from the 1-cell to 16-cell stage (group OF1–16, n = 483); (ii) from the 1-cell to 8-cell stage (group OF1–8, n = 488); and (iii) from the 8-cell to 16-cell stage (group OF8–16, n = 490). Thus, in these three experimental groups, OF was present respectively: (i) from the start of culture (18 hpi) to 98 hpi (Day 4); (ii) from 18 hpi to 52 hpi (Day 2); and (iii) from 52 hpi (Day 2) to 98 hpi (Day 4). In all four groups, embryo culture was continued until Day 8 post-insemination (pi). In the three OF groups, the culture medium outside the treatment windows was SOF supplemented with 3 mg/mL BSA. The concentration of OF used was chosen according our previous observations indicating that this concentration added to embryo culture medium supports in vitro development and positively affects the quality of the produced blastocysts in bovine (Lopera-Vasquez et al. 2015).

Figure 1
Figure 1

Diagram of the experimental design. Bovine embryos were subjected to in vitro culture under four experimental groups: (1) Group BSA = synthetic oviductal fluid (SOF) + 3 mg/mL bovine serum albumin (BSA); (2) Group OF1–16 = SOF + 1.25% (v/v) oviductal fluid (OF) added to culture from the 1-cell stage to 16-cell stage; (3) Group OF1–8 = SOF + 1.25% (v/v) OF added to culture from the 1-cell stage to 8-cell stage; and (4) Group OF8–16 = SOF + 1.25% (v/v) OF added to culture from the 8-cell stage to 16-cell stage. Expanding blastocysts derived from embryos developing in a timely manner were collected at Day 7–8 post-insemination (pi) for DNA methylation analysis.

Citation: Reproduction 154, 1; 10.1530/REP-16-0651

For this design, normally developing embryos that reached the ≥8-cell stage at 52 hpi and ≥16-cells at 98 hpi were selected and separately cultured from slowly developing embryos (referred to as ‘late 52 hpi’ and ‘late 98 hpi’ respectively). Cleavage rates were assessed at 52 hpi and the blastocyst rate was determined on Day 7–8 pi as the percentage of blastocysts obtained from embryos cultured under each experimental condition in both the normal and late development group. The experiment was carried out eight times under the same assay conditions. Expanding blastocysts obtained from embryos developing in a timely manner (Day 7–8) were frozen in liquid nitrogen (LN2) and stored at −80°C. A total of four pools of 20 expanding blastocysts per experimental group derived from five experimental replicates were used for methylation analysis. As result of bisulfite sequencing, 480 positive clones were sequenced, including a total of 20 individual clones from each target loci from each treatment group. On the other hand, three pools of 10 blastocysts obtained from the additional three experimental replicates were used to evaluate the relative mRNA expression.

In vitro oocyte maturation

Bovine cumulus–oocyte complexes (COCs) were recovered and in vitro matured as previously described by Lopera-Vasquez and coworkers (2015). Briefly, immature COCs were obtained by aspirating follicles (2–8 mm) from the ovaries of heifers collected at the slaughterhouse. Class 1 and 2 COCs were matured for 22 h in 500 µL maturation medium (TCM 199 (M4530) supplemented with 10% (v/v) fetal calf serum (FCS) and 10 ng/mL epidermal growth factor (E4127)) in groups of approximately 50 COCs per well in four-well dishes (NUNC, Roskilde, Denmark). The culture conditions were 38.5°C, 5% CO2 in air and maximum humidity.

In vitro fertilization

Frozen semen from a single Asturian Valley bull, previously tested for IVF (ASEAVA, Asturias, Spain), was thawed at 37°C in a water bath for 1 min and sperm was selected on a Bovipure gradient (Nidacon Laboratories AB, Gothenburg, Sweden) as previously described by Lopera-Vasquez and coworkers (2015). Sperm concentration was determined and adjusted to a final concentration of 1 × 106 sperm cells/mL for IVF. Gametes were co-incubated for 18 h in 500 µL of fertilization medium (Tyrode’s medium with 25 mM bicarbonate, 22 mM Na-lactate, 1 mM Na-pyruvate and 6 mg/mL fatty acid-free BSA) supplemented with 10 µg/mL heparin sodium salt (Calbiochem) in groups of 50 COCs per well in four-well dishes at 38.5°C in an atmosphere of 5% CO2 in air at maximum humidity.

In vitro embryo culture

After the fertilization period, presumptive zygotes were denuded of cumulus cells by vortexing for 3 min, randomly divided into groups of 25 and cultured in 25 µL droplets of synthetic oviductal fluid (SOF) supplemented with 4.2 mM sodium lactate (L4263), 0.73 mM sodium pyruvate (P4562), 30 µL/mL BME amino acids (B6766), 10 µL/mL MEM non-essential amino acids (M7145) and 1 µg/mL phenol red (P0290). Droplets were placed under mineral oil at 38.5°C in an atmosphere of 5% CO2, 5% O2 and 90% N2. Depending on the experimental group (see ‘Experimental design’ section), SOF was supplemented with either 3 mg/mL bovine serum albumin (BSA; A9647) or with 1.25% (v/v) OF.

Bovine oviductal fluid

The bovine OF added to the in vitro embryo culture medium was obtained from Embryocloud, Murcia, Spain (www.embryocloud.com). According to the information provided by the company, the OF (NatuArts BOF-EL) was collected from oviducts ipsilateral to the ovary containing a corpus hemorrhagicum obtained from heifers slaughtered during the early luteal phase of the estrous cycle (Day 1–4). Briefly, oviducts were transported to the laboratory on ice, washed twice with cold phosphate-buffered saline (PBS) and transferred to a stainless steel tray on a bed of ice before dissection from surrounding connective tissues. Following the protocol described by Carrasco and coworkers (2008), each oviduct was squeezed gently from the utero-tubal junction toward the ampulla and the OF was collected by aspiration using a 200-µL automatic pipette. A volume between 10 and 30 µL per oviduct was collected and a pool of OF from five oviducts was centrifuged at 7000 g for 10 min at 4°C to remove cellular debris. The supernatant was aliquoted and stored at −80°C until use.

Genomic DNA bisulfite conversion

Genomic DNA from four pools of 20 blastocysts obtained from each experimental group and derived from five IVF replicates was subjected to bisulfite treatment using the MethylEdge Bisulfite Conversion System (Promega) following the manufacturer’s instructions. Samples were digested with proteinase K for 1 h at 55°C in a 20 μL reaction volume containing 1 μg/μL proteinase K and 1× STES buffer (20 mM NaCl, 50 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.1% SDS). Samples were then incubated at 95°C for 5 min to inactivate proteinase K. Next, 130 μL of bisulfite conversion reagent was added directly to the samples which were incubated at 98°C for 8 min and then at 54°C for 1 h. For bisulfite DNA clean-up, bisulfite-treated samples were transferred to a spin column preloaded with 600 μL of binding buffer and centrifuged at 10,000 g. After washing, 200 µL of desulfonation buffer was added to each spin column and the DNA bound to the column was desulfonated for 15 min at room temperature. Bisulfite-converted DNA was then eluted from the column with 36 µL of elution buffer and immediately used for PCR amplification.

Primer design and bisulfite PCR

To amplify the bisulfite-converted DNA sequences, primers were designed using MethPrimer (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) (Table 1). The four genes chosen for this study contain regions that showed significant DNA methylation changes among porcine blastocysts collected in vivo and derived from embryos produced in vitro in the presence or absence of reproductive fluids during the entire procedure (Canovas et al. 2017). The candidate regions examined from bovine genome belong to CpG islands localized at proximal promoters or gene bodies within the genes mitochondrial transcription termination factor 2 (MTERF2), olfactomedin 1 (OLFM1), ATP-binding cassette subfamily A member 7 (ABCA7) and GDP-mannose 4.6-dehydratase (GMDS). Given the fact that DNA methylation is a key epigenetic modification controlling the transcriptional activity of mammalian retrotransposable elements, the other regions selected for methylation analysis corresponded to LINE-1 (long interspersed nuclear element class-1 or L1) repetitive elements. LINE-1 sequences are the most abundant interspersed sequences throughout the bovine genome and probably the most active type of LINE elements (Adelson et al. 2009). It should be mentioned that the CpG sites analyzed allowed assessment of changes in methylation patterns in three different contexts: (a) transcription start sites (e.g. MTERF2); (b) intragenic regions like introns (e.g. GMDS), last exons (e.g. OLFM1) and exon–intron junctions (e.g. ABCA7) and (c) regions located across the genome associated with transposable elements (e.g. LINE-1).

Table 1

Details of primers used for the amplification of bisulfite-treated DNA.

DNA region Outer and inner* primer sequences (5′–3′) Amplicon length (bp) Amplicon location in bovine genome and number of CpG analyzed
MTERF2 Forward GTTAGGYGGAGTTGAGGTAGTT 437 Chromosome 5
Reverse CTTCTCACGAACTATAACATTCC From: 70,601,882
Forward* GAGTATTTATAGGTGTGTAGG 240 To: 70,602,121 (240 bp–21 CpG)
Reverse* CRATCRAAATAAACTCCRCCACCCTA
OLFM1 Forward TGGAGAAAYGTGGGGGTAAYGTT 476 Chromosome 11
Reverse TACAAACCTAAAACACCAACTACC From: 106,675,747
Forward* GAGTTTAYGTTGTTGATGAGTTTG 249 To: 106,675,995 (249 bp–17 CpG)
Reverse* ACATCTCCATACTAAACTACAACC
ABCA7 Forward TGTTTTAYGTGTTGTGYGTGGTT 305 Chromosome 7
Reverse ACAACAAAAAACCAAAAACCTAAAC From: 45,170,162
Forward* GTTTGGAGGGATTAGTTGTTAATG 261 To: 45,170,422 (261 bp–19 CpG)
Reverse* CCAAACTAAAAACATCTACTATAA
GMDS Forward AAGTTTGYGGGATTTTATATGGTG 337 Chromosome 23
Reverse AAAATCTCCTCTACCCCATACTACC From: 51,395,536
Forward* GTTATTTGTTAGGGTGGGTTTGTT 137 To: 51,395,672 (137 bp–5 CpG)
Reverse* CACAAAACCACTTTCTAATCTACTC
LINE-1 Forward TAAAATTTATAGATTATGAGTTTTAT 357 Region located across the genome (317 bp–11 CpG)
Region A Reverse TAAATAATATCTCTCTAAAACTA
Forward* ATGAGTTTTATGGTAATTTTTATAG 317
Reverse* ATTACCCCCTTCCAACTCTAACTAC
LINE-1 Forward ATAGGTTGTATTGTTTAGAGTAAGGAT 244 Region located across the genome (201 bp–7 CpG)
Region B Reverse AATACATTTCTAAAACTACGATTAA
Forward* GAGTAAGGATAGGGTTTGAATGTTT 201
Reverse* CCCTTCCAACTCTAACTACCTATCAC

Y = C/T, R = A/G.

bp, base pairs.

Bisulfite-modified DNA (3 µL) was used to amplify each sequence by nested PCR. The first PCR reaction with outer pairs of primers consisted of one cycle at 95°C for 2 min; 5 cycles at 95°C for 20 s, 50°C for 1 min, and 72°C for 1 min 15 s; 30 cycles at 95°C for 20 s, 50°C for 1 min, and 72°C for 1 min 30 s; and a final step at 72°C for 4 min. For nested PCR, 2 µL of the primary PCR product were used in a first step at 95°C for 3 min followed by 35 cycles at 95°C for 20 s, 54°C for 30 s, 72°C for 45 s, and a final extension at 72°C for 20 min. PCR reactions were run in a 25 µL volume consisting of 10 μM of each primer, 0.1 mM of dNTPs mix (Biotools, Madrid, Spain), 2 mM of MgCl2, 5× GoTaq Flexi Buffer and 1 U GoTaq DNA Polymerase (Promega). The presence of each PCR product was confirmed by loading 5 μL of the product on 2% (w/v) agarose gels stained with SYBR Safe (Life Technologies) and electrophoresis was carried out at 120 V for 15–20 min.

Cloning of PCR products and sequencing analysis

PCR products derived from bisulfite-treated DNA were purified from the PCR reaction mixture using the FavorPrep PCR Clean-UP Kit (Favorgen Biotech Corp., Vienna, Austria) following the manufacturer’s instructions. Each purified PCR fragment was cloned into the pGEM-T Easy vector (Promega) and Escherichia coli competent cells were transformed. The bacterial cells were plated onto selective Luria-Bertani (LB) agar plates containing ampicillin/IPTG/X-gal and incubated overnight at 37°C. After incubation, independent white colonies were selected to verify the presence of the insert using PCR. Sequence data analysis of purified recombinant plasmids was performed using CpGviewer software (http://dna.leeds.ac.uk/cpgviewer/). The bisulfite conversion rate of cytosines located at non-CpG sites was checked and sequences included in the analysis showed conversion efficiency >99%. The sequences examined were localized in the genome using the Bos taurus genome assembly UMD 3.1.1 available at the National Center for Biotechnology Information (NCBI) as reference sequence.

RNA isolation, reverse transcription and quantitative real-time PCR (qRT-PCR)

Isolation of embryonic RNA was performed using three pools of 10 expanding blastocysts (Day 7–8) obtained from independent experiments per treatment group. Poly(A) RNA was extracted using the Dynabeads mRNA DIRECT Micro Kit (Ambion, Thermo Fisher Scientific) following the manufacturer’s instructions and with minor modifications described by Bermejo-Alvarez and coworkers (2008). After 10 min of incubation in lysis buffer with Dynabeads, poly(A) RNA attached to the Dynabeads was extracted with a magnet and washed twice with washing buffer A and washing buffer B. RNA was eluted with 30 µL of 10 mM Tris–HCl and immediately used for cDNA synthesis. Reverse transcription (RT) was carried out following the manufacturer’s instructions (Bioline, Ecogen, Madrid, Spain). Briefly, oligo-dT (0.2 µM) and random hexamer primers (0.5 µM) were added to the RNA and the mixture was heated at 70°C for 5 min for denaturation of the secondary RNA structure. Then, RNA was reverse-transcribed in a final volume of 40 µL containing 0.375 mM dNTPs (Biotools), 6.25 U RNasin RNAse inhibitor (Promega), 10× MMLV-RT buffer with 8 mM dithiothreitol, and 5 U MMLV (Moloney Murine Leukemia Virus) high performance reverse transcriptase (Epicentre, Madison, WI, USA), followed by incubation at 70°C for 10 min to inactivate the RT enzyme. cDNA was stored at −20°C until further use.

The expression levels of the selected genes and LINE-1 retrotransposons were determined by quantitative real-time PCR (qRT-PCR) using specific primers, which are listed in Table 2. Each pair of primers was verified to achieve efficiencies close to 1. All qRT-PCR reactions were performed in a final volume of 20 µL, containing 2 µL of each cDNA sample (60 ng/µL), 0.25 mM of forward and reverse primers and 10 µL of GoTaq qPCR Master Mix (Promega) using a Rotorgene 6000 Real Time Cycler (Corbett Research, Sydney, Australia) and SYBR Green as double-stranded DNA-specific fluorescent dye. Three cDNA samples per experimental group were used in two repetitions for all genes of interest. PCR amplification conditions were as follows: an initial denaturalization step at 94°C for 2 min, followed by 35 denaturalization cycles at 94°C for 15 s, annealing at 56°C for 30 s, extension at 72°C for 30 s and 10 s of fluorescence acquisition at a temperature which was specific for each product (76–86°C) and higher than the melting temperature of primer dimers.

Table 2

Primers used for qRT-PCR analysis.

Gene/repetitive element Primer sequences (5′–3′) Amplicon length (bp) GenBank accession number
MTERF2 Forward AGTTTATTGCAGGGAAGTGACA 198 NM_001191174
Reverse GCTGGGATCTCATCAGCAACT
ABCA7 Forward ATGGGCGGTTGAAGGGTCTGAG 154 NM_001205705
Reverse CCCACAAAGGCAATGGCCACTG
OLFM1 Forward AACCAGATGAAAGGGCTGGAG 128 NM_001101879
Reverse TGGACTGCTTCTTCAGTCTGC
GMDS Forward TCACCTCGGACAACTGGAATG 216 NM_001080331
Reverse TTCTTCCCTTCCCACACGATG
H2AFZ Forward AGGACGACTAGCCATGGACGTGTG 209 NM_174809
Reverse CCACCACCAGCAATTGTAGCCTTG
LINE-1 Forward CCCAGGTCCAGACGGCTT 137
Reverse GGGTGATGGTGGCCTCATAGA

bp, base pairs.

The comparative cycle threshold (CT) method was used to quantify expression levels of the genes analyzed. Housekeeping gene H2A histone family, member Z (H2AFZ), previously used for relative quantification of mRNA transcripts in bovine blastocysts (Bermejo-Alvarez et al. 2008) was used for normalization. In our determinations, H2AFZ produced uniform expression levels varying less than 0.5 CT between control and treated cDNA samples. Fluorescence was acquired in each cycle to determine the threshold cycle during the log-linear phase of the reaction during which fluorescence increased above the background for each sample. According to the comparative CT method, the ΔCT value was determined by subtracting the housekeeping gene mean CT value for each sample from each gene CT value of the sample. Calculation of ΔΔCT involved the use of the highest sample ΔCT value (i.e. the sample with the lowest target expression) as an arbitrary constant to subtract from all other ΔCT sample values. Fold changes in the relative gene expression of the target were determined using the formula 2–ΔΔCT. The entire study was carried out following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines (Bustin et al. 2009).

Statistical analysis

Data were analyzed using SigmaStat 3.5 and SigmaPlot 10.0 (Systat Software, Richmond, CA, USA). Embryo developmental variables and relative mRNA expression among the experimental groups were compared using one-way analysis of variance (ANOVA) followed by multiple pair-wise comparisons using the Tukey method. Significance was set at P < 0.05.

Methylation percentages obtained from the sequenced clones were compared among the different groups using the statistical z-test.

Results

Developmental rates of embryos cultured in the presence of oviductal fluid at different time points during in vitro development

No significant differences were observed in cleavage rates between control group embryos and embryos cultured in the presence of OF (Fig. 2A). Proportions of embryos reaching the ≥8-cell stage at 52 hpi were similar in the four experimental groups with no significant differences between them. Overall, 51.2–59.2% of the embryos reached the 8-cell stage or more at 52 hpi, and a significantly lower proportion of embryos was observed in a delayed developmental stage, irrespective the addition of OF to the embryo culture medium (Fig. 2B). Embryos that developed in a timely manner reaching the stage of ≥8-cells at 52 hpi were then separately cultured. A percentage between 52.8–61.3% of these embryos reached the 16-cell stage or more at 98 hpi, with no differences observed between the control and OF groups (Fig. 2C).

Figure 2
Figure 2

Development rates of bovine embryos cultured in the presence or absence of bovine oviductal fluid (OF) at different time periods during in vitro development. (A) Cleavage rate at 52 h post-insemination (hpi). (B) Percentage of cleaved embryos reaching the 8-cell stage or beyond (‘normal development’) at 52 hpi. (C) Percentage of embryos reaching the 16-cell stage or beyond at 98 hpi derived from embryos showing ‘normal development’ at 52 hpi. (D) Blastocyst rate on Day 7–8 (in vitro fertilization = Day 0) derived from the ‘normally developed’ (normal dev.), ‘late 98 hpi’ and ‘late 52 hpi’ groups. Results are expressed as mean ± s.e.m. Different superscripts in each column indicate significant differences based on ANOVA (P < 0.05). BSA: embryos cultured in SOF + BSA; OF1–16: embryos cultured in SOF + OF from the 1-cell stage to 16-cell stage; OF1–8: embryos cultured in SOF + OF from the 1-cell stage to 8-cell stage; OF8–16: embryos cultured in SOF + OF from the 8-cell stage to 16-cell stage.

Citation: Reproduction 154, 1; 10.1530/REP-16-0651

Cumulative blastocyst yields on Day 7 and Day 8 post-insemination were similar for embryos cultured with or without OF (Fig. 2D). In all experimental groups, normally developing embryos gave rise to significantly higher blastocyst rates than embryos that showed slower developmental kinetics at 52 hpi (late 52 hpi) or 98 hpi (late 98 hpi).

Effects of oviductal fluid on the DNA methylation state of gene-specific regions

To determine whether addition of OF to the embryo culture medium during different time intervals would affect DNA methylation marks at the blastocyst stage, bisulfite sequencing was performed to assess the methylation status of specific genomic regions within the CpG islands of four developmentally important genes.

As shown in Fig. 3A, the region analyzed for the MTERF2 gene spanned a 240 bp segment with 21 CpG sites, covering the entire first exon and part of its neighboring regions. Blastocysts from groups OF1–16, OF1–8 and OF8–16 showed a reduced level of methylation at the MTERF2 region compared to BSA control (20.0, 26.2 and 32.9 vs 56.2% respectively, P < 0.001). Additionally, embryos in the OF8–16 group showed a significantly higher methylation level of these CpG sites compared to those in OF1–16 (P < 0.05). In contrast, comparable methylation levels of the MTERF2 region were observed in blastocysts in OF1–16 vs OF1–8 (P > 0.05).

Figure 3
Figure 3

DNA methylation changes produced in genomic regions in blastocysts derived from embryos cultured in the presence or absence of bovine oviductal fluid as determined by bisulfite sequencing. (A) DNA methylation pattern around the first exon of MTERF2. (B) DNA methylation changes around intron 14 and its adjacent exons in ABCA7. (C) DNA methylation changes in the last exon of OLFM1. (D) DNA methylation profile in a region within intron 6 in GMDS. Exons are represented by a vertical rectangle, and the location of the region analyzed is indicated by a shaded horizontal rectangle. The black arrow indicates the transcription start site (TSS). Each row represents the average methylation level of the clones sequenced for each experimental group. Changes in methylation of each CpG site are indicated by shaded circles and shading indicates average percentage of DNA methylation. Black color denotes the presence of methylation, whereas white color indicates lack of methylation. Average methylation percentage for each experimental group is given on the right. Numbers across the top indicate specific positions of CpG dinucleotides in the genomic region. Different superscripts indicate significant differences between treatments based on the statistical z-test (P < 0.05).

Citation: Reproduction 154, 1; 10.1530/REP-16-0651

The fragment of 261 bp examined within ABCA7 gene spanned 19 CpG sites covering part of exon 14 and exon 15 and the entire intron between them (Fig. 3B). This CpG sequence showed a lower methylation level in blastocysts from OF1–16 (31.1%) than blastocysts from OF1–8 (56.8%), OF8–16 (57.9%) or the control group (65.8%) (P < 0.001). However, methylation values in embryos from OF1–8, OF8–16 or the control group were not significantly different (Fig. 3B,P > 0.05).

For the OLFM1 gene, a fragment of 249 bp was amplified from bisulfite-treated DNA and this amplicon included a total of 17 CpG sites within the last exon of the gene (Fig. 3C). The first 9 CpGs cover the last coding region of the exon and the other 8 CpGs encompass the first part of the non-coding region. The methylation pattern of this CpG sequence did not differ between blastocysts derived from the OF1–16 (19.4%) and control groups (24.1%) (Fig. 3C,P > 0.05). However, in embryos from OF1–8 this region was more methylated (47.1%) than in those from OF1–16 (19.4%), OF8–16 (29.4%) and the control group (24.1%) (Fig. 3C,P < 0.001). Although OF8–16 blastocysts showed a lower methylation level in the OLFM1 region than OF1–8 blastocysts, this methylation level was significantly higher than that observed for embryos in OF1–16 (Fig. 3C,P < 0.05).

In contrast with these results, no significant differences among experimental groups were detected in the methylation patterns of CpG sites in the GMDS region, which comprises a 137 bp genome segment containing five CpG sites within intron 6 of the gene (Fig. 3D,P > 0.05).

Effects of oviductal fluid on the DNA methylation state of LINE-1 repetitive elements

Since repetitive elements present in the genome are also important target sequences for DNA methylation, the methylation status of two regions (A and B) within the bovine LINE-1 elements was also examined.

Percentages of methylated cytosines observed in the CpG sequence of region A in LINE-1 were significantly higher in OF1–16 blastocysts than those in the OF8–16 (P < 0.001) and BSA group (P < 0.05) (Fig. 4A). However, no significant differences in the methylation level were observed between embryos in OF1–16 and OF1–8, though OF1–8 blastocysts showed a significantly higher methylation rate than OF8–16 blastocysts (Fig. 4A,P < 0.05).

Figure 4
Figure 4

DNA methylation profiles in regions within LINE-1 repetitive elements in blastocysts derived from embryos cultured with or without bovine oviductal fluid as determined by bisulfite sequencing. (A) DNA methylation changes in the A region of LINE-1 repeated sequences. (B) DNA methylation pattern in the B region of LINE-1 repeated sequences. Each row represents the average methylation level of the clones analyzed for each experimental group. Changes in methylation of each CpG site are indicated by shaded circles and shading indicates the average percentage of DNA methylation. Black color denotes the presence of methylation, while white indicates lack of methylation. Average methylation percentage for each experimental group is given on the right. Significant differences based on the statistical z-test (P < 0.05) are indicated with different letters.

Citation: Reproduction 154, 1; 10.1530/REP-16-0651

The CpG sequence within region B in LINE-1 showed low methylation levels in blastocysts from all the experimental groups (Fig. 4B).

Analysis of mRNA expression in blastocysts derived from embryos cultured with or without oviductal fluid during the first stages of development

In addition to the DNA methylation analysis, we investigated whether the changes in methylation marks, as a consequence of exposure to OF during different periods of the early development, are correlated with relative mRNA abundance changes. Therefore, relative transcriptional levels of MTERF2, ABCA7, OLFM1 and GMDS were determined in blastocysts derived from control and OF-treated groups according to the experimental design. Likewise, LINE-1 expression was also examined.

As shown in Fig. 5, relative mRNA expression for MTERF2 was found increased in blastocysts obtained from OF1–16, OF1–8 and OF8–16 groups compared to transcript level in BSA group (Fig. 5,P < 0.05). However, the relative mRNA expression levels for ABCA7, OLFM1 and GDMS did not differ significantly among blastocysts from the different treatment groups (Fig. 5). The transcription level for LINE-1 was found significantly lower in blastocysts derived from OF1–16 group than blastocysts from BSA group and the other OF-treated groups (Fig. 5,P < 0.05).

Figure 5
Figure 5

Relative mRNA abundance of selected genes and LINE-1 in blastocysts developed from embryos cultured with or without bovine oviductal fluid at different time points of the early embryogenesis. Bars represent the relative abundance of MTERF2, ABCA7, OLFM1, GMDS and LINE-1 transcripts in blastocyst stage embryos normalized to the H2AFZ housekeeping gene. The BSA group is represented by white columns and oviductal fluid (OF)-treated embryos are represented with gray (group OF1–16), black (group OF1–8) and hatched group (OF8–16) columns. Results are expressed as mean ± s.e.m. Different superscripts indicate significant differences (P < 0.05) between treatments. Data are obtained from three replicates of independent groups of 10 expanding blastocysts (Day 7–8).

Citation: Reproduction 154, 1; 10.1530/REP-16-0651

Discussion

Epigenetic reprogramming during preimplantation is critical for the development of the mammalian embryo (Beaujean 2014). Part of this reprogramming occurs when the embryo passes through the oviduct. Several studies have evidenced that mammalian embryos developed in in vitro culture conditions, outside the maternal environment, are susceptible to errors in the epigenetic reprogramming, leading to alterations in their DNA methylation pattern (Fernandez-Gonzalez et al. 2004, Niemann et al. 2010, Salilew-Wondim et al. 2015). In this sense, there is a growing body of evidence suggesting that the ovarian follicle microenvironment and the reproductive tract fluids can impact on the DNA methylation marks of the oocyte and the embryo respectively (O’Doherty et al. 2014, Canovas et al. 2017). However, the influence of OF on early embryo epigenetic marks is still poorly understood. Thus, the aim of the present study was to determine if the methylation pattern in particular genomic regions of bovine blastocysts changes in response to addition of OF to the culture medium during the first stages of development. Particularly, the attention was focused on genomic regions contained within CpG islands of four developmentally important genes including MTERF2 (Gustafsson et al. 2016), OLFM1 (Kodithuwakku et al. 2011), ABCA7 (Morales et al. 2008) and GMDS (Haliburton et al. 2016), and also within LINE-1 retrotransposons.

Addition of OF to the embryo culture medium at different time points during embryonic development had no effect on the kinetics of development and blastocyst yield. Similar findings were observed in a previous study using the same OF concentration (Lopera-Vasquez et al. 2015). As expected, a greater proportion of embryos reached the blastocyst stage in the subgroup of embryos that developed in a timely manner regardless the addition of OF compared to the subgroup of embryos showing slower developmental kinetics. Despite this difference, similar blastocyst yields were observed when embryos were cultured in the presence or absence of OF. This suggests that there is no impact of OF on embryo developmental kinetics during in vitro culture.

In contrast, methylation analysis revealed that bovine embryos exposed to OF for the first four days of culture (group OF1–16), showed significantly reduced methylation levels in CpG sites of MTERF2 and ABCA7 genes when compared with levels in the BSA group. This four-day period of in vitro culture in medium supplemented with OF mimics the window of development in which the embryo makes contact with oviductal components in an in vivo situation (Hackett et al. 1993). One plausible explanation for these results is that the higher levels of methylation detected in the BSA group for the genomic regions analyzed (compared with OF1–16) could be triggered by the absence of oviductal factors in the culture medium. This finding reinforces the idea that oviductal factors, that are naturally present in the OF, may be important for maintaining a more reduced methylation level at least in these genomic regions. As highlighted in a recent study by Canovas and coworkers (2017), porcine blastocysts produced in vitro in the presence of reproductive fluids during all steps of in vitro production show, in general, DNA methylation patterns diminished compared to blastocysts cultured without biological fluid supplementation. However, in this genomic study it is not possible to differentiate a precise effect of OF on specific DNA methylation marks in the resulting blastocysts as porcine embryos were cultured in vitro first with OF and then with uterine fluid. It has been well established that embryos of different mammalian species produced in vitro show higher DNA methylation levels than embryos developed in vivo (Corcoran et al. 2007, Deshmukh et al. 2011, Wright et al. 2011). An interesting fact observed by Salilew-Wondim and coworkers (2015) is that bovine embryos exposed to in vitro culture conditions up to the 16-cell stage produced higher genome methylation in the resulting blastocysts than those derived from embryos that were transferred at earlier stages to in vivo conditions. This finding, together with our results, emphasizes the idea that suboptimal culture conditions and particularly the absence of maternal signals from the 1-cell to 16-cell stage may affect DNA methylation reprogramming with a subsequent effect on later stages of development.

In the current study, the effect of addition of OF in a stage-specific manner, particularly at embryonic stages before or during the main phase of EGA in bovine embryos was also investigated. In cattle, the main phase of EGA occurs at the 8- to 16-cell stage (Graf et al. 2014). Even though the precise mechanisms involved in EGA have not yet been determined in the bovine species; it is thought that DNA methylation remodeling at specific gene-regulatory regions could play some role in EGA (Bogliotti & Ross 2015). This seems to be reflected by changes in the embryo gene expression profile at the blastocyst stage (Rizos et al. 2002, 2003, Gad et al. 2012). The present study showed that methylation levels in the analyzed CpG sites of MTERF2 ABCA7 and OLFM1 were higher in blastocysts exposed to the OF at embryo stages before the 8-cell stage (group OF1–8) or during major EGA (group OF8–16) than after addition of OF during the entire 1- to 16-cell stage (group OF1–16). One feasible interpretation of this finding is that in vitro culture without OF, before or during the major phase of EGA, may induce greater deregulation in DNA methylation, suggesting that the embryonic stages in both phases of development are susceptible to the oviductal factors missing in vitro. Our observations are somewhat consistent with the recent work indicating that the methylation profile of CpG islands and repetitive elements within the bovine genome in blastocysts is affected when embryos are subjected to in vitro culture during early stages of development (up to zygote, 4-cell or 16-cell stage) and then transferred to in vivo conditions (Salilew-Wondim et al. 2015). Thus, it seems that the stages of development before and during EGA are sensitive to embryonic DNA methylation changes induced by the embryo environment.

Interestingly, contrary to the effect of OF on specific gene regions in blastocysts developed from OF1–16 embryos (e.g. MTERF2 and ABCA7), methylation level significantly increased within the CpG sites of LINE-1 retrotransposons. Bovine LINE-1 repeats are among the evolutionarily younger active repetitive elements (Adelson et al. 2009). Other authors have proposed that LINE-1 repeats can serve as a surrogate marker for global genomic DNA methylation for the human or bovine genome (Yang et al. 2004, Li et al. 2017). In a physiological situation, the activity of interspersed repetitive elements is regulated by DNA methylation (Liang et al. 2002). Indeed, the loss of methylation has been associated with reactivation of retrotransposons and consequently with modified chromosome integrity and/or modified gene expression by insertion events (Thurston et al. 2007, Jones 2012). Hence, it could be expected that OF help keep these sequences methylated to prevent their activation and ensure the genomic stability of the embryos. The expression analysis showed lower transcriptional level of LINE-1 in blastocysts from OF1–16 groups than blastocysts from groups OF1–8, OF8–16 and BSA. This result suggests that the observed differences in DNA methylation status of LINE-1 in blastocysts derived from OF1–16 have a positive correlation with their expression level. Therefore, the addition of OF during the first four days of embryo culture may help the suppression of LINE-1 transposable elements.

It should be mentioned that the genome regions examined in the present study are situated at different loci either within genes or in intergenic regions. The biological significance of methylation changes at these loci in response to OF is not known. However, the role of DNA methylation in gene expression depends on the genomic context in which they occur. While methylation at promoters within CpG islands or the first exon is frequently associated with gene repression (Brenet et al. 2011, Smith et al. 2012), gene body specific methylation is often linked to active transcription (Hellman & Chess 2007) and it also seems to be related to the silencing of intragenic retrotransposons and modulation of alternative splicing promoting exon recognition (Maunakea et al. 2013). In order to further investigate the influence of changes in methylation marks within the genomic regions analyzed, the relative mRNA abundance for the selected genes was determined. The increased relative expression of MTERF2 in blastocysts derived from groups OF1–16, OF1–8 and OF8–16 suggests a correlation with the lower methylation levels observed in this genomic region compared to their BSA group counterparts. Considering that DNA methylation changes occurred very close to the promoter region of the gene, the MTERF2 transcriptional level could be epigenetically regulated via methylation changes as a consequence of the influence of the OF during early embryogenesis. In contrast to this finding, a similar relative mRNA abundance of ABCA7 and OLFM1 in blastocysts derived from OF-treated and BSA groups suggests that the changes in methylation of the genomic regions analyzed (exon–intron junction and last exon respectively) would not be involved in the control of the transcript level of these genes.

In conclusion, our findings indicate that bovine embryos are transiently sensitive to the presence of OF at early embryonic stages in vitro. This sensitivity was reflected by the OF effect on methylation marks in CpG sites within certain genomic regions and repetitive elements at the blastocyst stage. The changes in embryo DNA methylation induced by the presence of OF in the culture environment could partly affect the mRNA expression level for specific genes (e.g. MTERF2) and LINE-1 elements. Although the present study is only focused on methylation analysis of specific genomic CpG sequences thus giving only a partial view on the impact of OF on embryo epigenetics, it provides evidence to suggest that embryo could be able to respond to oviductal signaling modifying the methylation pattern of genome-specific loci. Our findings provide new evidence that may help reveal the role of maternal factors in the communication between the oviduct and the embryo in the early postconception period.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from the Spanish Ministry of Economy and Competitiveness (grants numbers AGL2015-70140-R and AGL2015-66145-R). A D B was supported by an external research fellowship granted by CONICET, Argentina.

Acknowledgements

The authors would like to thank Paula Beltrán and Carolina Nuñez for their technical assistance in IVF assays. They also thank the Transformación Ganadera de Leganés (Madrid, Spain) slaughterhouse for providing the biological materials used in this study.

References

  • Adelson DL, Raison JM & Edgar RC 2009 Characterization and distribution of retrotransposons and simple sequence repeats in the bovine genome. PNAS 106 1285512860. (doi:10.1073/pnas.0901282106)

    • Search Google Scholar
    • Export Citation
  • Aviles M, Gutierrez-Adan A & Coy P 2010 Oviductal secretions: will they be key factors for the future ARTs? Molecular Human Reproduction 16 896906. (doi:10.1093/molehr/gaq056)

    • Search Google Scholar
    • Export Citation
  • Barrera D, Garcia EV, Sinowatz F, Palma GA, Jimenez-Diaz MA & Miceli DC 2013 Expression of DNA methyltransferase genes in four-cell bovine embryos cultured in the presence of oviductal fluid. Anatomia, Histologia, Embryologia 42 312315. (doi:10.1111/ahe.12010)

    • Search Google Scholar
    • Export Citation
  • Beaujean N 2014 Epigenetics, embryo quality and developmental potential. Reproduction Fertility and Development 27 5362. (doi:10.1071/RD14309)

    • Search Google Scholar
    • Export Citation
  • Bell CE, Calder MD & Watson AJ 2008 Genomic RNA profiling and the programme controlling preimplantation mammalian development. Molecular Human Reproduction 14 691701. (doi:10.1093/molehr/gan063)

    • Search Google Scholar
    • Export Citation
  • Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P & Gutierrez-Adan A 2008 Epigenetic differences between male and female bovine blastocysts produced in vitro. Physiological Genomics 32 264272. (doi:10.1152/physiolgenomics.00234.2007)

    • Search Google Scholar
    • Export Citation
  • Bogliotti Y & Ross P 2015 Molecular mechanisms of transcriptional and chromatin remodeling around embryonic genome activation. Animal Reproduction 12 5261.

    • Search Google Scholar
    • Export Citation
  • Brenet F, Moh M, Funk P, Feierstein E, Viale AJ, Socci ND & Scandura JM 2011 DNA methylation of the first exon is tightly linked to transcriptional silencing. PLoS ONE 6 e14524. (doi:10.1371/journal.pone.0014524)

    • Search Google Scholar
    • Export Citation
  • Buhi WC, Alvarez IM & Kouba AJ 2000 Secreted proteins of the oviduct. Cells Tissues Organs 166 165179. (doi:10.1159/000016731)

  • Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW & Shipley GL et al. 2009 The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55 611622. (doi:10.1373/clinchem.2008.112797)

    • Search Google Scholar
    • Export Citation
  • Canovas S, Ivanova E, Romar R, Garcia-Martinez S, Soriano-Ubeda C, Garcia-Vazquez FA, Saadeh H, Andrews S, Kelsey G & Coy P 2017 DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids. Elife 6 e23670. (doi:10.7554/elife.23670)

    • Search Google Scholar
    • Export Citation
  • Carrasco LC, Coy P, Aviles M, Gadea J & Romar R 2008 Glycosidase determination in bovine oviducal fluid at the follicular and luteal phases of the oestrous cycle. Reproduction Fertility and Development 20 808817. (doi:10.1071/RD08113)

    • Search Google Scholar
    • Export Citation
  • Corcoran D, Rizos D, Fair T, Evans AC & Lonergan P 2007 Temporal expression of transcripts related to embryo quality in bovine embryos cultured from the two-cell to blastocyst stage in vitro or in vivo. Molecular Reproduction and Development 74 972977. (doi:10.1002/mrd.20677)

    • Search Google Scholar
    • Export Citation
  • Coy P & Yanagimachi R 2015 The common and species-specific roles of oviductal proteins in mammalian fertilization and embryo development. BioScience 65 973984. (doi:10.1093/biosci/biv119)

    • Search Google Scholar
    • Export Citation
  • Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E & Reik W 2001 Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. PNAS 98 1373413738. (doi:10.1073/pnas.241522698)

    • Search Google Scholar
    • Export Citation
  • Deshmukh RS, Ostrup O, Ostrup E, Vejlsted M, Niemann H, Lucas-Hahn A, Petersen B, Li J, Callesen H & Hyttel P 2011 DNA methylation in porcine preimplantation embryos developed in vivo and produced by in vitro fertilization, parthenogenetic activation and somatic cell nuclear transfer. Epigenetics 6 177187. (doi:10.4161/epi.6.2.13519)

    • Search Google Scholar
    • Export Citation
  • Dobbs KB, Rodriguez M, Sudano MJ, Ortega MS & Hansen PJ 2013 Dynamics of DNA methylation during early development of the preimplantation bovine embryo. PLoS ONE 8 e66230. (doi:10.1371/journal.pone.0066230)

    • Search Google Scholar
    • Export Citation
  • Duranthon V, Watson AJ & Lonergan P 2008 Preimplantation embryo programming: transcription, epigenetics, and culture environment. Reproduction 135 141150. (doi:10.1530/REP-07-0324)

    • Search Google Scholar
    • Export Citation
  • Fazeli A & Holt WV 2016 Cross talk during the periconception period. Theriogenology 86 438442. (doi:10.1016/j.theriogenology.2016.04.059)

    • Search Google Scholar
    • Export Citation
  • Fernandez-Gonzalez R, Moreira P, Bilbao A, Jimenez A, Perez-Crespo M, Ramirez MA, Rodriguez De Fonseca F, Pintado B & Gutierrez-Adan A 2004 Long-term effect of in vitro culture of mouse embryos with serum on mRNA expression of imprinting genes, development, and behavior. PNAS 101 58805885. (doi:10.1073/pnas.0308560101)

    • Search Google Scholar
    • Export Citation
  • Gad A, Hoelker M, Besenfelder U, Havlicek V, Cinar U, Rings F, Held E, Dufort I, Sirard MA & Schellander K et al. 2012 Molecular mechanisms and pathways involved in bovine embryonic genome activation and their regulation by alternative in vivo and in vitro culture conditions. Biology of Reproduction 87 100. (doi:10.1093/biolreprod/87.s1.100)

    • Search Google Scholar
    • Export Citation
  • Gkountela S & Clark AT 2014 A big surprise in the little zygote: the curious business of losing methylated cytosines. Cell Stem Cell 15 393394. (doi:10.1016/j.stem.2014.09.005)

    • Search Google Scholar
    • Export Citation
  • Golding MC, Williamson GL, Stroud TK, Westhusin ME & Long CR 2011 Examination of DNA methyltransferase expression in cloned embryos reveals an essential role for Dnmt1 in bovine development. Molecular Reproduction and Development 78 306317. (doi:10.1002/mrd.21306)

    • Search Google Scholar
    • Export Citation
  • Graf A, Krebs S, Zakhartchenko V, Schwalb B, Blum H & Wolf E 2014 Fine mapping of genome activation in bovine embryos by RNA sequencing. PNAS 111 41394144. (doi:10.1073/pnas.1321569111)

    • Search Google Scholar
    • Export Citation
  • Guo F, Li X, Liang D, Li T, Zhu P, Guo H, Wu X, Wen L, Gu TP & Hu B et al. 2014 Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 15 447458. (doi:10.1016/j.stem.2014.08.003)

    • Search Google Scholar
    • Export Citation
  • Gustafsson CM, Falkenberg M & Larsson NG 2016 Maintenance and expression of mammalian mitochondrial DNA. Annual Review of Biochemistry 85 133160. (doi:10.1146/annurev-biochem-060815-014402)

    • Search Google Scholar
    • Export Citation
  • Hackett A, Durnford R, Mapletoft R & Marcus G 1993 Location and status of embryos in the genital tract of superovulated cows 4 to 6 days after insemination. Theriogenology 40 11471153. (doi:10.1016/0093-691X(93)90285-D)

    • Search Google Scholar
    • Export Citation
  • Haliburton GD, McKinsey GL & Pollard KS 2016 Disruptions in a cluster of computationally identified enhancers near FOXC1 and GMDS may influence brain development. Neurogenetics 17 19. (doi:10.1007/s10048-015-0458-9)

    • Search Google Scholar
    • Export Citation
  • Hellman A & Chess A 2007 Gene body-specific methylation on the active X chromosome. Science 315 11411143. (doi:10.1126/science.1136352)

    • Search Google Scholar
    • Export Citation
  • Jones PA 2012 Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nature Reviews Genetics 13 484492. (doi:10.1038/nrg3230)

    • Search Google Scholar
    • Export Citation
  • Killian GJ 2004 Evidence for the role of oviduct secretions in sperm function, fertilization and embryo development. Animal Reproduction Science 82–83 141153. (doi:10.1016/j.anireprosci.2004.04.028)

    • Search Google Scholar
    • Export Citation
  • Kodithuwakku SP, Ng PY, Liu Y, Ng EH, Yeung WS, Ho PC & Lee KF 2011 Hormonal regulation of endometrial olfactomedin expression and its suppressive effect on spheroid attachment onto endometrial epithelial cells. Human Reproduction 26 167175. (doi:10.1093/humrep/deq298)

    • Search Google Scholar
    • Export Citation
  • Lee KF & Yeung WS 2006 Gamete/embryo – oviduct interactions: implications on in vitro culture. Human Fertility 9 137143. (doi:10.1080/14647270600636467)

    • Search Google Scholar
    • Export Citation
  • Li W, Van Soom A & Peelman L 2017 Repeats as global DNA methylation marker in bovine preimplantation embryos. Czech Journal of Animal Science 62 4350. (doi:10.17221/29/2016-CJAS)

    • Search Google Scholar
    • Export Citation
  • Liang G, Chan MF, Tomigahara Y, Tsai YC, Gonzales FA, Li E, Laird PW & Jones PA 2002 Cooperativity between DNA methyltransferases in the maintenance methylation of repetitive elements. Molecular and Cellular Biology 22 480491. (doi:10.1128/MCB.22.2.480-491.2002)

    • Search Google Scholar
    • Export Citation
  • Lopera-Vasquez R, Hamdi M, Maillo V, Lloreda V, Coy P, Gutierrez-Adan A, Bermejo-Alvarez P & Rizos D 2015 Effect of bovine oviductal fluid on development and quality of bovine embryos produced in vitro. Reproduction Fertility and Development 29 621. (doi:10.1071/RD15238)

    • Search Google Scholar
    • Export Citation
  • Maillo V, Gaora PO, Forde N, Besenfelder U, Havlicek V, Burns GW, Spencer TE, Gutierrez-Adan A, Lonergan P & Rizos D 2015 Oviduct-embryo interactions in cattle: two-way traffic or a one-way street? Biology of Reproduction 92 144. (doi:10.1095/biolreprod.115.127969)

    • Search Google Scholar
    • Export Citation
  • Maunakea AK, Chepelev I, Cui K & Zhao K 2013 Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition. Cell Research 23 12561269. (doi:10.1038/cr.2013.110)

    • Search Google Scholar
    • Export Citation
  • Messerschmidt DM, Knowles BB & Solter D 2014 DNA methylation dynamics during epigenetic reprogramming in the germline and preimplantation embryos. Genes and Development 28 812828. (doi:10.1101/gad.234294.113)

    • Search Google Scholar
    • Export Citation
  • Morales CR, Marat AL, Ni X, Yu Y, Oko R, Smith BT & Argraves WS 2008 ATP-binding cassette transporters ABCA1, ABCA7, and ABCG1 in mouse spermatozoa. Biochemical and Biophysical Research Communications 376 472477. (doi:10.1016/j.bbrc.2008.09.009)

    • Search Google Scholar
    • Export Citation
  • Niemann H, Carnwath JW, Herrmann D, Wieczorek G, Lemme E, Lucas-Hahn A & Olek S 2010 DNA methylation patterns reflect epigenetic reprogramming in bovine embryos. Cellular Reprogramming 12 3342. (doi:10.1089/cell.2009.0063)

    • Search Google Scholar
    • Export Citation
  • O’Doherty AM, O’Gorman A, al Naib A, Brennan L, Daly E, Duffy P & Fair T 2014 Negative energy balance affects imprint stability in oocytes recovered from postpartum dairy cows. Genomics 104 177185. (doi:10.1016/j.ygeno.2014.07.006)

    • Search Google Scholar
    • Export Citation
  • Okano M, Bell DW, Haber DA & Li E 1999 DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99 247257. (doi:10.1016/S0092-8674(00)81656-6)

    • Search Google Scholar
    • Export Citation
  • Rizos D, Lonergan P, Boland MP, Arroyo-Garcia R, Pintado B, de la Fuente J & Gutierrez-Adan A 2002 Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: implications for blastocyst quality. Biology of Reproduction 66 589595. (doi:10.1095/biolreprod66.3.589)

    • Search Google Scholar
    • Export Citation
  • Rizos D, Gutierrez-Adan A, Perez-Garnelo S, De La Fuente J, Boland MP & Lonergan P 2003 Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biology of Reproduction 68 236243. (doi:10.1095/biolreprod.102.007799)

    • Search Google Scholar
    • Export Citation
  • Salilew-Wondim D, Fournier E, Hoelker M, Saeed-Zidane M, Tholen E, Looft C, Neuhoff C, Besenfelder U, Havlicek V & Rings F. et al. 2015 Genome-wide DNA methylation patterns of bovine blastocysts developed in vivo from embryos completed different stages of development in vitro. PLoS ONE 10 e0140467. (doi:10.1371/journal.pone.0140467)

    • Search Google Scholar
    • Export Citation
  • Seytanoglu A, Georgiou AS, Sostaric E, Watson PF, Holt WV & Fazeli A 2008 Oviductal cell proteome alterations during the reproductive cycle in pigs. Journal of Proteome Research 7 28252833. (doi:10.1021/pr8000095)

    • Search Google Scholar
    • Export Citation
  • Smith ZD, Chan MM, Mikkelsen TS, Gu H, Gnirke A, Regev A & Meissner A 2012 A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature 484 339344. (doi:10.1038/nature10960)

    • Search Google Scholar
    • Export Citation
  • Thurston A, Lucas ES, Allegrucci C, Steele W & Young LE 2007 Region-specific DNA methylation in the preimplantation embryo as a target for genomic plasticity. Theriogenology 68 (Supplement 1) S98S106. (doi:10.1016/j.theriogenology.2007.03.020)

    • Search Google Scholar
    • Export Citation
  • Wright K, Brown L, Brown G, Casson P & Brown S 2011 Microarray assessment of methylation in individual mouse blastocyst stage embryos shows that in vitro culture may have widespread genomic effects. Human Reproduction 26 25762585. (doi:10.1093/humrep/der201)

    • Search Google Scholar
    • Export Citation
  • Yang AS, Estecio MR, Doshi K, Kondo Y, Tajara EH & Issa JP 2004 A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA elements. Nucleic Acids Research 32 e38. (doi:10.1093/nar/gnh032)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    Diagram of the experimental design. Bovine embryos were subjected to in vitro culture under four experimental groups: (1) Group BSA = synthetic oviductal fluid (SOF) + 3 mg/mL bovine serum albumin (BSA); (2) Group OF1–16 = SOF + 1.25% (v/v) oviductal fluid (OF) added to culture from the 1-cell stage to 16-cell stage; (3) Group OF1–8 = SOF + 1.25% (v/v) OF added to culture from the 1-cell stage to 8-cell stage; and (4) Group OF8–16 = SOF + 1.25% (v/v) OF added to culture from the 8-cell stage to 16-cell stage. Expanding blastocysts derived from embryos developing in a timely manner were collected at Day 7–8 post-insemination (pi) for DNA methylation analysis.

  • View in gallery
    Figure 2

    Development rates of bovine embryos cultured in the presence or absence of bovine oviductal fluid (OF) at different time periods during in vitro development. (A) Cleavage rate at 52 h post-insemination (hpi). (B) Percentage of cleaved embryos reaching the 8-cell stage or beyond (‘normal development’) at 52 hpi. (C) Percentage of embryos reaching the 16-cell stage or beyond at 98 hpi derived from embryos showing ‘normal development’ at 52 hpi. (D) Blastocyst rate on Day 7–8 (in vitro fertilization = Day 0) derived from the ‘normally developed’ (normal dev.), ‘late 98 hpi’ and ‘late 52 hpi’ groups. Results are expressed as mean ± s.e.m. Different superscripts in each column indicate significant differences based on ANOVA (P < 0.05). BSA: embryos cultured in SOF + BSA; OF1–16: embryos cultured in SOF + OF from the 1-cell stage to 16-cell stage; OF1–8: embryos cultured in SOF + OF from the 1-cell stage to 8-cell stage; OF8–16: embryos cultured in SOF + OF from the 8-cell stage to 16-cell stage.

  • View in gallery
    Figure 3

    DNA methylation changes produced in genomic regions in blastocysts derived from embryos cultured in the presence or absence of bovine oviductal fluid as determined by bisulfite sequencing. (A) DNA methylation pattern around the first exon of MTERF2. (B) DNA methylation changes around intron 14 and its adjacent exons in ABCA7. (C) DNA methylation changes in the last exon of OLFM1. (D) DNA methylation profile in a region within intron 6 in GMDS. Exons are represented by a vertical rectangle, and the location of the region analyzed is indicated by a shaded horizontal rectangle. The black arrow indicates the transcription start site (TSS). Each row represents the average methylation level of the clones sequenced for each experimental group. Changes in methylation of each CpG site are indicated by shaded circles and shading indicates average percentage of DNA methylation. Black color denotes the presence of methylation, whereas white color indicates lack of methylation. Average methylation percentage for each experimental group is given on the right. Numbers across the top indicate specific positions of CpG dinucleotides in the genomic region. Different superscripts indicate significant differences between treatments based on the statistical z-test (P < 0.05).

  • View in gallery
    Figure 4

    DNA methylation profiles in regions within LINE-1 repetitive elements in blastocysts derived from embryos cultured with or without bovine oviductal fluid as determined by bisulfite sequencing. (A) DNA methylation changes in the A region of LINE-1 repeated sequences. (B) DNA methylation pattern in the B region of LINE-1 repeated sequences. Each row represents the average methylation level of the clones analyzed for each experimental group. Changes in methylation of each CpG site are indicated by shaded circles and shading indicates the average percentage of DNA methylation. Black color denotes the presence of methylation, while white indicates lack of methylation. Average methylation percentage for each experimental group is given on the right. Significant differences based on the statistical z-test (P < 0.05) are indicated with different letters.

  • View in gallery
    Figure 5

    Relative mRNA abundance of selected genes and LINE-1 in blastocysts developed from embryos cultured with or without bovine oviductal fluid at different time points of the early embryogenesis. Bars represent the relative abundance of MTERF2, ABCA7, OLFM1, GMDS and LINE-1 transcripts in blastocyst stage embryos normalized to the H2AFZ housekeeping gene. The BSA group is represented by white columns and oviductal fluid (OF)-treated embryos are represented with gray (group OF1–16), black (group OF1–8) and hatched group (OF8–16) columns. Results are expressed as mean ± s.e.m. Different superscripts indicate significant differences (P < 0.05) between treatments. Data are obtained from three replicates of independent groups of 10 expanding blastocysts (Day 7–8).

  • Adelson DL, Raison JM & Edgar RC 2009 Characterization and distribution of retrotransposons and simple sequence repeats in the bovine genome. PNAS 106 1285512860. (doi:10.1073/pnas.0901282106)

    • Search Google Scholar
    • Export Citation
  • Aviles M, Gutierrez-Adan A & Coy P 2010 Oviductal secretions: will they be key factors for the future ARTs? Molecular Human Reproduction 16 896906. (doi:10.1093/molehr/gaq056)

    • Search Google Scholar
    • Export Citation
  • Barrera D, Garcia EV, Sinowatz F, Palma GA, Jimenez-Diaz MA & Miceli DC 2013 Expression of DNA methyltransferase genes in four-cell bovine embryos cultured in the presence of oviductal fluid. Anatomia, Histologia, Embryologia 42 312315. (doi:10.1111/ahe.12010)

    • Search Google Scholar
    • Export Citation
  • Beaujean N 2014 Epigenetics, embryo quality and developmental potential. Reproduction Fertility and Development 27 5362. (doi:10.1071/RD14309)

    • Search Google Scholar
    • Export Citation
  • Bell CE, Calder MD & Watson AJ 2008 Genomic RNA profiling and the programme controlling preimplantation mammalian development. Molecular Human Reproduction 14 691701. (doi:10.1093/molehr/gan063)

    • Search Google Scholar
    • Export Citation
  • Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P & Gutierrez-Adan A 2008 Epigenetic differences between male and female bovine blastocysts produced in vitro. Physiological Genomics 32 264272. (doi:10.1152/physiolgenomics.00234.2007)

    • Search Google Scholar
    • Export Citation
  • Bogliotti Y & Ross P 2015 Molecular mechanisms of transcriptional and chromatin remodeling around embryonic genome activation. Animal Reproduction 12 5261.

    • Search Google Scholar
    • Export Citation
  • Brenet F, Moh M, Funk P, Feierstein E, Viale AJ, Socci ND & Scandura JM 2011 DNA methylation of the first exon is tightly linked to transcriptional silencing. PLoS ONE 6 e14524. (doi:10.1371/journal.pone.0014524)

    • Search Google Scholar
    • Export Citation
  • Buhi WC, Alvarez IM & Kouba AJ 2000 Secreted proteins of the oviduct. Cells Tissues Organs 166 165179. (doi:10.1159/000016731)

  • Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW & Shipley GL et al. 2009 The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55 611622. (doi:10.1373/clinchem.2008.112797)

    • Search Google Scholar
    • Export Citation
  • Canovas S, Ivanova E, Romar R, Garcia-Martinez S, Soriano-Ubeda C, Garcia-Vazquez FA, Saadeh H, Andrews S, Kelsey G & Coy P 2017 DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids. Elife 6 e23670. (doi:10.7554/elife.23670)

    • Search Google Scholar
    • Export Citation
  • Carrasco LC, Coy P, Aviles M, Gadea J & Romar R 2008 Glycosidase determination in bovine oviducal fluid at the follicular and luteal phases of the oestrous cycle. Reproduction Fertility and Development 20 808817. (doi:10.1071/RD08113)

    • Search Google Scholar
    • Export Citation
  • Corcoran D, Rizos D, Fair T, Evans AC & Lonergan P 2007 Temporal expression of transcripts related to embryo quality in bovine embryos cultured from the two-cell to blastocyst stage in vitro or in vivo. Molecular Reproduction and Development 74 972977. (doi:10.1002/mrd.20677)

    • Search Google Scholar
    • Export Citation
  • Coy P & Yanagimachi R 2015 The common and species-specific roles of oviductal proteins in mammalian fertilization and embryo development. BioScience 65 973984. (doi:10.1093/biosci/biv119)

    • Search Google Scholar
    • Export Citation
  • Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E & Reik W 2001 Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. PNAS 98 1373413738. (doi:10.1073/pnas.241522698)

    • Search Google Scholar
    • Export Citation
  • Deshmukh RS, Ostrup O, Ostrup E, Vejlsted M, Niemann H, Lucas-Hahn A, Petersen B, Li J, Callesen H & Hyttel P 2011 DNA methylation in porcine preimplantation embryos developed in vivo and produced by in vitro fertilization, parthenogenetic activation and somatic cell nuclear transfer. Epigenetics 6 177187. (doi:10.4161/epi.6.2.13519)

    • Search Google Scholar
    • Export Citation
  • Dobbs KB, Rodriguez M, Sudano MJ, Ortega MS & Hansen PJ 2013 Dynamics of DNA methylation during early development of the preimplantation bovine embryo. PLoS ONE 8 e66230. (doi:10.1371/journal.pone.0066230)

    • Search Google Scholar
    • Export Citation
  • Duranthon V, Watson AJ & Lonergan P 2008 Preimplantation embryo programming: transcription, epigenetics, and culture environment. Reproduction 135 141150. (doi:10.1530/REP-07-0324)

    • Search Google Scholar
    • Export Citation
  • Fazeli A & Holt WV 2016 Cross talk during the periconception period. Theriogenology 86 438442. (doi:10.1016/j.theriogenology.2016.04.059)

    • Search Google Scholar
    • Export Citation
  • Fernandez-Gonzalez R, Moreira P, Bilbao A, Jimenez A, Perez-Crespo M, Ramirez MA, Rodriguez De Fonseca F, Pintado B & Gutierrez-Adan A 2004 Long-term effect of in vitro culture of mouse embryos with serum on mRNA expression of imprinting genes, development, and behavior. PNAS 101 58805885. (doi:10.1073/pnas.0308560101)

    • Search Google Scholar
    • Export Citation
  • Gad A, Hoelker M, Besenfelder U, Havlicek V, Cinar U, Rings F, Held E, Dufort I, Sirard MA & Schellander K et al. 2012 Molecular mechanisms and pathways involved in bovine embryonic genome activation and their regulation by alternative in vivo and in vitro culture conditions. Biology of Reproduction 87 100. (doi:10.1093/biolreprod/87.s1.100)

    • Search Google Scholar
    • Export Citation
  • Gkountela S & Clark AT 2014 A big surprise in the little zygote: the curious business of losing methylated cytosines. Cell Stem Cell 15 393394. (doi:10.1016/j.stem.2014.09.005)

    • Search Google Scholar
    • Export Citation
  • Golding MC, Williamson GL, Stroud TK, Westhusin ME & Long CR 2011 Examination of DNA methyltransferase expression in cloned embryos reveals an essential role for Dnmt1 in bovine development. Molecular Reproduction and Development 78 306317. (doi:10.1002/mrd.21306)

    • Search Google Scholar
    • Export Citation
  • Graf A, Krebs S, Zakhartchenko V, Schwalb B, Blum H & Wolf E 2014 Fine mapping of genome activation in bovine embryos by RNA sequencing. PNAS 111 41394144. (doi:10.1073/pnas.1321569111)

    • Search Google Scholar
    • Export Citation
  • Guo F, Li X, Liang D, Li T, Zhu P, Guo H, Wu X, Wen L, Gu TP & Hu B et al. 2014 Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 15 447458. (doi:10.1016/j.stem.2014.08.003)

    • Search Google Scholar
    • Export Citation
  • Gustafsson CM, Falkenberg M & Larsson NG 2016 Maintenance and expression of mammalian mitochondrial DNA. Annual Review of Biochemistry 85 133160. (doi:10.1146/annurev-biochem-060815-014402)

    • Search Google Scholar
    • Export Citation
  • Hackett A, Durnford R, Mapletoft R & Marcus G 1993 Location and status of embryos in the genital tract of superovulated cows 4 to 6 days after insemination. Theriogenology 40 11471153. (doi:10.1016/0093-691X(93)90285-D)

    • Search Google Scholar
    • Export Citation
  • Haliburton GD, McKinsey GL & Pollard KS 2016 Disruptions in a cluster of computationally identified enhancers near FOXC1 and GMDS may influence brain development. Neurogenetics 17 19. (doi:10.1007/s10048-015-0458-9)

    • Search Google Scholar
    • Export Citation
  • Hellman A & Chess A 2007 Gene body-specific methylation on the active X chromosome. Science 315 11411143. (doi:10.1126/science.1136352)

    • Search Google Scholar
    • Export Citation
  • Jones PA 2012 Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nature Reviews Genetics 13 484492. (doi:10.1038/nrg3230)

    • Search Google Scholar
    • Export Citation
  • Killian GJ 2004 Evidence for the role of oviduct secretions in sperm function, fertilization and embryo development. Animal Reproduction Science 82–83 141153. (doi:10.1016/j.anireprosci.2004.04.028)

    • Search Google Scholar
    • Export Citation
  • Kodithuwakku SP, Ng PY, Liu Y, Ng EH, Yeung WS, Ho PC & Lee KF 2011 Hormonal regulation of endometrial olfactomedin expression and its suppressive effect on spheroid attachment onto endometrial epithelial cells. Human Reproduction 26 167175. (doi:10.1093/humrep/deq298)

    • Search Google Scholar
    • Export Citation
  • Lee KF & Yeung WS 2006 Gamete/embryo – oviduct interactions: implications on in vitro culture. Human Fertility 9 137143. (doi:10.1080/14647270600636467)

    • Search Google Scholar
    • Export Citation
  • Li W, Van Soom A & Peelman L 2017 Repeats as global DNA methylation marker in bovine preimplantation embryos. Czech Journal of Animal Science 62 4350. (doi:10.17221/29/2016-CJAS)

    • Search Google Scholar
    • Export Citation
  • Liang G, Chan MF, Tomigahara Y, Tsai YC, Gonzales FA, Li E, Laird PW & Jones PA 2002 Cooperativity between DNA methyltransferases in the maintenance methylation of repetitive elements. Molecular and Cellular Biology 22 480491. (doi:10.1128/MCB.22.2.480-491.2002)

    • Search Google Scholar
    • Export Citation
  • Lopera-Vasquez R, Hamdi M, Maillo V, Lloreda V, Coy P, Gutierrez-Adan A, Bermejo-Alvarez P & Rizos D 2015 Effect of bovine oviductal fluid on development and quality of bovine embryos produced in vitro. Reproduction Fertility and Development 29 621. (doi:10.1071/RD15238)

    • Search Google Scholar
    • Export Citation
  • Maillo V, Gaora PO, Forde N, Besenfelder U, Havlicek V, Burns GW, Spencer TE, Gutierrez-Adan A, Lonergan P & Rizos D 2015 Oviduct-embryo interactions in cattle: two-way traffic or a one-way street? Biology of Reproduction 92 144. (doi:10.1095/biolreprod.115.127969)

    • Search Google Scholar
    • Export Citation
  • Maunakea AK, Chepelev I, Cui K & Zhao K 2013 Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition. Cell Research 23 12561269. (doi:10.1038/cr.2013.110)

    • Search Google Scholar
    • Export Citation
  • Messerschmidt DM, Knowles BB & Solter D 2014 DNA methylation dynamics during epigenetic reprogramming in the germline and preimplantation embryos. Genes and Development 28 812828. (doi:10.1101/gad.234294.113)

    • Search Google Scholar
    • Export Citation
  • Morales CR, Marat AL, Ni X, Yu Y, Oko R, Smith BT & Argraves WS 2008 ATP-binding cassette transporters ABCA1, ABCA7, and ABCG1 in mouse spermatozoa. Biochemical and Biophysical Research Communications 376 472477. (doi:10.1016/j.bbrc.2008.09.009)

    • Search Google Scholar
    • Export Citation
  • Niemann H, Carnwath JW, Herrmann D, Wieczorek G, Lemme E, Lucas-Hahn A & Olek S 2010 DNA methylation patterns reflect epigenetic reprogramming in bovine embryos. Cellular Reprogramming 12 3342. (doi:10.1089/cell.2009.0063)

    • Search Google Scholar
    • Export Citation
  • O’Doherty AM, O’Gorman A, al Naib A, Brennan L, Daly E, Duffy P & Fair T 2014 Negative energy balance affects imprint stability in oocytes recovered from postpartum dairy cows. Genomics 104 177185. (doi:10.1016/j.ygeno.2014.07.006)

    • Search Google Scholar
    • Export Citation
  • Okano M, Bell DW, Haber DA & Li E 1999 DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99 247257. (doi:10.1016/S0092-8674(00)81656-6)

    • Search Google Scholar
    • Export Citation
  • Rizos D, Lonergan P, Boland MP, Arroyo-Garcia R, Pintado B, de la Fuente J & Gutierrez-Adan A 2002 Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: implications for blastocyst quality. Biology of Reproduction 66 589595. (doi:10.1095/biolreprod66.3.589)

    • Search Google Scholar
    • Export Citation
  • Rizos D, Gutierrez-Adan A, Perez-Garnelo S, De La Fuente J, Boland MP & Lonergan P 2003 Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biology of Reproduction 68 236243. (doi:10.1095/biolreprod.102.007799)

    • Search Google Scholar
    • Export Citation
  • Salilew-Wondim D, Fournier E, Hoelker M, Saeed-Zidane M, Tholen E, Looft C, Neuhoff C, Besenfelder U, Havlicek V & Rings F. et al. 2015 Genome-wide DNA methylation patterns of bovine blastocysts developed in vivo from embryos completed different stages of development in vitro. PLoS ONE 10 e0140467. (doi:10.1371/journal.pone.0140467)

    • Search Google Scholar
    • Export Citation
  • Seytanoglu A, Georgiou AS, Sostaric E, Watson PF, Holt WV & Fazeli A 2008 Oviductal cell proteome alterations during the reproductive cycle in pigs. Journal of Proteome Research 7 28252833. (doi:10.1021/pr8000095)

    • Search Google Scholar
    • Export Citation
  • Smith ZD, Chan MM, Mikkelsen TS, Gu H, Gnirke A, Regev A & Meissner A 2012 A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature 484 339344. (doi:10.1038/nature10960)

    • Search Google Scholar
    • Export Citation
  • Thurston A, Lucas ES, Allegrucci C, Steele W & Young LE 2007 Region-specific DNA methylation in the preimplantation embryo as a target for genomic plasticity. Theriogenology 68 (Supplement 1) S98S106. (doi:10.1016/j.theriogenology.2007.03.020)

    • Search Google Scholar
    • Export Citation
  • Wright K, Brown L, Brown G, Casson P & Brown S 2011 Microarray assessment of methylation in individual mouse blastocyst stage embryos shows that in vitro culture may have widespread genomic effects. Human Reproduction 26 25762585. (doi:10.1093/humrep/der201)

    • Search Google Scholar
    • Export Citation
  • Yang AS, Estecio MR, Doshi K, Kondo Y, Tajara EH & Issa JP 2004 A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA elements. Nucleic Acids Research 32 e38. (doi:10.1093/nar/gnh032)

    • Search Google Scholar
    • Export Citation