Abstract
Homologous recombination (HR) plays a critical role in facilitating replication fork progression when the polymerase complex encounters a blocking DNA lesion, and it also serves as the primary mechanism for error-free DNA repair of double-stranded breaks. DNA repair protein RAD51 homolog 1 (RAD51) plays a central role in HR. However, the role of RAD51 during porcine early embryo development is unknown. In the present study, we examined whether RAD51 is involved in the regulation of early embryonic development of porcine parthenotes. We found that inhibition of RAD51 delayed cleavage and ceased development before the blastocyst stage. Disrupting RAD51 activity with RNAi or an inhibitor induces sustained DNA damage, as demonstrated by the formation of distinct γH2AX foci in nuclei of four-cell embryos. Inhibiting RAD51 triggers a DNA damage checkpoint by activating the ataxia telangiectasia mutated (ATM)–p53–p21 pathway. Furthermore, RAD51 inhibition caused apoptosis, reactive oxygen species accumulation, abnormal mitochondrial distribution and decreased pluripotent gene expression in blastocysts. Thus, our results indicate that RAD51 is required for proper porcine parthenogenetic activation (PA) embryo development.
Introduction
Organisms and cells have evolved complex systems for responding to DNA damage to ensure the survival and faithful transmission of genetic materials to subsequent generations. Depending on the type of DNA lesion, cells generally arrest cell cycle progression by activating the DNA damage response (DDR), which includes sensing DNA lesions and triggering cascades mediated by the ataxia telangiectasia mutated (ATM), ataxia telangiectasia and RAD3-related (ATR) kinases to repair damaged DNA (Jazayeri et al. 2006, Ciccia & Elledge 2010). Of the various forms of damage that are inflicted by mutagens, DNA double-strand breaks (DSBs) are considered the most harmful, because one unrepaired DNA double-strand break (DSB) is sufficient to trigger permanent growth arrest and cell death (Bennett et al. 1993, Wang et al. 2013). In mammals, two molecular pathways are involved in DSB repair: HR and nonhomologous end joining (NHEJ). Activated ATM and ATR can also phosphorylate histone H2AX (cH2AX) at the sites of DSB formation (Stiff et al. 2004). This phosphorylation involves large chromatin domains forming nuclear foci that are easily detected by immunostaining. The phosphorylation of histone H2AX is critical for DSB repair, because H2AX anchors important initiator proteins that are required for both HR (e.g., BRCA1, MRE11A, BRCA2) and NHEJ (e.g., 53BP1, PRKDC, XRCC6) (Paull et al. 2000, McManus & Hendzel 2005).
RAD51 is the central enzymatic component of HR. Upon its regulated recruitment to sites of DSBs, RAD51 forms a nucleoprotein filament by polymerizing onto single-stranded DNA at the processed break. This filament catalyzes DNA strand exchange with an undamaged sister chromatid or homologous chromosome, which serves as a template for the restoration of missing genetic information (Li & Heyer 2008, San Filippo et al. 2008). RAD51 plays a role in replication fork progression, which is critical for maintaining the structural integrity of chromosomes and ensuring cell proliferation in vertebrates (Tsuzuki et al. 1996, Sonoda et al. 1998, Carr et al. 2011). Tumor cells overexpressing RAD51 are more resistant to DNA damage induced by chemotherapy (Klein 2008).
RAD51 plays an important role in the maintenance of the human mitochondrial genome (Sage et al. 2010). Human RAD51 physically interacts with mitochondrial DNA and supports the maintenance of mitochondrial DNA copy number under stress conditions (Sage & Knight 2013). Moreover, depletion of RAD51 in mouse oocytes caused a decrease in ATP production and mitochondrial defect-activated autophagy (Kim et al. 2016). We recently reported (Jin & Kim 2017) that inhibition of RAD51 in porcine oocytes-induced metaphase I arrest along with spindle defects, chromosomal misalignment and abnormal mitochondrial distribution, indicating that RAD51 functions to safeguard mitochondrial integrity during meiotic maturation.
Although RAD51 mediates HR repair of DNA DSBs and safeguards mitochondrial activity, the molecular mechanisms underlying RAD51 activity still need to be elucidated. Here, we hypothesized that RAD51 plays a role in DNA DSBs repair, DNA damage checkpoint and mitochondria activity during porcine early parthenogenetic activation (PA) embryonic development. The specific RAD51 inhibitor B02, which is a cell-permeable pyridinyl vinyl-quinazolinone compound that directly interacts and controls the activity of RAD51, was used in the current study to disrupt RAD51 from binding to DNA and forming nucleoprotein filaments in mouse embryonic fibroblasts (Huang et al. 2011, Huang et al. 2012). In this study, we investigated DNA damage, reactive oxygen species (ROS) accumulation, mitochondrial distribution, pluripotent gene expression and apoptosis during porcine PA embryo development, following RAD51 disruption.
Materials and methods
Oocyte collection, in vitro maturation and embryo culture
All animal handling and experiments were performed according to a protocol approved by the Animal Research Committee of Chungbuk National University, Korea. All chemicals used in this study were purchased from Sigma-Aldrich, unless otherwise indicated. Porcine ovaries were provided by a local slaughterhouse (Umsung, Cheongju, Korea). Cumulus–oocyte complexes (COCs) were aspirated from the follicles (3–8 mm in diameter) of porcine ovaries and washed three times with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered Tyrode’s medium containing 0.1% (w/v) poly(vinyl alcohol) (HEPES-TL-PVA). The collected COCs were incubated with in vitro maturation (IVM) medium for 44 h at 38.5°C and 5% CO2. The IVM medium comprised tissue culture medium 199 (Gibco), supplemented with 0.1 g/L sodium pyruvate, 0.6 mM l-cysteine, 10 ng/mL epidermal growth factor, 10% porcine follicular fluid (v/v), 10 IU/mL luteinizing hormone (Sigma-Aldrich) and 10 IU/mL follicle-stimulating hormone (Sigma-Aldrich). The cumulus cells were removed in TL-HEPES, supplemented with 1 mg/mL hyaluronidase (w/v) by pipetting for 3 min. For activation of parthenogenesis, oocytes with polar bodies were selected. They were activated by two direct current pulses of 1.1 kV/cm for 60 µs and then incubated in porcine zygote medium (PZM-5), containing 7.5 μg/mL of cytochalasin B for 3 h. Finally, embryos were washed three times and cultured in PZM-5 for 7 days at 38.5°C in a humidified atmosphere of 5% CO2.
Quantitative RT-PCR
Total RNA was extracted using the Dynabeads mRNA DIRECT kit (Invitrogen Dynal AS), and cDNA was obtained by reverse transcription of the mRNA using a cDNA synthesis kit (TaKaRa) with Oligo(dT)12–18 primers and SuperScript III Reverse Transcriptase (Invitrogen Co). The PCR conditions were as follows: 95°C for 3 min followed by 35 cycles of 95°C for 15 s, 60°C for 30 s and 72°C for 20 s and a final extension step at 72°C for 5 min. Relative gene expression was normalized to internal porcine GAPDH mRNA level by the 2−ΔΔCt method. The primers used to amplify each gene are shown in Supplementary Table 1 (see section on supplementary data given at the end of this article).
Drug treatment
To evaluate the effect of RAD51 inhibition on porcine embryo development, the porcine embryos (stage) were treated with RAD51 Inhibitor B02 (SML0364, Sigma). B02 (50 mM) stock in DMSO was stored at 4°C until required. We controlled the content of DMSO so that it did not exceed 0.1%. We took 1 µL DMSO, 0.25 µL B02 + 0.75 µL DMSO, 0.5 µL B02 + 0.5 µL DMSO, 1 µL B02 and diluted the mixture with 1 mL PZM-5 to make four different concentrations (0, 10, 25, 50 μM) which contained an equivalent volume of DMSO.
Preparation of double-stranded RNA
To prepare the RAD51 double-stranded RNA (dsRNA) for knockdown experiments, a 609 bp DNA fragment of RAD51 cDNA was amplified using gene-specific primers containing the T7 promoter sequence (GAATTAATACGACTCACTATAGGGAGA) at both 5′ ends. RAD51 was amplified using cDNA and the RAD51-specific primers were 5ʹ-GAATTAATACGACTCACTATAGGGAGAGCTGCAGGCCGAGTATTGAA-3′ (forward) and 5′-GAATTAATACGACTCACTATAGGGAGACCCGGGCATATGCTACGTTA-3′ (reverse). Then, dsRNA was synthesized via in vitro transcription, at 37°C for 4 h, using the purified PCR amplicons and a MEGAscript T7 Kit (Ambion). The synthesized dsRNA was treated with DNase I to remove any contaminating DNA and purified using phenol–chloroform extraction and precipitation with isopropyl alcohol. The dsRNA was then frozen at −80°C until microinjection.
Microinjection
Porcine zygote incubated in medium (PZM-5), containing 7.5 μg/mL of cytochalasin B for 3 h and washed with HEPES-TL-PVA. To knockdown RAD51, 3–5 pL of dsRNA (1 μg/μL) prepared in RNase-free H2O was microinjected into the cytoplasm using an Eppendorf microinjector and a Nikon Diaphot ECLIPSE TE300 inverted microscope (Nikon Instruments) equipped with a Narishige MM0-202N hydraulic 3D micromanipulator (Narishige Inc, Tokyo, Japan). The procedure was completed within 1 h. Immediately after the microinjection, the zygotes were washed and cultured in PZM-5 for 7 days at 38.5°C in a humidified atmosphere of 5% CO2. As the control, 3–5 pL of water was microinjected into zygotes under the same conditions.
Western blot analysis
A total of 300 porcine embryos were placed in 1× SDS sample buffer and heated at 99°C for 5 min. Proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes in 1× transfer buffer. Thereafter, membranes were blocked in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) containing 5% nonfat milk for 1 h and were then incubated at 48°C overnight with rabbit anti-p53 (sc6243, 1:500; Santa Cruz), mouse anti-p21 (P1484, 1:1000; Sigma-Aldrich) or rabbit anti-β-actin (13E5, 1:1000; Cell Signaling Technology). Membranes were washed three times with TBS-T (10 min each) and incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit-IgG (1:1000; Santa Cruz Biotechnology). Signals were detected using Pierce ECL Western blotting substrate (Thermo Fisher Scientific). To quantify Western blot results, band intensity values were determined using ImageJ software.
Immunofluorescence analysis
Immunostaining was performed as previously described (Jin & Kim 2017). The antibodies used were rabbit anti-RAD51 (sc-8349, 1:100; Santa Cruz Biotechnology), mouse anti-γH2AX (ab26350, 1:100; Abcam), rabbit anti-ATM (pS1981, 1:100; Cell Signaling Technology), goat anti-OCT4 (sc-8628, 1:100; Santa Cruz), rabbit anti-p53 (sc6243, 1:100; Santa Cruz), rabbit anti-SOX2 (sc-17320, 1:100; Santa Cruz), and mouse anti-p21 (P1484, 1:1000; Sigma-Aldrich). The embryos were washed three times with phosphate-buffered saline (PBS)-PVA, and then labeled with a FITC-conjugated antibody (1:100) for 1 h at room temperature. The embryos were counterstained with 5 μg/mL Hoechst 33342 (Sigma Life Science) for 15 min, mounted on a glass slide and examined using an LSM 710 META confocal laser-scanning microscope (Zeiss).
Measurement of blastocyte ROS levels
To measure ROS levels, blastocyst were incubated with 10 µM 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA) for 15 min. After incubation, the blastocysts were washed three times in PZM-5 medium and transferred to PBS drops in a polystyrene culture dish. The fluorescent signals were captured using an epifluorescence microscope (green fluorescence, UV filter, 100 nm). ImageJ software was used to analyze fluorescence intensity.
Staining of mitochondria
To evaluate the distribution of mitochondria, blastocyst were incubated in IVC medium supplemented with 0.5 μM MitoTracker Red CMXRos dye (Molecular Probes) for 30 min at 38.5°C, washed three times with PBS-PVA and counterstained with Hoechst 33342 for 15 min.
TUNEL assay
Embryos were washed three times with PBS (pH 7.4) containing 1 mg/mL polyvinylpyrrolidone (PBS/PVP) and fixed in 3.7% paraformaldehyde, prepared in PBS. After fixation for 30 min at 37°C, the embryos were washed with PBS/PVP and permeabilized by incubation in 0.5% Triton X-100 for 1 h at room temperature. The embryos were then washed twice with PBS/PVP and incubated with fluorescein-conjugated dUTP and terminal deoxynucleotidyl transferase enzyme (In Situ Cell Death Detection Kit; Roche) in the dark for 1 h at 37°C. Blastocysts were counterstained with Hoechst 33342 to label all nuclei, washed with PBS/PVP, mounted with slight coverslip compression and examined under an Olympus fluorescence microscope.
Fluorescence intensity analysis
ImageJ software (v.1.47) was used to define a region of interest (ROI), and the average fluorescence intensity per unit area within the ROI was determined. Independent measurements using identically sized ROIs were obtained for the nucleus or cytoplasm. Average values of all measurements were used to obtain the final average intensities, which were compared between the control and treated embryos.
Statistical analysis
Each experiment was performed at least three times. Statistical analysis were performed with the SPSS software package (version 11.5; SPSS). The data are expressed as the mean ± s.e.m., and ANOVA was used to analyze the data. P values less than 0.05 were considered statistically significant.
Results
Subcellular localization of RAD51 in porcine early PA embryonic development
We first examined the RAD51 localization at early embryo development by immunofluorescent staining. RAD51 was examined in the following samples: zygotes, two-, four-, eight-, morula and blastocyst embryos. As shown in Fig. 1A, RAD51 was predominantly localized to nuclei during all embryonic stages and the formation of RAD51 foci was concentrated in four-cell embryos (Fig. 1B). RAD51 transcripts were detected by quantitative RT-PCR (Supplementary Fig. 1). Next, to determine whether RAD51 was involved in DNA repair in porcine embryos, the correlation between RAD51 and γH2AX, a marker of DNA damage, was assessed in two-cell embryos by staining. RAD51 foci were colocalized with γH2AX in the nuclei (Fig. 1C).
Localization and expression patterns of RAD51 in porcine early embryos. (A) Localization of RAD51 at various stages in early embryos was investigated by immunostaining with an anti-RAD51 antibody and Hoechst nuclear stain. Scale bar: 20 µm (white), 5 µm (yellow). (B) Quantitative RAD51 foci number per nuclei in one-, two-, four- and eight-cell embryos, as well as morula and blastocysts. (C) H2AX was activated by phosphorylation (γH2AX) at sites of DNA damage and served as a marker of DNA DSBs. RAD51 aggregated as foci in the nucleus and colocalized with γH2AX in 2-cell embryos. Red, RAD51; green, γH2AX; blue, DNA. Scale bar = 20 μm (white), 5 µm (yellow).
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
RAD51 is required for porcine early PA embryonic development
To investigate the role of RAD51 in embryo development, embryos produced by the PA of MII oocytes were treated with the RAD51 inhibitor, B02, and knocked down the expression of RAD51 using dsRNA. After 7 days of treatment with 0, 10, 25 or 50 μM B02, the development rate of blastocyst was 63.22, 46.87, 33.26 and 5.95%, respectively (Fig. 2A). Because an inhibitory B02 concentration of 25 μM can almost block RAD51 foci formation at the four-cell embryo (Fig. 2B and C), we used this concentration for all subsequent studies. The ability of the B02-treated PA embryos to develop to the blastocyst stage was dramatically reduced. The number of cells per blastocyst was lower in the B02 treatment groups than in the controls (Fig. 2D and Supplementary Fig. 2A). The level of RAD51 mRNA was significantly decreased after dsRNA injection (Supplementary Fig. 2B). Knockdown of RAD51 was confirmed at the protein level by immunostaining at four-cell stage (Fig. 2E and F). Normal development rate of blastocyst was also seen in RAD51-knockdown (KD) groups (Fig. 2G). A significant proportion of B02-treated (25 μM) embryos could develop beyond the first cleavage stage, although the embryo quality was poor, showing more micronuclei or abnormal nucleus numbers compared to embryos within the control group (Fig. 2H). Next, porcine PA embryos were recovered at 12, 24, 60 and 84 h, after treatment with B02. Compared with the controls, two-cell embryos were almost normal in morphology and number 24 h post activation (Fig. 2I and Supplementary Fig. 2C). However, when most control PA embryos were at the four-cell stage 36 h post activation (85.72%), there were still a large number of two-cell embryos in the B02 treatment groups (67.06%) (Fig. 2I and J). Most of the B02-treated PA embryos were arrested at the two- to four-cell stage, while most of the embryos in the control group had already reached the morula or early blastocyst stage after 5 days of development (Supplementary Fig. 2D).
Effects of RAD51 inhibition on the early porcine parthenogenetic embryo development. (A) Blastocyst rates of porcine embryos that were untreated (control) or exposed to 0.10, 25, or 50 μm RAD51 inhibitor B02. (B) RAD51 foci were decreased after B02 (25 μm) treatment. Scale bar = 20 μm (white), 5 µm (yellow). (C) Quantitative RAD51 foci number per nuclei in control and B02-treated 4cell-embryos. (D) Morphology of day-7 embryos derived from zygotes treated with B02, indicating that the blastocyst development rates and cell numbers per blastocyst were lower than in the control group. Blue, DNA; DIC, differential interference contrast. (E and F) Knockdown of endogenous RAD51 protein expression after RAD51 dsRNA injection was verified by immunofluorescent staining analysis. Bar = 5 µm. (G) Effects of RAD51 knockdown on rate of blastocyst over 7 days in culture. (H) Morphology of embryos derived from zygotes treated with B02 (50 μm). For embryos that were treated with B02, two nuclei or no nuclei were found in each blastomere. Blue, DNA; DIC, differential interference contrast. Scale bar = 20 μm. (I) Control and B02-treated embryos are shown at different stages derived from 12, 24, 60 and 84 h post activation. The developmental stages of embryos were affirmed according to blastomere number. Scale bar = 40 μm. (J) Two-cell embryos were collected at 24 h and cultured into the four-cell stage. Developmental rates were determined at 24, 28, 32 and 36 h post activation. *P < 0.05; **P < 0.01; ***P < 0.001. The experiment was performed in triplicate and the data are expressed as the mean ± s.e.m. The number of oocytes analyzed is specified in brackets.
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
Inhibition of RAD51 increased DNA damage in porcine early PA embryos
Given that RAD51 is a DNA repair protein, it is possible that RAD51 inhibition could lead to increased accumulation of DNA damage. To test this hypothesis, we stained for γH2AX, which is the DNA repair signal marker for DNA DSBs and observed the accumulation of γH2AX foci in the nuclei of two- and four-cell embryos that had been exposed to B02. The number of γH2AX foci was similar in control and B02-treated two-cell embryos (Fig. 3A and B). However, large γH2AX foci were frequently observed in B02-treated four-cell embryos. The number of γH2AX foci in nuclei were significantly higher in B02-treated four-cell embryos than the control group, which suggests that DNA damage increased after RAD51 inhibition (Fig. 3A and B). Using dsRNA targeting RAD51, we confirmed the presence of high levels of phosphorylated H2AX after RAD51 knockdown (Fig. 3C and D). Further analysis of γH2AX accumulation at later stages indicated a higher number of γH2AX foci in B02-treated embryos (Supplementary Fig. 3A and B). The phosphorylation of histone H2AX is critical for DSB repair, because H2AX anchors some of the important initiator proteins that are required for both HR (e.g., BRCA1, MRE11A, BRCA2) and NHEJ (e.g., 53BP1, PRKDC, XRCC6) pathways. These proteins are often colocalized with γH2AX at the sites of DSBs. B02-treated four-cell embryos were stained with γH2AX and 53BP1 antibodies. As compared with the control, the intensity of 53BP1 in nuclei increased after RAD51 inhibition (Fig. 3E and F). To explore the effect of B02 treatment on other DSB repair, mRNA levels of DDR genes participating in HR and NHEJ repair pathways were measured in the four-cell embryo stage (Fig. 3G).
DNA damage accumulates in B02-treated four-cell embryos. (A) Representative images of control and B02-treated embryos obtained at the two- and four-cell stages and stained with a γH2AX antibody. The size and number of γH2AX foci increased in B02-treated four-cell embryos. Scale bar = 20 μm (white), 5 µm (yellow). (B) Quantification of γH2AX foci number per nuclei in control and B02-treated two-cell and four-cell embryos. (C) Control and RAD51-knockdown embryos obtained at the four-cell stages and stained with a γH2AX antibody. (D) Quantification of γH2AX foci number per nuclei in control and RAD51-knockdown four-cell embryos. (E) Control and B02-treated four-cell embryos were stained with γH2AX and 53BP1 antibodies. For the negative control, the anti-53BP1 primary antibody was omitted. Scale bar = 20 μm (white), 5 µm (yellow). (F) Quantification of the 53BP1 intensity in four-cell embryos. (G) Levels of Brca1, Mre11a, Brca2, Prkdc and Xrcc6 mRNA were measured in the B02-treated four-cell embryos using qRT-PCR. *P < 0.05; **P < 0.01; ***P < 0.001. The experiment was performed in triplicate, and the data are expressed as the mean ± s.e.m. The number of oocytes analyzed is specified in brackets.
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
DNA damage checkpoints are activated in RAD51-inhibited four-cell embryos
Preimplantation embryo development has been shown to require the latency of p53, which interacted with RAD51, and increased expression of p53 is associated with poor developmental potential (Gabrielli et al. 1992, Buchhop et al. 1997). We hypothesized that the damaged DNA in B02-treated four-cell embryos might activate p53 to delay cell cycle progression. To test this, control and B02-treated four-cell embryos were stained with phosphorylated forms of ATM (ATM-p) and phosphorylated p53 antibodies. We observed an increased signal for ATM-p in nuclei from B02-treated embryos (Fig. 4A). Moreover, phosphorylated p53 was compared between control and B02-treated four-cell embryos (Fig. 4B, D and E). The activation of p53 usually triggers the expression of p21 in response to DNA damage to arrest the cell cycle (Brugarolas et al. 1995). Thus, p53 targeting of p21 in B02-treated embryos was examined by immunostaining and Western blot analysis. The p21 intensity significantly increased in B02-treated four-cell embryos (Fig. 4C, D and F).
Checkpoints are activated in B02-treated four-cell embryos. (A) Control and B02-treated embryos obtained at the four-cell stage and stained with an ATM-p antibody. Scale bar = 20 μm. (B) Control and B02-treated embryos obtained at the four-cell stage and stained with a p53 antibody. For the negative control, the anti-p53 primary antibody was omitted. Scale bar = 20 μm (white), 5 µm (yellow). (C) Control and B02-treated embryos obtained at the four-cell stage and stained with a p21 antibody. For the negative control, the anti-p21 primary antibody was omitted. Scale bar = 20 μm (white), 5 µm (yellow). (D) Western blot analysis showing activation/expression of p53 and p21 at the four-cell stage after B02 treatment; β-actin served as a loading control. (E) Relative intensity of p53 in Western blot was assessed by densitometry. (F) Relative intensity of p21 in Western blot was assessed by densitometry. ***P < 0.001. The experiment was performed in triplicate and the data are expressed as the mean ± s.e.m.
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
RAD51 inhibition leads to abnormal mitochondrial distribution and increased intracellular ROS levels
Next, the quality of blastocyst was examined by the distribution of mitochondria and ROS accumulation. As shown in Fig. 5A, the generation of ROS increased in the B02-treated group as compared with that in the control group. Moreover, the relative green fluorescence intensity that induced ROS production increased significantly (Fig. 5D). In control PA embryos, mitochondria were distributed around the nuclei, whereas in B02-treated PA embryos, the mitochondria were abnormally distributed (Fig. 5B and E). Mitochondrial membrane potential was detected in B02-treated blastocysts by JC-1 staining (Fig. 5F). However, RAD51 inhibition did not affect mitochondrial membrane potential (Fig. 5F).
RAD51 inhibition increased intracellular ROS levels and abnormal mitochondrial distribution. (A) ROS staining in B02-treated and untreated blastocyst. Scale bar = 120 μm. (B) Mitochondrial distribution in RAD51 inhibitor-treated and untreated control oocytes as detected by immunostaining. (C) Red fluorescence corresponds to activated mitochondria and green fluorescence corresponds to less-activated mitochondria. Scale bar = 120 μm. (D) ROS levels in B02-treated and control blastocyst. (E) The rate of abnormal mitochondria distribution is increased after B02 treatment. (F) Mitochondrial membrane potential was measured as the ratio of red fluorescence to total fluorescence. **P < 0.01; ***P < 0.001. The experiment was performed in triplicate and the data are expressed as the mean ± s.e.m. The number of oocytes analyzed is specified in brackets.
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
RAD51 inhibition leads to increased apoptosis and decreased expression of pluripotency markers
Apoptosis is a recognized cellular response to excessive DNA damage. The rate of apoptosis was calculated by dividing the number of cells with TUNEL-positive nuclei by the total embryo cell number. The number of TUNEL-positive nuclei increased significantly in day 7 blastocyst in the B02-treated group (Fig. 6A and D). In addition, the expression of pluripotency-related genes, OCT4 and SOX2, was lower in B02-treated PA embryos as compared to non-treated PA embryos at the blastocyst stage. The OCT4 and SOX2 intensity in B02-treated blastocyst were decreased (Fig. 6B, C, E and F). SOX2 is a marker of pluripotent cells that reflects the progression of trophectoderm (TE)/inner cell mass (ICM) specification in porcine embryos (Liu et al. 2015). SOX2 is specifically expressed in the nuclei of ICM region (Fig. 6B). The ratio of ICM cells were also decreased in B02-treated PA embryos (Supplementary Fig. 4).
Effects of B02 on apoptosis and pluripotency gene expression. (A) TUNEL-positive cells were detected in B02-treated and untreated blastocyst. Scale bar = 20 μm. (B) SOX2 protein detection in B02-treated and untreated blastocyst. Scale bar = 20 μm. (C) OCT4 protein detection in B02-treated and untreated blastocyst. Scale bar = 20 μm. (D) Quantification of the apoptotic rate (number of apoptotic cells/number of total cells) in B02-treated and untreated blastocyst. (E) Quantification of SOX2 signal in B02-treated and untreated blastocyst. (F) Quantification of OCT4 signal in B02-treated and -untreated blastocyst. **P < 0.01; ***P < 0.001. The experiment was performed in triplicate, and the data are expressed as the mean ± s.e.m. The number of oocytes analyzed is specified in brackets.
Citation: Reproduction 157, 3; 10.1530/REP-18-0271
Discussion
Porcine embryos can be produced in vitro by different technologies, such as in vitro fertilization (IVF), somatic cell nuclear transfer and PA. Although these in vitro-produced embryos are less developmentally competent than in vivo-derived embryos, they are important for agriculture and biomedical research (Niemann & Rath 2001). In the present study, we used PA-derived porcine embryos for experiments. Although the PA embryos contained less cells than ones generated by IVF, the blastocyst rate and immunofluorescence staining for pluripotent genes data illustrated that both the porcine PA and IVF blastocysts were of high quality for experiments (Hou et al. 2015, Choi et al. 2017, Niu et al. 2017).
RAD51 foci spontaneously form during mitosis as cells undergo DNA replication in the S phase or in response to DNA damage (Tarsounas et al. 2004). Here, a similar distribution pattern of RAD51 was observed in porcine embryos. We observed that RAD51 mainly formed foci in the four-cell embryo stage. In addition, etoposide-induced DNA DSBs arrest cell division at approximately the four-cell stage in porcine PA embryos (Wang et al. 2015). Thus, we speculate that the DNA repair protein, RAD51, mainly functions in the four-cell stage. Previously, deletion or inhibition of RAD51-induced DNA damage in oocyte meiosis (Kim et al. 2016, Jin & Kim 2017). Consistently, we observed similar results in porcine PA embryos. Most PA embryos that were treated with the RAD51 inhibitor or knockdown were arrested at approximately the four-cell stage on day 5, and these embryos showed increased DNA damage. In response to DNA damage, cell cycle checkpoints (G1, S, G2/M) are activated, stopping cell cycle progression to allow time for repair, thereby preventing the transmission of damaged or incomplete replicated chromosomes (Wang & Kim 2016). In somatic cells, insufficient DNA repair usually activates cell cycle checkpoints via the ATM and p53–p21 pathways (Espinosa et al. 2003, Arias-Lopez et al. 2006, Giono & Manfredi 2006). In mouse embryonic stem cells, suppression of RAD51 expression caused cells to accumulate in the G2/M phase and activate the DNA damage checkpoint (Yoon et al. 2014). Our findings were similar to those of previous studies in that both the p53 and p21 pathways were activated in response to damaged DNA in B02-treated four-cell embryos. This suggests that porcine early embryos could arrest development in response to DNA damage via these pathways, as early as the four-cell stage. In mice, embryos with targeted disruption of the RAD5l genes cannot undergo early embryonic development (Tsuzuki et al. 1996). In addition, a mutation in mouse RAD51 results in early embryonic lethality, followed by programmed cell death and chromosome loss (Lim & Hasty 1996). However, yeast RAD51 mutations do not convey cell lethality. This might reflect differences in the roles of RAD51 in different cellular organisms. There is the possibility that a recombination process is essential for the reproduction of mammalian cells, and it is plausible that the RAD51 protein is involved in DNA replication.
Oxidative stress is characterized by the overproduction of free radicals, which can disrupt the balance of ROS and antioxidants under normal physiological conditions. ROS levels within an optimal range are required for normal cell metabolism, while excessive ROS generation may negatively influence cell membranes, protein synthesis and lipid metabolism (Sena & Chandel 2012). In this study, RAD51 inhibition disrupted mitochondrial distribution and induced ROS accumulation. B02-treated blastocysts exhibited an upregulation of ROS, which supports the notion that RAD51 may have a role in mediating ROS production. Mitochondria are an important source of ROS production within most mammalian cells (Turrens 2003, Andreyev et al. 2005, Adam-Vizi & Chinopoulos 2006). The excessive production of ROS contributes to protein, lipid and mitochondrial damage in a range of pathologies (Duvnjak et al. 2007). Moreover, high levels of ROS have been shown to be detrimental to oocyte maturation and fertilization, as well as embryo development (Liang et al. 2016). Increased ROS production is often associated with mitochondrial dysfunction and RAD51 physically interacts with mitochondrial DNA in both humans and mice (Sage et al. 2011, Murphy 2013). There are critical needs for RAD51 in the mitochondrial response to oxidative stress (Sage et al. 2010). Thus, our data suggest that RAD51 functions to maintain ROS levels and ensure proper mitochondrial functioning in porcine embryo development.
Inhibition of RAD51 in blastocyst caused an increase in apoptosis and a decrease in the expression of pluripotent-related genes (Oct4 and Sox2). DNA damage and the failure to repair this damage can result in the induction of apoptosis through the activation of apoptotic pathways (Wang et al. 2015). Thirty genes that are implicated in DNA damage and repair, including RAD51, were positively correlated with OCT4 expression (Campbell et al. 2007). Laser microbeam-induced DNA damage in blastomeres of mouse early embryos also showed faint staining for OCT4 and CDX2 (Wang et al. 2013). In addition, etoposide-induced DNA DSBs increased apoptosis and decreased the expression of OCT4 and SOX2 in porcine early embryos (Wang et al. 2015). Thus, we hypothesize that the decreased expression of OCT4 and SOX2 was due to DNA damage and apoptosis, induced by RAD51 inhibition. Moreover, our study allows us to exclude the possibility that RAD51 directly influences the expression of pluripotency genes. That said, the relationship between RAD51 and pluripotency-related genes still requires further investigation.
Taken together, in the present study, we demonstrated that RAD51 is essential for porcine early PA embryo development using specific inhibitor or dsRNA. Disrupting RAD51 induces the accumulation of DNA damage and arrests preimplantation development through the activation of the ATM–p53–p21 pathway. We also found that RAD51 inhibition influences the transcript levels of HR and NHEJ DNA repair pathway genes. Moreover, RAD51 inhibition caused apoptosis, ROS accumulation and decreased pluripotent gene expression in blastocysts.
Supplementary data
This is linked to the online version of the paper at https://doi.org/10.1530/REP-18-0271.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Next-Generation BioGreen21 Program (Project PJ01322101), Rural Development Administration, South Korea, and supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2018RIA2B2005880). This work was supported by the research grant of Chungbuk National University in 2014.
Acknowledgments
The authors thank all the group members for their insights and critical reading of the manuscript.
References
Adam-Vizi V & Chinopoulos C 2006 Bioenergetics and the formation of mitochondrial reactive oxygen species. Trends in Pharmacological Sciences 27 639–645. (https://doi.org/10.1016/j.tips.2006.10.005)
Andreyev AY, Kushnareva YE & Starkov AA 2005 Mitochondrial metabolism of reactive oxygen species. Biochemistry 70 200–214. (https://doi.org/10.1007/s10541-005-0102-7)
Arias-Lopez C, Lazaro-Trueba I, Kerr P, Lord CJ, Dexter T, Iravani M, Ashworth A & Silva A 2006 p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene. EMBO Reports 7 219–224. (https://doi.org/10.1038/sj.embor.7400587)
Bennett CB, Lewis AL, Baldwin KK & Resnick MA 1993 Lethality induced by a single site-specific double-strand break in a dispensable yeast plasmid. PNAS 90 5613–5617. (https://doi.org/10.1073/pnas.90.12.5613)
Brugarolas J, Chandrasekaran C, Gordon JI, Beach D, Jacks T & Hannon GJ 1995 Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature 377 552–557. (https://doi.org/10.1038/377552a0)
Buchhop S, Gibson MK, Wang XW, Wagner P, Stürzbecher HW & Harris CC 1997 Interaction of p53 with the human Rad51 protein. Nucleic Acids Research 25 3868–3874. (https://doi.org/10.1093/nar/25.19.3868)
Campbell PA, Perez-Iratxeta C, Andrade-Navarro MA & Rudnicki MA 2007 Oct4 targets regulatory nodes to modulate stem cell function. PLoS ONE 2 e553. (https://doi.org/10.1371/journal.pone.0000553)
Carr AM, Paek AL & Weinert T 2011 DNA Replication: Failures and Inverted Fusions. Seminars in Cell and Developmental Biology 22 866–874. (https://doi.org/10.1016/j.semcdb.2011.10.008)
Choi JW, Zhao MH, Liang S, Guo J, Lin ZL, Li YH, Jo YJ, Kim NH & Cui XS 2017 Spindlin 1 is essential for metaphase II stage maintenance and chromosomal stability in porcine oocytes. Molecular Human Reproduction 23 166–176. (https://doi.org/10.1093/molehr/gax005)
Ciccia A & Elledge SJ 2010 The DNA damage response: making it safe to play with knives. Molecular Cell 40 179–204. (https://doi.org/10.1016/j.molcel.2010.09.019)
Duvnjak M, Lerotić I, Baršić N, Tomašić V, Jukić LV & Velagić V 2007 Pathogenesis and management issues for non-alcoholic fatty liver disease. World Journal of Gastroenterology 13 4539–4550. (https://doi.org/10.3748/wjg.v13.i34.4539)
Espinosa JM, Verdun RE & Emerson BM 2003 p53 functions through stress-and promoter-specific recruitment of transcription initiation components before and after DNA damage. Molecular Cell 12 1015–1027. (https://doi.org/10.1016/S1097-2765(03)00359-9)
Gabrielli BG, Roy LM, Gautier J, Philippe M & Maller JL 1992 A cdc2-related kinase oscillates in the cell cycle independently of cyclins G2/M and cdc2. Journal of Biological Chemistry 267 1969–1975.
Giono LE & Manfredi JJ 2006 The p53 tumor suppressor participates in multiple cell cycle checkpoints. Journal of Cellular Physiology 209 13–20. (https://doi.org/10.1002/jcp.20689)
Hou D, Su M, Li X, Li Z, Yun T, Zhao Y, Zhang M, Zhao L, Li R & Yu H et al. 2015 The efficient derivation of trophoblast cells from porcine in vitro fertilized and parthenogenetic blastocysts and culture with ROCK inhibitor Y-27632. PLoS ONE 10 e0142442. (https://doi.org/10.1371/journal.pone.0142442)
Huang F, Motlekar NA, Burgwin CM, Napper AD, Diamond SL & Mazin AV 2011 Identification of specific inhibitors of human RAD51 recombinase using high-throughput screening. ACS Chemical Biology 6 628–635. (https://doi.org/10.1021/cb100428c)
Huang F, Mazina OM, Zentner IJ, Cocklin S & Mazin AV 2012 Inhibition of homologous recombination in human cells by targeting RAD51 recombinase. Journal of Medicinal Chemistry 55 3011–3020. (https://doi.org/10.1021/jm201173g)
Jazayeri A, Falck J, Lukas C, Bartek J, Smith GC, Lukas J & Jackson SP 2006 ATM-and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nature Cell Biology 8 37–45. (https://doi.org/10.1038/ncb1337)
Jin ZL & Kim NH 2017 RAD51 maintains chromosome integrity and mitochondrial distribution during porcine oocyte maturation in vitro. Journal of Reproduction and Development 63 489–496. (https://doi.org/10.1262/jrd.2017-078)
Kim KH, Park JH, Kim EY, Ko JJ, Park KS & Lee KA 2016 The role of Rad51 in safeguarding mitochondrial activity during the meiotic cell cycle in mammalian oocytes. Scientific Reports 6 34110. (https://doi.org/10.1038/srep34110)
Klein HL 2008 The consequences of Rad51 overexpression for normal and tumor cells. DNA Repair 7 686–693. (https://doi.org/10.1016/j.dnarep.2007.12.008)
Li X & Heyer WD 2008 Homologous recombination in DNA repair and DNA damage tolerance. Cell Research 18 99–113. (https://doi.org/10.1038/cr.2008.1)
Lim DS & Hasty P 1996 A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Molecular and Cellular Biology 16 7133–7143. (https://doi.org/10.1128/MCB.16.12.7133)
Liang S, , Yuan B, , Kwon J-W, , Ahn M, , Cui X-S, , Bang JK, & Kim N-H2016 Effect of antifreeze glycoprotein 8 supplementation during vitrification on the developmental competence of bovine oocytes. Theriogenology 86 485–494.e1. (https://doi.org/10.1016/j.theriogenology.2016.01.032)
Liu S, Bou G, Sun R, Guo S, Xue B, Wei R, Cooney AJ & Liu Z 2015 Sox2 is the faithful marker for pluripotency in pig: evidence from embryonic studies. Developmental Dynamics 244 619–627. (https://doi.org/10.1002/dvdy.24248)
McManus KJ & Hendzel MJ 2005 ATM-dependent DNA damage-independent mitotic phosphorylation of H2AX in normally growing mammalian cells. Molecular Biology of the Cell 16 5013–5025. (https://doi.org/10.1091/mbc.e05-01-0065)
Murphy MP 2013 Mitochondrial dysfunction indirectly elevates ROS production by the endoplasmic reticulum. Cell Metabolism 18 145–146. (https://doi.org/10.1016/j.cmet.2013.07.006)
Niemann H & Rath D 2001 Progress in reproductive biotechnology in swine. Theriogenology 56 1291–1304. (https://doi.org/10.1016/S0093-691X(01)00630-6)
Niu YJ, Zhou W, Guo J, Nie ZW, Shin KT, Kim NH, Lv WF & Cui XS 2017 C-Phycocyanin protects against mitochondrial dysfunction and oxidative stress in parthenogenetic porcine embryos. Scientific Reports 7 16992. (https://doi.org/10.1038/s41598-017-17287-0)
Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M & Bonner WM 2000 A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Current Biology 10 886–895. (https://doi.org/10.1016/S0960-9822(00)00610-2)
Sage JM & Knight KL 2013 Human Rad51 promotes mitochondrial DNA synthesis under conditions of increased replication stress. Mitochondrion 13 350–356. (https://doi.org/10.1016/j.mito.2013.04.004)
Sage JM, Gildemeister OS & Knight KL 2010 Discovery of a novel function for human Rad51 maintenance of the mitochondrial genome. Journal of Biological Chemistry 285 18984–18990. (https://doi.org/10.1074/jbc.M109.099846)
Sage JM, Gildemeister OS & Knight KL 2011 Discovery of a novel function for human Rad51: maintenance of the mitochondrial genome. Mitochondrion 11 676. (https://doi.org/10.1016/j.mito.2011.03.118)
San Filippo J, Sung P & Klein H 2008 Mechanism of eukaryotic homologous recombination. Annual Review of Biochemistry 77 229–257. (https://doi.org/10.1146/annurev.biochem.77.061306.125255)
Sena LA & Chandel NS 2012 Physiological roles of mitochondrial reactive oxygen species. Molecular Cell 48 158–167. (https://doi.org/10.1016/j.molcel.2012.09.025)
Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O, Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y & Takeda S 1998 Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO Journal 17 598–608. (https://doi.org/10.1093/emboj/17.2.598)
Stiff T, O’Driscoll M, Rief N, Iwabuchi K, Löbrich M & Jeggo PA 2004 ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation. Cancer Research 64 2390–2396. (https://doi.org/10.1158/0008-5472.CAN-03-3207)
Tarsounas M, Davies AA & West SC 2004 RAD51 localization and activation following DNA damage. Philosophical Transactions of the Royal Society B: Biological Sciences 359 87–93. (https://doi.org/10.1098/rstb.2003.1368)
Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K, Sekiguchi M, Matsushiro A, Yoshimura Y & MoritaT 1996 Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. PNAS 93 6236–6240. (https://doi.org/10.1073/pnas.93.13.6236)
Turrens JF 2003 Mitochondrial formation of reactive oxygen species. Journal of Physiology 552 335–344. (https://doi.org/10.1113/jphysiol.2003.049478)
Wang H & Kim NH 2016 CDK2 is required for the DNA damage response during porcine early embryonic development. Biology of Reproduction 95 31. (https://doi.org/10.1095/biolreprod.116.140244)
Wang ZW, Ma XS, Ma JY, Luo YB, Lin F, Wang ZB, Fan HY, Schatten H & Sun QY 2013 Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos. Cell Cycle 12 3336–3344. (https://doi.org/10.4161/cc.26327)
Wang H, Luo Y, Lin Z, Lee IW, Kwon J, Cui XS & Kim NH 2015 Effect of ATM and HDAC inhibition on etoposide-induced DNA damage in porcine early preimplantation embryos. PLoS ONE 10 e0142561. (https://doi.org/10.1371/journal.pone.0142561)
Yoon SW, Kim DK, Kim KP & Park KS 2014 Rad51 regulates cell cycle progression by preserving G2/M transition in mouse embryonic stem cells. Stem Cells and Development 23 2700–2711. (https://doi.org/10.1089/scd.2014.0129)
