Abstract
Endothelin-2 (EDN2), expressed at a narrow window during the periovulatory period, critically affects ovulation and corpus luteum (CL) formation. LH (acting mainly via cAMP) and hypoxia are implicated in CL formation; therefore, we aimed to elucidate how these signals regulate EDN2 using human primary (hGLCs) and immortalized (SVOG) granulosa-lutein cells. The hypoxiamiR, microRNA-210 (miR-210) was identified as a new essential player in EDN2 expression. Hypoxia (either mimetic compound-CoCl2, or low O2) elevated hypoxia-inducible factor 1A (HIF1A), miR-210 and EDN2. Hypoxia-induced miR-210 was suppressed in HIF1A-silenced SVOG cells, suggesting that miR-210 is HIF1A dependent. Elevated miR-210 levels in hypoxia or by miR-210 overexpression, increased EDN2. Conversely, miR-210 inhibition reduced EDN2 levels, even in the presence of CoCl2, indicating the importance of miR-210 in the hypoxic induction of EDN2. A molecule that destabilizes HIF1A protein, glycerol-3-phosphate dehydrogenase 1-like gene-GPD1L, was established as a miR-210 target in both cell types. It was decreased by miR-210-mimic and was increased by miR-inhibitor. Furthermore, reducing GPD1L by endogenously elevated miR-210 (in hypoxia), miR-210-mimic or by GPD1L siRNA resulted in elevated HIF1A protein and EDN2 levels, implying a vital role for GPD1L in the hypoxic induction of EDN2. Under normoxic conditions, forskolin (adenylyl cyclase activator) triggered changes typical of hypoxia. It elevated HIF1A, EDN2 and miR-210 while inhibiting GPD1L. Furthermore, HIF1A silencing greatly reduced forskolin’s ability to elevate EDN2 and miR-210. This study highlights the novel regulatory roles of miR-210 and its gene target, GPD1L, in hypoxia and cAMP-induced EDN2 by human granulosa-lutein cells.
Introduction
Endothelin 2 (EDN2), a small peptide that belongs to the EDN family of pleiotropic peptides (Inoue et al. 1989, Arinami et al. 1991), is emerging as a crucial player in follicular rupture, ovulation and corpus luteum (CL) formation (Palanisamy et al. 2006, Klipper et al. 2010, Cacioppo et al. 2014).
Although the role of LH in ovulation and CL formation is well established, it only became apparent in recent years that hypoxia may play an important complementary role (Boonyaprakob et al. 2005, Duncan et al. 2008, van den Driesche et al. 2008, Nishimura & Okuda 2010, Jiang et al. 2011, Meidan et al. 2013). Hypoxic conditions prevail in CL at early stages of its development (Boonyaprakob et al. 2005, Duncan et al. 2008, van den Driesche et al. 2008, Nishimura & Okuda 2010, Jiang et al. 2011). Hypoxia is known to transcriptionally activate a variety of genes affecting CL formation and the angiogenic process (Kim et al. 2009, Klipper et al. 2010, Tam et al. 2010, Zhang et al. 2012, Yalu et al. 2015). Hypoxia also enhances bovine granulosa cell proliferation (Jiang et al. 2011, Shiratsuki et al. 2016) and progesterone synthesis (Fadhillah et al. 2014), further contributing to CL formation. Soon after ovulation, EDN2 is elevated simultaneously with hypoxia-inducible factor 1A (HIF1A) (Klipper et al. 2010), suggesting a functional link between these two factors in a physiological context. Indeed, in vitro, EDN2 expression in granulosa cells is upregulated by hypoxia, as shown in various species (Na et al. 2008, Klipper et al. 2010, Zhang et al. 2012, Yalu et al. 2015). Hypoxia stabilizes HIF1A protein by inhibiting the catalytic activity of the prolyl hydroxylase domain (PHD), permitting HIF1A accumulation and nuclear translocation (Semenza 2007). In the nucleus, the HIF1A and B subunits dimerize and bind to hypoxia response elements (HREs) located in the promoters of a number of target genes (Semenza 2007, Adams et al. 2009). HIF1A knockdown abolished hypoxia-induced EDN2, confirming that EDN2 is a HIF1A-responsive gene (Yalu et al. 2015).
Besides hypoxia, EDN2 was elevated in primary bovine granulosa and SVOG cells treated with forskolin (adenylyl cyclase activator) or LH/hCG alone (Klipper et al. 2010, Zhang et al. 2012, Yalu et al. 2015). Additionally, LH, along with hypoxia (CoCl2), synergistically augments HIF1A protein levels and consequently, higher EDN2 and VEGFA were observed in primary bovine granulosa cells (Yalu et al. 2015). The combined effect of gonadotropins and hypoxia results from elevated HIF1A mRNA by LH/hCG (Duncan et al. 2008, Yalu et al. 2015), which becomes apparent with HIF1A stabilization in hypoxia (Yalu et al. 2015). Importantly, LH alone elevated HIF1A and EDN2 mRNAs without visible changes in HIF1A protein (Yalu et al. 2015). Therefore, it remains to be determined whether HIF1A is involved in the transcriptional activation of cAMP-induced EDN2.
MicroRNA-210 (miR-210), also known as hypoxiamiR, is another direct transcriptional target of HIF1A (Camps et al. 2008, Huang et al. 2009, Chan & Loscalzo 2010, Guo et al. 2015) and was shown to be modulated by hypoxia in several non-granulosa cells (Devlin et al. 2011, Chan et al. 2012). Quite a few miR-210 gene targets were identified, two of which, glycerol-3-phosphate dehydrogenase 1-like (GPD1L) and succinate dehydrogenase complex subunit D (SDHD), have been reported to increase the catalytic activity of PHD, therefore de-stabilizing HIF1A (Kelly et al. 2011, Puissegur et al. 2011, Merlo et al. 2012). However, the regulation of miR-210 or its gene targets in ovarian cells has not yet been studied.
To better elucidate the molecular regulation of EDN2, we investigated the roles of HIF1A, miR-210, GPD1L and SDHD in granulosa cells exposed to hypoxia (CoCl2, and 1% O2) or cAMP (elevated with forskolin) using human primary and immortalized granulosa-lutein cells. To this end, siRNAs, miR-mimic and inhibitor were used as tools to target gene expression and as well as miR-210 activity.
Materials and methods
All biochemical reagents were obtained from Sigma-Aldrich and cell culture materials were from Biological Industries, Kibbutz Beit Haemek, Israel unless otherwise stated.
Cell cultures
The Hadassah Hebrew University Medical Center Institutional Review Board approved this study (HMO-0110-09) and all subjects gave written informed consent. All women were under 35 years of age and were undergoing IVF treatment, due to male factor infertility (MFI). Primary human granulosa-lutein cells (hGLCs) were isolated as described previously (Imbar et al. 2012) and cultured in a Dulbecco-modified Eagle medium (DMEM)/F-12 medium containing 10% fetal calf serum (FCS), 2 mM l-glutamine and 100 µg/mL of penicillin. These processes were repeated three times to represent three independent experiments. Cell density at the time of the assay was about 60–70% and the morphology was typical of round granulosa cells.
Immortalized human granulosa-lutein cells (SVOG cells) were a generous gift from N Auersperg and P Leung (University of British Columbia, BC, Canada) and were used as granulosa-lutein model. These cells are a non-tumorigenic immortalized human granulosa-lutein cell line, produced by transfecting human granulosa-lutein cells (obtained from patients undergoing IVF) with the SV40 large T antigen (Lie et al. 1996). Because primary hGLCs cells were used to generate the immortalized SVOG cells, both cell types display similar biological responses to many different treatments and have been used extensively in experiments (in vitro) (Kisliouk et al. 2003, Fang et al. 2014, Chang et al. 2015, Chen et al. 2015).
The cells were cultured in DMEM/F-12 medium containing 10% fetal calf serum (FCS), 2 mmol/L l-glutamine, and 100 µg/mL of penicillin/streptomycin (Fang et al. 2014, Chang et al. 2015). Cultures were maintained in humidified 95% air–5% CO2 at 37°C or, in specific experiments, incubated with CoCl2 (25–100 µmol/L) or in a humidified multi-gas chamber (1% O2, 5% CO2, and 94% N2; Sanyo, Japan) in 1% FCS for 6–36 h, as indicated.
Cell transfection
siRNA:SVOG cells were trypsinized with trypsin–EDTA solution (0.05% trypsin and 0.02% EDTA) and plated (1.5 × 105/well) immediately on six-well plates and cultured for 24 h. Cells were transfected with 50 nmol/L siRNA constructs (Genecust, Luxembourg) targeting HIF1A (Yalu et al. 2015) or GPD1L or with scrambled siRNA (the negative control; Table 1) using Lipofectamine 2000 (ThermoFisher Scientific) reagent in 1% FCS, as described previously (Shrestha et al. 2015). After 24 h of transfection, the medium was replaced with 1% FCS and briefly exposed to CoCl2 (100 µmol/L) or forskolin (10 µmol/L) for the times indicated. Total RNA or proteins were then extracted from cells 48 and 72 h after transfection (for mRNA and protein levels, respectively).
siRNA sequences for gene silencing.
| Target gene | siRNA sequence | Accession No. | Target location | |
|---|---|---|---|---|
| Sense | Antisense | |||
| HIF1A-siRNA | cugaugaccagcaacuugadtdt | ucaaguugcuggucaucagdtdt | NM_001530 | 1663–1681 |
| GPD1L-siRNA | aaauuucugaaguuucuugdadc | acgugacacguucggagaadtdt | NM_015141 | 285–303 |
| Scrambled siRNA | uucuccgaacgugucacgudtdt | acgugacacguucggagaadtdt | None | None |
miR-210: miR-210-mimic or miR-210-inhibitor and their negative control oligos were purchased from Ambion (ThermoFisher Scientific) and Bioneer (Daejeo, Republic of Korea). SVOG cells or primary hGLCs were plated (0.3 × 106/well) in six-well plates 24 h prior to transfection. Cells were then transfected either with miR-210-mimic (10 nmol/L), miR-210-inhibitor (60 nmol/L) or their respective negative control (miR-NC or miR-iNC) in 1% FCS for 24 h using Lipofectamine RNAiMAX reagent (ThermoFisher Scientific) according to the manufacturer’s recommended protocol. After 24 h of transfection, the medium was replaced with 10% FCS, and cells were harvested for RNA and protein determinations, 48 h and 72 h post transfection, respectively.
Messenger RNA and miRNA quantitation
Total RNA was isolated using Tri-reagent (Molecular Research Center, Cincinnati, OH, USA). This reagent allows for mRNA and miRNA extraction. Total cDNA was synthesized as previously described (Rayhman et al. 2008, Klipper et al. 2010). miRNA cDNA was synthesized from the purified total RNA (700 ng) using the qScript microRNA Synthesis Kit (Quanta Biosciences, Inc., Beverly, MA, USA). Quantitative PCRs for gene expression were performed using the LightCycler 96 system (Roche Diagnostics), with SYBR Green I master (Roche Diagnostics) as previously described (Klipper et al. 2010) and for miR-210 with PerfeCTa SYBR Green SuperMix, Low ROX (Quanta Biosciences). The PerfeCTa microRNA assay included Universal Primer, miR-210 Primer and SNORD44 as positive control primers (Quanta Biosciences). Beta-actin (ACTB) and ribosomal protein S18 (RPS18) were used as housekeeping genes. Sequences of primers used for quantitative (q) PCR are listed in Table 2. Primers were designed using Oligo Primer Analysis Software (Molecular Biology Insights, Inc. Colorado Springs, USA) based on the available human sequences and span an intron to prevent amplification of genomic DNA.
Sequences of primers used for qPCR.
| Genes | Primer sequence (5′–3′) | Accession No. |
|---|---|---|
| ACTB | f: cgggacctgacggactacctc r:gccatctcctgctcgaagtcc |
NM_001100 |
| RPS18 | f: caccaagagggcgggaga r: cttcttcagtcgctccagg |
NM_022551 |
| HIF1A | f: actcatccatgtgaccacg r: tagttctcccccggctag |
NM_001530 |
| EDN2 | f: gccagcgtcctcatctat r: gccgtaaggagctgtctgttc |
NM_001956 |
| GPD1L | f: gatgcagacactgttgaactc r: aggtggctgtagacacttgg |
NM_015141 |
| SDHD | f: tccttgctctgcgatggac r: gctttgcagatgcccacat |
NM_003002 |
Western blot analyses
Proteins were extracted by adding sample buffer (×2), separated by 7.5–12.0% SDS-PAGE, and subsequently transferred to nitrocellulose membranes, as previously reported (Klipper et al. 2010). The protein samples were separated by 7.5–10% SDS-PAGE under reducing conditions. Membranes were blocked for 1 h in TBST (20 mmol/L Tris, 150 mmol/L NaCl and 0.1% Tween 20; pH 7.6) containing 5% low-fat milk, and then incubated overnight at 4°C with the following respective primary antibodies overnight at 4°C: rabbit anti-HIF1A (H-206; Santa Cruz Biotechnology, diluted 1:500) and rabbit anti-p44/42 total MAPK (diluted 1:50,000; used as the loading control). The membranes were incubated with peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch) for 1 h at room temperature. A chemiluminescent signal was generated with SuperSignal (Thermo Fisher Scientific), and the signal was captured either with membranes exposed to X-ray films or ImageQuant LAS 500 (GE Healthcare Life Sciences). The protein bands were analyzed using Gel-Pro 32 Software (Media Cybernetics, Silver Spring, MD, USA). Densitometric quantifications are relative to respective controls and are normalized to the levels of total MAPK p44/42.
Statistical analysis
Data are presented as means ± s.e.m. Each experiment was repeated at least three times. Comparison between two groups was performed by Student t-test. Comparison among multiple groups was performed by one-way analysis of variance (ANOVA) followed by Newman–Keuls test. Significance was defined at a value of P < 0.05 or lower.
Results
The relationship between HIF1A, miR-210 and EDN2
The temporal patterns of HIF1A protein and miR-210 were closely related in SVOG cells exposed to hypoxia (Figs 1 and 2). As expected, hypoxia mimetic CoCl2 (100 µmol/L) elevates HIF1A protein levels (Fig. 1A). The intensity of HIF1A protein increased in a time-dependent manner, with stronger intensity at 36 h. Importantly, hypoxia significantly elevated miR-210 levels simultaneously with those of HIF1A in SVOG cells (Fig. 1B). At 24 h, miR-210 was induced by 3-fold, and was further increased at 36 h (4-fold as compared with the respective control; Fig. 1B). Next, to determine whether HIF1A mediates the hypoxic induction of miR-210, HIF1A was silenced using siRNA. This siRNA markedly reduced HIF1A protein levels (Fig. 2A), which also was shown before (Yalu et al. 2015). HIF1A-silenced SVOG cells exhibited significantly lower levels of miR-210 under hypoxic conditions (Fig. 2B). This was evident for both 25 and 100 µmol/L CoCl2 with a maximal inhibition of 75% (compared with scrambled siRNA) at 100 µmol/L CoCl2 (Fig. 2B). The findings, presented in Figs 1 and 2, show that miR-210 levels are regulated in SVOG cells in a HIF1A-dependent manner.
Induction of HIF1A protein and miR-210 by hypoxia. SVOG cells were incubated with hypoxia mimetic (CoCl2; 100 µmol/L) for the indicated times. (A) Representative Western blot of HIF1A protein. (B) miR-210 levels measured by qPCR. **P < 0.01 indicates significant differences from the levels at 6-h hypoxic condition. # represents the difference from 24-h time point in hypoxia (P < 0.05).
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
HIF1A knockdown downregulates miR-210 levels. (A) Representative western blot of HIF1A protein. (B) miR-210 levels measured by qPCR. SVOG cells were transfected with scrambled siRNA or siRNA targeting HIF1A (HIF1A siRNA). After 24 h of transfection, cells were incubated with CoCl2 (25–100 µmol/L) for another 24 h. P values indicate significant differences from their respective CoCl2 in scrambled siRNA-transfected cells. Scrambled siRNA without CoCl2 is designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
Next, we studied the effect of varied miR-210 levels in SVOG cells using miR-210-mimic or miR-210-inhibitor on EDN2 and HIF1A protein, under hypoxic conditions (Fig. 3). As expected, hypoxia significantly stimulated the HIF1A protein and the HIF1A-dependent gene, EDN2. Moreover, miR-210 overexpression in hypoxia further increased HIF1A protein as well as EDN2 (Fig. 3). miR-210 inhibition had an opposite effect: it significantly reduced EDN2 elevated in the presence of CoCl2 (Fig. 3B). However, although miR-210 inhibition lowered HIF1A, it did not reach statistical significance (Fig. 3A). This most likely results from poor sensitivity of standard western blotting technique, discussed later.
Effect of miR-210 manipulation on HIF1A protein (A) and EDN2 (B) levels under hypoxic conditions. SVOG cells were transfected with either miR-210-mimic vs its respective miR-negative control (miR-NC) or miR-210-inhibitor vs its respective miR-inhibitor negative control (also designated miR-NC). *P < 0.05, which indicates significant differences from miR-negative controls without CoCl2, is designated as 1. Multiple comparisons were performed by one-way analysis of variance (ANOVA) followed by a Newman–Keuls test.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
miR-210 regulates EDN2 via its target genes (GPD1L and SDHD)
Data depicted in Fig. 4 further show that miR-210 is positively correlated with EDN2 in hGLCs and SVOG cells; miR-210 overexpression elevated EDN2 (Fig. 4A and C), whereas transfecting hGLCs with miR-210 inhibitor reduced EDN2 levels (Fig. 4B). We next examined GPD1L and SDHD as plausible gene targets of miR-210 in primary hGLCs and SVOG cells. MiR-210 overexpression by itself, significantly downregulated GPD1L and SDHD in primary hGLCs (Fig. 4A) and in SVOG cells (Fig. 4C). miR-210 inhibition showed an inverse relationship: it significantly increased the expression of GPD1L (1.5-fold) and SDHD (2-fold) compared with miR-iNC (Fig. 4B). These data suggest that miR-210 may affect EDN2 by downregulating its target genes: GPD1L and SDHD in hGLCs.
miR-210 manipulation affects expression on GPD1L, SDHD and EDN2 in primary hGLCs and SVOG cells. hGLCs (A) and SVOG cells (C) were transfected either with miR-210-mimic or miR-negative control (miR-NC). (B) hGLCs were transfected either with miR-210-inhibitor or miR-inhibitor negative control (miR-iNC). Cells were collected 48 h post transfection. P values indicate significant differences from their respective NC designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
To examine this contention using physiological cues, we incubated SVOG cells and primary hGLCs with reduced oxygen tension (1% O2) expected to elevate miR-210 as suggested by data demonstrated in Fig. 1 with hypoxia mimetic agent. Low oxygen resulted in time-dependent increased HIF1A protein in SVOG cells (Fig. 5A). Levels of miR-210 were indeed elevated under reduced oxygen tension (1% O2; 4-fold at 24 h compared to normoxia; Fig. 5B). Hypoxia reduced GPD1L in SVOG cells (by 50% at 24 h; Fig. 5B) and also in primary hGLCs (Fig. 6; 33% at 6 h). SDHD expression did not change under the same conditions in SVOG cells (Fig. 5C) or marginally downregulated in the primary hGLCs. As shown in Fig. 6, EDN2 expression in primary hGLCs was also stimulated by reduced O2.
Effect of hypoxia (1% O2) on HIF1A protein (A), miR-210 (B), GPD1L (C) and SDHD (D) levels. SVOG cells were incubated either under normoxic (21% O2) or hypoxic (1% O2) conditions for designated time points. *P < 0.05 indicates significant differences from the levels at 6 h under normoxic conditions, designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
Effect of hypoxia (1% O2) on GPD1L (A), SDHD (B), and EDN2 (C) mRNA levels in primary hGLCs. Cells were incubated either under normoxic (21% O2) or hypoxic (1% O2) conditions for 6 h. P values indicate significant differences from the levels under normoxic conditions, designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
To determine whether reduced GPD1L and SDHD may contribute to sustained HIF1A protein and EDN2 levels, we manipulated their expression in SVOG cells, independently of miR-210, using specific siRNAs. GPD1L was significantly silenced to levels that were only ~40% of those of scrambled siRNA-transfected cells (Fig. 7A). As hypothesized, under hypoxia, GPD1L silencing significantly elevated HIF1A protein levels (Fig. 7B) and a concomitant elevation of EDN2 levels was noted (Fig. 7C). Specific siRNA also successfully silenced SDHD expression (data not shown); however, these cells exhibited poor viability; therefore, further analyses were not conducted.
SiRNA knockdown of GPD1L (A) elevates HIF1A protein (B) and EDN2 mRNA (C) levels. SVOG cells were transfected with scrambled siRNA or siRNA targeting GPD1L (GPD1L-siRNA). Sixty-eight hours after transfection, cells were incubated with CoCl2 (100 µmol/L) for 4 h. P values indicate significant differences from scrambled siRNA, designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
HIF1A is required for forskolin-regulated miR-210 and EDN2
As alluded to in the introduction, elevated cAMP levels, stimulated by forskolin, augmented EDN2 (Kim et al. 2009, Yalu et al. 2015). We therefore next examined whether forskolin influenced genes similarly to hypoxia. Forskolin increased HIF1A and EDN2 in SVOG cells in comparison with their respective controls (cells incubated in media alone, Table 3). The data in Table 3 also indicates that forskolin elevated miR-210 and inhibited GPD1L. Note that the forskolin-induced changes shown in Table 3 occurred under normoxic conditions. To verify whether these actions of forskolin are HIF1A dependent, HIF1A siRNA was utilized. HIF1A silencing indeed abolished HIF1A in control and forskolin-treated SVOG cells to levels that were ~20% of those in scrambled siRNA-transfected SVOG cells (Fig. 8A). In the absence of HIF1A, forskolin’s ability to induce EDN2 (Fig. 8B) and miR-210 (Fig. 8C) was significantly hampered. GPD1L expression remained unchanged in these experiments (data not shown).
HIF1A silencing suppresses forskolin-induced HIF1A (A), EDN2 (B) and miR-210 (C) levels. SVOG cells were transfected with scrambled siRNA or siRNA targeting HIF1A (HIF1A siRNA). At 24 h post transfection, cells were incubated with forskolin for another 24 h. P values indicate significant differences from their respective forskolin in scrambled siRNA-transfected cells. Scrambled siRNA without forskolin is designated as 1.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
Forskolin triggers changes typical to hypoxia.
| Fold change from control | P value | |
|---|---|---|
| HIF1A | 1.51 ± 0.1 | 0.01 |
| EDN2 | 1.80 ± 0.15 | 0.006 |
| miR-210 | 1.55 ± 0.2 | 0.04 |
| GPD1L | 0.82 ± 0.04 | 0.001 |
SVOG cells were incubated for 24 h with forskolin (10 µmol/L). P values indicate significant differences from their respective control (cells incubated in media alone; designated as 1).
Discussion
The data presented here propose a novel regulatory pathway, emphasizing the role of HIF1A/miR-210/GPD1L loop in promoting EDN2 expression in human granulosa-lutein cells as illustrated in Fig. 9.
Potential mechanisms regulating EDN2 in human granulosa-lutein cells as implied by data using primary and immortalized human granulosa-lutein cells. Hypoxia (CoCl2 or 1% O2) and elevated cAMP (by gonadotropins) induce HIF1A; HIF1A protein activates miR-210 and EDN2 transcription through HRE in their promoter regions (Semenza 2007, Huang et al. 2009). miR-210 downregulates its gene target: GPD1L, suppressing PHD-dependent hydroxylation of HIF1A thereby stabilizing its protein levels (Kelly et al. 2011). Altogether, these events promote a sustained EDN2 expression.
Citation: Reproduction 155, 2; 10.1530/REP-17-0574
This study highlights the role of miR-210 as an important component of the adaptive response to HIF1A in ovarian steroidogenic cells. miR-210 was elevated in SVOG cells exposed to hypoxia, whereas HIF1A silencing prevented this induction. The levels of miR-210 were positively correlated with EDN2. Elevating endogenous miR-210 by hypoxia and miR-mimic increased EDN2, whereas inhibiting miR-210 reduced EDN2 even in the presence of CoCl2, implying the significance of miR-210 in the hypoxic induction of this gene. In support, a recent in vivo study reported that miR-210 is markedly upregulated in early bovine CL (Gecaj et al. 2017), overlapping the expression profile of EDN2 in in this gland (Klipper et al. 2010). Forskolin, although less prominently, also elevated miR-210 and EDN2 while reducing GPD1L, suggesting that forskolin initiates a response similar to that of hypoxia. Furthermore, similar to hypoxia, most of these effects of forskolin were abolished with HIF1A silencing, demonstrating the significance of HIF1A/miR-210 also in cAMP elevated EDN2.
In both SVOG cells and primary hGLCs, transfection with miR-210-mimic (increasing miR-210 levels by >500 folds) markedly suppressed GPD1L and SDHD, implying that these genes are miR-210 targets. Pertinent to miR-210’s role in hypoxia, these two genes were shown to destabilize HIF1A but with different modes of action (Kelly et al. 2011, Puissegur et al. 2011). Reduced SDHD caused succinate accumulation, a Kreb cycle intermediate that is a natural inhibitor of PHD (Puissegur et al. 2011, Merlo et al. 2012), thus stabilizing HIF1A. GPD1L regulates HIF1A differently; high amounts of GPD1L caused increased proline hydroxylation of HIF1A (Kelly et al. 2011), resulting in proteosomal degradation of HIF1A protein (Semenza 2007). Less vigorous miR-210 induction in hypoxia could still reduce GPD1L but much less so, SDHD suggesting that higher concentration of the miR-210 may be necessary to suppress SDHD in granulosa cells. Experiments utilizing either hypoxia-induced miR-210 or miR-210 overexpression, suggest that GPD1L reduction plays a role in EDN2 expression. GPD1L silencing by its siRNA provides a direct evidence for this assumption, showing increased HIF1A protein and elevated EDN2. These data together imply the need to suppress GPD1L, by elevated miR-210, in order to allow HIF1A accumulation and increase in EDN2. SDHD-silenced SVOG cells exhibited, as expected, signs of functional knockout, e.g., reduced viability and lactate accumulation (Puissegur et al. 2011); however, their poor viability precluded further analyses. Therefore, it is unclear yet whether SDHD plays a role in hypoxic induction of EDN2 in granulosa cells.
Treatment of primary granulosa cells with either gonadotropins (LH/hCG or FSH) or forskolin alone elevated EDN2 (Klipper et al. 2010, Zhang et al. 2012). However, cAMP-induced HIF1A protein could only be detected in conjunction with hypoxia (CoCl2) (Alam et al. 2009). These findings suggest that detection of HIF1A protein by western blotting does not necessarily reflect its transcriptional activity (Alam et al. 2004, 2009, Thompson et al. 2015), which is more robust than the low sensitivity of standard western blotting technique. Both LH and FSH (Alam et al. 2009, Rico et al. 2014) as well as forskolin (this study and Kim et al. 2009) elevated VEGFA and EDN2, without any apparent increase in HIF1A protein. Another example of this contention was noted here using the miR-210-inhibitor; while the transcriptional target of HIF1A i.e. EDN2 was reduced, HIF1A protein was not significantly affected. Rico and coworkers (Rico et al. 2014) provided evidence demonstrating that gonadotropin-regulated Vegfa requires HIF1A transcriptional activity. They reported that granulosa cells from mice that lack a single HRE in the Vegfa promoter failed to respond to FSH or LH with an increase in Vegfa mRNA (Rico et al. 2014). Using a different approach, HIF1A silencing, our results provide additional evidence that cAMP utilizes the HIF1A pathway for inducing the hypoxia-dependent gene, EDN2. Exploring the human EDN2 promoter (−1500 bp) using MatInspector Genomatix software (Cartharius et al. 2005), we identified a putative HRE sequence between 613 and 629 with a core similarity of 0.9. This site could mediate the induction of EDN2 by hypoxia and cAMP-elevating agents. Promoter studies are still needed to validate this contention.
Taken together, this study elucidated novel molecular regulation of EDN2. We found that hypoxia and elevated cAMP increase miR-210 in a HIF1A-dependent manner. miR-210 downregulates its gene target: GPD1L, stabilizing HIF1A protein thus augmenting its responsive gene EDN2. These in vitro findings may also suggest that the two main signals driving CL formation, namely, hypoxia and LH (mimicked in vitro by forskolin) act similarly via HIF1A/miR-210/GPD1L loop to augment EDN2 expression.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This research was supported by grants from the Israel Science Foundation (No. 510/14) R M and the 2015 joint research fund of the Hebrew University and Hadassah Medical Center (R M and T I).
References
Adams JM, Difazio LT, Rolandelli RH, Lujan JJ, Hasko G, Csoka B, Selmeczy Z & Nemeth ZH 2009 HIF-1: a key mediator in hypoxia. Acta Physiologica Hungarica 96 19–28. (https://doi.org/10.1556/APhysiol.96.2009.1.2)
Alam H, Maizels ET, Park Y, Ghaey S, Feiger ZJ, Chandel NS & Hunzicker-Dunn M 2004 Follicle-stimulating hormone activation of hypoxia-inducible factor-1 by the phosphatidylinositol 3-kinase/AKT/Ras homolog enriched in brain (Rheb)/mammalian target of rapamycin (mTOR) pathway is necessary for induction of select protein markers of follicular differentiation. Journal of Biological Chemistry 279 19431–19440. (https://doi.org/10.1074/jbc.M401235200)
Alam H, Weck J, Maizels E, Park Y, Lee EJ, Ashcroft M & Hunzicker-Dunn M 2009 Role of the phosphatidylinositol-3-kinase and extracellular regulated kinase pathways in the induction of hypoxia-inducible factor (HIF)-1 activity and the HIF-1 target vascular endothelial growth factor in ovarian granulosa cells in response to follicle-stimulating hormone. Endocrinology 150 915–928. (https://doi.org/10.1210/en.2008-0850)
Arinami T, Ishikawa M, Inoue A, Yanagisawa M, Masaki T, Yoshida MC & Hamaguchi H 1991 Chromosomal assignments of the human endothelin family genes: the endothelin-1 gene (EDN1) to 6p23-p24, the endothelin-2 gene (EDN2) to 1p34, and the endothelin-3 gene (EDN3) to 20q13.2-q13.3. American Journal of Human Genetics 48 990–996.
Boonyaprakob U, Gadsby JE, Hedgpeth V, Routh PA & Almond GW 2005 Expression and localization of hypoxia inducible factor-1alpha mRNA in the porcine ovary. Canadian Journal of Veterinary Research 69 215–222.
Cacioppo JA, Oh SW, Kim HY, Cho J, Lin PC, Yanagisawa M & Ko C 2014 Loss of function of endothelin-2 leads to reduced ovulation and CL formation. PLoS ONE 9 e96115. (https://doi.org/10.1371/journal.pone.0096115)
Camps C, Buffa FM, Colella S, Moore J, Sotiriou C, Sheldon H, Harris AL, Gleadle JM & Ragoussis J 2008 hsa-miR-210 is induced by hypoxia and is an independent prognostic factor in breast cancer. Clinical Cancer Research 14 1340–1348. (https://doi.org/10.1158/1078-0432.CCR-07-1755)
Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M & Werner T 2005 MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21 2933–2942. (https://doi.org/10.1093/bioinformatics/bti473)
Chan SY & Loscalzo J 2010 MicroRNA-210: a unique and pleiotropic hypoxamir. Cell Cycle 9 1072–1083. (https://doi.org/10.4161/cc.9.6.11006)
Chan YC, Banerjee J, Choi SY & Sen CK 2012 miR-210: the master hypoxamir. Microcirculation 19 215–223. (https://doi.org/10.1111/j.1549-8719.2011.00154.x)
Chang HM, Cheng JC, Huang HF, Shi FT & Leung PC 2015 Activin A, B and AB decrease progesterone production by down-regulating StAR in human granulosa cells. Molecular and Cellular Endocrinology 412 290–301. (https://doi.org/10.1016/j.mce.2015.05.016)
Chen YC, Chang HM, Cheng JC, Tsai HD, Wu CH & Leung PC 2015 Transforming growth factor-beta1 up-regulates connexin43 expression in human granulosa cells. Human Reproduction 30 2190–2201. (https://doi.org/10.1093/humrep/dev175)
Devlin C, Greco S, Martelli F & Ivan M 2011 miR-210: more than a silent player in hypoxia. IUBMB Life 63 94–100. (https://doi.org/10.1002/iub.427)
Duncan WC, van den Driesche S & Fraser HM 2008 Inhibition of vascular endothelial growth factor in the primate ovary up-regulates hypoxia-inducible factor-1alpha in the follicle and corpus luteum. Endocrinology 149 3313–3320. (https://doi.org/10.1210/en.2007-1649)
Fang L, Chang HM, Cheng JC, Leung PC & Sun YP 2014 TGF-beta1 downregulates StAR expression and decreases progesterone production through Smad3 and ERK1/2 signaling pathways in human granulosa cells. Journal of Clinical Endocrinology and Metabolism 99 E2234–E2243. (https://doi.org/10.1210/jc.2014-1930)
Fadhillah, Yoshioka S, Nishimura R & Okuda K 2014 Hypoxia promotes progesterone synthesis during luteinization in bovine granulosa cells. Journal of Reproduction and Development 60 194–201. (https://doi.org/10.1262/jrd.2014-014)
Gecaj RM, Schanzenbach CI, Kirchner B, Pfaffl MW, Riedmaier I, Tweedie-Cullen RY & Berisha B 2017 The Dynamics of microRNA Transcriptome in Bovine Corpus Luteum during Its Formation, Function, and Regression. Frontiers in Genetics 8 213 (https://doi.org/10.3389/fgene.2017.00213)
Guo S, Bai R, Liu W, Zhao A, Zhao Z, Wang Y, Wang Y, Zhao W & Wang W 2015 MicroRNA-210 is upregulated by hypoxia-inducible factor-1alpha in the stromal cells of giant cell tumors of bone. Molecular Medicine Reports 12 6185–6192. (https://doi.org/10.3892/mmr.2015.4170)
Huang X, Ding L, Bennewith KL, Tong RT, Welford SM, Ang KK, Story M, Le QT & Giaccia AJ 2009 Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. Molecular Cell 35 856–867. (https://doi.org/10.1016/j.molcel.2009.09.006)
Imbar T, Klipper E, Greenfield C, Hurwitz A, Haimov-Kochman R & Meidan R 2012 Altered endothelin expression in granulosa-lutein cells of women with polycystic ovary syndrome. Life Science 91 703–709. (https://doi.org/10.1016/j.lfs.2012.06.006)
Inoue A, Yanagisawa M, Kimura S, Kasuya Y, Miyauchi T, Goto K & Masaki T 1989 The human endothelin family: three structurally and pharmacologically distinct isopeptides predicted by three separate genes. PNAS 86 2863–2867. (https://doi.org/10.1073/pnas.86.8.2863)
Jiang YF, Tsui KH, Wang PH, Lin CW, Wang JY, Hsu MC, Chen YC & Chiu CH 2011 Hypoxia regulates cell proliferation and steroidogenesis through protein kinase A signaling in bovine corpus luteum. Animal Reproduction Science 129 152–161. (https://doi.org/10.1016/j.anireprosci.2011.12.004)
Kelly TJ, Souza AL, Clish CB & Puigserver P 2011 A hypoxia-induced positive feedback loop promotes hypoxia-inducible factor 1alpha stability through miR-210 suppression of glycerol-3-phosphate dehydrogenase 1-like. Molecular and Cellular Biology 31 2696–2706. (https://doi.org/10.1128/MCB.01242-10)
Kim J, Bagchi IC & Bagchi MK 2009 Signaling by hypoxia-inducible factors is critical for ovulation in mice. Endocrinology 150 3392–3400. (https://doi.org/10.1210/en.2008-0948)
Kisliouk T, Levy N, Hurwitz A & Meidan R 2003 Presence and regulation of endocrine gland vascular endothelial growth factor/prokineticin-1 and its receptors in ovarian cells. Journal of Clinical Endocrinology and Metabolism 88 3700–3707. (https://doi.org/10.1210/jc.2003-030492)
Klipper E, Levit A, Mastich Y, Berisha B, Schams D & Meidan R 2010 Induction of endothelin-2 expression by luteinizing hormone and hypoxia: possible role in bovine corpus luteum formation. Endocrinology 151 1914–1922. (https://doi.org/10.1210/en.2009-0767)
Lie BL, Leung E, Leung PC & Auersperg N 1996 Long-term growth and steroidogenic potential of human granulosa-lutein cells immortalized with SV40 large T antigen. Molecular and Cellular Endocrinology 120 169–176. (https://doi.org/10.1016/0303-7207(96)03835-X)
Meidan R, Klipper E, Zalman Y & Yalu R 2013 The role of hypoxia-induced genes in ovarian angiogenesis. Reproduction, Fertility, and Development 25 343–350. (https://doi.org/10.1071/RD12139)
Merlo A, de Quiros SB, Secades P, Zambrano I, Balbin M, Astudillo A, Scola B, Aristegui M, Suarez C & Chiara MD 2012 Identification of a signaling axis HIF-1alpha/microRNA-210/ISCU independent of SDH mutation that defines a subgroup of head and neck paragangliomas. Journal of Clinical Endocrinology and Metabolism 97 E2194–E2200. (https://doi.org/10.1210/jc.2012-2410)
Na G, Bridges PJ, Koo Y & Ko C 2008 Role of hypoxia in the regulation of periovulatory EDN2 expression in the mouse. Canadian Journal of Physiology and Pharmacology 86 310–319. (https://doi.org/10.1139/Y08-025)
Nishimura R & Okuda K 2010 Hypoxia is important for establishing vascularization during corpus luteum formation in cattle. Journal of Reproduction and Development 56 110–116. (https://doi.org/10.1262/jrd.09-162E)
Palanisamy GS, Cheon YP, Kim J, Kannan A, Li Q, Sato M, Mantena SR, Sitruk-Ware RL, Bagchi MK & Bagchi IC 2006 A novel pathway involving progesterone receptor, endothelin-2, and endothelin receptor B controls ovulation in mice. Molecular Endocrinology 20 2784–2795. (https://doi.org/10.1210/me.2006-0093)
Puissegur MP, Mazure NM, Bertero T, Pradelli L, Grosso S, Robbe-Sermesant K, Maurin T, Lebrigand K, Cardinaud B & Hofman V et al. 2011 miR-210 is overexpressed in late stages of lung cancer and mediates mitochondrial alterations associated with modulation of HIF-1 activity. Cell Death and Differentiation 18 465–478. (https://doi.org/10.1038/cdd.2010.119)
Rayhman O, Klipper E, Muller L, Davidson B, Reich R & Meidan R 2008 Small interfering RNA molecules targeting endothelin-converting enzyme-1 inhibit endothelin-1 synthesis and the invasive phenotype of ovarian carcinoma cells. Cancer Research 68 9265–9273. (https://doi.org/10.1158/0008-5472.CAN-08-2093)
Rico C, Dodelet-Devillers A, Paquet M, Tsoi M, Lapointe E, Carmeliet P & Boerboom D 2014 HIF1 activity in granulosa cells is required for FSH-regulated Vegfa expression and follicle survival in mice. Biology of Reproduction 90 135. (https://doi.org/10.1095/biolreprod.113.115634)
Semenza GL 2007 Hypoxia-inducible factor 1 (HIF-1) pathway. Sciences STKE 2007 cm8.
Shiratsuki S, Hara T, Munakata Y, Shirasuna K, Kuwayama T & Iwata H 2016 Low oxygen level increases proliferation and metabolic changes in bovine granulosa cells. Molecular and Cellular Endocrinology 437 75–85. (https://doi.org/10.1016/j.mce.2016.08.010)
Shrestha K, Lukasik K, Baufeld A, Vanselow J, Moallem U & Meidan R 2015 Regulation of ovulatory genes in bovine granulosa cells: lessons from siRNA silencing of PTGS2. Reproduction 149 21–29. (https://doi.org/10.1530/REP-14-0337)
Tam KK, Russell DL, Peet DJ, Bracken CP, Rodgers RJ, Thompson JG & Kind KL 2010 Hormonally regulated follicle differentiation and luteinization in the mouse is associated with hypoxia inducible factor activity. Molecular and Cellular Endocrinology 327 47–55. (https://doi.org/10.1016/j.mce.2010.06.008)
Thompson JG, Brown HM, Kind KL & Russell DL 2015 The ovarian antral follicle: living on the edge of hypoxia or not? Biology of Reproduction 92 153. (https://doi.org/10.1095/biolreprod.115.128660)
van den Driesche S, Myers M, Gay E, Thong KJ & Duncan WC 2008 HCG up-regulates hypoxia inducible factor-1 alpha in luteinized granulosa cells: implications for the hormonal regulation of vascular endothelial growth factor A in the human corpus luteum. Molecular Human Reproduction 14 455–464. (https://doi.org/10.1093/molehr/gan040)
Yalu R, Oyesiji AE, Eisenberg I, Imbar T & Meidan R 2015 HIF1A-dependent increase in endothelin 2 levels in granulosa cells: role of hypoxia, LH/cAMP, and reactive oxygen species. Reproduction 149 11–20. (https://doi.org/10.1530/REP-14-0409)
Zhang J, Zhang Z, Wu Y, Chen L, Luo Q, Chen J, Huang X, Cheng Y & Wang Z 2012 Regulatory effect of hypoxia-inducible factor-1alpha on hCG-stimulated endothelin-2 expression in granulosa cells from the PMSG-treated rat ovary. Journal of Reproduction and Development 58 678–684. (https://doi.org/10.1262/jrd.2012-089)
