Abstract
Peri-ovarian adipose tissue (POAT) is a kind of intra-abdominal white adipose tissue that is present surrounding the ovaries in rodents. Recent studies demonstrated that POAT-deficient mice displayed a phenotype of delayed antral follicular development, for which decreases in serum estrogen, serum FSH and FSHR levels were responsible. However, folliculogenesis is regulated by endocrine signals and also modulated by a number of locally produced intraovarian factors whose acts are both autocrine and paracrine. Here, we used a model of surgical removal of POAT unilaterally and contralateral ovaries as controls, as both were under the same endocrine control, to assess the paracrine effect of the POAT on folliculogenesis. Surgical removal of unilateral POAT resulted in delayed antral follicular development and the increased number of atretic follicles, accompanied by decreased levels of intraovarian adipokines and growth factors, lipid accumulation and steroidogenic enzyme expression. POAT-deficient ovaries displayed compensatory increased expressions of intraovarian genes, such as Vegf and Adpn for angiogenesis, Acc, Fasn, and Gapdh involved in lipogenesis and Fshr in response to FSH stimulation. Furthermore, we demonstrated that removal of POAT promoted follicular apoptosis, caused retention of cytoplasmic YAP and inhibited PTEN-AKT-mTOR activation. These alterations were observed only in the POAT-deficient ovaries but not in the contralateral ovaries (with POAT), which suggests that a paracrine interaction between POAT and ovaries is important for normal folliculogenesis.
Introduction
Adipose tissue, as the major form of energy storage, is the most abundant tissue in mammals. White adipose tissue and brown adipose tissue are the two forms of adipose tissue, and each of them performs different functions. Brown adipose tissue stores small amounts of fat, produces heat and maintains body temperature when needed. White adipose tissue stores large amounts of excess energy in the form of triglycerides. It is also considered an endocrinologically active organ that produces numerous hormones and bioactive substances called adipokines, which take part in the regulation of energy homeostasis, nervous system activity, cardiovascular function, the body’s immune response and the reproductive axis (Cancello et al. 2004, Beall et al. 2017). Major advances have been made in identifying and characterizing the role of adipose tissue in the development of reproductive organs and the secretion and release of reproductive hormones. As an important site for steroid storage and metabolism, adipose tissue has been proven to contribute to the whole body’s steroid levels (Li et al. 2015). Obesity induced by a high-fat diet accelerates follicle development and follicle loss (Wang et al. 2014). Obese women are more likely to have ovulatory dysfunction such as polycystic ovary syndrome (PCOS) due to dysregulation of the hypothalamic–pituitary–ovarian (HPO) axis (Doi et al. 2005).
The studies on perinodal adipose tissue around lymph nodes (Pond & Mattacks 1995), perivascular adipose tissue in the blood (Lohn et al. 2002) and pericardial adipose tissue around the heart (Fox et al. 2009) demonstrated site-specific properties of adipose tissue, as well as paracrine interactions between minor adipose depots and contiguous tissues. Gonadal adipose tissue is a kind of intra-abdominal white adipose tissue that is present surrounding the gonads in rodents. It is called epididymal adipose tissue (EAT) in males and peri-ovarian adipose tissue (POAT) in females. Recent studies demonstrated that gonadal adipose tissue took part in gonadal development and germ cell formation. EAT may produce a local nutritive or trophic factor that facilitates spermatogenesis by direct action on the adjacent testis (Chu et al. 2010). Diet-induced obesity accelerated the expressions of inflammatory-mediator genes in the POAT, which was associated with increased mRNA levels of intraovarian pro-inflammatory cytokines, suggesting a functional impact of the POAT on ovarian function (Nteeba et al. 2013). Recently, Wang and colleagues revealed that POAT played an important role in female fertility because it influenced ovarian folliculogenesis by the regulation of estrogen secretion and release of gonadotropins (Wang et al. 2017).
Ovarian folliculogenesis is regulated by both endocrine and intraovarian mechanisms that coordinate the processes of the growth and development or atresia of the follicles (Hsueh et al. 2015). At the endocrine level, folliculogenesis is regulated by the HPO axis. Specialized hypothalamic neurons secrete pulses of gonadotropin-releasing hormone (GnRH) into the portal blood vessels, which leads to a pulsatile release of follicle-stimulating hormone (FSH) and luteinizing hormone (LH), which control folliculogenesis through their actions on ovarian follicle cells. In contrast to the critically important endocrines above (GnRH, FSH, and LH), intraovarian regulators act locally to play a vital role through complex mechanisms governing folliculogenesis (Hsueh et al. 2015). Though the authors believed that the low level of FSH induced by removal of the POAT may account for the disordered folliculogenesis in bilaterally POAT-deficient mice (Wang et al. 2017), we hypothesized that POAT locally affects ovarian folliculogenesis and function. In order to test this hypothesis, we unilaterally removed the POAT from one ovary of pre-pubertal mice and assessed the alternations on the ovarian folliculogenesis and function, as well as intraovarian parameters, such as intraovarian adipokines and growth factors, lipid accumulation, steroidogenic enzymes, apoptosis-related proteins and signal pathways.
Materials and methods
Reagents
TRIzol reagent was purchased from Invitrogen. ReverTra Ace qPCR RT Master Mix with gDNA Remover Kit and SYBR Green Master Mix were obtained from TOYOBO (Osaka, Japan). Hyaluronidase, Oil Red O, pentobarbital natrium and paraformaldehyde were purchased from Sigma-Aldrich. 3,3′-diaminobenzidine and hematoxylin and eosin (HE) were obtained from Bosterbio. Optimal cutting temperature compound (OCT) was purchased from Sakura Finetek (Torrance, CA, USA). Pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) were obtained from Ningbo Secondary Hormone Corp. (Ningbo, China). In Situ Cell Death Detection Kit (Fluorescein) was purchased from Roche Applied Sciences. Chemiluminescent HRP Substrate, Embryo max HTF, EmbryoMax M2 medium, Embryo Max KSOM were obtained from Millipore. Oil for embryo culture was purchased from Irvine Science (Santa Ana, CA, USA). Halt Protease & Phosphatase Inhibitor Cocktail was obtained from Pierce. Bicinchoninic acid (BCA) protein assay kit and RIPA lysis and extraction buffer were purchased from Dingguo (Beijing, China). The details, suppliers and dilution of antibodies used in this study are reported in Table 1. All other chemicals were of reagent grade and were obtained from standard commercial sources.
Antibodies used in Western blot.
| Antibody target | Host/type | Catalog No. | Supplier | Dilution |
|---|---|---|---|---|
| Primary antibodies | ||||
| Aromatase (CYP19) | Rabbit monoclonal | 14528 | Cell Signaling Technologya | 1:1000 |
| Phospho-mTOR (Ser2448) | Rabbit monoclonal | 5536 | Cell Signaling Technologya | 1:1000 |
| mTOR | Rabbit monoclonal | 2983 | Cell Signaling Technologya | 1:1000 |
| Phospho-AMPKα (Thr172) | Rabbit monoclonal | 2535 | Cell Signaling Technologya | 1:1000 |
| AMPKα | Rabbit polyclonal | 2532 | Cell Signaling Technologya | 1:1000 |
| Phospho-Akt (Ser473) | Rabbit monoclonal | 4060 | Cell Signaling Technologya | 1:1000 |
| Akt (pan) | Rabbit monoclonal | 4691 | Cell Signaling Technologya | 1:1000 |
| Phospho-ERK1/2 (Thr202/Thr204) | Rabbit monoclonal | 4370 | Cell Signaling Technologya | 1:1000 |
| ERK1/2 | Rabbit monoclonal | 4695 | Cell Signaling Technologya | 1:1000 |
| PTEN | Rabbit polyclonal | 9552 | Cell Signaling Technologya | 1:1000 |
| Caspase-3 (CASP3) | Rabbit polyclonal | 9662 | Cell Signaling Technologya | 1:1000 |
| Caspase-8 (CASP8) | Rabbit monoclonal | 4790 | Cell Signaling Technologya | 1:1000 |
| Caspase-9 (CASP9) | Rabbit monoclonal | 9508 | Cell Signaling Technologya | 1:1000 |
| Acetyl-CoA carboxylase (ACC) | Rabbit monoclonal | 3676 | Cell Signaling Technologya | 1:1000 |
| Fatty acid synthase (FASN) | Rabbit monoclonal | 3180 | Cell Signaling Technologya | 1:1000 |
| GAPDH | Mouse monoclonal | 60004 | Proteintechb | 1:2000 |
| Phospho-YAP (Ser127) | Rabbit polyclonal | 4911 | Cell Signaling Technologya | 1:1000 |
| YAP | Rabbit polyclonal | 4912 | Cell Signaling Technologya | 1:1000 |
| Adiponectin (ADPN) | Rabbit monoclonal | 2789 | Cell Signaling Technologya | 1:1000 |
| C1QTNF3 | Rabbit monoclonal | ab36870 | Abcamc | 1:500 |
| Leptin | Rabbit polyclonal | NBP1-59324 | NOVUS Biologicalsd | 1:1000 |
| Lipocalin 2 (LCN-2) | Rabbit polyclonal | PB 0641 | Bosterbioe | 1:200 |
| TGFB1 | Rabbit polyclonal | BA 0290 | Bosterbioe | 1:300 |
| HGF | Rabbit polyclonal | PB 0298 | Bosterbioe | 1:500 |
| VEGF | Mouse monoclonal | sc-7269 | Santa Cruzf | 1:1000 |
| β-Tubulin | Rabbit polyclonal | NB 600-936 | NOVUS Biologicalsd | 1:1000 |
| Secondary antibodies | ||||
| Rabbit IgG | Goat polyclonal | A0545 | Sigma-Aldrichg | 1:2000 |
| Mouse IgG (H + L) | Goat polyclonal | SA 00001-1 | Proteintechb | 1:2000 |
aCell Signaling Technology (Beverly, MA); bProteintech (Rosemont, IL); cAbcam (Cambridge, MA); dNOVUS Biologicals (Littleto, CO); eBosterbio (Wuhan, China); fSanta Cruz (Santa Cruz, CA); gSigma-Aldrich (St. Louis, MO).
Ig, immunoglobulin.
Animals and surgical procedure
Twenty-one-day old Kunming female mice were purchased from GuangDong Medical Laboratory Animal Centre, Guangzhou, China and maintained in 22–24°C rooms on 14-h light, 10-h darkness cycles and given food and water ad libitum. All procedures were carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals, and all animal experimental protocols were approved by the Animal Experimental Ethics Committee of Jinan University. After the mouse was anesthetized with 0.67% pentobarbital natrium (10 µL/g), two small incisions were made in the muscle layer of dorsal above the ovary. Then one side of POAT pad from each mouse was removed carefully without damaging the ovary (Removal), whereas the contralateral POAT was exposed in the air for the same time as surgical one (Sham). Then, the muscle and surface layers were sutured carefully. After 2 or 3 weeks of recovery, mice were killed by cervical dislocation. The whole ovary tissues were removed under the stereoscope with 27-gauge needle to clean the connective tissues, including the POAT. In order to avoid the contamination of adipose tissue, the ovarian bursa was detached from the whole ovary tissue under the stereoscope with 31-gauge needle. Then, the ovaries without the bursa were washed, weighed and collected for the following studies.
Ovarian morphology and follicle counting
Ovarian tissue was fixed with 4% paraformaldehyde in PBS, dehydrated and embedded in paraffin. Whole ovaries were longitudinally and serially sectioned at 5 µm, aligned in order on glass microscope slides and stained with HE. To assess whether unilateral removal of the POAT had an impact on folliculogenesis, follicle numbers from each follicle stage were counted. Follicle quantification was performed as previously described (Perez et al. 1999, Mao et al. 2018). Follicles with one oocyte surrounded by a single layer of flattened granulosa cells were scored as primordial follicles, follicles with an oocyte surrounded by one layer of cubical granulosa cells were considered primary and follicles with an oocyte surrounded by two or more layers of granulosa cells but without an antrum were considered secondary. A follicle that was roughly round in appearance with an intact, non-fragmenting oocyte was scored as an intact antral follicle. Only follicles with clearly stained oocyte nuclei were counted. Immature follicles were scored as atretic if the oocyte was of degenerate appearance, was fragmenting or was not subjectively round. Follicle counting was performed by blinded operators to avoid any biases, and the ovaries of four mice were used for serial counting.
Ovulation detection and in vitro fertilization
After 2 weeks of recovery, each mouse received i.p. injection of 10 IU PMSG, following with another injection of hCG (5 IU) 48 h later. After treatment with hCG 14 h, mice were killed by cervical dislocation and the oocytes were collected from oviductal ampulla in M2 media containing 0.3 mg/mL hyaluronidase. After three washes in M2 medium, oocytes were counted under a microscope. Then the mature oocytes were used for in vitro fertilization (IVF). Donor sperm were collected from the cauda region of the epididymis of Kunming mice (10 weeks old) into the HTF medium and incubated under oil for 1 h in 5% CO2 and 95% air to ensure sperm capacitation. Oocytes were then placed in 250 µL HTF medium with sperm (approximately 1 × 106/mL). Fertilization was carried out for 6 h, and inseminated oocytes were transferred into a 30 µL droplet of KSOM medium under mineral oil for culture at 37°C in a 5% CO2 incubator. Two-cell embryos were scored 24 h later.
TUNEL staining
For detection of apoptotic cells in ovarian sections, a fluorescence TUNEL kit was used according to the manufacturer’s instructions (Roche Diagnostics). Briefly, after deparaffinization and hydration, ovarian sections were incubated with TUNEL reaction mixture for 1 h at 37°C in a humidified chamber. Then, the sections were washed with PBS, counterstained with DAPI and visualized under Leica DFC300 FX fluorescence microscope.
Oil Red O staining
Fresh ovarian tissue was collected and embedded immediately in OCT, then sectioned at 5 µm and mounted on glass slides. Sections were stained for lipids with Oil Red O and counterstained with hematoxylin. Sections were visualized under an Olympus CKX41 microscope, and relative areas stained with Oil Red O were quantified by histomorphometry using Image-Pro Plus 6.0.
Quantitative real-time PCR
Total RNA of the ovaries was isolated separately using TRIzol reagent, and first-strand cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover Kit according to the manufacturer’s protocol. Quantitative analysis of gene expression was performed by qPCR in a Bio-Rad Real-Time PCR system and with QuantiTect SYBR Green Real-Time PCR kit. The primers used in this study are shown in Table 2. The program used to analyze the abundance of different genes was 5 min at 95°C, then 40 cycles of 15 s at 95°C and 60 s at 60°C. The amount of target gene, normalized to β-actin and relative to a calibrator, was determined by the arithmetic Equation 2−ΔΔCt described in the comparative Ct method.
Primers used in RT-PCR and qPCR analysis.
| Target gene | GenBank accession number | Primer sequence (5′–3′) | Position of primers (nt) | |
|---|---|---|---|---|
| Star | NM_011485 | Forward | CATTGTGCCGACTTCCCTAC | 1427–1446 |
| Reverse | GCTCTGGCTATCCTTCTGTG | 1715–1734 | ||
| Cyp11a1 | NM_019779 | Forward | AGGTCCTTCAATGAGATCCCTT | 214–235 |
| Reverse | TCCCTGTAAATGGGGCCATAC | 330–350 | ||
| Cyp17a1 | NM_007809 | Forward | CCAGGACCCAAGTGTGTTCT | 997–1016 |
| Reverse | CCTGATACGAAGCACTTCTCG | 1226–1246 | ||
| 3β-Hsd | NM_013821 | Forward | GCCAGTGTTCCAGCCTTCAT | 667–686 |
| Reverse | ATTTGCCCGTACAACCGAGA | 957–976 | ||
| Cyp19 | NM_001348171 | Forward | CGTCGCAGAGTATCCAGAGG | 1071–1090 |
| Reverse | GGGTAAATTCATTGGGCTTA | 1332–1351 | ||
| Lcn2 | NM_008491 | Forward | GACAACTGAATGGGTGGTGA | 617–636 |
| Reverse | GGTGGTGTTAAGACAGGTGGAT | 794–815 | ||
| Adpn | NM_009605 | Forward | GGAGAGAAAGGAGATGCAGGT | 319–339 |
| Reverse | CTTTCCTGCCAGGGGTTC | 410–427 | ||
| Leptin | NM_008493 | Forward | AATCCTATTGATGGGTCTGC | 1113–1132 |
| Reverse | CTTCACCCTCCCTCTAACAC | 1369–1388 | ||
| C1qtnf3 | NM_001204134 | Forward | GGCAGACAAATGGATGCAAAGT | 2035–2056 |
| Reverse | TAGGCAAAAACCATCTAGCACCT | 2188–2210 | ||
| Vegf | NM_001025250 | Forward | AGCCGTCCTGTGTGCCCCTAAT | 1239–1260 |
| Reverse | CCCTTTCCCTTTCCTCGAACTGA | 1445–1467 | ||
| Hgf | NM_001289460 | Forward | TCATTGGTAAAGGAGGCA | 594–611 |
| Reverse | GTCACAGACTTCGTAGCG | 797–814 | ||
| Tgfb1 | NM_025609 | Forward | GCTCTTTCGGCTTTCGCAACT | 644–664 |
| Reverse | TGGCAAACTCGGTGTCAATC | 938–957 | ||
| Fshr | NM_013523 | Forward | TGCTACACCCACATCTACCT | 1702–1721 |
| Reverse | GCACCTCATAACAGCCAAAC | 1989–2008 | ||
| β-Actin | NM_007393 | Forward | TGAGCTGCGTTTTACACCCT | 1250–1269 |
| Reverse | TTTGGGGGATGTTTGCTCCA | 1461–1480 | ||
Western blot analyses
The tissues were lysed in RIPA buffer containing Halt Protease & Phosphatase Inhibitor Cocktail with microelectric tissue homogenizer. After 15-min incubation on ice, lysates were centrifuged at 12,000 g for 5 min for removal of debris. Total protein concentration was assessed by BCA assay, and 80 µg of total protein were submitted to gel electrophoresis. Proteins were separated on polyacrylamide gel before transferring them to PVDF membranes. After blocking in TBST (10 mM Tris (pH 7.5), 150 mM NaCl and 0.05% Tween 20) supplemented with 5% skim milk, membranes were incubated overnight at 4°C with appropriate primary antibodies (Table 1) in TBST overnight at 4°C. Then, blots were incubated with anti-rabbit or anti-mouse secondary antibodies conjugated with horseradish peroxidase and finally detected by chemiluminescence and visualized with GeneGenius bioimaging system (Syngene, Cambridge, UK). Protein expression was compared and analyzed with ImageJ. The density of each band was normalized to the density of the β-tubulin band that was used as an internal control.
Statistical analyses
The data were analyzed by using GraphPad Prism 6.0 (GraphPad Software, Inc) and presented as mean ± s.e.m. of at least three independent animals. Student’s paired t-test for comparison of data derived from two groups was performed in order to assess the statistical significance of differences. A P value less than 0.05 was considered significant. A P value between 0.05 and 0.1 was considered a trend.
Results
Unilateral removal of POAT arrested ovarian growth and follicular development
After 2 weeks of recovery, there was almost no adipose tissue regenerated around the POAT-deficient ovaries. The weight of the POAT-deficient ovaries (4.71 ± 0.32 mg) was significantly reduced compared to the sham (5.94 ± 0.47 mg) (P < 0.001, n = 11, Fig. 1A). The ovarian morphology was examined with HE staining, and a representative section from each group was shown in Fig. 1B. Histological examination of the POAT-deficient ovaries revealed a decrease in the number of large antral follicles and an increase in the number of small preantral follicles. Moreover, a few of corpora lutea appeared in the sham ovaries, but disappeared in the POAT-deficient ovaries. Detailed counting of different stage follicles indicated that unilateral removal of POAT decreased the proportion of antral follicles (P < 0.05) and increased the proportions of secondary follicles (P < 0.05) and atretic follicles (P < 0.01). There was no significant difference in the primordial follicle pool and primary follicle pool between the sham and the POAT-deficient ovaries (Fig. 1C). To further confirm the effect of removal of POAT on oocyte development, we counted the ovulated oocytes after PMSG and hCG treatment and found that the number of oocytes was significantly decreased in the POAT-deficient side (removal: 3.92 ± 0.88 vs sham: 21.75 ± 1.45, P < 0.001). Three of twelve were even anovulatory (Fig. 1D). To further assess whether the ovulated oocytes obtained from the POAT-deficient ovaries were capable of being fertilized, IVF was performed. Fertilized oocytes from the POAT-deficient ovaries developed to two-cell embryo with the same efficiency as the oocytes obtained from the sham side (removal: 109 two-cell embryos/150 oocytes, 72.67%; sham: 54 two-cell embryos/76 oocytes, 71.05%), suggesting that removal of POAT had no significant effect on the oocyte quality.
Unilateral removal of POAT arrested ovarian growth and follicular development. POAT was removed from one ovary (removal) of a per-pubertal mouse with the contralateral ovary serving as the control (sham). After 2 weeks of recovery, the ovaries were weighed and the mean weight of the ovaries was shown (A, n = 11). After weighing, the ovaries were embedded and sectioned for histology analysis. A representative ovarian tissue section from each group (B) and the detailed count of different stage follicles (C, n = 4) are shown. The ovulated oocytes were counted after PMSG and hCG treatment (D, n = 12). *P < 0.05, **P < 0.01 and ***P < 0.001. hCG, human chorionic gonadotropin; NS, no significant difference; PMSG, pregnant mare serum gonadotropin; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Unilateral removal of POAT arrested ovarian growth and follicular development. POAT was removed from one ovary (removal) of a per-pubertal mouse with the contralateral ovary serving as the control (sham). After 2 weeks of recovery, the ovaries were weighed and the mean weight of the ovaries was shown (A, n = 11). After weighing, the ovaries were embedded and sectioned for histology analysis. A representative ovarian tissue section from each group (B) and the detailed count of different stage follicles (C, n = 4) are shown. The ovulated oocytes were counted after PMSG and hCG treatment (D, n = 12). *P < 0.05, **P < 0.01 and ***P < 0.001. hCG, human chorionic gonadotropin; NS, no significant difference; PMSG, pregnant mare serum gonadotropin; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Unilateral removal of POAT arrested ovarian growth and follicular development. POAT was removed from one ovary (removal) of a per-pubertal mouse with the contralateral ovary serving as the control (sham). After 2 weeks of recovery, the ovaries were weighed and the mean weight of the ovaries was shown (A, n = 11). After weighing, the ovaries were embedded and sectioned for histology analysis. A representative ovarian tissue section from each group (B) and the detailed count of different stage follicles (C, n = 4) are shown. The ovulated oocytes were counted after PMSG and hCG treatment (D, n = 12). *P < 0.05, **P < 0.01 and ***P < 0.001. hCG, human chorionic gonadotropin; NS, no significant difference; PMSG, pregnant mare serum gonadotropin; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT increased Fshr gene expression and decreased the gene expression of steroidogenic enzymes in the ovary
FSHR protein (P < 0.01) and mRNA (P < 0.05) levels significantly increased in the POAT-deficient ovaries compared to the sham control (Fig. 2A). The sex steroids produced by follicular cells are known to play major roles in the regulation of ovarian function, and aromatase (CYP19) is the key enzyme involved in estrogen synthesis. There was a significant decrease in aromatase (CYP19) expression in the POAT-deficient ovaries (33.9% decrease, P < 0.05, Fig. 2A). Consistent with a decreased aromatase expression, the abundance of aromatase (Cyp19) mRNA was significantly decreased in the POAT-deficient ovaries. In agreement with the change observed in the aromatase, the abundances of mRNA encoding other steroidogenic enzymes, cytochrome P450 side chain cleavage (CYP11A1), 17α-hydroxylase/17, 20-lyase (CYP17) and 3β-hydroxysteroid dehydrogenase (3β-HSD), were also decreased in the POAT-deficient ovaries (P < 0.05). However, removal of POAT had no impact on the transcript abundance of steroidogenic acute regulatory protein (STAR) (Fig. 2B).
Removal of POAT decreased the gene expressions of Fshr and ovarian steroidogenic enzymes. (A) The FSHR and CYP19 protein levels were analyzed by Western blot. Data were reported as densitometric mean (±s.e.m.), normalized to β-tubulin. The representative band plotted with the ovaries from three mice was shown. The same number meant the ovary from the same mouse. (B) The abundances of Fshr mRNA and genes of steroidogenic enzymes in the ovaries. The mRNA abundances of each gene were analyzed by qPCR and normalized to constitutively expressed β-actin. Data were shown as a ratio (means ± s.e.m.) to mRNA abundance of the sham ovaries. n = 4. *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT decreased the gene expressions of Fshr and ovarian steroidogenic enzymes. (A) The FSHR and CYP19 protein levels were analyzed by Western blot. Data were reported as densitometric mean (±s.e.m.), normalized to β-tubulin. The representative band plotted with the ovaries from three mice was shown. The same number meant the ovary from the same mouse. (B) The abundances of Fshr mRNA and genes of steroidogenic enzymes in the ovaries. The mRNA abundances of each gene were analyzed by qPCR and normalized to constitutively expressed β-actin. Data were shown as a ratio (means ± s.e.m.) to mRNA abundance of the sham ovaries. n = 4. *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT decreased the gene expressions of Fshr and ovarian steroidogenic enzymes. (A) The FSHR and CYP19 protein levels were analyzed by Western blot. Data were reported as densitometric mean (±s.e.m.), normalized to β-tubulin. The representative band plotted with the ovaries from three mice was shown. The same number meant the ovary from the same mouse. (B) The abundances of Fshr mRNA and genes of steroidogenic enzymes in the ovaries. The mRNA abundances of each gene were analyzed by qPCR and normalized to constitutively expressed β-actin. Data were shown as a ratio (means ± s.e.m.) to mRNA abundance of the sham ovaries. n = 4. *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the levels of intraovarian growth factors and adipokines
As we know, adipose tissues secrete a number of adipokines and growth factors. However, whether the adipokines and growth factors secreted by the POAT act on the ovary in a paracrine-like way or not is still unknown. Here, we found that removal of POAT produced significant reductions in protein levels of adiponectin (ADPN) (P < 0.05), lipocalin-2 (LCN2) (P < 0.05) and vascular endothelial growth factor (VEGF) (P < 0.05) and decreased tendencies for protein levels of leptin (38% decrease, P = 0.068), hepatocyte growth factor (HGF) (34.12% decrease, P = 0.096) and C1q/tumor necrosis factor-related protein 3 (C1QTNF3) (36.20% decrease, P = 0.103) (Fig. 3A). However, the abundance of transforming growth factor beta (TGFB1) was similar between the POAT-deficient ovaries and sham control (Fig. 3A). To further determine whether the decreased levels of adipokines and growth factors were caused by the reduced supply from the POAT, we used qPCR to analyze the endogenous adipokine and growth factor expressions. The result showed that removal of POAT led to a significant reduction of the abundance of Lcn2 mRNA (P < 0.01), significant increases in the abundances of Vegf (P < 0.05) and Tgfb1 (P < 0.05) mRNA, increased trends for the abundances of Adpn (2.17-fold increase, P = 0.080) and C1qtnf3 (2.09-fold increase, P = 0.076) mRNA and had no impact on the abundances of leptin and Hgf transcriptions (Fig. 3B). These results suggested that a fair amount of intraovarian adipokines and growth factors were derived from the POAT.
Removal of POAT altered the levels of intraovarian adipokines and growth factors. The intraovarian protein levels of ADPN, C1QTNF3, LCN2, leptin, HGF, TGFB1 and VEGF were analyzed by Western blot (A), and endogenous abundances of Adpn, C1qtnf3, Lcn2, leptin, Hgf, Tgfb1 and Vegf were measured by qPCR (B). A blot of one replicate of both ovaries of three mice was shown, and the measurements of adipokines and growth factors were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). The qPCR procedure was similar to description in Fig. 2C (n = 4). *P < 0.05, **P < 0.01. ADPN, adiponectin; HGF, hepatocyte growth factor; LCN2, lipocalin-2; NS, no significant difference; POAT, peri-ovarian adipose tissue; TGFB1, transforming growth factor beta-1; VEGF, vascular endothelial growth factor.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the levels of intraovarian adipokines and growth factors. The intraovarian protein levels of ADPN, C1QTNF3, LCN2, leptin, HGF, TGFB1 and VEGF were analyzed by Western blot (A), and endogenous abundances of Adpn, C1qtnf3, Lcn2, leptin, Hgf, Tgfb1 and Vegf were measured by qPCR (B). A blot of one replicate of both ovaries of three mice was shown, and the measurements of adipokines and growth factors were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). The qPCR procedure was similar to description in Fig. 2C (n = 4). *P < 0.05, **P < 0.01. ADPN, adiponectin; HGF, hepatocyte growth factor; LCN2, lipocalin-2; NS, no significant difference; POAT, peri-ovarian adipose tissue; TGFB1, transforming growth factor beta-1; VEGF, vascular endothelial growth factor.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the levels of intraovarian adipokines and growth factors. The intraovarian protein levels of ADPN, C1QTNF3, LCN2, leptin, HGF, TGFB1 and VEGF were analyzed by Western blot (A), and endogenous abundances of Adpn, C1qtnf3, Lcn2, leptin, Hgf, Tgfb1 and Vegf were measured by qPCR (B). A blot of one replicate of both ovaries of three mice was shown, and the measurements of adipokines and growth factors were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). The qPCR procedure was similar to description in Fig. 2C (n = 4). *P < 0.05, **P < 0.01. ADPN, adiponectin; HGF, hepatocyte growth factor; LCN2, lipocalin-2; NS, no significant difference; POAT, peri-ovarian adipose tissue; TGFB1, transforming growth factor beta-1; VEGF, vascular endothelial growth factor.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT attenuated lipid accumulation and increased the abundances of enzymes involved in lipogenesis in the ovary
Considering that adipose tissue is a main energy storage organ, removal of POAT may reduce the energy supply to the ovary and promote intraovarian lipogenesis. To test this hypothesis, Oil Red O staining was used to detect the intraovarian lipid accumulation. The result showed that lipid accumulation was significantly decreased in the POAT-deficient ovaries (P < 0.01, Fig. 4A). We further detected the abundance changes of enzymes involved in triacylglycerol synthesis, such as acetyl coenzyme A carboxylase (ACC), fatty acid synthase (FASN) and glycerol-3-phosphate dehydrogenase (GAPDH), in the ovary. After 2 weeks of recovery, there were trends for increased levels of ACC (2.14-fold increase, P = 0.063) and GAPDH (2.37-fold increase, P = 0.063) in the POAT-deficient ovaries (Fig. 4B). Though the abundance of FASN in the POAT-deficient ovaries was 3.90-fold of that in the sham control, the difference was not significant (P = 0.177) (Fig. 4B). However, after 3 weeks of recovery, the abundances of ACC and GAPDH were significantly increased (ACC: 4.78-fold increase, P = 0.013; GAPDH: 5.85-fold increase, P = 0.0079), meanwhile, the abundance of FASN had an increasing tendency (1.85-fold increase, P = 0.088) in the POAT-deficient ovaries (Fig. 4C). These results indicated that intraovarian lipogenesis was accelerated in the recovery process of the POAT-deficient ovaries.
Removal of POAT changed the lipid accumulation and lipogenesis in the ovary. (A) The representative ovarian tissue sections from the sham side and the contralateral POAT-deficient side were stained with Oil Red O (ORO). Relative areas stained with Oil Red O were quantified by histomorphometry using Image-Pro Plus 6.0 and shown as the means ± s.e.m. in statistical charts (n = 3). *P < 0.05. (B and C) Western blot analysis of the enzymes involved in lipogenesis in the POAT-deficient ovaries and the sham control after 2 weeks of recovery (B) or 3 weeks of recovery (C). A blot of one replicate of both ovaries of three mice was shown, and the measurements of ACC, FASN and GAPDH were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 5–6). ACC, acetyl-CoA carboxylase; FASN, fatty acid synthase; GAPDH, glycerol-3-phosphate dehydrogenase; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT changed the lipid accumulation and lipogenesis in the ovary. (A) The representative ovarian tissue sections from the sham side and the contralateral POAT-deficient side were stained with Oil Red O (ORO). Relative areas stained with Oil Red O were quantified by histomorphometry using Image-Pro Plus 6.0 and shown as the means ± s.e.m. in statistical charts (n = 3). *P < 0.05. (B and C) Western blot analysis of the enzymes involved in lipogenesis in the POAT-deficient ovaries and the sham control after 2 weeks of recovery (B) or 3 weeks of recovery (C). A blot of one replicate of both ovaries of three mice was shown, and the measurements of ACC, FASN and GAPDH were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 5–6). ACC, acetyl-CoA carboxylase; FASN, fatty acid synthase; GAPDH, glycerol-3-phosphate dehydrogenase; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT changed the lipid accumulation and lipogenesis in the ovary. (A) The representative ovarian tissue sections from the sham side and the contralateral POAT-deficient side were stained with Oil Red O (ORO). Relative areas stained with Oil Red O were quantified by histomorphometry using Image-Pro Plus 6.0 and shown as the means ± s.e.m. in statistical charts (n = 3). *P < 0.05. (B and C) Western blot analysis of the enzymes involved in lipogenesis in the POAT-deficient ovaries and the sham control after 2 weeks of recovery (B) or 3 weeks of recovery (C). A blot of one replicate of both ovaries of three mice was shown, and the measurements of ACC, FASN and GAPDH were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 5–6). ACC, acetyl-CoA carboxylase; FASN, fatty acid synthase; GAPDH, glycerol-3-phosphate dehydrogenase; POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT induced intraovarian caspase activation and follicular apoptosis
TUNEL staining showed an increased apoptosis signaling in the POAT-deficient ovaries (Fig. 5A), suggesting that removal of POAT resulted in an increase in follicular atresia. Consistent with the increased apoptosis signal in the POAT-deficient ovaries, the abundances of uncleaved CASP3, CASP8 and CASP9 were significantly decreased, and cleaved CASP3 expression was obviously increased in the POAT-deficient ovaries (P < 0.05) (Fig. 5B). Meanwhile, the abundance of cleaved CASP9 had an increasing tendency (29.51% increase, P = 0.09) in the POAT-deficient ovaries (Fig. 5B).
Removal of POAT induced intraovarian caspase activation and follicular atresia. (A) Ovarian sections from both ovaries of three mice were examined by TUNEL staining. The representative ovarian tissue sections were shown. The right panel was a magnification of the left panel. White arrows denoted areas of detected signal (green). (B) Western blot analysis of the abundance of CASP3, CASP8 and CASP9. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT induced intraovarian caspase activation and follicular atresia. (A) Ovarian sections from both ovaries of three mice were examined by TUNEL staining. The representative ovarian tissue sections were shown. The right panel was a magnification of the left panel. White arrows denoted areas of detected signal (green). (B) Western blot analysis of the abundance of CASP3, CASP8 and CASP9. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT induced intraovarian caspase activation and follicular atresia. (A) Ovarian sections from both ovaries of three mice were examined by TUNEL staining. The representative ovarian tissue sections were shown. The right panel was a magnification of the left panel. White arrows denoted areas of detected signal (green). (B) Western blot analysis of the abundance of CASP3, CASP8 and CASP9. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the activation of intraovarian signal molecules involved in maintaining cellular homeostasis
Follicle growth and atresia are controlled by a multiplicity of molecular and cellular signaling events to maintain cellular homeostasis. Herein, Western blot was used to detect the effect of removal of POAT on the key signaling molecules involved in maintaining cellular hemostasis such as extracellular-signal-regulated kinase 1/2 (ERK1/2), AMP-activated protein kinase (AMPK), protein kinase B (PKB/AKT) and Yes-associated protein (YAP) in the ovaries. The abundances of total and phosphorylated ERK1/2 and AMPK in the ovaries were not affected by removal of POAT. Removal of POAT decreased the abundance of phosphorylated AKT (P < 0.01), the ratio of phosphorylated AKT to total AKT (P < 0.05) and the abundance of non-phosphorylated YAP (P < 0.05). Removal of POAT increased the abundance of phosphorylated YAP (P < 0.05) (Fig. 6). To further assess the effect of removal of POAT on the intraovarian AKT-associated signaling cascade, we examined the protein levels of phosphatase and tensin homolog deleted on chromosome ten (PTEN) and mammalian target of rapamycin (mTOR), which are related to AKT signal activation. In agreement with the inactivation of AKT, an increase in the abundance of PTEN (P < 0.01) and decreases in the abundance of phosphorylated mTOR (P < 0.05) and the ratio of phosphorylated mTOR to total mTOR (P < 0.01) were observed in the POAT-deficient ovaries. Meanwhile, the abundance of total mTOR had a decreasing tendency (55.44% decrease, P = 0.073) (Fig. 6).
Removal of POAT altered the activation of intraovarian signal molecules. Western blot analysis of the abundances of cellular signaling molecules indicated above. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05, **P < 0.01. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the activation of intraovarian signal molecules. Western blot analysis of the abundances of cellular signaling molecules indicated above. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05, **P < 0.01. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Removal of POAT altered the activation of intraovarian signal molecules. Western blot analysis of the abundances of cellular signaling molecules indicated above. A blot of one replicate of both ovaries of three mice was shown, and the measurements of proteins from six mice were normalized with β-Tubulin and shown as the means ± s.e.m. in statistical charts (n = 6). *P < 0.05, **P < 0.01. POAT, peri-ovarian adipose tissue.
Citation: Reproduction 156, 2; 10.1530/REP-18-0120
Discussion
Recently, gonadal adipose tissues, EAT in males and POAT in females, have been reported to be involved in gonadal and germ cell development (Chu et al. 2010, Wang et al. 2017). These tissues functioned like other adipose tissues, such as pericardial adipose tissue and perivascular adipose tissue, on their anatomically adjacent organs and tissues, e.g., heart and vessels (Lohn et al. 2002, Fox et al. 2009). Herein, we reported that unilateral removal of POAT in pre-pubertal mice caused similar phenotypes in follicular development and fertility as bilateral removal of adult mice’s POAT in Wang et al.’s study (2017) and demonstrated that a paracrine interaction between POAT and ovaries was important for normal folliculogenesis.
As we all know, an intact HPO axis is essential for the maintenance of regular follicle development. Gonadotropins are fundamental to the mechanisms regulating follicle status and development. As a gonadotropin, FSH plays an obligatory role in maintaining the normal ovarian function through its specific receptor (FSHR) (Richards 1980). The decreased level of FSH in the bilateral POAT-deficient mice led to a corresponding decrease in the abundance of Fshr mRNA, which was consistent with the common mechanism (Findlay & Drummond 1999). However, unilateral removal of POAT resulted in increased abundances of FSHR at mRNA and protein levels. We considered that removal of POAT altered the intraovarian parameters and formed an unfavorable environment that was unsuitable for normal follicular development. Under these circumstances, the increased expression of FSHR in the POAT-deficient ovaries might be a compensatory response to restore follicle growth. The compensatory increase in FSHR was also found in FSH antiserum-treated hamsters, in which FSH antiserum markedly reduced serum FSH while Fshr mRNA was slightly increased to restore the FSH signaling in ovarian cells (Chakraborty & Roy 2015). It seemed that the compensatory increase of FSHR expression was common in the condition of FSH deficiency. The compensatory effects may be the intrinsic mechanisms for the recovery of ovarian function because unilateral removal of POAT led to compensatory increases of serial genes that are beneficial for folliculogenesis, such as pro-angiogenesis genes (Adpn and Vegf) and the enzymes involved in lipogenesis (Acc, Fasn and Gapgh). Wang and colleagues also found after 2-month recovery, the POAT-deficient mice showed a tendency of recovery in fertility even though little POAT was observed (Wang et al. 2017). We deduced that removal of POAT may cause a short-term alteration of ovarian parameters, which may result in aberrant folliculogenesis and subfertility. To antagonize the effect of POAT removal, the intrinsic compensatory mechanisms were activated for ovarian repair and regeneration and fertility restoration.
Estrogen has a well-established role as a feedback regulator of gonadotropin release but also has an acknowledged pivotal role as an intra-follicular modulator that enhances folliculogenesis (Drummond & Findlay 1999). In females, the ovaries are the major source of estrogens. Though the POAT-deficient ovaries and contralateral ovaries were under the same endocrine control in the unilateral POAT-deficient mice, bilateral removal of POAT caused a decrease in serum estrogen (Wang et al. 2017), which led us to our hypothesis that removal of POAT may have an effect on the intraovarian estrogen synthesis. The decreased expression of those steroidogenic genes involved in estrogen biosynthesis in unilateral POAT-deficient ovaries suggested that removal of POAT may result in decreased levels of estrogen in the local and circulation. As a crucial local regulator in the ovary, estrogen stimulated follicular growth by promoting proliferation of granulosa cells in small preantral follicles and decreased atresia of antral follicles in a concomitant way via its intraovarian receptor ERβ (Drummond & Findlay 1999, Rosenfeld et al. 2001, Drummond 2006). The ERβ-null mice had retarded follicular development and increased atresia of large follicles (Emmen et al. 2005), which were similar to the phenotypes of the POAT-deficient ovaries. From our study with a unilateral POAT-deficient mice model, in which contralateral ovaries were under the same control of serum estrogen and FSH, we believed that the alternations of local intraovarian regulators, such as estrogen, as well as some beneficial growth factors and adipokines, might account for the abnormal folliculogenesis in the POAT-deficient ovaries. Local estrogen will need to be evaluated in future studies.
Lipid in droplets provides a depot for energy storage that can be accessed in a regulated fashion according to metabolic need. When normal, healthy ovaries are in caloric balance, their liporegulatory system is at rest. Removal of POAT disrupted the energy balance and led the ovaries at the condition of energy scarcity. In this situation, the POAT-deficient ovaries accessed and retrieved the stored energy via the activity of lipid hydrolases, which resulted in the decrease in the lipid accumulation. The stored lipid can also be used as substrate for synthesis of other important cellular molecules, such as membrane phospholipids, eicosanoids and steroid hormones. For example, circulating pituitary hormones stimulated the ovaries to synthesize steroid hormones (such as estrogen) from cholesterol. A study in beef cows showed that a good energy supply would increase cholesterol availability to maintain ovarian function and to favor earlier resumption of ovarian activity (Oliveira Filho et al. 2010), which demonstrated the vital role of lipids in folliculogenesis. Herein, removal of POAT led to a significant decrease in the intraovarian lipid accumulation, which may reduce available substrate for local steroid production. However, during the recovery process, the POAT-deficient ovaries may not have been able to mobilize sufficient lipids for follicular development and oocyte maturation. In order to maintain the content of lipids at a near-normal level, the POAT-deficient ovaries accelerated the expression of those enzymes involved in lipogenesis, such as ACC, FANS and GAPDH to promote lipid biosynthesis. However, even after 2 weeks of recovery, the amount of intraovarian lipid accumulation was still decreased. Grummer and Carrol considered that cholesterol utilized for steroid synthesis by ovarian tissue may be derived from de novo synthesis or cellular uptake of lipoprotein cholesterol (Grummer & Carroll 1988). From our studies, we considered that the intraovarian lipid was mainly derived from the POAT, an anatomical arrangement that facilitated paracrine interactions.
As a white visceral adipose tissue, POAT functions not only as a lipid storage organ but also as an endocrine organ to secrete various adipose tissue-derived growth factors and adipokines. Those bioactive substances secreted by adipose tissues either alone or collectively stimulated adipocyte growth and neovascularization during fat mass expansion (Cao 2007) or contributed to paracrine control of the adjacent organs or tissues (Miyazawa-Hoshimoto et al. 2003, Verlohren et al. 2004). Some of them have been reported to be involved in steroidogenesis, proliferation of granulosa cells and apoptosis in the ovary. VEGF is an important factor in folliculogenesis. Injection of Vegf gene or administration of VEGF protein induced an increase in preovulatory follicle number concomitantly with a decrease in the number of atretic preovulatory follicles (Iijima et al. 2005, Shimizu 2006). After removal of POAT, the nutrient supply was reduced. To recover the growth, ovaries required concomitant neovascularization to enable delivery of oxygen and nutrients. As a key growth factor involved in neovascularization, the expression of Vegf mRNA abundance was significantly increased in response to the adverse growth environment after removal of POAT. ADPN was considered a beneficial adipokine to participate in energy metabolism, inflammation, angiogenesis and reproductive system (Palin et al. 2012, Wang & Scherer 2016). Though Adpn was considered as an adipose tissue-specific gene, the mRNA and protein of Adpn were detected in the ovarian tissues of various species (Palin et al. 2012). Female mice deficient in Adpn had impaired fertility, reduced retrieval of oocytes, a disrupted estrous cycle, impaired late folliculogenesis and an elevated number of atretic follicles (Cheng et al. 2016). These phenotypes of Adpn-deficient mice were similar to the POAT-deficient mice. As a beneficial adipokine involved in folliculogenesis, intrinsic Adpn mRNA was compensatorily increased in the POAT-deficient ovaries in our study. A similar effect was found in ADPN paralog, C1QTNF3. Our recent studies showed that a novel adipokine, C1QTNF3, was also localized in the murine ovaries and promoted follicular development by increasing granulosa cell proliferation and reducing granulosa cell apoptosis via AKT and mTOR activation (Mao et al. 2018). LCN2 is an estrogen-dependent acute phase protein that binds a variety of hydrophobic ligands including retinoids, fatty acids, prostaglandins and various steroids and plays multiple roles in apoptosis, cancer, inflammation, iron homeostasis and innate immunity (Seth et al. 2002, Li & Chan 2011). Recently, LCN2 was recognized as a novel adipokine involved in estradiol biosynthesis (Guo et al. 2010, 2012). Female Lcn2 deficiency had significantly reduced expression levels of aromatase and serum estradiol (Guo et al. 2012). There was a feedback loop between LCN2 and estrogen. Removal of POAT led to a decrease in the abundance of LCN2, which may be due to the reduction of intraovarian estrogen biosynthesis. This hypothesis will need further experimentation. Leptin is a commonly investigated adipokine and has been invariably linked to the development of polycystic ovarian syndrome and may be involved in folliculogenesis. Leptin-deficient mice displayed impaired folliculogenesis and increased granulosa cell apoptosis (Hamm et al. 2004). In summary, the decreased growth factors and adipokines derived by POAT may result in steroidogenic disorders, increased apoptosis and abnormal folliculogenesis. The decreased protein abundances of adipokines and growth factors in the POAT-deficient ovaries were inconsistent with their mRNA abundances, suggesting that a fair amount of intraovarian regulators were derived from the POAT. However, a full understanding of how paracrine factors of the POAT are involved in follicular development requires further investigation.
Removal of POAT led to an increased proportion of atretic follicles, accompanied by the increases in programmed cell death signals and activated caspases, which was not reported in Wang et al.’s study (2017). Estradiol regulated follicle development and ovarian atresia, inhibited granulosa cell apoptosis and promoted the division and growth of granulosa cells (Billig et al. 1993, Chun et al. 1996). A decrease in local estrogen synthesis in the POAT-deficient ovaries may be responsible for the increases in granulosa cells apoptosis and follicle atresia. Furthermore, some growth factors and adipokines, such as VEGF (Iijima et al. 2005), HGF (Uzumcu et al. 2006), leptin (Hamm et al. 2004), ADPN (Cheng et al. 2016) and C1QTNF3 (Mao et al. 2018) have been reported to have an effect on reducing follicle atresia by inhibiting granulosa cell apoptosis. Though some active substances from the POAT, such as TGFB1, possessed the inverse ability to induce apoptosis and promote follicle atresia (Rosairo et al. 2008), the destiny of the individual follicle (growth/ovulation or atresia) was dependent on a delicate balance in the expression and action of factors promoting follicular cell proliferation, growth and differentiation and of those promoting programmed cell death (apoptosis) (Craig et al. 2007).
Activation of the PTEN/AKT/mTOR signaling pathway suppressed apoptosis, promoted cell growth and drived cellular proliferation (Schwab et al. 2009). In the present study, removal of POAT decreased the intraovarian phosphorylation of AKT and mTOR, as well as increased the abundance of PTEN, a negative regulator of AKT/mTOR activation, which were consistent with the phenomenon of increased apoptosis and arrested folliculogenesis in the POAT-deficient ovaries. YAP was a key effector of the Hippo signaling pathway, which was essential for organ size control (Piccolo et al. 2014). Hippo signaling controlled the activity of YAP by phosphorylation to retain it in the cytoplasm. Decreases in YAP phosphorylation led to its nuclear localization, thus increasing YAP’s activity as a co-transcriptional factor (Zhao et al. 2007). Kawamura and colleagues demonstrated that fragmentation of rodent ovaries promoted follicle development accompanied by a nuclear localization of YAP (Kawamura et al. 2013). Herein, removal of POAT resulted in an increase in YAP phosphorylation, which would lead to a decrease in nuclear localization of YAP and disrupt the Hippo signal pathway in the ovaries. Ultimately, the size of POAT-deficient ovaries was reduced, and the ovarian weight was significantly decreased compared to sham control. However, no significant difference was observed between the POAT-deficient ovaries and sham control in activation of ERK1/2 and AMPK, which were important for cell proliferation, growth and metabolic regulation. Presumably, the stable status of ERK1/2 and AMPK may be due to the balance between the decreases induced by POAT removal and the increases induced by ovarian endogenous gene expressions.
In this study, utilizing a unilateral POAT-deficient mice model, we demonstrated that a paracrine effect of POAT during normal folliculogenesis as surgical removal of POAT resulted in delayed antral follicle development and increased the number of atretic follicles, accompanied by decreased levels of intraovarian adipokines and growth factors, lipid accumulation and steroidogenic enzyme expression. To the best of our knowledge, this study is the first report about a paracrine interaction between gonadal adipose tissue and female gonad. Though the ovaries in women are in general not closely surrounded by adipose tissue like rodents, the paracrine effect of POAT will be of value to develop efficient and safe methods for fertility recovery, such as improved strategies for stem cell transplantation.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Natural Science Foundation of China (30900232); the Natural Science Foundation of Guangdong Province, China (8451063201000105); the Fundamental Research Funds for the Central Universities of China (21610202), the Postdoctoral Science Foundation Funded Project of China (200801259) and was partially supported by the Major Research Plan of the National Natural Science Foundation of China-Key program (91649203).
References
Beall C, Hanna L & Ellacott KLJ 2017 CNS targets of adipokines. Comprehensive Physiology 7 1359–1406. (https://doi.org/10.1002/cphy.c160045)
Billig H, Furuta I & Hsueh AJ 1993 Estrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology 133 2204–2212. (https://doi.org/10.1210/endo.133.5.8404672)
Cancello R, Tounian A, Poitou C & Clement K 2004 Adiposity signals, genetic and body weight regulation in humans. Diabetes and Metabolism 30 215–227. (https://doi.org/DM-06-2004-30-3-1262-3636-101019-ART1)
Cao Y 2007 Angiogenesis modulates adipogenesis and obesity. Journal of Clinical Investigation 117 2362–2368. (https://doi.org/10.1172/JCI32239)
Chakraborty P & Roy SK 2015 Expression of FSH receptor in the hamster ovary during perinatal development. Molecular and Cellular Endocrinology 400 41–47. (https://doi.org/10.1016/j.mce.2014.11.014)
Cheng L, Shi H, Jin Y, Li X, Pan J, Lai Y, Lin Y, Jin Y, Roy G & Zhao A et al. 2016 Adiponectin deficiency leads to female subfertility and ovarian dysfunctions in mice. Endocrinology 157 4875–4887. (https://doi.org/10.1210/en.2015-2080)
Chu Y, Huddleston GG, Clancy AN, Harris RBS & Bartness TJ 2010 Epididymal fat is necessary for spermatogenesis, but not testosterone production or copulatory behavior. Endocrinology 151 5669–5679. (https://doi.org/10.1210/en.2010-0772)
Chun SY, Eisenhauer KM, Minami S, Billig H, Perlas E & Hsueh AJ 1996 Hormonal regulation of apoptosis in early antral follicles: follicle-stimulating hormone as a major survival factor. Endocrinology 137 1447–1456. (https://doi.org/10.1210/endo.137.4.8625923)
Craig J, Orisaka M, Wang HM, Orisaka S, Thompson W, Zhu C, Kotsuji F & Tsang BK 2007 Gonadotropin and intra-ovarian signals regulating follicle development and atresia: the delicate balance between life and death. Frontiers in Bioscience-Landmark 12 3628–3639. (http://dx.doi.org/10.2741/2339)
Doi SAR, Towers PA, Scott CJ & Al-Shoumer KAS 2005 PCOS: an ovarian disorder that leads to dysregulation in the hypothalamic-pituitary-adrenal axis? European Journal of Obstetrics, Gynecology and Reproductive Biology 118 4–16. (https://doi.org/10.1016/j.ejogrb.2004.06.024)
Drummond AE 2006 The role of steroids in follicular growth. Reproductive Biology and Endocrinology 4 16. (https://doi.org/10.1186/1477-7827-4-16)
Drummond AE & Findlay JK 1999 The role of estrogen in folliculogenesis. Molecular and Cellular Endocrinology 151 57–64. (https://doi.org/10.1016/S0303-7207(99)00038-6)
Emmen JMA, Couse JF, Elmore SA, Yates MM, Kissling GE & Korach KS 2005 In vitro growth and ovulation of follicles from ovaries of estrogen receptor (ER)alpha and ER beta null mice indicate a role for ER beta in follicular maturation. Endocrinology 146 2817–2826. (https://doi.org/10.1210/en.2004-1108)
Findlay JK & Drummond AE 1999 Regulation of the FSH receptor in the ovary. Trends in Endocrinology and Metabolism 10 183–188. (https://doi.org/10.1016/S1043-2760(98)00144-1)
Fox CS, Gona P, Hoffmann U, Porter SA, Salton CJ, Massaro JM, Levy D, Larson MG & D’Agostino RB Sr et al. 2009 Pericardial fat, intrathoracic fat, and measures of left ventricular structure and function: the Framingham Heart Study. Circulation 119 1586–1591. (https://doi.org/10.1161/CIRCULATIONAHA.108.828970)
Grummer RR & Carroll DJ 1988 A review of lipoprotein cholesterol metabolism: importance to ovarian function. Journal of Animal Science 66 3160–3173. (https://doi.org/10.2527/jas1988.66123160x)
Guo H, Jin D, Zhang Y, Wright W, Bazuine M, Brockman DA, Bernlohr DA & Chen X 2010 Lipocalin-2 deficiency impairs thermogenesis and potentiates diet-induced insulin resistance in mice. Diabetes 59 1376–1385. (https://doi.org/10.2337/db09-1735)
Guo H, Zhang Y, Brockman DA, Hahn W, Bernlohr DA & Chen X 2012 Lipocalin 2 deficiency alters estradiol production and estrogen receptor signaling in female mice. Endocrinology 153 1183–1193. (https://doi.org/10.1210/en.2011-1642)
Hamm ML, Bhat GK, Thompson WE & Mann DR 2004 Folliculogenesis is impaired and granulosa cell apoptosis is increased in leptin-deficient mice. Biology of Reproduction 71 66–72. (https://doi.org/10.1095/biolreprod.104.027292)
Hsueh AJ, Kawamura K, Cheng Y & Fauser BC 2015 Intraovarian control of early folliculogenesis. Endocrine Reviews 36 1–24. (https://doi.org/10.1210/er.2015.36.issue-1.edboard)
Iijima K, Jiang JY, Shimizu T, Sasada H & Sato E 2005 Acceleration of follicular development by administration of vascular endothelial growth factor in cycling female rats. Journal of Reproduction and Development 51 161–168. (https://doi.org/10.1262/jrd.51.161)
Kawamura K, Cheng Y, Suzuki N, Deguchi M, Sato Y, Takae S, Ho CH, Kawamura N, Tamura M & Hashimoto S et al. 2013 Hippo signaling disruption and Akt stimulation of ovarian follicles for infertility treatment. PNAS 110 17474–17479. (https://doi.org/10.1073/pnas.1312830110)
Li C & Chan YR 2011 Lipocalin 2 regulation and its complex role in inflammation and cancer. Cytokine 56 435–441. (https://doi.org/10.1016/j.cyto.2011.07.021)
Li J, Papadopoulos V & Vihma V 2015 Steroid biosynthesis in adipose tissue. Steroids 103 89–104. (https://doi.org/10.1016/j.steroids.2015.03.016)
Lohn M, Dubrovska G, Lauterbach B, Luft FC, Gollasch M & Sharma AM 2002 Periadventitial fat releases a vascular relaxing factor. FASEB Journal 16 1057–1063. (https://doi.org/10.1096/fj.02-0024com)
Mao Z, Yang L, Lu X, Tan A, Wang Y, Ding F, Xiao L, Qi X & Yu Y 2018 C1QTNF3 in the murine ovary and its function in folliculogenesis. Reproduction 155 333–346. (https://doi.org/10.1530/REP-17-0783)
Miyazawa-Hoshimoto S, Takahashi K, Bujo H, Hashimoto N & Saito Y 2003 Elevated serum vascular endothelial growth factor is associated with visceral fat accumulation in human obese subjects. Diabetologia 46 1483–1488. (https://doi.org/10.1007/s00125-003-1221-6)
Nteeba J, Ortinau LC, Perfield JW 2nd & Keating AF 2013 Diet-induced obesity alters immune cell infiltration and expression of inflammatory cytokine genes in mouse ovarian and peri-ovarian adipose depot tissues. Molecular Reproduction and Development 80 948–958. (https://doi.org/10.1002/mrd.22231)
Oliveira Filho BD, Toniollo GH, Oliveira AF, Viu MA, Ferraz HT, Lopes DT & Gambarini ML 2010 The effect of offering an energy and protein supplement to grazing Canchim beef cows either postpartum or both pre- and postpartum on lipid blood metabolites and folliculogenesis. Animal Reproduction Science 121 39–45. (https://doi.org/10.1016/j.anireprosci.2010.04.192)
Palin MF, Bordignon VV & Murphy BD 2012 Adiponectin and the control of female reproductive functions. Vitamins and Hormones 90 239–287. (https://doi.org/10.1016/B978-0-12-398313-8.00010-5)
Perez GI, Robles R, Knudson CM, Flaws JA, Korsmeyer SJ & Tilly JL 1999 Prolongation of ovarian lifespan into advanced chronological age by Bax-deficiency. Nature Genetics 21 200–203. (https://doi.org/10.1038/5985)
Piccolo S, Dupont S & Cordenonsi M 2014 The biology of YAP/TAZ: hippo signaling and beyond. Physiological Reviews 94 1287–1312. (https://doi.org/10.1152/physrev.00005.2014)
Pond CM & Mattacks CA 1995 Interactions between adipose tissue around lymph nodes and lymphoid cells in vitro. Journal of Lipid Research 36 2219–2231.
Richards JS 1980 Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiological Reviews 60 51–89. (https://doi.org/10.1152/physrev.1980.60.1.51)
Rosairo D, Kuyznierewicz I, Findlay J & Drummond A 2008 Transforming growth factor-beta: its role in ovarian follicle development. Reproduction 136 799–809. (https://doi.org/10.1530/REP-08-0310)
Rosenfeld CS, Wagner JS, Roberts RM & Lubahn DB 2001 Intraovarian actions of oestrogen. Reproduction 122 215–226. (https://doi.org/10.1530/rep.0.1220215)
Schwab J, Antonescu C, Boland P, Healey J, Rosenberg A, Nielsen P, Iafrate J, Delaney T, Yoon S & Choy E et al. 2009 Combination of PI3K/mTOR inhibition demonstrates efficacy in human chordoma. Anticancer Research 29 1867–1871.
Seth P, Porter D, Lahti-Domenici J, Geng Y, Richardson A & Polyak K 2002 Cellular and molecular targets of estrogen in normal human breast tissue. Cancer Research 62 4540–4544.
Shimizu T 2006 Promotion of ovarian follicular development by injecting vascular endothelial growth factor (VEGF) and growth differentiation factor 9 (GDF-9) genes. Journal of Reproduction and Development 52 23–32. (https://doi.org/10.1262/jrd.17072)
Uzumcu M, Pan Z, Chu Y, Kuhn PE & Zachow R 2006 Immunolocalization of the hepatocyte growth factor (HGF) system in the rat ovary and the anti-apoptotic effect of HGF in rat ovarian granulosa cells in vitro. Reproduction 132 291–299. (https://doi.org/10.1530/rep.1.00989)
Verlohren S, Dubrovska G, Tsang SY, Essin K, Luft FC, Huang Y & Gollasch M 2004 Visceral periadventitial adipose tissue regulates arterial tone of mesenteric arteries. Hypertension 44 271–276. (https://doi.org/10.1161/01.HYP.0000140058.28994.ec)
Wang ZV & Scherer PE 2016 Adiponectin, the past two decades. Journal of Molecular Cell Biology 8 93–100. (https://doi.org/10.1093/jmcb/mjw011)
Wang N, Luo LL, Xu JJ, Xu MY, Zhang XM, Zhou XL, Liu WJ & Fu YC 2014 Obesity accelerates ovarian follicle development and follicle loss in rats. Metabolism 63 94–103. (https://doi.org/10.1016/j.metabol.2013.09.001)
Wang HH, Cui Q, Zhang T, Guo L, Dong MZ, Hou Y, Wang ZB, Shen W & Ma JY et al. 2017 Removal of mouse ovary fat pad affects sex hormones, folliculogenesis and fertility. Journal of Endocrinology 232 155–164. (https://doi.org/10.1530/JOE-16-0174)
Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J & Li L et al. 2007 Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes and Development 21 2747–2761. (https://doi.org/10.1101/gad.1602907)
