Ultrastructural characteristics and immune profile of equine MSCs from fetal adnexa

in Reproduction
Authors:
Eleonora Iacono Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Search for other papers by Eleonora Iacono in
Current site
Google Scholar
PubMed
Close
,
Luisa Pascucci Department of Veterinary Medicine, University of Perugia, Perugia, Italy

Search for other papers by Luisa Pascucci in
Current site
Google Scholar
PubMed
Close
,
Barbara Rossi Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Search for other papers by Barbara Rossi in
Current site
Google Scholar
PubMed
Close
,
Cinzia Bazzucchi Department of Veterinary Medicine, University of Perugia, Perugia, Italy

Search for other papers by Cinzia Bazzucchi in
Current site
Google Scholar
PubMed
Close
,
Aliai Lanci Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Search for other papers by Aliai Lanci in
Current site
Google Scholar
PubMed
Close
,
Monica Ceccoli Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Search for other papers by Monica Ceccoli in
Current site
Google Scholar
PubMed
Close
, and
Barbara Merlo Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Search for other papers by Barbara Merlo in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

Both in human and equine species, mesenchymal stem cells (MSCs) from amniotic membrane (AM) and Wharton’s jelly (WJ), may be particularly useful for immediate use or in later stages of life, after cryopreservation in cell bank. The aim of this study was to compare equine AM- and WJ-MSCs in vitro features that may be relevant for their clinical employment. MSCs were more easily isolated from WJ, even if MSCs derived from AM exhibited more rapid proliferation (P < 0.05). Osteogenic and chondrogenic differentiation were more prominent in MSCs derived from WJ. This is also suggested by the lower adhesion of AM cells, demonstrated by the greater volume of spheroids after hanging drop culture (P < 0.05). Data obtained by PCR confirmed the immunosuppressive function of AM and WJ-MSCs and the presence of active genes specific for anti-inflammatory and angiogenic factors (IL-6, IL 8, IL-β1). For the first time, by means of transmission electron microscopy (TEM), we ascertained that equine WJ-MSCs constitutively contain a very impressive number of large vesicular structures, scattered throughout the cytoplasm. Moreover, an abundant extracellular fibrillar matrix was located in the intercellular spaces among WJ-MSCs. Data recorded in this study reveal that MSCs from different fetal tissues have different characteristics that may drive their therapeutic use. These finding could be noteworthy for horses as well as for other mammalian species, including humans.

Abstract

Both in human and equine species, mesenchymal stem cells (MSCs) from amniotic membrane (AM) and Wharton’s jelly (WJ), may be particularly useful for immediate use or in later stages of life, after cryopreservation in cell bank. The aim of this study was to compare equine AM- and WJ-MSCs in vitro features that may be relevant for their clinical employment. MSCs were more easily isolated from WJ, even if MSCs derived from AM exhibited more rapid proliferation (P < 0.05). Osteogenic and chondrogenic differentiation were more prominent in MSCs derived from WJ. This is also suggested by the lower adhesion of AM cells, demonstrated by the greater volume of spheroids after hanging drop culture (P < 0.05). Data obtained by PCR confirmed the immunosuppressive function of AM and WJ-MSCs and the presence of active genes specific for anti-inflammatory and angiogenic factors (IL-6, IL 8, IL-β1). For the first time, by means of transmission electron microscopy (TEM), we ascertained that equine WJ-MSCs constitutively contain a very impressive number of large vesicular structures, scattered throughout the cytoplasm. Moreover, an abundant extracellular fibrillar matrix was located in the intercellular spaces among WJ-MSCs. Data recorded in this study reveal that MSCs from different fetal tissues have different characteristics that may drive their therapeutic use. These finding could be noteworthy for horses as well as for other mammalian species, including humans.

Introduction

Mesenchymal stem cells (MSCs) are a population of multipotent stem cells, and due to their properties, they offer a great chance for cell-based therapies and tissue engineering applications. Bone marrow (BM) is the common source of autologous MSCs for clinical applications in equine medicine. Alternatively, adipose tissue-derived MSCs can be used as they have a higher proliferation potential (Iacono et al. 2015a). However, for both sources, an invasive procedure is required and a large variability in the cell yield related to the donor was demonstrated (Colleoni et al. 2009). Furthermore, even though BM is the most widely investigated source of MSCs, they have limited potential in terms of in vitro proliferation capability (Guest et al. 2010, Lange-Consiglio et al. 2013) and do not appear to noticeably improve long-term functionality compared to MSCs derived from extra-fetal tissues (Paris & Stout 2010). Placental tissues and fetal fluids represent a source of cells for regenerative medicine. These tissues are readily available and easily procured without invasive procedures. MSCs from fetal fluids and adnexa are defined as an intermediate between embryonic and adult SCs, due to the preservation of some characteristics typical of the primitive native layers (De Coppi et al. 2007). Among fetal adnexal tissues, the major sources of MSCs are AM and Wharton’s jelly (Iacono et al. 2015b). Despite the increasing interest in using MSCs for regenerative medicine in horses and the possibility to employ MSCs from perinatal tissue, both for immediate use in newborns both in later stages of life, there is lacking information on comparison between equine MSCs derived from AM and WJ.

Usually, clinical treatments with MSCs are based on their transplantation but only a small percentage of the injected MSCs engraft successfully (Chimenti et al. 2010). Consistent with these findings, some studies recently showed that the regenerative ability of MSCs could be attributed to the production of molecules and mediators capable of activating the intrinsic repair processes in the damaged tissues. Different authors, working on cardiac, renal, spinal cord and tendon regeneration, indicate that the beneficial effects of MSCs can be attributed to the activation of paracrine mechanisms enabling stimulation of endogenous stem cells. These cells are responsible for the bioactive soluble factors (lipids, growth factors and cytokines) known to inhibit apoptosis and fibrosis, enhance angiogenesis, stimulate mitosis and/or differentiation of tissue-resident progenitor cells and modulate the immune response (Yagi et al. 2010, Liang et al. 2014). Recently, the ability of equine adult MSCs to secrete numerous soluble mediators, implicated in the inhibition of T-cell proliferation, when stimulate with IFN-gamma and TNG-alpha, was demonstrated (Carrade et al. 2012, Kol et al. 2013). However, to our knowledge, no studies define immunophenotype profile, before in vitro stimulation, of equine WJ-MSCs and AM-MSCs, to better know their role in the immune response, angiogenesis, apoptosis, oxidation level and cell migration. Furthermore, in addition to soluble factors, recent findings indicate that extracellular vesicles are released from MSCs inside the CM and that these can be involved as important mediators in cell-to-cell communication (Pascucci et al. 2014, 2015). Microvesicles (MVs) have been categorized into exosomes (EXs), released from the endosomal compartment, and shedding vesicles (SVs), which bud directly from the cell membrane (Biancone et al. 2012). MVs seem to be involved in a dynamic mutual paracrine communication between the embryonic and the maternal environment at the early stage of pre-implantation embryo development (Saadeldin et al. 2015). Recently, Lange-Consiglio et al. (2016) and Perrini et al. (2016) identified the presence and type of MVs secreted by equine AM-MSCs; the authors also evaluated, in a preliminary study in vitro, the possible therapeutic implication of MVs in endometrial and tendon pathologies. Despite these studies on equine AM-MSCs, the recognized importance of WJ as an alternative source of MSCs both in equine and human medicine (Iacono et al. 2012, Subramanian et al. 2015) and despite a lot of data have been reported on these features of equine adult MSCs (Pascucci et al. 2010, 2014, 2015, Maia et al. 2013), no studies are present on ultrastructural characteristics and MVs of equine WJ-MSCs. In this context, the aims of the present study were to analyze the expression of stemness markers, immunophenotype and ultrastructural features. In addition, we considered migration and adhesion ability of equine WJ-MSCs and AM-MSCs since migration ability, expression of adhesion molecules and homing to injured environments are important features of MSCs (Burk et al. 2013, Kavanagh et al. 2014).

Materials and methods

Materials

Unless otherwise indicated, chemicals were purchased from Sigma-Aldrich, and laboratory plastics from Sarstedt Inc. (Newton, NC, USA).

Animals

Samples were recovered from 13 Standardbred mares, housed at the Department of Veterinary Medical Sciences, University of Bologna, for attended delivery. Experimental procedures were approved by the Ethics Committee, University of Bologna (8134-X/10). The written consent was given by the owners to allow tissues recovery for research purposes.

Umbilical cord collection and WJ-MSCs isolation

Immediately after breaking the umbilical cord (UC), the part closest to the colt, characterized by an abundant amount of WJ, was severed. For avoiding mildew and bacterial contamination, samples were washed under flowing water for removing straw or feces debris. Samples were then stored in D-PBS (Dulbecco’s phosphatase-buffered solution) containing penicillin (100 IU/mL) and streptomycin (100 mg/mL), at 4°C for at the latest 12 h. In the lab, before WJ enzymatic digestion, under a laminal flow hood, UCs were disinfected by immersing for few seconds in 70% ethanol and rinsed by repeated immersion in D-PBS. WJ was then isolated, weighed, minced finely (0.5 cm2) by sterile scissors and cells were isolated as previously described (Iacono et al. 2012). Briefly, WJ fragments were incubated in a 37°C water bath for 1–2 h into a 50mL polypropylene tube, containing 1 mL/1g sample of digestion solution (0.1% (w/v) collagenase type IV (Gibco, Invitrogen Corporation), in D-PBS). The mixture was then filtered to separate the dispersed amnion cells from the tissue pieces and collagenase was inactivated by diluting 1:1 in D-PBS plus 10% (v/v) FBS (Gibco). Nucleated cells were pelleted at 470 g for 10 min. The supernatant was discarded, pellet was re-suspended in 5 mL of culture medium (Dulbecco’s Modified Essential Medium (D-MEM)-F12 Glutamax (Gibco) supplemented with 10% v/v FBS, 100 IU/mL penicillin and 100 µg/mL streptomycin) and spin at 470 g for 10 min to wash cells. This operation was repeated three times. After the last wash, cell pellet was re-suspended in 1 mL of culture medium and cell concentration was determined by hemocytometer.

Amnion collection and cells isolation

Allanto-AMs were obtained immediately after vaginal delivery. Samples of allanto-amnion were washed under flowing water for removing straw or feces debris, stored at 4°C in D-PBS, added with antibiotics (100 IU/mL penicillin and 100 µg/mL streptomycin) and were processed within 12 h. In the lab, before enzymatic digestion, under a laminal flow hood, samples were disinfected by immersing for few seconds in 70% ethanol and rinsed by repeated immersion in D-PBS. Then, AM was stripped from the overlying allantois, weighted and cut into small pieces (0.5 cm2) by sterile scissors. Cells were then isolated as described previously for WJ, by an enzymatic digestion.

Cell culture and proliferation assays

After isolation, primary cells derived from all recovered samples were plated in a 25 cm2 flask in 5 mL of D-MEM-F12 Glutamax, plus 10% v/v FBS and antibiotics. Cells were incubated in a 5% CO2 humidified atmosphere at 38.5°C. At ~80–90% of confluence, they were dissociated by 0.25% trypsin, counted and plated at the concentration of 5 × 103 cells/cm2 as ‘Passage 1’ (P1), and so on for the subsequent passages. Calculation of cell-doubling time (DT) and cell-doubling numbers (CD) was carried out according to the following formulas (Rainaldi et al. 1991):
E0001
E0002
where Nf and Ni were the final and the initial number of cells, respectively.

Adhesion and migration assays

To define the differences between WJ and AM-MSCs, spheroid formation and migration test were performed. Three replicates for each experiment were conducted; all replicates were carried out at passage 3 of in vitro culture.

For adhesion assay, cells were cultured in ‘hanging drops’ (5.000 cells/drop of 25 µL) for 24 h. Images were acquired by a Nikon Eclipse TE 2000-U microscope. Spheroid areas were determined using ImageJ software (imagej.nih.gov/ij/). Starting from the binary masks obtained by ImageJ, the volume of each spheroid was computed using ReViSP (sourceforge.net/projects/revisp) (Bellotti et al. 2016), a software specifically designed to accurately estimate the volume of spheroids and to render an image of their 3D surface.

To assess cell migration potential, a scratch assay (also known as Wound-Healing assay) was carried out, as previously described (Liang et al. 2007). Briefly, at 80–90% confluence, the cell monolayer was scraped using a p1000 pipet tip. After washing twice with D-PBS, the dish was incubated for 24 h at 38.5°C and 5% CO2 in a humidified atmosphere. Images were acquired both immediately after the tip-scratch (time 0; T0) and after the incubation period (last time point or time 1; T1), and the distances of each scratch closure were calculated by Image J software. The migration percentages were calculated using the following formula (Rossi et al. 2014):
E0003

In vitro differentiation

In vitro differentiation potential of cells toward osteogenic, adipogenic and chondrogenic lineages was studied. Cells (5 × 103 cells⁄cm2) were cultured under specific induction media (Table 1). As negative control, an equal number of cells was cultured in expansion medium. In vitro differentiation potential was assessed at passage 3 of culture in two replicates for three samples from each lineage. To cytologically evaluate differentiation, cells were fixed with 10% formalin at room temperature (RT) and stained with Oil Red O, Alcian Blue and Von Kossa for adipogenic, chondrogenic and osteogenic induction, respectively. Quantitative analysis of in vitro differentiation was performed by ImageJ.

Table 1

Specific induction media compositions.

Adipogenic medium (7 days) Iacono et al. (2012) Chondrogenic medium (21 days) Iacono et al. (2012) Osteogenic medium (21 days) Mizuno and Hyakusoku (2003)
DMEM F12 DMEM/TCM199 DMEM/TCM199
15% Rabbit Serum 1% FBS 10% FBS
0.5 mM IBMXa (removed after 3 days) 6.25 µg/mL insulin 50 nM AA2Pc
1 μM DXMb (removed after 6 days) 50 µM AA2Pc 0.1 μM DXMb
10 µg/mL insulin 0.1 μM DXMb 10 mM BGPe
0.2 mM indomethacin 10 ng/mL hTGFβ1d

IBMX, isobutylmethylxanthine; bDXM, Dexamethasone; cAA2P, Ascorbic Acid 2-Phosphate; dhTGF, human Transforming Growth Factor; eBGP, Beta-Glycerophosphate.

Immunocytochemistry (ICC)

Cells, derived from 3 AM and WJ samples, at P3, were cultured on ICC slides, until confluence. They were then fixed with 4% paraformaldehyde (20 min at RT) and then washed in phosphate buffer (PB). Cells were blocked in goat serum (10%) for 1 h and incubated overnight with primary antibodies (Table 2); the day after, they were washed in PB2 (PB + 0.2% BSA + 0.05% saponin) and incubated with anti-mouse- or anti-rabbit-FITC-conjugated secondary antibodies for 1 h. Nuclei were then labeled with Hoechst 33342. The excess of secondary antibody and Hoechst were removed by three washes with PB2. Images were obtained with a Nikon Eclipse E400 microscope, using the software Nikon NIS-Elements.

Table 2

Primary antibodies for ICC.

Primary antibody Dilution
α-SMA (α-smooth muscle actin) (Gene tex) 1:500
E-Cadherin (Cell Signaling Tech. #3195) 1:200
N-Cadherin (Biorbyt orb11100) 1:100
pan-Cytokeratin (Chemicon Inter.Millipore CBL234) 1:250

Molecular characterization

To evaluate pluripotency potential of the two types of equine cells, PCR for the pluripotency genes OCT4, NANOG and SOX2 was performed. Gene expression was tested on equine blastocysts, as positive control. To test cell stemness and immunoproperty, the following set of genes was evaluated: CD45, CD 34, CD90, CD73, MHC-I, MHC-II, IL-β1, IL-4, IL-6, IL-8, IFN-γ and TNF-α. Primers were tested on activated equine lymphocyte. The specific set of primers used is listed in Table 3. All tests were carried out on 100 × 103 cells, derived from AM and WJ of three different mares. Experiments were performed at passage 3 of culture.

Table 3

Sequence of primers used for PCR analysis.

Primers References Sequences (5′→3′) bp
MSC marker
 CD90 Mohanty et al. (2014) F: TGCGAACTCCGCCTCTCT 93
R: GCTTATGCCCTCGCACTTG
 CD73 Mohanty et al. (2014) F: GGGATTGTTGGATACACTTCAAAAG 90
R: GCTGCAACGCAGTGATTTCA
Ematopoietic markers
 CD34 Mohanty et al. (2014) F: CACTAAACCCTCTACATCATTTTCTCCTA 101
R: GGCAGATACCTTGAGTCAATTTCA
 CD45 Mohanty et al. (2014) F: TGATTCCCAGAAATGACCATGTA 101
R: ACATTTTGGGCTTGTCCTGTAAC
MHC markers
 MHC-I Corradetti et al. (2011) F: GGAGAGGAGCAGAGATACA 218
R: CTGTCACTGTTTGCAGTCT
 MHC-II Corradetti et al. (2011) F: TCTACACCTGCCAAGTG 178
R: CCACCATGCCCTTTCTG
ILs
 TNF α Jischa et al. (2008) F: GCTCCAGACGGTGCTTGTG 95
R: GCCGATCACCCCAAAGTG
 IL-8 Jischa et al. (2008) F: CGGTGCCAGTGCATCAAG 81
R: TGGCCCACTCTCAATCACTCT
 IFN-γ Castagnetti et al. (2012) F: GTGTGCGATTTTGGGTTCTTCTA 235
R: TTGAATGACCTGGTTATCT
 IL4 Castagnetti et al. (2012) F: CAACTTCATCCAGGGATGCAA 107
R: CAGTCAGCTCCATGCACGAAT
 IL-β1 Castagnetti et al. (2012) F: GAGGCAGCCATGGCAGCAGTA 257
R: TGTGAGCAGGGAACGGGTATCTT
 IL-6 Visser and Pollitt (2011) F: AAACCACCTCAAATGGACCACTAR: TTTTTCAGGGCAGAGATTTTGC 91
Pluripotency markers
 OCT4 Desmarais et al. (2011) F: TCCCAGGACATCAAAGCTCTGCAGA 679
R: TCAGTTTGAATGCATGGGAGAAGCCCAGA
 NANOG Desmarais et al. (2011) F: GACAGCCCCGATTCATCCACCAG 492
R: GCACCAGGTCTGACTGTTCCAGG
 SOX2 Desmarais et al. (2011) F: GGCGGCAACCAGAAGAACAG 663
R: AGAAGAGGTAACCACGGGGG
Housekeeping
 GAPDH Desmarais et al. (2011) F: GTCCATGCCATCACTGCCAC 262
R: CCTGCTTCACCACCTTCTTG

F, forward; R, reverse.

Cells were snap-frozen and RNA was extracted using Nucleo Spin RNA kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions. cDNAs were synthesized by RevertAid RT Kit (ThermoFisher Scientific) and used directly in PCR reactions, following the instructions of Maxima Hot Start PCR Master Mix (2×) (ThermoFisher Scientific). PCR products were visualized with ethidium bromide on a 2% agarose gel.

Transmission electron microscopy (TEM)

Ultrastructural examination was performed on AM (n = 3) and WJ-MSCs (n = 3) at P3. The analysis was performed on three replicates. After detaching cells, the pellet was fixed with 2.5% glutaraldehyde in 0.1 M PB, pH 7.3, for 1 h, at RT. Cells were then washed twice in PB and post-fixed with buffered 2% osmium tetroxide for 1 h, at RT. They were finally dehydrated in a graded ethanol-propylene oxide series, pre-infiltrated and embedded in Epon 812. Ultrathin sections (90 nM) were mounted on 200-mesh copper grids, stained with uranyl acetate and lead citrate and examined by a Philips EM 208 microscope, equipped with a digital camera (Center for Electron Microscopy, CUME, University of Perugia).

Statistical analysis

Harvested WJ and AM (grams), CDs, DTs and percentages of migration are expressed as mean ± standard deviation (s.d.). Statistical analyses were performed using IBM SPSS Statistics 21 (IBM Corporation, Armonk, New York, USA). Data were analyzed, for normal distribution, using a Shapiro–Wilk test, then using one-way ANOVA or a Student’s t-test (CDs and DTs). The 3D spheroid volumes and mean gray intensity of differentiated cells were compared using Mann–Whitney U test, due to their non-normal distribution. Significance was assessed for P < 0.05.

Results

Cellular growth

As soon as after birth of foals and immediately after foal detachment, UC (length ~15 cm) and AM samples were recovered. The mean weight of recovered jelly and AM were 5.22 ± 3.34 g and 15.60 ± 5.23 g, respectively. Adherent mononuclear cells, characterized by elongated fibroblast-like morphology were isolated in 13/13 (100%) WJ samples and in 9/13 (69.2%) AM samples. Undifferentiated cells of both lines were passaged up to seven times; no changes in cell morphology were observed throughout the culture period. As demonstrated by DTs assay, AM and WJ-MSCs were able to divide for an extensive period in vitro. From P0 to P7, AM-MSCs showed a mean DT of 1.49 ± 0.34 days/CD, significantly lower than that recorded for WJ-MSCs (1.71 ± 0.65 days/CD; P < 0.05). No statistically significant differences were found in DTs among earlier culture passages in both cell lines (P > 0.05). However, AM-MSCs start to grow more slowly, as a sign of cellular aging, by P6 (P < 0.05); on the contrary, WJ-MSCs, despite a mean higher DT, showed an increase of DT from P7 (P < 0.05). By P7, total WJ and AM-MSCs cell doublings were similar (36.57 ± 0.76 vs 37.05 ± 0.59; P > 0.05; Fig. 1).

Figure 1
Figure 1

Doubling times of AM-MSCs (A) and WJ-MSCs (B) over seven passages of culture. *P < 0.05.

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Adhesion and migration assays

Both AM and WJ cells formed spheroids when cultured in hanging drops. Average areas and volume of the spheroids formed by WJ-MSCs were significantly smaller than AM-MSCs spheroids (P < 0.05; Fig. 2). Average percentage of migration, observed by scratch test, was statistically similar between cell lines (AM-MSCs vs WJ-MSCs: 34.14 ± 4.51% vs 38.20 ± 2.88%; P > 0.05; Fig. 2).

Figure 2
Figure 2

(A, B and C): Scratch assay on WJ-MSCs at T0 (A) and after 24 h (B) of cell growth. The same on AM-MSCs at T0 (C) and after 24 h (D) (Magnification 4×, scale bar 100 µm). (E and F) Adhesion assay. Volume reconstruction and visualization of a WJ (on the left) and a AM (on the right) MSCs spheroid, obtained after 24 h of hanging drop culture (Magnification 10×, scale bar 10 µm). (G) 3D Volume reconstruction obtained by ReViSP (scale in pixels).

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

In vitro differentiation

Both cell lines were able to differentiate toward osteogenic, chondrogenic and adipogenic direction (Fig. 3). However, WJ-MSCs showed a greater chondrogenic and osteogenic potential (P < 0.05), characterized by a greater accumulation of extra-cellular mucosubstances and calcium deposits, as showed by Alcian Blue (Fig. 3A) and Von Kossa (Fig. 3B) stains respectively.

Figure 3
Figure 3

In vitro differentiation studies. Magnification 20×, scale bar 100 µM. (A) Cells induced toward chondrogenic differentiation and control: glycosaminoglycans in cartilage matrix are stained by Alcian Blue and appear bright blue in the pictures. (B) Osteogenic-induced cells and control: extracellular calcium deposition are stained black by von Kossa. (C) Cells induced toward adipogenic differentiation: Oil red O stains in red intra-cellular lipid droplet. CI, chondrogenic induction; OI, osteogenic induction; AI, adipogenic induction

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Immunostaining and PCR analysis

Immunostaining results are showed in Fig. 4. AM and WJ-MSCs clearly expressed mesenchymal marker, N-Cadherin and the mesodermal marker alpha-SMA. On the contrary, they did not express pan-cytokeratin and E-Cadherin.

Figure 4
Figure 4

AM-MSCs and WJ-MSCs labeled with antibodies against antigens N-Cadherin, alpha-SMA, e-Cadherin and pan-Cytokeratin. As showed by the merge of Hoechst and antibody staining, both cell populations were positive for N-Cadherin and alpha-SMA, while lacked the expression of e-Cadherin and pan-Cytokeratin. Magnification 40×, scale bar 1.000 µM.

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

PCR results are reported in Table 4; positive expression is also showed in Fig. 5. Both cell populations expressed MSC-associated markers (CD90 and CD73), while were negative for an hematopoietic marker (CD45), at P3 of in vitro culture. On the contrary, the hematopoietic marker CD34 was registered for either population. Both WJ-MSCs and AMSCs lacked MHC-I and MHC-II expression. Regarding embryonic markers, WJ-MSCs expressed OCT-4, while AM-MSCs were weakly positive for this marker; both cell populations lacked Nanog and Sox2. About their immune-phenotype, both WJ-MSCs and AMSCs lacked MHC-I, MHC-II, IFN- γ, TNF-α and IL-4 expression. Cells were instead positive for IL-6 and IL- β1. WJ-MSCs expressed IL-8 marker, while a weak expression was showed by AM-MSCs.

Figure 5
Figure 5

PCR analysis of WJ-MSCs and AMMSCs at P3. GAPDH was used as the reference gene. Positive markers expression was reported.

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Table 4

Results of PCR carried out on samples derived from three mares at P3.

Primers WJ-MSCs AM-MSCs
MSC marker
 CD90 + +
 CD 73 + +
Hematopoietic markers
 CD34 + +
 CD45
MHC markers
 MHC-I
 MHC-II
ILs
 TNF α
 IL-8 + +
 IFN-γ
 IL4
 IL-β1 + +
 IL-6 + +
Pluripotency markers
 OCT4 + +/–
 NANOG
 SOX2

+, positive marker expression; –, lacked marker expression; +/–, weak expression.

TEM

At low magnification, cells of both samples were quite small and uniform in size (diameter range: 10–15 μM; Figs 6A and 7A). AM-MSCs appeared generally well dissociated, while WJ-MSCs were frequently tightly adherent with each other to form wide aggregates (Fig. 6A and B). Golgi complex was particularly well developed; it occupied a juxta-nuclear position and exhibited flattened cisternae, transport vesicles and heterogeneous sized secreting granules. Some of them were very large and enclosed fine granular material (Fig. 6C and D). RER showed linear flat profiles and dilated cisternae (Fig. 6E and F). In both samples, the most interesting ultrastructural feature was represented by the very impressive number of large vesicular structures, up to 2 µm in diameter, scattered throughout the cytoplasm (Fig. 6G and H). They showed a variety of appearances and ranged from multivesicular bodies (MVB) (Fig. 7A and B) comprising intralumenal nanovesicles of different sizes (30–500 nM), to endolysosomes and autophagic vacuoles. They were particularly abundant in WJ-MSCs. The occurrence of membrane vesicles shedding from cell surface was observed in both samples. They ranged in size from 100 to 500 nM and included electron-lucent, as well as moderately electron-dense vesicles isolated or aggregated nearby the cells (Fig. 7C and D).

Figure 6
Figure 6

Comparative ultrastructural features of AM-MSCs and WJ-MSCs. (A) Single round-shaped AM-MSC with a unique euchromatic irregularly-profiled nucleus. (B) A group of reciprocally adherent WJ-MSCs with a single large euchromatic nucleus and a cytoplasm rich in vacuolar bodies. (C) Well-developed Golgi complex and a group of large secreting granules in AM-MSCs. (D) Golgi apparatus in the juxta-nuclear area producing large secreting granules (WJ-MSCs). (E) RER showing linear flat profiles and dilated cisternae (AM-MSCs). (F) Dilated cisternae of the RER (WJ-MSCs). (G) Cell cytoplasm containing a huge number of vacuolar elements, up to 2 μM in diameter (AM-MSCs). (H) vacuolar structures comprising endo-luminal vesicles, very heterogeneous in size and morphology (WJ-MSCs).

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Figure 7
Figure 7

Comparative ultrastructural features of AM-MSCs and WJ-MSCs. (A) Maturing MVB in a AM-MSC. (B) Maturing MVB in a WJ-MSC. (C) Membrane vesicles of different size located in the peri-cellular space of AM-MSCs. (D) Isolated (arrows) and aggregated (arrow head) extracellular vesicles located nearby the cell membrane of WJ-MSCs. (E) complex vesicle containing round-shaped small vesicles (AM-MSCs). (F) Large complex vesicle budding from the cell surface (WJ-MSCs). (G) Tunneling nanotube connecting two adjacent AM-MSCs. (H) Tunneling nanotube emerging from a cell (WJ-MSCs).

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Complex extracellular vesicles measuring 500 nM–1 μM and containing packed nanovesicles, frequently budded from the cell surface or were detected in the intercellular space (Fig. 7E and F). Tunneling nanotubes were occasionally observed in both samples suggesting that this may be an additional mechanism of crosstalk between MSCs (Fig. 7G and H). The most noteworthy difference between AM-MSCs and WJ-MSCs was the presence of an abundant extracellular fibrillar matrix (EFM) located in the intercellular spaces among WJ-MSCs (Fig. 8A, B and C). It was composed of a finely granular and moderately electron-dense ground substance populated by a loosely arranged network of reticular fibrils. These were uniformly thin and tend to run parallel to the cell surface. Abundant vesicles were entrapped among the fibrils (Fig. 8C). The intercellular spaces were devoid of collagen fibrils.

Figure 8
Figure 8

WJ-MSCs – Morphological features of extracellular matrix. (A) Extracellular fibrillar matrix (EFM). (B) EFM, high magnification. (C) Extracellular vesicles entrapped in EFM.

Citation: Reproduction 154, 4; 10.1530/REP-17-0032

Discussion

AM-MSCs and WJ-MSCs are the focus of great interest in human and veterinary regenerative medicine for their in vitro multilineage differentiation potential and in vitro expansion (Iacono et al. 2012, Lange-Consiglio et al. 2013). In the present study, for the first time in equine species, proliferation, migration, spheroids formation, trilineage differentiation capacity, expression of stemness markers, immunophenotype and ultrastructural features of MSCs derived from WJ and AM were compared.

From both tissues, cells with mesenchymal morphology were isolated. However, as recently reported in human (Subramanian et al. 2015), in the present study, equine MSCs were isolated from all samples by collagenase digestion technique only for WJ. No other reports exist on the successful isolation rate from equine WJ and AM. Despite the lower isolation rate, AM-MSCs showed a higher proliferation rate compared to WJ-MSCs. Nevertheless, AM-MSCs showed an increased DT earlier (P6) than WJ-MSCs (P7), thus no differences were found in total CD number.

As in human (Pasquinelli et al. 2007), in both cell types, TEM examination revealed an highly metabolic and synthetic nature, demonstrated by euchromatic nucleus, prominent nucleoli, abundant nuclear pores as well as by well-developed RER and Golgi complex.

Beyond the growth curve, migration ability is an important feature of MSCs because of its fundamental significance for systemic application (Li et al. 2009, Burk et al. 2013). No differences were found between WJ-MSCs and AM-MSCs in migration ability.

As the adhesion capability is related and enhanced to differentiation potential (Pasquinelli et al. 2007, Wang et al. 2009, Kavanagh et al. 2014), in the present study, spheroid formation in vitro was assessed using the hanging drop method. Cell derived from WJ showed a higher adhesion ability, forming smaller spheroids, as determined by ReVisp. The analysis of differentiated cells by ImageJ showed a higher WJ-MSCs chondrogenic and osteogenic potential. Our results confirmed data recently registered in human cells (Subramanian et al. 2015), in fact, also equine WJ-MSCs, exposed to differentiation media, showed the highest number of Von Kossa-stained cells, greatest staining intensity of nodules and higher number of cells positive for Alcian Blue compared to AM cells.

Concerning molecular characterization, the equine fetal adnexa-derived MSCs demonstrate the characteristics defined by the International Society for Cellular Therapy criteria (Dominici et al. 2006), except for the CD34. CD34 is predominantly considered as a marker of hematopoietic stem cells (HSC) and hematopoietic progenitor cells. However, different authors demonstrated CD34 expression on several other cell types, including embryonic stem cell (Kopher et al. 2010) and MSCs (Nielsen & McNagny 2008). In many cases, CD34 indicate a distinct subset of cells with enhanced progenitor activity (Sidney et al. 2014). The expression of CD34 by equine cells might constitute evidence of their potentiality. Moreover, as intermediate between adult and embryonic cells, equine WJ and AM-MSCs express OCT-4, a marker for pluripotent stem cells. However, as previously reported in human (Subramanian et al. 2015), also in equine, the expression level of OCT-4 seems to be lower for cells from AM compared to WJ. This finding, coupled with greater differentiation ability, could be related to the middle position of WJ-MSCs between blastocyst and adult cells. The stem cells isolated from the WJ probably start to lose their embryonic pluripotency tumorigenic characteristics and start to acquire multipotent non-tumorigenic MSC characteristics with progressive development. This feature would help cells from the WJ to differentiate into specific lineages more easily, in vitro or during cell-based therapy, and to allow higher reprogramming efficiency to the embryonic state because of an immature phenotype (Pera et al. 2009). In human cells derived from WJ, the telomerase levels remained high throughout serial culture compared to AM-MSCs, suggesting that they retain their primitive characteristics in culture for long periods of time (Subramanian et al. 2015). In equine species, further studies are needed to verify this condition.

Due to the importance of MSCs for their immune response and their ability to suppress T-cells (Carrade et al. 2012), in the present study, anti-inflammatory and pro-inflammatory factors produced by WJ-MSCs and AM-MSCs were investigated for the first time in the horse. One of the most important cytokines of the acute phase reaction is TNF-α, while IL-4 is a cytokine involved in allergic inflammation. Different from that observed in human cells, equine WJ and AM-MSCs do not express these markers, neither IFN-γ, if they are not stimulated in vitro by the presence of IFN. Confirming their reduced immunogenicity, both cell lines were negative for MHC-I and MHC-II. On the contrary, they expressed IL-1β, IL-6 and IL-8. Data registered in this study confirmed those already reported in human WJ-MSCs (Dominici et al. 2006, Choi et al. 2013) and AM-MSCs (Yazdanpanah et al. 2015). These cytokines are important mediator of the inflammatory response, involved in a variety of cellular activities, including cell proliferation, differentiation, apoptosis, chemotaxis, angiogenesis and hematopoiesis (Lamalice et al. 2007). Furthermore, these factors are involved in the complex interaction between MSCs and the tissue microenvironment as well as in the production of membrane vesicles, containing molecules such as short peptides, proteins, lipids and various forms of RNAs (György et al. 2011).

As previously observed in adult equine cells (Pascucci et al. 2014), the great number of MVB, containing intraluminal vesicles maturing from their internal membrane, may be interpreted as the ability of both cell types to produce a huge variety of ‘secreting’ molecules, enclosed inside vesicles of different types that are released in the extracellular milieu. In addition, it can be hypothesized that the several other vesicular structures observed by TEM represent a mechanism to efficiently recycle cell constituents by autophagy. The intense proliferating and metabolic activity, in fact, makes it necessary to constantly renew sub-cellular components, especially membrane fractions. The main difference between AM-MSCs and WJ-MSCs attained the presence of an abundant EFM in the intercellular spaces among WJ-MSCs; it probably determines a tight intercellular adhesion even after trypsin treatment and is responsible for the observation of cell aggregates at TEM analysis. It is well known that these cells, in vivo, are immersed in a mucoid connective matrix. It seems evident that WJ-MSC isolation and cultivation in vitro does not affect their ability to produce extracellular matrix.

Conclusion

From the present study, it emerged that cells isolated from different fetal origin matrices exhibit different morphological, molecular and differentiation potential. Equine WJ could be considered as a viable source for MSCs with reliable migration and differentiation capacities, and it is therefore a convenient cell source for autologous or allogeneic regenerative therapies. Although the molecular content and functional activities of EVs produced by WJ and AM-MSCs remain to be characterized, the results of the present study indicated that MSCs from equine fetal adnexa are able to constitutively produce EVs that may be partly responsible for their paracrine activity. Further investigations are needed to find the best protocols for isolation and in vitro differentiation for AM-MSCs. Moreover, additional in vivo tests should be carried out to confirm our in vitro findings.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

Acknowledgments

The authors wish to thank Prof Carolina Castagnetti (Head of Equine Clinical Service, DIMEVET, University of Bologna, Italy) for the agreement to the sample collection. They wish also to thank all of the technical staff and veterinarians at Equine Perinatology and Reproduction Unit, DIMEVET, University of Bologna, for their assistance with this project.

References

  • Bellotti C, Duchi S, Bevilacqua A, Lucarelli E & Piccinini F 2016 Long term morphological characterization of mesenchymal stromal cells 3D spheroids built with a rapid method based on entry-level equipment. Cytotechnology 68 24792490. (doi:10.1007/s10616-016-9969-y)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Biancone L, Bruno S, Deregibus MC, Tetta C & Camussi G 2012 Therapeutic potential of mesenchymal stem cell-derived microvesicles. Nephrology Dialisis Transplantation 27 30373042. (doi:10.1093/ndt/gfs168)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Burk J, Ribitsch I, Gittel C, Juelke H, Kasper C, Staszyk C & Brehm W 2013 Growth and differentiation characteristics of equine mesenchymal stromal cells derived from different sources. Veterinary Journal 195 98106. (doi:10.1016/j.tvjl.2012.06.004)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Carrade DD, Lame MW, Kent MS, Clark KC, Walker NJ & Borjesson DL 2012 Comparative analysis of the immunomodulatory properties of equine adult-derived mesenchymal stem cells. Cell Medicine 4 111. (doi:10.3727/215517912X647217)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Castagnetti C, Mariella J, Pirrone A, Cinotti S, Mari G & Peli A 2012 Expression of interleukin-1 β, interleukin-8, and interferon-γ in blood samples obtained from healthy and sick neonatal foals. American Journal of Veterinary Research 73 14181427. (doi:10.2460/ajvr.73.9.1418)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chimenti I, Smith RR, Li TS, Gerstenblith G, Messina E, Giacomello A & Marbán E 2010 Relative roles of direct regeneration versus paracrine effects of human cardiosphere-derived cells transplanted into infarcted mice. Circulation Research 106 971980. (doi:10.1161/CIRCRESAHA.109.210682)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Choi M, Lee H, Naidansaren P, Kim H, Cha J, Ahn H, Yang P, Shin J & Joe Y 2013 Proangiogenic features of Wharton’s jelly-derived mesenchymal stromal/stem cells and their ability to form functional vessels. International Journal of Biochemistry and Cell Biology 45 560570. (doi:10.1016/j.biocel.2012.12.001)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colleoni S, Bottani E, Tessaro I, Mari G, Merlo B, Romagnoli N, Spadari A, Galli C & Lazzari G 2009 Isolation, growth and differentiation of equine mesenchymal stem cells: effect of door, source, amount of tissue and supplementation with basic fibroblast growth factor. Veterinary Research Communication 33 811821. (doi:10.1007/s11259-009-9229-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Corradetti B, Lange-Consiglio A, Barucca M, Cremonesi F & Bizzarro D 2011 Size-sieved subpopulations of mesenchymal stem cells from intervascular and perivascular equine umbilical cord matrix. Cell Proliferation 44 330342. (doi:10.1111/j.1365-2184.2011.00759.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • De Coppi P, Bartsch G, Siddiqui MM, Xu T, Santos CC, Perin L, Mostoslavsky G, Serre AC, Snyder EY & Yoo JJ et al. 2007 Isolation of amniotic stem cell lines with potential for therapy. Nature Biotechnology 25 100106. (doi:10.1038/nbt1274)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Desmarais J, Demers S, Suzuki JJ, Laflamme S, Vincent P, Laverty S & Smith L 2011 Trophoblast stem cell marker gene expression in inner cell mass-derived cells from parthenogenetic equine embryos. Reproduction 141 321332. (doi:10.1530/REP-09-0536)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D & Horwitz E 2006 Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8 315317. (doi:10.1080/14653240600855905)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Guest DJ, Smith MR & Allen WR 2010 Equine embryonic stem-like cells and mesenchymal stromal cells have different survival rates and migration patterns following their injection into damaged superficial digital flexor tendon. Equine Veterinary Journal 42 636642. (doi:10.1111/j.2042-3306.2010.00112.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • György B, Szabò T, Pàsztòi M, Pàl Z, Mijàk P, Aradi B, Làszlò V, Pàllinger E, Pap E & Kittel A et al. 2011 Membrane vesicles, current state-of-the-art: emerging role of extracellular vesicles. Cellular and Molecular Life Sciences 68 26672688. (doi:10.1007/s00018-011-0689-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Brunori L, Pirrone A, Pagliaro PP, Ricci F, Tazzari PL & Merlo B 2012 Isolation, characterization and differentiation of mesenchymal stem cells from amniotic fluid, umbilical cord blood and Wharton’s jelly in the horse. Reproduction 143 455468. (doi:10.1530/REP-10-0408)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Merlo B, Romagnoli N, Rossi B, Ricci F & Spadari A 2015a Equine bone marrow and adipose tissue mesenchymal stem cells: cytofluorimetric characterization, in vitro differetiation and clinical application. Journal of Equine Veterinary Sciences 35 130140. (doi:10.1016/j.jevs.2014.12.010)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Rossi B & Merlo B 2015b Stem cells from foetal adnexa and fluid in domestic animals: an update on their features and clinical application. Reproduction in Domestic Animals 50 353364. (doi:10.1111/rda.12499)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jischa S, Walter I, Nowotny N, Palm F, Budik S, Kolodziejek J & Aurich C 2008 Uterine involution and endometrial function in postpartum pony mares. American Journal of Veterinary Research 69 15251534. (doi:10.2460/ajvr.69.11.1525)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kavanagh D, Robinson J & Kalia N 2014 Mesenchymal stem cell priming: fine-tuning adhesion and function. Stem Cell Reviews 10 587599. (doi:10.1007/s12015-014-9510-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kol A, Walker NJ, Galuppo LD, Clark KC, Buerchler S, Bernanke A & Borjesson DL 2013 Autologous point-of-care cellular therapies variably induce equinemesenchymal stem cell migration, proliferation and cytokine expression. Equine Veterinary Journal 45 193198. (doi:10.1111/j.2042-3306.2012.00600.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kopher RA, Penchev VR, Islam MS, Hill KL, Khosla S & Kaufman DS 2010 Human embryonic stem cell-derived CD34+ cells function as MSC progenitor cells. Bone 47 718728. (doi:10.1016/j.bone.2010.06.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lamalice L, Le Boeuf F & Huot J 2007 Endothelial cell migration during angiogenesis. Circulation Research 100 782794. (doi:10.1161/01.RES.0000259593.07661.1e)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lange-Consiglio A, Corradetti B, Meucci A, Bizzaro D & Cremonesi F 2013 Characteristics of equine mesenchymal stem cells derived from amnion and bone marrow: in vitro proliferative and multilineage potential assessment. Equine Veterinary Journal 45 737744. (doi:10.1111/evj.12052)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lange-Consiglio A, Perrini C, Tasquier R, Deregibus M, Camussi G, Pascucci L, Marini M, Corradetti B, Bizzarro D & De Vita B et al. 2016 Equine amniotic microvesicles and their anti-inflammatory potential in a tenocyte model in vitro. Stem Cells Development 25 610621. (doi:10.1089/scd.2015.0348)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li G, Zhang X, Wang H, Wang X, Meng C, Chan C, Yew D, Tsang K, Li K & Tsai S et al. 2009 Comparative proteomic analysis of mesenchymal stem cells derived from human bone marrow, umbilical cord and placenta: implication in the migration. Proteomics 9 2030. (doi:10.1002/pmic.200701195)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liang CC, Park AY & Guan JL 2007 In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nature Protocols 2 329333. (doi:10.1038/nprot.2007.30)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liang X, Ding Y, Zhang Y, Tse H & Lian Q 2014 Paracrine mechanisms of mesenchymal stem cell-based therapy: current status and perspectives. Cell Transplantation 23 10451059. (doi:10.3727/096368913X667709)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Maia L, Landim-Alvarenga FC, Da Mota LS, De Assis Golim M, Laufer-Amorim R, De Vita B, Barberini DJ, Listoni AJ, De Moraes CN & Heckler MC et al. 2013 Immunophenotypic, immunocytochemistry, ultrastructural, and cytogenetic characterization of mesenchymal stem cells from equine bone marrow. Microscopy Research and Technique 76 618624. (doi:10.1002/jemt.22208)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mizuno H & Hyakusoku H 2003 Mesengenic potential and future clinical perspective of human processed lipoaspirate cells. Journal of Nippon Medical School 70 300306. (doi:10.1272/jnms.70.300)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mohanty N, Gulati B, Kumar R, Gera S, Kumar P, Somasundaram R & Kumar S 2014 Immunophenotypic characterization and tenogenic differentiation of mesenchymal stromal cells isolated from equine umbilical cord blood. In Vitro Cellular and Developmental Biology – Animal 50 538548. (doi:10.1007/s11626-013-9729-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nielsen J & McNagny K 2008 Novel functions of the CD34 family. Journal of Cell Science 121 36833692. (doi:10.1242/jcs.037507)

  • Paris DB & Stout TA 2010 Equine embryos and embryonic stem cells: defining reliable markers of pluripotency. Theriogenology 74 516524. (doi:10.1016/j.theriogenology.2009.11.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Mercati F, Marini C, Ceccarelli P, Dall'Aglio C, Pedini V & Gargiulo AM 2010 Ultrastructural morphology of equine adipose-derived mesenchymal stem cells. Histology and Histopathology 25 12771285.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Alessandri G, Dall’Aglio C, Mercati F, Cloliolo P, Bazzucchi C, Dante S, Petrini S, Curina G & Ceccarelli P 2014 Membrane vesicles mediate pro-angiogenic activity of equine adipose-derived mesenchymal stromal cells. Veterinary Journal 202 361366. (doi:10.1016/j.tvjl.2014.08.021)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Dall’Aglio C, Bazzucchi C, Mercati F, Mancini M, Pessina A, Alessandri G, Giammaroli M, Dante S & Brunati G et al. 2015 Horse adipose-derived mesenchymal stromal cells constitutively produce membrane vesicles: a morphological study. Histology and Histopathology 30 549557. (doi:10.14670/HH-30.549)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pasquinelli G, Tazzari PL, Ricci F, Vaselli C, Buzzi M, Conte R, Orrico C, Foroni L, Stella A & Alviano F et al. 2007 Ultrastructural characteristics of human mesenchymal stromal (stem) cells derived from bone marrow and term placenta. Ultrastructural Pathology 31 2331. (doi:10.1080/01913120601169477)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pera MF 2009 Stem cells: low-risk reprogramming. Nature 458 715716. (doi:10.1038/458715a)

  • Perrini C, Strillacci MG, Bagnato A, Esposti P, Marini MG, Corradetti B, Bizzaro D, Idda A, Ledda S & Capra E et al. 2016 Microvesicles secreted from equine amniotic-derived cells and their potential role in reducing inflammation in endometrial cells in an in-vitro model. Stem Cell Research and Therapy 18 169. (doi:10.1186/s13287-016-0429-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rainaldi G, Pinto B, Piras A, Vatteroni L, Simi S & Citti L 1991 Reduction of proliferative heterogeneity of CHEF18 Chinese hamster cell line during the progression toward tumorigenicity. In Vitro Cellular and Developmental Biology 27A 27 949952.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rossi B, Merlo B, Colleoni S, Iacono E, Tazzari PL, Ricci F, Lazzari G & Galli C 2014 Isolation and in vitro characterization of bovine amniotic fluid derived stem cells at different trimesters of pregnancy. Stem Cell Reviews 10 712724. (doi:10.1007/s12015-014-9525-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Saadeldin IM, Oh HJ & Lee BC 2015 Embryonic-maternal cross-talk via exosomes: potential implications. Stem Cells Cloning 8 103107.

  • Sidney LE, Branch MJ, Dunphy SE, Dua HS & Hopkinson A 2014 Concise review: evidence for CD34 as a common marker for diverse progenitors. Stem Cells 32 13801389. (doi:10.1002/stem.1661)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Subramanian A, Fong C, Biswas A & Bongso A 2015 Comparative characterization of cells from the various compartments of the human umbilical cord shows that the Wharton’s Jelly compartment provides the best source of clinically utilizable mesenchymal stem cells. PLos ONE 10 e0127992. (doi:10.1371/journal.pone.0127992)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M & Pollitt C 2011 Lamellar leukocyte infiltration and involvement of IL-6 during oligofructose-induced equine laminitis development. Veterinary Immunology and Immunopathology 144 120128. (doi:10.1016/j.vetimm.2011.07.016)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang W, Itaka K, Ohba S, Nishiyama N, Chung U, Yamasaki Y & Kataoka K 2009 3D spheroid culture system on micropatterned substrates for improved differentiation efficiency of multipotent mesenchymal stem cells. Biomaterials 30 27052715. (doi:10.1016/j.biomaterials.2009.01.030)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yagi H, Soto-Gutierrez A, Parekkadan B, Kitagawa Y, Tompkins RG, Kobayashi N & Yarmush ML 2010 Mesenchymal stem cells: mechanisms of immunomodulation and homing. Cell Transplant 19 667679. (doi:10.3727/096368910X508762)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yazdanpanah G, Paeini-Vayghan G, Asadi S & Niknejad H 2015 The effects of cryopreservation on angiogenesis modulation activity of human amniotic membrane. Cryobiology 71 413418. (doi:10.1016/j.cryobiol.2015.09.008)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Doubling times of AM-MSCs (A) and WJ-MSCs (B) over seven passages of culture. *P < 0.05.

  • (A, B and C): Scratch assay on WJ-MSCs at T0 (A) and after 24 h (B) of cell growth. The same on AM-MSCs at T0 (C) and after 24 h (D) (Magnification 4×, scale bar 100 µm). (E and F) Adhesion assay. Volume reconstruction and visualization of a WJ (on the left) and a AM (on the right) MSCs spheroid, obtained after 24 h of hanging drop culture (Magnification 10×, scale bar 10 µm). (G) 3D Volume reconstruction obtained by ReViSP (scale in pixels).

  • In vitro differentiation studies. Magnification 20×, scale bar 100 µM. (A) Cells induced toward chondrogenic differentiation and control: glycosaminoglycans in cartilage matrix are stained by Alcian Blue and appear bright blue in the pictures. (B) Osteogenic-induced cells and control: extracellular calcium deposition are stained black by von Kossa. (C) Cells induced toward adipogenic differentiation: Oil red O stains in red intra-cellular lipid droplet. CI, chondrogenic induction; OI, osteogenic induction; AI, adipogenic induction

  • AM-MSCs and WJ-MSCs labeled with antibodies against antigens N-Cadherin, alpha-SMA, e-Cadherin and pan-Cytokeratin. As showed by the merge of Hoechst and antibody staining, both cell populations were positive for N-Cadherin and alpha-SMA, while lacked the expression of e-Cadherin and pan-Cytokeratin. Magnification 40×, scale bar 1.000 µM.

  • PCR analysis of WJ-MSCs and AMMSCs at P3. GAPDH was used as the reference gene. Positive markers expression was reported.

  • Comparative ultrastructural features of AM-MSCs and WJ-MSCs. (A) Single round-shaped AM-MSC with a unique euchromatic irregularly-profiled nucleus. (B) A group of reciprocally adherent WJ-MSCs with a single large euchromatic nucleus and a cytoplasm rich in vacuolar bodies. (C) Well-developed Golgi complex and a group of large secreting granules in AM-MSCs. (D) Golgi apparatus in the juxta-nuclear area producing large secreting granules (WJ-MSCs). (E) RER showing linear flat profiles and dilated cisternae (AM-MSCs). (F) Dilated cisternae of the RER (WJ-MSCs). (G) Cell cytoplasm containing a huge number of vacuolar elements, up to 2 μM in diameter (AM-MSCs). (H) vacuolar structures comprising endo-luminal vesicles, very heterogeneous in size and morphology (WJ-MSCs).

  • Comparative ultrastructural features of AM-MSCs and WJ-MSCs. (A) Maturing MVB in a AM-MSC. (B) Maturing MVB in a WJ-MSC. (C) Membrane vesicles of different size located in the peri-cellular space of AM-MSCs. (D) Isolated (arrows) and aggregated (arrow head) extracellular vesicles located nearby the cell membrane of WJ-MSCs. (E) complex vesicle containing round-shaped small vesicles (AM-MSCs). (F) Large complex vesicle budding from the cell surface (WJ-MSCs). (G) Tunneling nanotube connecting two adjacent AM-MSCs. (H) Tunneling nanotube emerging from a cell (WJ-MSCs).

  • WJ-MSCs – Morphological features of extracellular matrix. (A) Extracellular fibrillar matrix (EFM). (B) EFM, high magnification. (C) Extracellular vesicles entrapped in EFM.

  • Bellotti C, Duchi S, Bevilacqua A, Lucarelli E & Piccinini F 2016 Long term morphological characterization of mesenchymal stromal cells 3D spheroids built with a rapid method based on entry-level equipment. Cytotechnology 68 24792490. (doi:10.1007/s10616-016-9969-y)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Biancone L, Bruno S, Deregibus MC, Tetta C & Camussi G 2012 Therapeutic potential of mesenchymal stem cell-derived microvesicles. Nephrology Dialisis Transplantation 27 30373042. (doi:10.1093/ndt/gfs168)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Burk J, Ribitsch I, Gittel C, Juelke H, Kasper C, Staszyk C & Brehm W 2013 Growth and differentiation characteristics of equine mesenchymal stromal cells derived from different sources. Veterinary Journal 195 98106. (doi:10.1016/j.tvjl.2012.06.004)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Carrade DD, Lame MW, Kent MS, Clark KC, Walker NJ & Borjesson DL 2012 Comparative analysis of the immunomodulatory properties of equine adult-derived mesenchymal stem cells. Cell Medicine 4 111. (doi:10.3727/215517912X647217)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Castagnetti C, Mariella J, Pirrone A, Cinotti S, Mari G & Peli A 2012 Expression of interleukin-1 β, interleukin-8, and interferon-γ in blood samples obtained from healthy and sick neonatal foals. American Journal of Veterinary Research 73 14181427. (doi:10.2460/ajvr.73.9.1418)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chimenti I, Smith RR, Li TS, Gerstenblith G, Messina E, Giacomello A & Marbán E 2010 Relative roles of direct regeneration versus paracrine effects of human cardiosphere-derived cells transplanted into infarcted mice. Circulation Research 106 971980. (doi:10.1161/CIRCRESAHA.109.210682)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Choi M, Lee H, Naidansaren P, Kim H, Cha J, Ahn H, Yang P, Shin J & Joe Y 2013 Proangiogenic features of Wharton’s jelly-derived mesenchymal stromal/stem cells and their ability to form functional vessels. International Journal of Biochemistry and Cell Biology 45 560570. (doi:10.1016/j.biocel.2012.12.001)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colleoni S, Bottani E, Tessaro I, Mari G, Merlo B, Romagnoli N, Spadari A, Galli C & Lazzari G 2009 Isolation, growth and differentiation of equine mesenchymal stem cells: effect of door, source, amount of tissue and supplementation with basic fibroblast growth factor. Veterinary Research Communication 33 811821. (doi:10.1007/s11259-009-9229-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Corradetti B, Lange-Consiglio A, Barucca M, Cremonesi F & Bizzarro D 2011 Size-sieved subpopulations of mesenchymal stem cells from intervascular and perivascular equine umbilical cord matrix. Cell Proliferation 44 330342. (doi:10.1111/j.1365-2184.2011.00759.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • De Coppi P, Bartsch G, Siddiqui MM, Xu T, Santos CC, Perin L, Mostoslavsky G, Serre AC, Snyder EY & Yoo JJ et al. 2007 Isolation of amniotic stem cell lines with potential for therapy. Nature Biotechnology 25 100106. (doi:10.1038/nbt1274)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Desmarais J, Demers S, Suzuki JJ, Laflamme S, Vincent P, Laverty S & Smith L 2011 Trophoblast stem cell marker gene expression in inner cell mass-derived cells from parthenogenetic equine embryos. Reproduction 141 321332. (doi:10.1530/REP-09-0536)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D & Horwitz E 2006 Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8 315317. (doi:10.1080/14653240600855905)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Guest DJ, Smith MR & Allen WR 2010 Equine embryonic stem-like cells and mesenchymal stromal cells have different survival rates and migration patterns following their injection into damaged superficial digital flexor tendon. Equine Veterinary Journal 42 636642. (doi:10.1111/j.2042-3306.2010.00112.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • György B, Szabò T, Pàsztòi M, Pàl Z, Mijàk P, Aradi B, Làszlò V, Pàllinger E, Pap E & Kittel A et al. 2011 Membrane vesicles, current state-of-the-art: emerging role of extracellular vesicles. Cellular and Molecular Life Sciences 68 26672688. (doi:10.1007/s00018-011-0689-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Brunori L, Pirrone A, Pagliaro PP, Ricci F, Tazzari PL & Merlo B 2012 Isolation, characterization and differentiation of mesenchymal stem cells from amniotic fluid, umbilical cord blood and Wharton’s jelly in the horse. Reproduction 143 455468. (doi:10.1530/REP-10-0408)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Merlo B, Romagnoli N, Rossi B, Ricci F & Spadari A 2015a Equine bone marrow and adipose tissue mesenchymal stem cells: cytofluorimetric characterization, in vitro differetiation and clinical application. Journal of Equine Veterinary Sciences 35 130140. (doi:10.1016/j.jevs.2014.12.010)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iacono E, Rossi B & Merlo B 2015b Stem cells from foetal adnexa and fluid in domestic animals: an update on their features and clinical application. Reproduction in Domestic Animals 50 353364. (doi:10.1111/rda.12499)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jischa S, Walter I, Nowotny N, Palm F, Budik S, Kolodziejek J & Aurich C 2008 Uterine involution and endometrial function in postpartum pony mares. American Journal of Veterinary Research 69 15251534. (doi:10.2460/ajvr.69.11.1525)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kavanagh D, Robinson J & Kalia N 2014 Mesenchymal stem cell priming: fine-tuning adhesion and function. Stem Cell Reviews 10 587599. (doi:10.1007/s12015-014-9510-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kol A, Walker NJ, Galuppo LD, Clark KC, Buerchler S, Bernanke A & Borjesson DL 2013 Autologous point-of-care cellular therapies variably induce equinemesenchymal stem cell migration, proliferation and cytokine expression. Equine Veterinary Journal 45 193198. (doi:10.1111/j.2042-3306.2012.00600.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kopher RA, Penchev VR, Islam MS, Hill KL, Khosla S & Kaufman DS 2010 Human embryonic stem cell-derived CD34+ cells function as MSC progenitor cells. Bone 47 718728. (doi:10.1016/j.bone.2010.06.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lamalice L, Le Boeuf F & Huot J 2007 Endothelial cell migration during angiogenesis. Circulation Research 100 782794. (doi:10.1161/01.RES.0000259593.07661.1e)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lange-Consiglio A, Corradetti B, Meucci A, Bizzaro D & Cremonesi F 2013 Characteristics of equine mesenchymal stem cells derived from amnion and bone marrow: in vitro proliferative and multilineage potential assessment. Equine Veterinary Journal 45 737744. (doi:10.1111/evj.12052)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lange-Consiglio A, Perrini C, Tasquier R, Deregibus M, Camussi G, Pascucci L, Marini M, Corradetti B, Bizzarro D & De Vita B et al. 2016 Equine amniotic microvesicles and their anti-inflammatory potential in a tenocyte model in vitro. Stem Cells Development 25 610621. (doi:10.1089/scd.2015.0348)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li G, Zhang X, Wang H, Wang X, Meng C, Chan C, Yew D, Tsang K, Li K & Tsai S et al. 2009 Comparative proteomic analysis of mesenchymal stem cells derived from human bone marrow, umbilical cord and placenta: implication in the migration. Proteomics 9 2030. (doi:10.1002/pmic.200701195)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liang CC, Park AY & Guan JL 2007 In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nature Protocols 2 329333. (doi:10.1038/nprot.2007.30)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liang X, Ding Y, Zhang Y, Tse H & Lian Q 2014 Paracrine mechanisms of mesenchymal stem cell-based therapy: current status and perspectives. Cell Transplantation 23 10451059. (doi:10.3727/096368913X667709)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Maia L, Landim-Alvarenga FC, Da Mota LS, De Assis Golim M, Laufer-Amorim R, De Vita B, Barberini DJ, Listoni AJ, De Moraes CN & Heckler MC et al. 2013 Immunophenotypic, immunocytochemistry, ultrastructural, and cytogenetic characterization of mesenchymal stem cells from equine bone marrow. Microscopy Research and Technique 76 618624. (doi:10.1002/jemt.22208)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mizuno H & Hyakusoku H 2003 Mesengenic potential and future clinical perspective of human processed lipoaspirate cells. Journal of Nippon Medical School 70 300306. (doi:10.1272/jnms.70.300)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mohanty N, Gulati B, Kumar R, Gera S, Kumar P, Somasundaram R & Kumar S 2014 Immunophenotypic characterization and tenogenic differentiation of mesenchymal stromal cells isolated from equine umbilical cord blood. In Vitro Cellular and Developmental Biology – Animal 50 538548. (doi:10.1007/s11626-013-9729-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nielsen J & McNagny K 2008 Novel functions of the CD34 family. Journal of Cell Science 121 36833692. (doi:10.1242/jcs.037507)

  • Paris DB & Stout TA 2010 Equine embryos and embryonic stem cells: defining reliable markers of pluripotency. Theriogenology 74 516524. (doi:10.1016/j.theriogenology.2009.11.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Mercati F, Marini C, Ceccarelli P, Dall'Aglio C, Pedini V & Gargiulo AM 2010 Ultrastructural morphology of equine adipose-derived mesenchymal stem cells. Histology and Histopathology 25 12771285.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Alessandri G, Dall’Aglio C, Mercati F, Cloliolo P, Bazzucchi C, Dante S, Petrini S, Curina G & Ceccarelli P 2014 Membrane vesicles mediate pro-angiogenic activity of equine adipose-derived mesenchymal stromal cells. Veterinary Journal 202 361366. (doi:10.1016/j.tvjl.2014.08.021)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pascucci L, Dall’Aglio C, Bazzucchi C, Mercati F, Mancini M, Pessina A, Alessandri G, Giammaroli M, Dante S & Brunati G et al. 2015 Horse adipose-derived mesenchymal stromal cells constitutively produce membrane vesicles: a morphological study. Histology and Histopathology 30 549557. (doi:10.14670/HH-30.549)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pasquinelli G, Tazzari PL, Ricci F, Vaselli C, Buzzi M, Conte R, Orrico C, Foroni L, Stella A & Alviano F et al. 2007 Ultrastructural characteristics of human mesenchymal stromal (stem) cells derived from bone marrow and term placenta. Ultrastructural Pathology 31 2331. (doi:10.1080/01913120601169477)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pera MF 2009 Stem cells: low-risk reprogramming. Nature 458 715716. (doi:10.1038/458715a)

  • Perrini C, Strillacci MG, Bagnato A, Esposti P, Marini MG, Corradetti B, Bizzaro D, Idda A, Ledda S & Capra E et al. 2016 Microvesicles secreted from equine amniotic-derived cells and their potential role in reducing inflammation in endometrial cells in an in-vitro model. Stem Cell Research and Therapy 18 169. (doi:10.1186/s13287-016-0429-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rainaldi G, Pinto B, Piras A, Vatteroni L, Simi S & Citti L 1991 Reduction of proliferative heterogeneity of CHEF18 Chinese hamster cell line during the progression toward tumorigenicity. In Vitro Cellular and Developmental Biology 27A 27 949952.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rossi B, Merlo B, Colleoni S, Iacono E, Tazzari PL, Ricci F, Lazzari G & Galli C 2014 Isolation and in vitro characterization of bovine amniotic fluid derived stem cells at different trimesters of pregnancy. Stem Cell Reviews 10 712724. (doi:10.1007/s12015-014-9525-0)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Saadeldin IM, Oh HJ & Lee BC 2015 Embryonic-maternal cross-talk via exosomes: potential implications. Stem Cells Cloning 8 103107.

  • Sidney LE, Branch MJ, Dunphy SE, Dua HS & Hopkinson A 2014 Concise review: evidence for CD34 as a common marker for diverse progenitors. Stem Cells 32 13801389. (doi:10.1002/stem.1661)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Subramanian A, Fong C, Biswas A & Bongso A 2015 Comparative characterization of cells from the various compartments of the human umbilical cord shows that the Wharton’s Jelly compartment provides the best source of clinically utilizable mesenchymal stem cells. PLos ONE 10 e0127992. (doi:10.1371/journal.pone.0127992)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M & Pollitt C 2011 Lamellar leukocyte infiltration and involvement of IL-6 during oligofructose-induced equine laminitis development. Veterinary Immunology and Immunopathology 144 120128. (doi:10.1016/j.vetimm.2011.07.016)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang W, Itaka K, Ohba S, Nishiyama N, Chung U, Yamasaki Y & Kataoka K 2009 3D spheroid culture system on micropatterned substrates for improved differentiation efficiency of multipotent mesenchymal stem cells. Biomaterials 30 27052715. (doi:10.1016/j.biomaterials.2009.01.030)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yagi H, Soto-Gutierrez A, Parekkadan B, Kitagawa Y, Tompkins RG, Kobayashi N & Yarmush ML 2010 Mesenchymal stem cells: mechanisms of immunomodulation and homing. Cell Transplant 19 667679. (doi:10.3727/096368910X508762)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yazdanpanah G, Paeini-Vayghan G, Asadi S & Niknejad H 2015 The effects of cryopreservation on angiogenesis modulation activity of human amniotic membrane. Cryobiology 71 413418. (doi:10.1016/j.cryobiol.2015.09.008)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation