Abstract
MicroRNAs (miRNAs) are 18–24 nucleotides non-coding RNAs that regulate gene expression by post-transcriptional suppression of mRNA. The Chinese giant salamander (CGS, Andrias davidianus), which is an endangered species, has become one of the important models of animal evolution; however, no miRNA studies on this species have been conducted. In this study, two small RNA libraries of CGS ovary and testis were constructed using deep sequencing technology. A bioinformatics pipeline was developed to distinguish miRNA sequences from other classes of small RNAs represented in the sequencing data. We found that many miRNAs and other small RNAs such as piRNA and tsRNA were abundant in CGS tissue. A total of 757 and 756 unique miRNAs were annotated as miRNA candidates in the ovary and testis respectively. We identified 145 miRNAs in CGS ovary and 155 miRNAs in CGS testis that were homologous to those in Xenopus laevis ovary and testis respectively. Forty-five miRNAs were more highly expressed in ovary than in testis and 21 miRNAs were more highly expressed in testis than in ovary. The expression profiles of the selected miRNAs (miR-451, miR-10c, miR-101, miR-202, miR-7a and miR-499) had their own different roles in other eight tissues and different development stages of testis and ovary, suggesting that these miRNAs play vital regulatory roles in sexual differentiation, gametogenesis and development in CGS. To our knowledge, this is the first study to reveal miRNA profiles that are related to male and female CGS gonads and provide insights into sex differences in miRNA expression in CGS.
Introduction
Amphibians are an important evolutionary bridge between aquatic and terrestrial vertebrates (Vogel et al. 1999). The Chinese giant salamander (CGS, Andrias davidianus) is the largest extant amphibian in the world (Zhou et al. 2013) and belongs to the Cryptobranchidae family, which only contains three species (Cryptobranchus alleganiensis in North America, Andrias japonicus in Japan and Andrias davidianus in China). It is known as a ‘living fossil’ because it has existed for more than 350 million years (Gao & Shubin 2003). It was listed in the China Red Data Book as an endangered species in 1986 and has been included on the International Union for Conservation of Nature and Natural Resources Red List of Threatened Species since 2004 (Hu et al. 2016). The phylogenetic position of the CGS makes it as an invaluable model organism, and it has received a great deal of attentions in studies on evolution, comparative biology and other studies (Fan et al. 2015). However, due to the deterioration of its habitat, over-harvesting, environmental pollution, climate change and the increasing prevalence of infectious diseases (Dong et al. 2010, Du et al. 2016), the CGS population has declined sharply in last half-century (Wang et al. 2004, Che et al. 2014, Li et al. 2015a,b). At present, artificial breeding with mixed-sex cultures is used to increase the CGS population (Fan et al. 2015), but not wholly successfully. For example, the reproductive rate is low, and less than 15% of CGSs produce offspring every year (Shi 2011). Because of the difficulty in determining CGS sex at the immature stage, mixed-sex cultures have not satisfactorily increased the CGS population. The reproductive physiology and gonadal development of CGSs are currently unknown. However, recent advances have revealed that microRNAs (miRNAs) are essential for sexual differentiation, gonadal development, gametogenesis and reproductive performance (Grossman & Shalgi 2016, Kwekel et al. 2017).
The miRNAs belong to a group of endogenous small non-coding RNAs that are 18–24 nucleotides (nt) in length (Bartel et al. 2004, Dong et al. 2014), exist in all known animal species and have different spatiotemporal expression patterns (Li et al. 2010, Kadri et al. 2011, Ji et al. 2012). In animals, almost all miRNAs regulate their gene expression at the post-transcriptional level by binding to complementary target sites in the 3′ untranslated region of mRNA (He & Hannon 2004, Leung & Sharp 2010). Over one-third of protein-coding genes in humans are regulated by miRNAs, which open a new perspective on gene regulatory networks (Kim & Nam 2006). The miRNAs are involved in a variety of biological processes, such as development (Ambros et al. 2003, Chen et al. 2004), cell proliferation and death (Brennecke et al. 2003), cell differentiation, cell survival, cell-cycle control, apoptosis (Beilharz et al. 2009), immune responses (Pedersen et al. 2007, Li et al. 2008), as well as diseases (Poy et al. 2004); however, to our knowledge, there have been no reports of miRNAs in the CGS.
High-throughput sequencing of RNA (RNA-Seq) is an efficient way of mapping and quantifying transcriptomes and has been developed to analyze global gene expression in different tissues. In this study, Illumina sequencing technology was used to characterize miRNA expression profiles in the gonadal tissues of male and female CGSs. A miRNA database would not only significantly advance our knowledge of the miRNA population presented in CGSs but also improve our understanding of the roles that miRNAs play in biological processes, such as sexual differentiation, reproductive performance, and the annual cycle of gonadal development in the CGS. Furthermore, the identified miRNAs and differentially expressed miRNAs would be excavated for revealing their regulatory roles in the sexual differentiation and reproduction in this species.
Materials and methods
CGSs were obtained from artificial breeding farms in Chenggu County, Shaanxi Province, China in November. All of the experimental animals were the second generation individuals that were completely permitted for use in research by the Wildlife Conservation Bureau of Shaanxi Province, China. The experimental procedures used in this study were approved by the Faculty Animal Policy and Welfare Committee of Northwest A&F University. The CGSs were anesthetized with 0.6 mg/L tricaine methane sulfonate (MS-222) before being killed by severing the spinal cord with a needle. Tissues samples were collected immediately after death.
Sample collection and RNA extraction
Tissues samples from the heart, liver, spleen, lung, kidney, brain, muscle, pancreas, bladder, ovary and testis were collected at different developmental stages (1, 2, 3 and 4 years old) in November. Three female and three male CGSs were dissected to obtain tissue samples at each developmental stage. Some aliquots of tissue were fixed in Bouin’s buffer for sectioning, and others were immediately frozen in liquid nitrogen and stored at −80°C.
For Illumina sequencing, tissue RNA from 4-year-old CGSs was extracted, and RNA samples from three ovaries and three testes tissues were pooled prior to the construction of indexed libraries for Illumina sequencing (Beijing Biomarker Technologies, China).
Total RNA was extracted using the TRIzol reagent (TaKaRa) following the manufacturer’s protocol. The quantity and quality of the total RNA were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific) at 260/280 nm (ratio >2.0), and its integrity was tested using a 2100 Bioanalyzer and a RNA 6000 Nano LabChip Kit (Agilent) with an RNA integrity number greater than 8.0.
Histological analysis
Ovary and testis tissues from 1-, 2-, 3- and 4-year-old CGSs were fixed in Bouin’s buffer for 12 h, stored in 70% (v/v) ethanol and embedded in paraffin. The 7 μm thick sections were deparaffinized with xylene and rehydrated with an ethanol series from 100% (v/v) to 70% (v/v). The slides were washed for 5 min with phosphate-buffered saline (PBS) three times, followed by a hematoxylin wash for 30 s at room temperature. The slides were then washed and stained with 5% acid alcohol for 30 s. Subsequently, the slides were washed for 10 min in PBS to change the stain from purple to blue, before being stained with eosin for 30 s and dehydrated with an ethanol series from 70% (v/v) to 100% (v/v). Digital images were captured using a Nikon Eclipse 80i microscope camera (Nikon).
Small RNA sequence analysis
The original image data obtained by the Illumina sequencing analyzer were automatically transformed into raw reads using base calling. After removing adaptor sequences, low-quality reads, sequences smaller than 18 bp and reads with no insertion, clean reads were obtained and used for further analysis. The sequences were classified by comparing them with the following non-coding RNAs that are deposited in the US National Center for Biotechnology Information (NCBI) GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) and the Rfam database (http://rfam.xfam.org/): ribosomal RNA (rRNA), tRNA-derived small RNA (tRNA), small cytoplasmic RNA (scRNA), small nuclear RNA (snRNA) and small nucleolar RNA (snoRNA), using BLAST to annotate the small RNA sequences. We also compared small RNA expression levels between the ovary and testis.
Identification and expression analysis of miRNAs
Genomic and transcriptomic CGS characteristics are currently unknown; therefore, all the sequencing reads were aligned against miRNA sequences in miRBase (version 20.0) (http://www.mirbase.org/) by the homology comparison method (the default allows one or two base mismatches). The model amphibian Xenopus laevis, which has a close genetic relationship with the CGS and its transcriptomic data being available, was used as a reference to analyze CGS miRNA sequences and expression profiles. Homologous miRNAs were identified by comparing clean tags with mature miRNAs in miRBase. A differential expression analysis of miRNAs between the ovary and testis was conducted using miRDeep 2.0 (Wu et al. 2013). The significance level was set at |log2 (fold-change)| > 1, which ensured an accurate selection of differentially expressed miRNAs. All the sequence data were submitted to the NCBI Sequence Read Archive (https://submit.ncbi.nlm.nih.gov/subs/sra/) with accession no. SRP097571.
Real-time quantitative validation
Reverse transcription PCRs (RT-PCRs) of the separate RNA samples used for sequencing were performed. The stem-loop RT-PCR method was developed by Chen and coworkers (Chen et al. 2005) and has been used by other researchers (Sun et al. 2014). ReverTra Ace reverse transcriptase (TaKaRa) and miRNA-specific stem-loop RT primers were used to synthesize cDNA. The amplification program was as follows: incubation at 37°C for 15 min, 85°C for 5 s and then stored at 4°C. A SYBR Green Real-Time PCR Master Mix (TaKaRa) and a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad) were used to conduct real-time quantitative PCRs (qPCRs) according to the standard protocol. Each 20 μL qPCR system contained 10 μL SYBR Premix Ex Taq II (Tli RNaseH Plus) (2×), 1 μL cDNA (blank control using ddH2O rather than a cDNA template), 0.8 μL forward miRNA primer and 0.8 μL reverse miRNA primer. All the reactions were run in triplicate. The qPCR amplification program was as follows: pre-denaturation at 95°C for 2 min, followed by 35 cycles of 30 s at 95°C, 30 s at 60°C and 15 s at 72°C (Chen et al. 2015). Relative quantification was calculated using the 2−ΔΔCT formula (Sun et al. 2014), with U6 snRNA included as an internal control. The data were compared by Student t-test, using the SPSS (version 17.0) (SPSS), and the results are expressed as the mean ± 1 s.d. of duplicates values. P < 0.05 was considered statistically significant. All the primers for the RT-PCRs and qPCRs are presented in Table 1.
Stem-loop RT-PCR and qPCR primers of miRNAs of CGS.
| miRNA ID | RT primer (5′–3′) | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|---|
| ada-miR-451 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCAG | AACACGTGAAACCGTTACCATT | CAGTGCAGGGTCCGAGGT |
| ada-miR-10c | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAAT | ACGGAACCACCCTGTAGAATC | CAGTGCAGGGTCCGAGGT |
| ada-miR-7a | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACA | AACAAGCAAAGTGCTGTTCGT | CAGTGCAGGGTCCGAGGT |
| ada-miR-101 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTT | CACCGTGGTACAGTACTGTGA | CAGTGCAGGGTCCGAGGT |
| ada-miR-499 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAAACA | ACGGAACTTAAGACTTGCAGTG | CAGTGCAGGGTCCGAGGT |
| ada-miR-202 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAAGA | TCGCGCATTCCTATGCATATAC | CAGTGCAGGGTCCGAGGT |
| U6 | TTACATTGCTATCCACAGAACGG | CTATGCTGCTGCTTTTTGCTC |
Results
Gonadal development
Testis and ovary tissues at different developmental stages (1, 2, 3 and 4 years) were examined by hematoxylin and eosin staining (Fig. 1), which revealed that the male CGSs had not reached sexually maturity at 1, 2 and 3 years (Fig. 1A, B, C, A′, B′ and C′). At 4 years, the seminiferous tubules contained various types of germ cell including primary germ cells, primary spermatocytes, secondary spermatocytes and sperm (Fig. 1D and D′). Only primary oocytes and primordial follicles were observed in the ovaries of 1-, 2- and 3-year-old CGSs (Fig. 1E, F and G), whereas in 4-year-olds, in addition to the above, large antral follicles were present (Fig. 1H). Therefore, we chose the gonadal tissues of 4-year-old CGSs for sequencing.
The histology of testis and ovary tissues from different development stages (1, 2, 3 and 4 years) of CGSs by H&E staining. A, B, C, D, A′, B′, C′, D′ and E, F, G, H were represented testis and ovary tissues of 1, 2, 3 and 4 years old CGSs respectively. 1 Y: 1-year old; 2 Y: 2-year old; 3 Y: 3-year old; 4 Y: 4-year old. Sectors of green dots represented seminiferous tubules in A, B, C, D and A′, B′, C′, D′. Green arrows indicated sperm in D′. Green asterisk indicated primordial follicles in E, F, G and H and red asterisk displayed large antral follicles in H. Bar = 60 μm.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The histology of testis and ovary tissues from different development stages (1, 2, 3 and 4 years) of CGSs by H&E staining. A, B, C, D, A′, B′, C′, D′ and E, F, G, H were represented testis and ovary tissues of 1, 2, 3 and 4 years old CGSs respectively. 1 Y: 1-year old; 2 Y: 2-year old; 3 Y: 3-year old; 4 Y: 4-year old. Sectors of green dots represented seminiferous tubules in A, B, C, D and A′, B′, C′, D′. Green arrows indicated sperm in D′. Green asterisk indicated primordial follicles in E, F, G and H and red asterisk displayed large antral follicles in H. Bar = 60 μm.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The histology of testis and ovary tissues from different development stages (1, 2, 3 and 4 years) of CGSs by H&E staining. A, B, C, D, A′, B′, C′, D′ and E, F, G, H were represented testis and ovary tissues of 1, 2, 3 and 4 years old CGSs respectively. 1 Y: 1-year old; 2 Y: 2-year old; 3 Y: 3-year old; 4 Y: 4-year old. Sectors of green dots represented seminiferous tubules in A, B, C, D and A′, B′, C′, D′. Green arrows indicated sperm in D′. Green asterisk indicated primordial follicles in E, F, G and H and red asterisk displayed large antral follicles in H. Bar = 60 μm.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Overview of the sequencing data
In order to identify differentially expressed miRNAs between the ovary and testis, two small RNA libraries of 4-year-old CGSs were constructed. The Illumina sequencing of which provided a total dataset of 31,406,812 raw reads (15,464,561 and 15,942,251 reads from the ovary and testis libraries respectively). After removing low-quality sequences, simple sequences, contaminants that were formed by adapter–adapter ligation and sequences longer than 30 nt or shorter than 18 nt, 13,018,310 and 11,796,754 clean reads were ultimately obtained from the ovary and testis libraries respectively (Table 2). We compared the small RNA sequences with those in GenBank and the Rfam database to obtain the annotation information of other non-coding RNAs (Table 3). We found a large amount of rRNA, which is consistent with that reported by previous studies (Kadri et al. 2011). This was not surprising, because rRNA is the most abundant small RNA and regulates protein biosynthesis by binding ribosomes to a variety of proteins. After removing the rRNA and other non-coding RNA sequences, the two small RNA libraries were analyzed to find tissue-specific small RNAs. The percentages of the ovary-specific and testis-specific sequences were 41.33% and 36.54% of the total small RNAs in the two libraries respectively (Fig. 2A). Ovary-specific unique sequences accounted for 50.30% of all sequencing reads, and testis-specific unique sequences accounted for 46.94% of the sequencing reads (Fig. 2B).
Flow chart of miRNA sequencing. A and B represented the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues respectively. (C) and (D) displayed the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues by homology comparison respectively. (E) showed the proportion of common and specific miRNAs of CGS ovary and testis tissues when compared with Xenopus laevis.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Flow chart of miRNA sequencing. A and B represented the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues respectively. (C) and (D) displayed the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues by homology comparison respectively. (E) showed the proportion of common and specific miRNAs of CGS ovary and testis tissues when compared with Xenopus laevis.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Flow chart of miRNA sequencing. A and B represented the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues respectively. (C) and (D) displayed the percentage of the common and specific tags of total and unique sRNAs of ovary and testis tissues by homology comparison respectively. (E) showed the proportion of common and specific miRNAs of CGS ovary and testis tissues when compared with Xenopus laevis.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Summary of small RNA sequencing data in ovary and testis libraries of CGSs.
| Ovary | Testis | ||||
|---|---|---|---|---|---|
| Type | Count | Percent (%) | Count | Percent (%) | |
| Total_reads | 15,464,561 | 15,942,251 | |||
| High_quality | 15,464,561 | 100 | 15,942,251 | 100 | |
| N′ reads | 2801 | 0.02 | 2702 | 0.02 | |
| Length <18 | 1,109,456 | 7.17 | 3,384,346 | 21.23 | |
| Length >30 | 1,333,994 | 8.63 | 758,449 | 4.75 | |
| Clean reads | 13,018,310 | 84.18 | 11,796,754 | 74.00 | |
Distribution of the genome-mapped sequencing reads in ovary and testis small RNA libraries of CGSs.
| Ovary | Testis | ||||
|---|---|---|---|---|---|
| Type | Count | Percent (%) | Count | Percent (%) | |
| Total | 13,018,310 | 100 | 11,796,754 | 100 | |
| Genome | 2,181,677 | 16.77 | 2,420,409 | 20.51 | |
| rRNA | 1,612,098 | 12.38 | 1,560,497 | 13.23 | |
| scRNA | 2 | 0.00 | 1 | 0.00 | |
| snRNA | 3062 | 0.02 | 12,420 | 0.11 | |
| snoRNA | 4253 | 0.03 | 2309 | 0.02 | |
| tRNA | 110,280 | 0.85 | 113,054 | 0.96 | |
| Repbase | 12,252 | 0.09 | 18,984 | 0.16 | |
| Other | 9,094,686 | 69.86 | 7,669,080 | 65.01 | |
The miRNAs found by homology comparisons
Many miRNAs varied in sequence length and in the number of single-nucleotide polymorphisms (SNPs) they contained, possibly due to post-transcriptional RNA modifications. These miRNA variations are referred as miRNA isoforms (isomiRs) which vary in length and/or sequence (Morin et al. 2008, Neilsen et al. 2012). The total numbers of miRNA sequences (isomiRs or SNPs) found by homology comparisons in the ovary and testis were 18,182 and 16,719 respectively (Supplementary Tables 1 and 2, see section on supplementary data given at the end of this article). When all the identical sequence reads were classified as a group, 757 unique miRNAs were annotated as miRNA candidates in the ovary library and 756 unique miRNAs were annotated as miRNA candidates in the testis library (Supplementary Tables 3 and 4). The ovary-specific and testis-specific sequences accounted for 2.09% and 1.55% of the total miRNAs in the two libraries respectively (Fig. 2C). Ovary-specific unique miRNAs accounted for 19.95% of all the sequencing reads and testis-specific unique miRNAs accounted for 19.84% of all the sequencing reads (Fig. 2D).
We found that 145 (1.37%) and 155 (7.74%) miRNA sequences in the ovary and testis of CGSs respectively were homologous to those in the ovary and testis respectively, of Xenopus laevis (Fig. 2E and Supplementary Tables 5 and 6). Size distributions of the small RNAs (from 18 nt to 30 nt) were similar between the male and female libraries (Fig. 3). There were small peaks at 22 nt and 29–30 nt; however, most of the small RNAs were of different lengths. However, size distributions are only a rough and preliminary screening, and small RNAs should be mapped to the genome and known pre-miRNAs and their secondary structures predicted for identification and characterization. Variations in length are mainly caused by enzymatic modifications, such as RNA editing, 3′-editing or exonuclease activity (Li et al. 2010).
The size distribution of small RNAs of CGS by homology comparison.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The size distribution of small RNAs of CGS by homology comparison.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The size distribution of small RNAs of CGS by homology comparison.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Deep sequencing revealed that the individual miRNAs exhibited heterogeneous 5′ or 3′ ends or post-transcriptional end additions, deletions or substitutions, as exemplified by miR-200a-5p and miR-200a-3p, the predicted precursors, which had a typical hairpin structure (Fig. 4). Their isoforms had different sequence reads, which suggests that they exhibit differential expression in male and female gonads. The other predicted miRNA hairpin structures in the ovary and testis are shown in Supplementary Files 1 and 2.
The predicted hairpin structure of ada-miR-200a.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The predicted hairpin structure of ada-miR-200a.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The predicted hairpin structure of ada-miR-200a.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Differentially expressed miRNAs between the ovary and testis
The expression profiles of each miRNAs in the ovary and testis by using Xenopus laevis miRNA sequences as a reference are presented in Supplementary Table 7. A total of 120 miRNAs were differentially expressed between the ovary and testis, 45 of which were more highly expressed in ovary and 21 of which were more highly expressed in the testis (Supplementary Tables 8 and 9). For example, miR-451 and miR-10c were mainly expressed in the ovary, whereas miR-101, miR-202, miR-7a and miR-499 were mainly expressed in the testis. This suggests that these miRNAs may affect the development of gonadal tissue.
Validation of differentially expressed miRNAs
Six differentially expressed miRNAs between the ovary and testis libraries were selected: ada-miR-10c and ada-miR-451 from the ovary library and ada-miR-7a, ada-miR-499, ada-miR-101 and ada-miR-202 from the testis library. The primers for these miRNAs are shown in Table 1. The qPCR and deep sequencing results were similar for the selected miRNAs (Fig. 5) and indicated that they coexisted in the different tissues.
The expression profiles of miRNAs in different tissues of CGS were detected by qPCR. Note: the values with different letters (a, b, c, d, e, f and g) differ significantly at P < 0.05 or P < 0.01 level.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The expression profiles of miRNAs in different tissues of CGS were detected by qPCR. Note: the values with different letters (a, b, c, d, e, f and g) differ significantly at P < 0.05 or P < 0.01 level.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The expression profiles of miRNAs in different tissues of CGS were detected by qPCR. Note: the values with different letters (a, b, c, d, e, f and g) differ significantly at P < 0.05 or P < 0.01 level.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The miRNAs expression levels at different developmental stages (1, 2, 3 and 4 years) in the ovary and testis are presented in Fig. 6. The relative expression levels of the selected miRNAs differed between the testis and ovary. During development, the relative expression levels of miR-451, miR-202 and miR-499 in the testes gradually decreased, whereas no specific trends were observed in the ovary. The expression levels of miR-7a, miR-101, miR-202 and miR-499 in the testis were significantly higher than those in the ovary, whereas the miR-451 expression level was higher in the ovary, but only in the 4-year-old CGSs.
The expression profiles of miRNAs in CGSs different development stages of ovary and testis were detected by qPCR. 1, 2, 3 and 4 were represented 1-, 2-, 3- and 4-year-old CGSs respectively. T and O were represented testis and ovary of CGSs respectively. Asterisk * and ** indicate significant differences between the two groups at P < 0.05 and P < 0.01 respectively. NS means not significant.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The expression profiles of miRNAs in CGSs different development stages of ovary and testis were detected by qPCR. 1, 2, 3 and 4 were represented 1-, 2-, 3- and 4-year-old CGSs respectively. T and O were represented testis and ovary of CGSs respectively. Asterisk * and ** indicate significant differences between the two groups at P < 0.05 and P < 0.01 respectively. NS means not significant.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
The expression profiles of miRNAs in CGSs different development stages of ovary and testis were detected by qPCR. 1, 2, 3 and 4 were represented 1-, 2-, 3- and 4-year-old CGSs respectively. T and O were represented testis and ovary of CGSs respectively. Asterisk * and ** indicate significant differences between the two groups at P < 0.05 and P < 0.01 respectively. NS means not significant.
Citation: Reproduction 154, 3; 10.1530/REP-17-0109
Discussion
The CGS is an invaluable animal model for research in genetics, phylogenetics and evolution (Fan et al. 2015). However, environmental degradation, over-harvesting and other reasons have made the CGS rare. As a result, it is artificially farmed in mesocosms for research and conservation. However, because of the difficulty in determining the species’ sex at immature stage, mixed-sex cultures have not satisfactorily increased the CGS population. Recent advances have revealed that miRNAs are essential for sexual differentiation, gonadal development and reproductive performance (McEwen et al. 2016, Tyler et al. 2017); however, no studies have been conducted on the regulatory roles of miRNAs in CGSs. Here, we present CGS ovary and testis miRNAs profiles, which will increase our understanding of the mechanisms underlying sexual differentiation in this species and provide a preliminary theoretical basis for the further study of the CGS’s reproductive biology.
Lower values were obtained when using Xenopus laevis as a reference (1.37% and 7.74%) than when using the homology comparisons (19.95% and 19.84%), verifying the accuracy of the data analysis. That part of less (18.58% and 12.10%) possible matching other homologous species, such as frog, highlighting the difference between CGSs and Xenopus laevis, demonstrated the particularity of CGS. The size distributions of the sequences included two peaks (22 nt and 29–30 nt), which were probably miRNAs and piwi-interacting RNAs (piRNAs) respectively (Grossman & Shalgi 2016, Marie et al. 2016). The size distribution of the miRNAs peaked at 22 nt, which is the typical size of Dicer-derived products (Mi et al. 2014). Meanwhile, miRNAs (isomiRs and SNPs) were found by homology comparisons in the ovary and testis. MiRNA variations can be caused by post-transcriptional RNA modifications, such as shifts in Drosha and Dicer cleavage sites, exonuclease-mediated trimming, miRNA editing or 3′-end non-templated nucleotide additions (Morin et al. 2008, Neilsen et al. 2012). In addition to the homologous miRNA, isomiR expression could also have a post-transcriptional regulatory function in cells, tissues or at specific developmental stages (Fernandez-Valverde et al. 2010, Bizuayehu et al. 2012a,b).
A novel class of small RNAs (piRNAs) was found in 2006 that differed from miRNAs in size (26–32 nt long rather than 18–24 nt long), mostly in 29–30 nt (Lau et al. 2006, Rastetter et al. 2015) and could silence transposons and retroposons at the epigenetic and post-transcriptional levels, maintain the genomic stability and integrity of germ cells (Bao & Yan 2012) and regulate cell proliferation (Klattenhoff & Theurkauf 2008), and meiosis, particularly during spermatogenesis (Goh et al. 2015). Twenty-eight-nucleotide-long piRNAs are highly expressed in both the ovary and testis of zebrafish (Houwing et al. 2007, Kamminga et al. 2010). In Xenopus laevis and Oreochromis niloticus, piRNAs are abundant in both female and male gonads (Wilczynska et al. 2009, Xiao et al. 2014). The piRNAs are present in the gonads of lower vertebrates and are involved in the regulation of sexual differentiation, gonadal development and gametogenesis; therefore, potential piRNAs were also investigated in the present study. BLAST software was used to compare the CGS raw data with human, mouse and rat piRNA sequences (Sai et al. 2008), and sequences with a high similarity (≥96%) were selected for homology analysis. We found that 182, 114 and 113 piRNA-like sequences in the small CGS ovary library were homologous with piRNA sequences in the human, mouse and rat respectively (Supplementary Tables 10, 11 and 12). And 168, 129 and 120 piRNA-like sequences in the small CGS testis library were homologous with piRNA sequences in the human, mouse and rat respectively (Supplementary Tables 13, 14 and 15). These piRNA-like sequences require further investigation.
We observed only small peaks in size distribution of the small RNAs possibly because other types of non-coding small RNAs of different sizes increased the basic level of the size distribution. Recently, tRNA-derived small RNAs (tsRNAs) that are 14–32 nt in length have been discovered in various organisms (Haussecker et al. 2010, Peng et al. 2012, Kumar et al. 2014). The tsRNAs could maintain their stability by means of the nucleic acid sequence modification and are also sensitive to stress. The tsRNA and their RNA modifications could contain epigenetic information. In mice, sperm tsRNAs could contribute to the intergenerational inheritance of an acquired metabolic disorder (Chen et al. 2016). It would be reasonable to expect that tsRNAs exist in the gonads of the CGS and may play an important role in gonadal development in this species.
The qPCR and deep sequencing revealed similar trends for all of the miRNAs selected. At 4 years, ada-miR-10c and ada-miR-451 were more highly expressed in the ovary than the testis, whereas ada-miR-7a, ada-miR-499, ada-miR-101 and ada-miR-202 were more highly expressed in the testis. MiR-202 is abundant in mouse and Xenopus gonads (Ro et al. 2007, Armisen et al. 2009), and in the chicken, is more highly upregulated in the testis than the ovary (Bannister et al. 2009, 2011), as is the case in Atlantic halibut (Hippoglossus hippoglossus), which is a teleost vertebrate ItheIt (Bizuayehu et al. 2012a,b). In cattle, miR-202 is highly expressed in sperm and could improve embryonic development and nuclear reprogramming (Gao & Zhang 2016). Our results for CGSs agree with these findings. The results of these studies suggest that the gonadal expression of miR-202 is conserved among vertebrates and that miR-202 plays a crucial role in reproduction. Similar to our results, miR-451 has been reported to be highly expressed in female halibut (Bizuayehu et al. 2012a,b) and plays a vital role during bovine follicle development (Sontakke et al. 2014). The miRNA-451 and its target gene Ankrd46 are vital for embryo implantation (Li et al. 2015a,b). The differentially expressed miRNAs in CGS gonads are functionally conserved in other animals and may play crucial roles in gonadal development and reproductive physiology. These miRNAs were also found in eight other tissues (heart, liver, lung, kidney, brain, muscle, pancreas and bladder), demonstrating that they not only play a role in gonads, but also play regulatory roles in other organs, which should be investigated further. Little information is available concerning the CGS genome; therefore, it is difficult to predict its target genes. The role of the miRNA-451 target gene Ankrd46 in murine suggests that it may also play an important role in CGS development. Future studies should investigate the functions of these CGS miRNAs target genes.
The expression levels of miR-7a, miR-101, miR-202 and miR-499 in the testis were significantly higher than those in the ovary at all developmental stages, whereas the miR-451 expression level was higher in the ovary than that in the testis, but only at 4 years. The relative expression levels of miR-451, miR-202 and miR-499 in the testes gradually decreased, whereas in the ovary, there was no relationship between expression level and developmental stage. This may have been related to the histological analysis of the gonads at different developmental stages (Fig. 1). In CGSs, sexual differentiation is complete at 1 year (Yang et al. 1983). Subsequently, the testis and ovary are immature until 3 years of age. In 2- and 3-year-old CGSs, there are many developmentally arrested oocytes in the ovary (Huang 2009), and few male germ cells in the testis (Fig. 1). However, at 4 years of age, there are different types of germ cells in the testis and the ovary. There were no significant differences between 2- and 3-year-old CGSs in the ovary and testis expression levels of some miRNAs, such as miR-451 and miR-7a. This confirms that miRNAs play individual as well as synergistic roles in regulating the gonadal development and gametogenesis (Bizuayehu et al. 2012a,b, Gao & Zhang 2016).
Although tissue-specific miRNAs were not found in this study, the differentially expressed miRNAs identified could be used to distinguish male and female CGSs during development, which will improve CGS artificial breeding.
Conclusion
Many miRNAs and other small RNAs, such as piRNAs and tsRNA, were abundant in the ovary and testis of CGSs. We identified 145 miRNAs in the CGS ovary and 155 miRNAs in the CGS testis that were homologous to those in the Xenopus laevis ovary and testis respectively. Forty-five miRNAs were more highly expressed in the ovary than that in the testis, and 21 were more highly expressed in the testis. The selected miRNAs exhibited differential expression levels in the ovary and testis during different CGS developmental stages. These results increase our knowledge of CGS miRNAs, facilitate investigations into gonadal developmental regulation in CGSs, and provide a theoretical basis for the artificial breeding of CGSs.
Supplementary data
This is linked to the online version of the paper at http://dx.doi.org/10.1530/REP-17-0109.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.
Author contribution statement
Wu-zi Dong was the primary corresponding author and Chuan-ying Pan was the secondary corresponding author who designed the overall studies. Wu-zi Dong and Chang-ming Yang collected and prepared samples. Sheng-song Xie, Lin Ma and Wu-zi Dong performed bio-statistical analyses. Rui Chen and Li-qing Wang performed to observe the histomorphology. Rui Chen and Jian Du did the experimental verification. Rui Chen and Wu-zi Dong wrote the manuscript. Wu-zi Dong, Chuan-ying Pan and Xian-yong Lan edited the manuscript. All authors discussed the results and commented on the manuscript.
Acknowledgments
This work was supported by the Fund of the Agriculture Sci-Tech Project of Shaanxi Province (No. 2014K01-20-01) and the National Natural Science Foundation China (NSFC) (No. C170104-31172205). They thank Prof. Wen-xian Zeng and Xian-yong Lan at College of Animal Science and Technology, Northwest A&F University who commented on their manuscript.
References
Ambros V 2003 MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113 673–676. (doi:10.1016/S0092-8674(03)00562-2)
Armisen J, Gilchrist MJ, Wilczynska A, Standart N & Miska EA 2009 Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis. Genome Research 19 1766–1775. (doi:10.1101/gr.093054.109)
Bannister SC, Smith CA, Roeszler KN, Doran TJ, Sinclair AH & Tizard MLV 2011 Manipulation of estrogen synthesis alters mir202* expression in embryonic chicken gonads. Biology of Reproduction 85 22–30. (doi:10.1095/biolreprod.110.088476)
Bannister SC, Tizard MLV, Doran TJ, Sinclair AH & Smith CA 2009 Sexually dimorphic microRNA expression during chicken embryonic gonadal development. Biology of Reproduction 81 165–176. (doi:10.1095/biolreprod.108.074005)
Bao JQ & Yan W 2012 Male germline control of transposable elements. Biology of Reproduction 86 162.
Bartel DP 2004 MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 281–297.
Beilharz TH, Humphreys DT, Clancy JL, Thermann R, Martin DIK, Hentze MW & Preiss T 2009 MicroRNA-mediated messenger RNA deadenylation contributes to translational repression in mammalian cells. PLoS ONE 4 e6783. (doi:10.1371/journal.pone.0006783)
Bizuayehu TT, Babiak J, Norberg B, Fernandes JMO, Johansen SD & Babiak I 2012a Sex-biased miRNA expression in Atlantic halibut (Hippoglossus hippoglossus) brain and gonads. Sexual Development 6 257–266. (doi:10.1159/000341378)
Bizuayehu TT, Lanes CFC, Furmanek T, Karlsen BO, Fernandes JMO, Johansen SD & Babiak I 2012b Differential expression patterns of conserved miRNAs and isomiRs during Atlantic halibut development. BMC Genomics 13 11. (doi:10.1186/1471-2164-13-11)
Brennecke J, Hipfner DR, Stark A, Russell PB & Cohen SM 2003 Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113 25–36. (doi:10.1016/S0092-8674(03)00231-9)
Che RB, Sun YN, Wang RX & Xu TJ 2014 Transcriptomic analysis of endangered Chinese salamander: identification of immune, sex and reproduction-related genes and genetic markers. PLoS ONE 9 e87940. (doi:10.1371/journal.pone.0087940)
Chen CZ, Li L, Lodish HF & Bartel DP 2004 MicroRNAs modulate hematopoietic lineage differentiation. Science 303 83–86. (doi:10.1126/science.1091903)
Chen Q, Ma J, Fan YD, Meng Y, Xu J, Zhou Y, Liu WZ, Zeng XH & Zeng LB 2015 Identification of type I IFN in Chinese giant salamander (Andrias davidianus) and the response to an iridovirus infection. Molecular Immunology 65 350–359. (doi:10.1016/j.molimm.2015.02.015)
Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR & Andersen MR et al. 2005 Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Research 33 e179. (doi:10.1093/nar/gni178)
Chen Q, Yan MH, Cao ZH, Li X, Zhang YF, Shi JC, Feng GH, Peng HY, Zhang XD & Zhang Y et al. 2016 Sperm tsRNAs contribute to intergenerational inheritance of an acquired metabolic disorder. Science 351 397–400. (doi:10.1126/science.aad7977)
Dong WZ, Zhang XM, Yang CM & Zeng WX 2010 Iridovirus outbreak in Chinese giant salamanders. Emerging Infectious Diseases 17 2388–2389. (doi:10.3201/eid1712.101758)
Du J, Wang LQ, Wang YX, Shen JA, Pan CY, Meng Y, Yang CM, Ji H & Dong WZ 2016 Autophagy and apoptosis induced by Chinese giant salamander (Andrias davidianus) iridovirus (CGSIV). Veterinary Microbiology 195 87–95. (doi:10.1016/j.vetmic.2016.09.011)
Dong F, Zhang Y, Xia F, Yang Y, Xiong S, Jin L & Zhang J 2014 Genome-wide miRNA profiling of villus and decidua of recurrent spontaneous abortion patients. Reproduction 148 33–41. (doi:10.1530/REP-14-0095)
Fan YD, Chang MX, Ma J, LaPatra SE, Hu YW, Huang LL, Nie P & Zeng LB 2015 Transcriptomic analysis of the host response to an iridovirus infection in Chinese giant salamander, Andrias davidianus. Veterinary Research 46 136. (doi:10.1186/s13567-015-0279-8)
Fernandez-Valverde SL, Taft RJ & Mattick JS 2010 Dynamic isomiR regulation in Drosophila development. RNA 16 1881–1888. (doi:10.1261/rna.2379610)
Gao KQ & Shubin NH 2003 Earliest known crown-group salamanders. Nature 422 424–428. (doi:10.1038/nature01491)
Gao Y & Zhang Y 2016 A preliminary study of bovine sperm-borne miR-202 on early embryonic development. Thesis for Master’s Degree. Northwest A&F University.
Goh WSS, Falciatori I, Tam OH, Burgess R, Meikar O, Kotaja N, Hammell M & Hannon GJ 2015 PiRNA-directed cleavage of meiotic transcripts regulates spermatogenesis. Genes and Development 29 1032–1044. (doi:10.1101/gad.260455.115)
Grossman H & Shalgi R 2016 A role of microRNAs in cell differentiation during gonad development. Results and Problems in Cell Differentiation 58 309–336. (doi:10.1007/978-3-319-31973-5_12)
Haussecker D, Huang Y, Lau A, Parameswaran P, Fire AZ & Kay MA 2010 Human tRNA-derived small RNAs in the global regulation of RNA silencing. RNA 16 673–695. (doi:10.1261/rna.2000810)
He L & Hannon GJ 2004 MicroRNAs: small RNAs with a big role in gene regulation. Nature Reviews Genetics 5 522–531. (doi:10.1038/nrg1379)
Houwing S, Kamminga LM, Berezikov E, Cronembold D, Girard A, van den Elst H, Filippov DV, Blaser H, Raz E & Moens CB et al. 2007 A role for piwi and piRNAs in germ cell maintenance and transposon silencing in zebrafish. Cell 129 69–82. (doi:10.1016/j.cell.2007.03.026)
Hu QM, Xiao HB, Tian HF & Meng Y 2016 Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus. Comparative Biochemistry and Physiology B Biochemistry and Molecular Biology 192 21–29. (doi:10.1016/j.cbpb.2015.11.005)
Huang XY 2009 The process of embryonic development of giant salamander. Nature and Science 6 52–53. (in Chinese)
Ji ZB, Wang GZ, Xie ZJ, Zhang CL & Wang JM 2012 Identification and characterization of microRNA in the dairy goat (Capra hircus) mammary gland by Solexa deep sequencing technology. Molecular Biology Reports 39 9361–9371. (doi:10.1007/s11033-012-1779-5)
Kadri S, Hinman VF & Benos PV 2011 RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star. PLoS ONE 6 e29217. (doi:10.1371/journal.pone.0029217)
Kamminga LM, Luteijn MJ, den Broeder MJ, Redl S, Kaaij LJ, Roovers EF, Ladurner P, Berezikov E & Ketting RF 2010 Hen1 is required for oocyte development and piRNA stability in zebrafish. EMBO Journal 29 3688–3700. (doi:10.1038/emboj.2010.233)
Kim VN & Nam J 2006 Genomics of microRNA. Trends in Genetics 22 165–173. (doi:10.1016/j.tig.2006.01.003)
Klattenhoff C & Theurkauf W 2008 Biogenesis and germline functions of piRNAs. Development 135 3–9. (doi:10.1242/dev.006486)
Kumar P, Anaya J, Mudunuri SB & Dutta A 2014 Meta-analysis of tRNA derived RNA fragments reveals that they are evolutionarily conserved and associate with AGO proteins to recognize specific RNA targets. BMC Biology 12 78. (doi:10.1186/s12915-014-0078-0)
Kwekel JC, Vijay V, Han T, Moland CL, Desai VG & Fuscoe JC 2017 Sex and age differences in the expression of liver microRNAs during the life span of F344 rats. Biology of Sex Differences 8 6. (doi:10.1186/s13293-017-0127-9)
Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP & Kingston RE 2006 Characterization of the piRNA complex from rat testes. Science 313 363–367. (doi:10.1126/science.1130164)
Leung AK & Sharp PA 2010 MicroRNA functions in stress responses. Molecular Cell 40 205–215. (doi:10.1016/j.molcel.2010.09.027)
Li ZJ, Lu J, Sun M, Mi SL, Zhang H, Luo RT, Chen P, Wang YG, Yan M & Qian ZJ et al. 2008 Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. PNAS 105 15535–15540. (doi:10.1073/pnas.0808266105)
Li MZ, Xia YL, Gu YR, Zhang K, Lang QL, Chen L, Guan JQ, Luo ZG, Chen HS & Li Y et al. 2010 MicroRNAome of porcine pre- and postnatal development. PLoS ONE 5 e11541. (doi:10.1371/journal.pone.0011541)
Li ZY, Jia J, Gou JH, Zhao X & Yi T 2015a MicroRNA-451 plays a role in murine embryo implantation through targeting Ankrd46, as implicated by a microarray-based analysis. Fertility and Sterility 103 834–844. (doi:10.1016/j.fertnstert.2014.11.024)
Li FG, Wang LX, Lan QJ, Yang H, Li Y & Liu XL 2015b RNA-seq analysis and gene discovery of Andrias davidanus using Illumina short read sequencing. PLoS ONE 10 e0123730. (doi:10.1371/journal.pone.0123730)
Marie PP, Ronsseray S & Boivin A 2016 From embryo to adult: piRNA-mediated silencing throughout germline development in Drosophila. G3 7 505–516. (doi:10.1534/g3.116.037291)
McEwen TJ, Yao Q, Yun S, Lee CY & Bennett KL 2016 Small RNA in situ hybridization in Caenorhabditis elegans, combined with RNA-seq, identifies germline-enriched microRNAs. Developmental Biology 418 248–257. (doi:10.1016/j.ydbio.2016.08.003)
Mi X, Wei ZL, Zhou ZC & Liu XL 2014 Identification and profiling of sex-biased microRNAs from sea urchin Strongylocentrotus nudus gonad by Solexa deep sequencing. Comparative Biochemistry and Physiology D Genomics and Proteomics 10 1–8. (doi:10.1016/j.cbd.2014.01.001)
Morin RD, O’Connor MD & Griffith M 2008 Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Genome Research 18 610–621. (doi:10.1101/gr.7179508)
Neilsen CT, Goodall GJ & Bracken CP 2012 IsomiRs-the overlooked repertoire in the dynamic microRNAome. Trends in Genetics 28 544–549. (doi:10.1016/j.tig.2012.07.005)
Pedersen IM, Cheng G, Wieland S, Volinia S, Croce CM, Chisari FV & David M 2007 Interferon modulation of cellular microRNAs as an antiviral mechanism. Nature 449 919–922. (doi:10.1038/nature06205)
Peng HY, Shi JC, Zhang Y, Zhang H, Liao SY, Li W, Lei L, Han CS, Ning LN & Cao YJ et al. 2012 A novel class of tRNA-derived small RNAs extremely enriched in mature mouse sperm. Cell Research 22 1609–1612. (doi:10.1038/cr.2012.141)
Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdon-ald PE, Pfeffer S, Tuschl T, Rajewsky N & Rorsman P et al. 2004 A pancreatic islet-specific microRNA regulates insulin secretion. Nature 432 226–230. (doi:10.1038/nature03076)
Rastetter RH, Smith CA & Wilhelm D 2015 The role of non-coding RNAs in male sex determination and differentiation. Reproduction 150 R93–R107.
Ro S, Song R, Park C, Zheng H, Sanders KM & Yan W 2007 Cloning and expression profiling of small RNAs expressed in the mouse ovary. RNA 13 2366–2380. (doi:10.1261/rna.754207)
Sai LS & Agrawal S 2008 piRNABank: a web resource on classified and clustered Piwi-interacting RNAs. Nucleic Acids Research 36 D173–D177. (doi:10.1093/nar/gkm696)
Shi XW 2011 Preliminary study of artificial propagation technology of Andrias davidianus. Journal of Fujian Fisheries 33 48–51. (in Chinese)
Sontakke SD, Mohammed BT, McNeilly AS & Donadeu FX 2014 Characterization of microRNAs differentially expressed during bovine follicle development. Reproduction 148 271–283. (doi:10.1530/REP-14-0140)
Sun JJ, Zhang B, Lan XY, Zhang CL, Lei CZ & Chen H 2014 Comparative transcriptome analysis reveals significant differences in MicroRNA expression and their target genes between adipose and muscular tissues in cattle. PLoS ONE 9 e102142. (doi:10.1371/journal.pone.0102142)
Tyler CR, Labrecque MT, Solomon ER, Guo X & Allan AM 2017 Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner. Neurotoxicology and Teratology 59 1–15. (doi:10.1016/j.ntt.2016.10.004)
Vogel G 1999 Frog is a prince of a new model organism. Science 285 25. (doi:10.1126/science.285.5424.25)
Wu J, Liu Q, Wang X, Zheng J, Wang T, You M, Sheng Sun Z & Shi Q 2013 mirTools 2.0 for non-coding RNA discovery, profiling, and functional annotation based on high-throughput sequencing. RNA Biology 10 1087–1092. (doi:10.4161/rna.25193)
Wilczynska A, Minshall N, Armisen J, Miska EA & Standart N 2009 Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female germline. RNA 15 337–345. (doi:10.1261/rna.1422509)
Wang XM, Zhang KJ, Wang ZH, Ding YZ, Wu W & Huang S 2004 The decline of the Chinese giant salamander Andrias davidianus and implications for its conservation. Oryx 38 197–202.
Xiao J, Zhong H, Zhou Y, Yu F, Gao Y, Luo YJ, Tang ZY, Guo ZB, Guo EY & Gan X et al. 2014 Identification and characterization of microRNAs in ovary and testis of Nile tilapia (Oreochromis niloticus) by using solexa sequencing technology. PLoS ONE 9 e86821. (doi:10.1371/journal.pone.0086821)
Yang AS, Bian W, Liu YQ & Liu GJ 1983 Preliminary studies on the embryonic development of giant salamander. Acta Zoologica Sinica 29 42–47. (in Chinese).
Zhou ZY, Geng Y, Liu XX, Ren SY, Zhou Y, Wang KY, Huang XL, Chen DF, Peng X & Lai WM 2013 Characterization of a ranavirus isolated from the Chinese giant salamander (Andrias davidianus, Blanchard, 1871) in China. Aquaculture 384 .
