Abstract
Compared to ovarian antral follicle development, the mechanism underlying preantral follicle growth has not been well documented. Although C-type natriuretic peptide (CNP) involvement in preantral folliculogenesis has been explored, its detailed role has not been fully defined. Here, we used mouse preantral follicles and granulosa cells (GCs) as a model for investigating the dynamic expression of CNP and natriuretic peptide receptor 2 (NPR2) during preantral folliculogenesis, the regulatory role of oocyte-derived growth factors (ODGFs) in natriuretic peptide type C (Nppc) and Npr2 expression, and the effect of CNP on preantral GC viability. Both mRNA and protein levels of Nppc and Npr2 were gradually activated during preantral folliculogenesis. CNP supplementation in culture medium significantly promoted the growth of in vitro-cultured preantral follicles and enhanced the viability of cultured GCs in a follicle-stimulating hormone (FSH)-independent manner. Using adult and prepubertal mice as an in vivo model, CNP pre-treatment via intraperitoneal injection before conventional superovulation also had a beneficial effect on promoting the ovulation rate. Furthermore, ODGFs enhanced Nppc and Npr2 expression in the in vitro-cultured preantral follicles and GCs. Mechanistic study demonstrated that the regulation of WNT signaling and estrogen synthesis may be implicated in the promoting role of CNP in preantral folliculogenesis. This study not only proves that CNP is a critical regulator of preantral follicle growth, but also provides new insight in understanding the crosstalk between oocytes and somatic cells during early folliculogenesis.
Introduction
Folliculogenesis is divided into three stages (Orisaka et al. 2013). The initial stage covers primordial to primary follicle transition, which is believed to be independent of gonadotropin influence (Mcnatty et al. 2007). The second stage covers preantral to antral follicle transition. Although it is a gonadotropin-responsive phase, folliculogenesis during this stage is primarily controlled by intraovarian regulators, not gonadotropins (Cattanach et al. 1977, Halpin et al. 1986). In the last stage, growing follicles may be recruited to continue their development until they are ovulated (Craig et al. 2007) in a gonadotropin-dependent manner (Hunter et al. 2004). Compared with the well-documented role of pituitary gonadotropins (e.g., follicle-stimulating hormone (FSH) and luteinizing hormone (LH)) in regulating antral follicle development, intraovarian factors, which support autocrine and paracrine signals from oocytes and granulosa cells (GCs), may be more important for preantral follicle growth. Although a series of intraovarian factors, which include R-Spondin 2, WNT, GDF9 (growth differentiation factor 9), BMP15 (bone morphogenetic protein 15) and KITL (KIT ligand), are supportive factors of preantral follicle development (Eppig et al. 2001, 2002, Boyer et al. 2010, Cheng et al. 2013), the molecular and cellular mechanisms responsible for this process have not been fully defined.
A recent study (Sato et al. 2012) showed evidence that C-type natriuretic peptide (CNP) may play an important role as an upstream regulator in stimulating preantral follicle growth. Using a cultured ovarian explant model, they reported that CNP supplementation in culture medium-facilitated primary and early secondary follicle transition to the late secondary stage, which covers preantral follicle development, in a dose-dependent manner (0.25–3 μM). In addition, in vivo studies, where juvenile and prepubertal mice were treated via CNP intraperitoneal (i.p.) injection for 4 days, further indicated the role of CNP in promoting follicle growth (Sato et al. 2012).
CNP belongs to the natriuretic peptide family, which consists of three major types: atrial natriuretic peptide, brain natriuretic peptide and CNP. These peptides show high structural homology, characterized by a highly conserved 17-member ring structure formed by intramolecular disulfide linkage (Nishikimi et al. 2011). Natriuretic peptides execute their biological function by stimulating cyclic guanosine monophosphate (cGMP) production via guanylyl cyclase–coupled receptors (Chinkers et al. 1989). CNP acts exclusively through natriuretic peptide receptor 2 (NPR2 or NRRB) to stimulate downstream cGMP signaling (Potter et al. 2006). CNP–NPR2–cGMP signaling acts locally as a positive regulator of endochondral ossification and is essential for promoting physiological longitudinal bone growth (Chusho et al. 2001). CNP is widely distributed in the body, including in the brain, chondrocytes and endothelial cells and is considered a paracrine/autocrine regulator (Lumsden et al. 2010). More recently, genetic evidence has elucidated that loss-of-function mutation in Nppc and Npr2 results in female infertility due to premature oocyte meiotic resumption (Zhang et al. 2010, Geister et al. 2013). In Graafian follicles, CNP produced by mural GCs stimulates cGMP generation by activating NPR2, which is expressed by cumulus cells (CCs) surrounding and associating with oocytes and diffuses into oocytes via gap junctions. In oocytes, cGMP inhibits phosphodiesterase 3A, thereby preventing cAMP hydrolysis and maintaining meiotic arrest with high intra-oocyte cAMP levels (Zhang et al. 2010). The results of Sato et al. (Sato et al. 2012) are in accordance with an earlier study (Mcgee et al. 1997), in which cGMP analogs promoted the development of cultured rat preantral follicles; the authors hypothesized that cGMP pathway activators may be essential for preantral follicle survival and development (Mcgee et al. 1997). These findings not only support the possible role of CNP in initiating antrum formation, but also implicate CNP regulation of preantral follicle response to gonadotropin, which is essential for follicle development.
CNP–NPR2 signaling is the critical determinant for oocyte meiotic arrest in antral follicles in different species (Zhang et al. 2010, Hiradate et al. 2014, Zhong et al. 2015, Xi et al. 2018), and its regulatory mechanisms via gonadotropins or oocyte-derived growth factors (ODGFs) are well documented (Kawamura et al. 2011, Lee et al. 2013). However, the upstream regulatory mechanism of CNP–NPR2 signaling in preantral follicles and the mechanism underlying the promoting effect on preantral follicle growth remain to be elucidated. Accordingly, we investigated (1) CNP and NPR2 expression dynamics during preantral follicle development; (2) the effect of ODGFs, as upstream regulators, on Nppc and Npr2 expression in mouse preantral follicles and (3) the effect of CNP on the viability of GCs isolated from mouse preantral follicles. We show that CNP and NPR2 expression is gradually activated during preantral follicle development. CNP facilitated the in vitro preantral follicle development and the viability of cultured GCs in a dose-dependent and FSH-independent manner. Furthermore, based on the role of CNP in facilitating preantral follicle development, in vivo study also confirmed the beneficial effect of CNP on early follicle growth. This observation also provides a promising reference for developing a novel strategy for inducing ovulation by CNP-based pre-treatment in females. In addition, the ODGFs regulated both Nppc and Npr2 expression in preantral follicles, providing new insight into understanding the crosstalk between oocytes and somatic cells during early folliculogenesis. Finally, we demonstrate that CNP may regulate WNT signaling and enhance estrogen synthesis by modulating the expression of key ovarian genes (e.g., Wnt2b (wingless-type MMTV integration site family, member 2B), Wnt5a, Cyp11a1 (chrome P450, family 11, subfamily a, polypeptide 1) and Cdkn1a (cyclin-dependent kinase inhibitor 1A)) closely related to follicle development.
Materials and methods
Animal studies and ethical approval
All female ICR mice used in this study were from Beijing Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). The adult mice were maintained in a climate-controlled room on a 12-h light/darkness cycle and allowed food and water ad libitum. The China Agricultural University Institutional Animal Care and Use Committee (XK662) approved this study and it was performed in accordance with the committee guidelines. All efforts were made to minimize animal suffering.
GCs collection and culture
The preantral GCs were collected as previously reported (Latham et al. 2004). Briefly, ICR mice (10–13 days old) were killed by cervical dislocation. The ovaries were dissected in Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium (Gibco, Thermo Fisher Scientific) supplemented with 1% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific), 100 IU/mL penicillin (Invitrogen, Thermo Fisher Scientific) and 100 µg/mL streptomycin sulfate (Invitrogen, Thermo Fisher Scientific) after three washes in physiological saline solution. After mechanical dissection, the follicles (100–130 µm) were digested in medium containing 1 mg/mL collagenase IV (Sigma), 0.025% trypsin (Gibco, Thermo Fisher Scientific) and 0.02 mg/mL DNase I (Sigma) for 10 min at 37°C. The GC–oocyte complexes were aspirated repeatedly in and out of a borosilicate glass pipette with an internal diameter slightly smaller than that of an oocyte. After two washes, the cells were seeded with DMEM/F12 culture medium (Gibco, Thermo Fisher Scientific) supplemented with 10% FBS (Gibco, Thermo Fisher Scientific), 100 IU/mL penicillin (Invitrogen, Thermo Fisher Scientific) and 100 μg/mL streptomycin sulfate (Invitrogen, Thermo Scientific) and cultured for 4 h for adhesion. Subsequently, the cells were cultured in fresh medium with or without CNP, 8-Br-cGMP (a cGMP analog), BMP15, GDF9 or FGF8 (fibroblast growth factor 8) according to the different experimental treatments.
Preantral follicle isolation and culture
The ovaries of prepubertal mice (13 days old) were aseptically removed after the animals had been killed by cervical dislocation and placed in 3 mL prewarmed isolation medium consisting of L15 Leibovitz medium (Gibco, Thermo Fisher Scientific) supplemented with 10% FBS (Gibco, Thermo Fisher Scientific) and 1% antibiotics (100 units/mL penicillin and 100 μg/mL streptomycin; Invitrogen, Thermo Fisher Scientific) (Orisaka et al. 2006). Then, the preantral follicles were dissected microscopically using 26-gauge needles. To minimize experimental variation during the isolation, only follicles with two layers of GCs; a visible, centrally located oocyte; 100–130-µm diameter, and which were enclosed by an intact basal membrane and had at least some attached thecal cells were collected (Cortvrindt et al. 1996). Instead of enzymatic digestion, the ovary and early preantral follicles (EPFs) were mechanically dissected to conserve all cell types and receptor systems of the ovarian follicle for culture.
After three washes in isolation medium and two washes in culture medium, the preantral follicles were cultured individually in 100 µL culture medium in 96-well tissue culture plates for up to 4 days at 37°C in a humidified atmosphere of 5% CO2 in air (Cortvrindt et al. 1998). The culture medium consisted of α-minimal essential medium (with 10 mM HEPES; Gibco, Thermo Fisher Scientific) enriched with 1% ITS (5 µg/mL insulin, 5 µg/mL transferrin, 5 ng/mL selenium; Sigma), 0.1% bovine serum albumin (BSA; Sigma), 100 µg/mL sodium pyruvate and 1% antibiotics in the absence (control) or presence of CNP (N8768; Sigma-Aldrich) (Huang et al. 2011, Zhong et al. 2015, Zhang et al. 2017). CNP was dissolved in phosphate-buffered saline (PBS; Gibco, Thermo Fisher Scientific) and stored at −20°C until used. For control cultures, an equal volume of PBS was added to the culture medium in place of CNP. All selected follicles were pooled and randomly divided over the culture conditions under study. Half the medium was replaced with fresh medium every other day. The follicle morphological characteristics and diameters were recorded every day as the average distance between the outer edges of the basal membrane in two perpendicular planes (Kobayashi et al. 2009). To study ODGF regulation of Nppc and Npr2 expression, the follicles were cultured in culture medium with 100 ng/mL BMP15 (R&D Systems), 100 ng/mL GDF9 (R&D Systems), 100 ng/mL FGF8 (R&D Systems) or combinations thereof for 24 h (Su et al. 2003, Zhang et al. 2010, Miyoshi et al. 2012, Machado et al. 2015).
In vivo CNP treatment
Adult female mice (7 weeks old) were treated with CNP (120 μg/kg body weight; N8768; Sigma-Aldrich) by i.p. injection daily for 4 days. CNP was dissolved in PBS and diluted by physiological saline solution before injection. The mice were injected with 5 IU hCG (human chorionic gonadotropin; Ningbo Second Hormone Factory, Zhejiang, China) after 48-h administration of 5 IU PMSG (pregnant mare serum gonadotropin; Ningbo Second Hormone Factory). The ovulated oocytes in the oviducts were counted after 16 h to evaluate ovulation efficiency. Meanwhile, oocyte morphology was evaluated under an inverted microscope (Olympus). Nonviable oocytes had shape abnormalities, dark cytoplasm, fragmented first polar body, ooplasm vacuolization and fragments in the cytoplasm (Balaban & Urman 2006). Prepubertal mice (13 days old) were processed as described earlier, but were treated with 50 μg/kg body weight CNP. The control group was injected with the same volume of normal saline instead of CNP.
Cell viability assay
Cell viability was assessed by measuring the conversion of tetrazolium salt (WST-8) to formazan according to the manufacturer’s instructions of an Enhanced CCK-8 assay kit (Beyotime Biotechnology, Jiangsu, China). The cells were plated onto 96-well plates at a density of 3 × 103 cells per well and cultured for 24 h, followed by 3-day treatment without (control) or with CNP (Sigma) and 8-Br-cGMP (Sigma). CCK-8 assays were performed 24, 48 and 72 h after treatment. The cells were washed with PBS (Gibco, Thermo Fisher Scientific), and then 200 μL CCK-8 solution was added to each well and incubated for 3 h at 37°C. The optical density of each well at 450 nm was recorded on a Tecan microplate reader (Infinite M200, Tecan Nordic AB, Stockholm, Sweden). The results were calculated as the mean values of eight wells per treatment group.
RNA extraction and quantitative real-time reverse transcription (RT)-PCR (RT-qPCR)
Preantral follicle or cultured cell RNA isolation and qRT-PCR were performed as previously described (Ren et al. 2015). In summary, cultured cells in a six-well culture dish or about 100–150 follicles were treated as indicated, rinsed twice with cold PBS and collected in 1.0 mL TRIzol (Invitrogen); RNA was isolated as per the manufacturer’s instructions. The extracted total RNA concentration and quality were assessed by the absorbance at 260 nm (A260)/280 and A260/230 ratios as determined using a DS-11 spectrophotometer (DeNovix, Wilmington, NC, USA). The RNA to be used for the next experiment should have an A260/280 ratio of 1.8–2.0 and an A260/230 ratio of 2.0–2.2. Before RT, 1 μg total RNA samples were digested with DNase I (Fermentas, Hanover, MD, USA) to remove contaminating genomic DNA. The primer of this cDNA synthesis kit was an oligo-dT and random primer mix. Aliquot RNA RT was performed using a commercially available first-strand cDNA synthesis kit (iScript cDNA Synthesis Kit; Bio-Rad Laboratories). The real-time PCR was performed in triplicate in a CFX96 Real-Time PCR System (Bio-Rad Laboratories) using SsoFast EvaGreen Supermix (Bio-Rad Laboratories). The thermal cycling conditions were denaturation (95°C for 3 min), 40 cycles of amplification (95°C for 10 s) and quantification (61°C for 30 s) with a single fluorescence measurement and melting curve analysis (65–95°C with 0.5°C/s increments and continuous fluorescence measurements). Table 1 summarizes the related primer information. The specificity of the qRT-PCR products was confirmed with melting curve analysis. The amplification efficiency of each primer pair was calculated based on the slope of the standard curve. The amplification efficiency of the primers used in our study was 95–105%. The relative quantity of each gene was calculated by the comparative threshold cycle (2−ΔΔCt) method as described previously (Livak et al. 2001). All experiments were repeated three or four times using independent samples; the relative abundance of specific genes was normalized to the relative abundance of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) levels (Xu et al. 2013, Sadr et al. 2015, Yan et al. 2019).
Primers for RT-PCR and qRT-PCR.
| Gene | Primer sequence (5′-3′) | Tm (°C) | Amplification efficiency (%) | Accession number |
|---|---|---|---|---|
| Nppc | Forward: GGTCTGGGATGTTAGTGCAGCTA | 58 | 96.7 | NM_010933.5 |
| Reverse: TAAAAGCCACATTGCGTTGGA | ||||
| Npr2 | Forward: GCTGACCCGGCAAGTTCTGT | 58 | 95.2 | NM_173788.4 |
| Reverse: ACAATACTCGGTGACAATGCAGAT | ||||
| Wnt2b | Forward: GACACGTCCTGGTGGTACATAGG | 58 | 102.4 | NM_009520.3 |
| Reverse: TGGGTAGCGTTGACACAACTG | ||||
| Wnt5a | Forward: GCAGGCCGTAGGACAGTATACAA | 60 | 100.9 | NM_009524.4 |
| Reverse: CGCCGCGCTATCATACTTCT | ||||
| Cyp1a1 | Forward: ATCCCCCACAGCACCACAA | 58 | 97.8 | NM_001136059.2 |
| Reverse: AGTTCCCGGTCATGGTTAACC | ||||
| Cyp11a1 | Forward: GACGCATCAAGCAGCAAAATTC | 58 | 99.1 | NM_019779.4 |
| Reverse: TCCACGATCTCCTCCAGCAT | ||||
| Cdkn1a | Forward: CTGTCTTGCACTCTGGTGTCTG | 60 | 95.0 | NM_007669.5 |
| Reverse: AGAAATCTGTCAGGCTGGTCTG | ||||
| Gapdh | Forward: CCTGGAGAAACCTGCCAAGTAT | 60 | 104.3 | NM_008084.3 |
| Reverse: GGAAGAGTGGGAGTTGCTGTTG |
Protein extraction and western blotting
The CNP and NPR2 levels in the mouse preantral follicles at different stages were assayed by western blotting. About 250 preantral follicles were prepared by 20-min homogenization in ice-cold radioimmunoprecipitation assay lysis buffer (CWBio Co., Ltd., Beijing, China) containing 1% Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). The supernatant was collected after 10-min centrifugation at 15,000 g at 4°C, and proteins were quantified using an Enhanced Bicinchoninic Acid Protein Assay Kit (Beyotime Biotechnology). The samples were denatured in the same volume of 2× Laemmli sample loading buffer (Bio-Rad Laboratories) with 5% β-mercaptoethanol (Sigma) for 5 min at 100°C and stored at −80°C for future use. Equal amounts of protein (about 20 µg) were loaded in each well for 12% SDS-PAGE, and then transferred onto microporous PVDF membranes (Millipore). Membranes containing the transferred proteins were blocked with Tris-buffered saline containing 0.1% Tween 20 (TBST; 20 mM Tris–HCl, 150 mM NaCl and 0.1% Tween 20, pH 7.6) and 5% skim milk for 1 h at room temperature. After three washes with TBST, the membranes were incubated overnight at 4°C with rabbit anti-CNP polyclonal antibody (2 μg/mL; Santa Cruz Biotechnology Inc.), rabbit anti-NPR2 antibody (2 μg/mL; Abcam) and rabbit anti-GAPDH antibody (0.2 μg/mL; Sigma). After three washes with TBST, the membranes were incubated for 1 h at room temperature with horseradish peroxidase–linked secondary antibodies (0.2 μg/mL; Golden Bridge, Beijing, China). After three washes in TBST, the membranes were incubated with enhanced chemiluminescence reagents (Millipore), exposed digitally with Image Reader LAS-4000 (FujiFilm Life Science, Tokyo, Japan).
Immunofluorescence staining
Mouse ovaries were fixed in 4% paraformaldehyde overnight and stored at 4°C. The tissue was dehydrated and paraffin embedded and sections (5 μm) were cut with a microtome. The slides were deparaffinized in xylene, and then rehydrated in a series of ethanol dilutions. After dewaxing and rehydration, antigen retrieval was performed in 0.01% sodium citrate buffer (pH 6.0), followed by cooling at room temperature for at least 1 h. The sections were blocked in 0.5% BSA in PBS for 1 h at room temperature. Then, the sections were immunostained overnight at 4°C in a wet chamber with anti-CNP primary antibody (10 μg/mL; Abnova, Taiwan, China) and anti-NPR2 antibody (10 μg/mL; Abcam), followed by 1-h incubation at room temperature with Alexa Fluor 594 Goat Anti-Rabbit IgG (H+L) Secondary Antibody (1 μg/mL; Thermo Fisher Scientific) and DAPI (4′,6-diamidino-2-phenylindole; Thermo Fisher Scientific) counterstaining. The slides were imaged with a fluorescence microscope (Olympus). For the negative control, rabbit IgG (immunoglobulin G, 10 μg/mL; Beyotime) was used in place of the primary antibody in parallel reactions.
17β-Estradiol measurement
Media cultured with individual mouse follicles were pooled on the fourth day and stored at −80°C until the measurement of estradiol levels. Estradiol levels in the collected culture media were determined by radioimmunoassay with the Iodine [125I] Estradiol Radioimmunoassy Kit (Beijing North Institute of Biological Technology, Beijing, China). The measurements were taken in the General Hospital of the Nanjing Military Command, China. The sensitivity of the assay was 1.4 pg/mL. The intra-assay coefficient of variation (CV) was 6.2% and the interassay CV was 8.9%.
Statistical analysis
Statistical differences in the data were evaluated using SPSS (SPSS Inc.). Dunnett’s t-test was used for statistical comparisons between two groups. Multiple groups were compared statistically using one-way ANOVA, followed by a least significant difference test. Significance was indicated when P < 0.05.
Results
Nppc and Npr2 were gradually activated during preantral follicle development
Follicle growth and development is largely dependent on the activation of a series of paracrine, autocrine and endocrine signals. Nppc and Npr2 transcription were activated in the EPFs and late preantral follicles (LPFs) of the prepubertal mice (Fig. 1A and B). The immunofluorescence results confirmed these observations (Fig. 1C). Interestingly, qRT-PCR showed significantly increased Nppc and Npr2 transcripts during early to late preantral follicle development (Fig. 1D). Nppc is predominantly expressed in GCs, whereas Npr2 is primarily expressed in CCs (Zhang et al. 2010). Here, we also detected antral GCs and CCs as positive controls, which had higher Nppc and Npr2 expression, respectively (Fig. 1D). These results imply that, compared with antral follicles, in which high CNP levels are needed for maintaining oocyte meiotic arrest, relatively lower CNP levels may be sufficient for promoting preantral follicle growth. Similarly, western blotting showed an upward trend of CNP and NPR2 in LPFs (Fig. 1E). Together, these results indicated a gradual upregulation of CNP and NPR2 during mouse preantral follicle growth.
Nppc and Npr2 expression in follicles of different diameters. (A) Representative morphology of EPFs and LPFs. Scale bar = 100 μm. (B) RT-PCR detection of Nppc and Npr2 expression in EPFs and LPFs. For the blank control reaction, water was used as the template. For the no reverse transcriptase (NRT) control, 100 ng RNA was used as the template to confirm the absence of genomic DNA contamination. (C) Representative immunofluorescence images of CNP and NPR2 expression. Scale bar = 100 μm. AF, antral follicle; pAF, preantral follicle. (D) Comparisons of relative expression levels of Nppc and Npr2 in EPFs and LPFs. Antral GCs and CCs were used as positive controls for detecting Nppc and Npr2, respectively. Values are the means ± s.e.m. of four independent replicates. Four samples prepared from individual animals were used. P values for qRT-PCR were obtained using one-way ANOVA, followed by a least significant difference test. *P < 0.05, **P < 0.01. (E) Western blotting detection of protein abundance of CNP and NPR2 in EPFs, LPFs and GCs. Antral GCs were used as the positive control for detecting NPR2.
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
CNP facilitated the growth of in vitro-cultured preantral follicles
We isolated preantral follicles (100–130 µm diameter) from prepubertal mouse ovaries and treated them with 0, 0.1, 1, 10, 100 or 500 nM CNP during in vitro culture. Follicle growth dynamics monitoring showed that >10 nM CNP increased follicle diameter significantly (Fig. 2A and B), as revealed by the significantly increased follicle sizes without flattened morphology (Fig. 2A). Therefore, the role of CNP in promoting preantral follicle growth was confirmed using the in vitro culture model of mouse preantral follicles.
CNP promoted preantral follicle growth in vitro. (A) Representative images at day 0 and day 4 of cultured preantral follicles with or without CNP treatment. Scale bar = 100 μm. (B) Diameters of preantral follicles with or without CNP treatment monitored daily from day 0 to day 4. Values are the means ± s.e.m. Four independent culture experiments were performed; there were at least 100 follicles per group. Comparisons were performed between the treatment groups and the control group. Values are the means ± s.e.m. P values were obtained using Dunnett’s t-test. *P < 0.05, **P < 0.01.
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
CNP and 8-Br-cGMP enhanced preantral GC viability
Based on the above observations, we speculated that the promoting effect of CNP on preantral follicle growth may largely be due to its effect on preantral GC viability. Accordingly, we tested the effect of 0, 0.1, 10, 100 and 500 nM CNP on the viability of in vitro-cultured preantral GCs. Unexpectedly, it appeared that CNP did not alter GC viability at any concentration in culture conditions with typical 10% FBS supplementation (Fig. 3A). Considering CNP is ubiquitously present in serum (Yagci et al. 2008, Kake et al. 2009), we reduced FBS supplementation to 5% and 1% to exclude its possible influence (Fig. 3B and C). With 1% FBS supplementation, the control group also showed sustained, but lower viability than that with 10% FBS supplementation. Under the 1% FBS supplementation culture condition, 10, 100 and 500 nM CNP significantly increased preantral GC viability (Fig. 3C).
Effect of CNP and cGMP on GC viability in vitro. (A and B) GC proliferation in CNP-treated high-serum culture medium (5 and 10% FBS–DMEM/F12 medium) was not significantly different. (C) At 10, 100 and 500 nM, CNP significantly increased preantral GC viability in low-serum (1% FBS) supplementation conditions. (D) Preantral GCs cultured with 100 µM, 500 µM or 1 mM cGMP had highly significant proliferation rates. Comparison was only performed between the treatment groups and the control group. Five independent experiments were performed. Values are the means ± s.e.m. P values were obtained using Dunnett’s t-test. *P < 0.05, **P < 0.01.
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
Next, as the biological function of CNP is dependent on intracellular cGMP production via its exclusive receptor NPR2, we detected the effect of the cGMP analog (8-Br-cGMP) on preantral GC viability. At >50 µM, 8-Br-cGMP exhibited a significant viability-promoting effect (Fig. 3D). Taken together, these findings suggest that both CNP and cGMP benefit preantral GC viability in vitro.
CNP pre-treatment enhanced the ovulation rate of superovulated mice
To detect the function of CNP for stimulating preantral follicle development in vivo, adult (8-week-old) and prepubertal mice (13-day-old) were treated i.p. with CNP daily for 4 days, followed by a single i.p. injection of 5 IU equine chorionic gonadotropin for 48 h, and further treated with an ovulatory dose of 5 IU hCG to examine superovulation efficiency. We divided the total ovulated oocytes based on the quality of the recovered oocytes: nonviable oocytes always presented a non-uniform or even fragmented cytoplasm (Fig. 4A). CNP pre-treatment (120 μg/kg body weight) increased ovulation in the adult mice, as revealed by the increased total and viable oocytes (Fig. 4B). Similar results were obtained when the prepubertal mice were pre-treated with CNP (50 μg/kg body weight) (Fig. 4C). These findings suggest the ability of CNP to promote preantral follicle development to the early antral stage, thereby significantly enhancing the outcome of superovulation in both adult and prepubertal mice.
Effects of CNP pre-treatment on superovulation in mice. (A) Representative images of viable (arrows) and nonviable (arrowheads) ovulated oocytes. Scale bar = 100 μm. (B) The number of total and viable oocytes from adult mice with or without CNP pre-treatment were significantly different. (C) The number of total oocytes from prepubertal mice with or without CNP pre-treatment was significantly different. The number of mice per group is indicated. Values are the means ± s.e.m. The two-tailed Student t-test was used to evaluate the statistical significance. *P < 0.05.
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
ODGFs stimulated Nppc and Npr2 expression
To understand the mechanism responsible for Nppc and Npr2 expression regulation during early folliculogenesis, we examined whether ODGFs modulate the two genes in preantral follicles. Mouse preantral follicles and preantral GCs were cultured in medium containing BMP15, GDF9, FGF8 or combinations thereof, for 24 h. Real-time RT-PCR revealed that the ODGFs had promoting effects on Nppc expression in the preantral follicles (Fig. 5A). These effects were also observed in the preantral GCs, except those cultured with FGF8, which only increased Nppc expression mildly, but not significantly (Fig. 5C). It is worth noting that BMP15 plus GDF9 had a dramatic additive effect on Nppc expression in the preantral GCs (Fig. 5C). Only BMP15 significantly enhanced the expression levels of Npr2 mRNA in both the preantral follicles and GCs (Fig. 5B and D). These findings demonstrate that ODGFs, which are important regulators of preantral follicle development, can also manipulate CNP–NPR2 signaling in mouse preantral GCs at transcriptional level.
The effects of ODGFs on Nppc and Npr2 expression in preantral follicles and GCs. (A) Nppc and (B) Npr2 mRNA expression in ODGF-treated preantral follicles. (C) Nppc and (D) Npr2 mRNA expression in cultured GCs treated with combination ODGFs. Four independent experiments were performed. The P values for qRT-PCR were obtained using one-way ANOVA followed by a least significant difference test. Values are the means ± s.e.m. Lowercase letters (a, b, c) indicate significant differences (P < 0.05).
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
The effect of CNP on the expression of key ovarian genes and steroidogenesis in mouse preantral follicles
To further elucidate the molecular mechanisms underlying the promoting effect of CNP on preantral follicle development, we selected a set of key ovarian genes important for follicle growth and steroidogenesis and detected the effect of CNP on their expression in cultured mouse preantral follicles. Preantral follicles were treated with or without 200 nM CNP for 24 h before qRT-PCR analyses of transcript levels. It should be noted that the preantral growth promotion of 100 and 500 nM CNP supplementation was not significantly different (Fig. 2). Therefore, an intermediate concentration (200 nM) was used in the subsequent follicle culture. CNP increased the expression of paracrine or autocrine factors that contribute to follicle growth or GC viability (Wnt2b and Wnt5a) and a key steroidogenic enzyme (Cyp11a1) (Fig. 6A). In contrast, CNP significantly repressed the expression of estrogen metabolic enzymes (Cyp1a1) and cyclin-dependent kinase inhibitor (Cdkn1a/P21). Furthermore, the CNP-treated group had significantly increased 17β-estrogen concentrations in the medium at 4 days of culture compared with the control group (Fig. 6B). These results demonstrate that CNP might promote preantral follicle development by regulating WNT signaling and enhancing estrogen synthesis.
CNP regulates the transcription of ovarian developmental key genes and increases estrogen levels. (A) Expression levels of representative genes involved in follicle development (Wnt2b, Wnt5a, Cdkn1a) and estrogen metabolism (Cyp1a1 and Cyp11a1) in preantral follicles without (Control) or with 200 nM CNP treatment in vitro. (B) Estrogen concentration in control and CNP groups on day 4. Four independent experiments were performed. Values are the means ± s.e.m. The two-tailed Student t-test was used to evaluate the statistical significance. *P < 0.05, **P < 0.01.
Citation: Reproduction 157, 5; 10.1530/REP-18-0470
Discussion
In female gametogenesis-related events, CNP is a well-established factor that plays a central role in regulating oocyte meiotic progress in growing follicles among different species (Zhang et al. 2010, Hiradate et al. 2014, Zhong et al. 2015, Xi et al. 2018). In the present study, we focused on the function of CNP in promoting preantral follicle growth via enhanced GC viability. CNP–NPR2 signaling was gradually activated upon early-to-late preantral follicle development (Fig. 1). The CNP and NPR2 expression dynamics during follicle development provide a molecular basis for the promoting effect of CNP, as an autocrine factor, on preantral follicle growth.
CNP treatment led to dose- and-time-dependent increases in follicle size (Sato et al. 2012). Similarly, we found that CNP stimulated preantral follicle growth in mice independent of FSH (Fig. 2). Correspondingly, LPFs had significantly higher Nppc and Npr2 mRNA levels than the EPFs (Fig. 1D). Considering GC viability is essential for preantral follicle development (Zhang et al. 2011), we isolated preantral GCs and treated them with CNP in vitro. CNP significantly promoted cell viability (Fig. 3), and it is worth noting that this effect was also independent of FSH or any other gonadotropins.
CNP acts through guanylyl cyclase receptors, which activate intracellular cGMP production, one of the most important second messengers. We show that, like CNP, cGMP remarkably increased GC viability in vitro (Fig. 3D). 8-Br-cGMP suppressed rat preantral follicle apoptosis cultured in serum-free conditions (Mcgee et al. 1997). The authors hypothesized that a potential activator of the cGMP pathway may be essential for preantral follicle survival and development (Mcgee et al. 1997). We speculate that CNP may be an upstream factor that controls cGMP content in mouse preantral follicles. Nonetheless, how CNP increases GC viability and whether it can inhibit GC apoptosis remains to be studied.
In addition to the evidence from the in vitro experiments, the in vivo studies using 13-day-old juvenile mice also demonstrated that CNP may promote preantral follicle development and enhance preantral follicle response to subsequent exogenous gonadotropins and lead to the satisfactory outcome of ovulation induction (Fig. 4). Similarly, CNP treatment of 21-day-old prepubertal mice facilitated early antral follicle development to the preovulatory stage, thereby allowing LH/hCG ovulation induction to generate fertilizable oocytes and successful pregnancy (Sato et al. 2012). Preantral follicles gradually establish the full ability to respond to gonadotropins during follicular antrum formation, so we speculate that CNP can respond to gonadotropins by accelerating the development of more preantral follicles. Accordingly, we tested the effect of CNP on the ovulation rate in both adult and prepubertal mice using the standard superovulation method. CNP pre-treatment significantly improved the effect of superovulation in both groups of mice, as indicated by the increase in total ovulated and viable oocytes. Based on the profound inhibitory effect of CNP on meiotic resumption, we have established a natural factor synchronized in vitro oocyte maturation system in our laboratory, which can significantly improve the developmental competence of matured oocytes, thereby resulting in higher in vitro bovine embryo production efficiency (Xi et al. 2018). In view of the role of CNP in promoting follicle growth, it may be used to replace gonadotropin for treating patients with infertility. As CNP is a natural small-molecule polypeptide present in the ovary, it may be possible to avoid adverse effects stemming from the long half-life of gonadotropins, such as ovarian hyperstimulation syndrome. Therefore, our findings may provide a new strategy for improving current superovulation technology in human infertility treatment or farm animal reproductive management in the future, if no adverse effects of CNP are found.
ODGFs are prominent paracrine regulators of preantral follicle development, modulating transcription in preantral follicles (Hayashi et al. 1999, Celestino et al. 2011, Lima et al. 2012, Fenwick et al. 2013). We examined whether ODGFs can modulate Nppc and Npr2 expression in preantral follicles and GCs. Generally, GDF9, BMP15 and FGF8 alone or combined enhanced Nppc and Npr2 expression in preantral follicles and GCs (Fig. 5). Given the essential role of CYP17A1 expression, GDF9 promotes rat preantral follicle growth by upregulating follicular androgen biosynthesis (Orisaka et al. 2009). Recently, it has been found that BMP15 maintains in vitro culture caprine preantral follicle integrity and promotes their growth (Celestino et al. 2011, Lima et al. 2012). The expression of FGF8 and its cognate receptors were discovered in fetal bovine preantral follicles (Buratini et al. 2005). However, their regulation of Nppc and Npr2 in mouse preantral follicle has not been reported. Our results show that ODGFs are involved in regulating Nppc and Npr2 expression in mouse preantral follicle and imply that CNP may be a critical mediator of the regulatory role of oocytes in preantral follicle growth and survival, as oocytes secrete GDF9, BMP15 and FGF8.
We investigated the effect of CNP on gene expression in mouse preantral follicle and found that it affects the expression of key ovarian genes involved in cell growth and key steroidogenic enzymes (Fig. 6). CNP enhanced Wnt2b, Wnt5a and Cyp11a1 expression and reduced Cyp1a1 and Cdkn1a mRNA levels in cultured preantral follicles (Fig. 6). Using conditional gene targeting, Abedini et al. found that GC-specific inactivation of Wnt5a in mouse preantral follicle results in female subfertility associated with increased follicular atresia and decreased ovulation rates (Abedini et al. 2016). Therefore, Wnt5a expression is critical for normal preantral follicle development in mice. Cdkn1a encodes the potent cyclin-dependent kinase inhibitor P21, which can directly bind to cyclin/cyclin-dependent kinase 2 or 4 complexes and further inhibit their activity, resulting in G1 arrest (Dutto et al. 2015). More recently, it was reported that p21 inhibits ovarian GC proliferation (Jiang et al. 2015). CNP treatment of preantral follicles may regulate the GC cell cycle by affecting p21 expression. In the future, it is necessary to focus on how CNP regulates p21 expression and its effect on the cell cycle. We observed that adding CNP to cultured preantral follicles enhanced Cyp11a1 expression, which is involved in estrogen synthesis. Consistent with our observations, estrogen concentration was increased after the 4-day CNP treatment (Fig. 6B). The elevated estrogen levels were characteristic of preantral follicle growth in vitro, and estrogen supplementation benefits the reorganization of cultured follicles (Gore-Langton et al. 1990, Adriaens et al. 2004).
Antrum initiation, the transition from preantral to early antral follicle, is the determinant for normal folliculogenesis. In humans, developmental disorder of preantral follicles, including impaired antrum formation and poor gonadotropin response, is a main cause of female infertility. In short, our study not only highlights the role of CNP in promoting preantral follicle growth by enhancing follicular GC viability, but may also provide a strategy for improving poor gonadotropin response in human medicine.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by grants from the National Key R&D Program (2017YFD0501901 and 2017YFD0501905), the National Natural Science Foundation of China (No. 3167246 and 31472092) and the Earmarked Fund for the Innovative Teams of Beijing Swine Industrialization Research Program.
Author contribution statement
G X, J T and L A were responsible for experimental design. G X, L A, S A F and W W were responsible for writing the paper and for data analysis. G X, W W and S A F were responsible for RNA isolation, qRT-PCR and western blotting. M Y was responsible for cell viability analysis. F Y and J H were responsible for sample collection. J T and L A recruited the subjects and supervised the experiments and revised the manuscript.
References
Abedini A, Zamberlam G, Lapointe E, Tourigny C, Boyer A, Paquet M, Hayashi K, Honda H, Kikuchi A & Price C et al. 2016 WNT5a is required for normal ovarian follicle development and antagonizes gonadotropin responsiveness in granulosa cells by suppressing canonical WNT signaling. FASEB Journal 30 1534–1547. (https://doi.org/10.1096/fj.15-280313)
Adriaens I, Cortvrindt R & Smitz J 2004 Differential FSH exposure in preantral follicle culture has marked effects on folliculogenesis and oocyte developmental competence. Human Reproduction 19 398–408. (https://doi.org/10.1093/humrep/deh074)
Balaban B & Urman B 2006 Effect of oocyte morphology on embryo development and implantation. Reproductive Biomedicine Online 12 608–615. (https://doi.org/10.1016/S1472-6483(10)61187-X)
Boyer A, Goff AK & Boerboom D 2010 WNT signaling in ovarian follicle biology and tumorigenesis. Trends in Endocrinology and Metabolism 21 25–32. (https://doi.org/10.1016/j.tem.2009.08.005)
Buratini JJ, Glapinski VF, Giometti IC, Teixeira AB, Costa IB, Avellar MC, Barros CM & Price CA 2005 Expression of fibroblast growth factor-8 and its cognate receptors, fibroblast growth factor receptor (FGFR)-3c and-4, in fetal bovine preantral follicles. Molecular Reproduction and Development 70 255–261. (https://doi.org/10.1002/mrd.20205)
Cattanach BM, Iddon CA, Charlton HM, Chiappa SA & Fink G 1977 Gonadotrophin-releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 269 338–340. (https://doi.org/10.1038/269338a0)
Celestino JJ, Lima-Verde IB, Bruno JB, Matos MH, Chaves RN, Saraiva MV, Silva CM, Faustino LR, Rossetto R & Lopes CA et al. 2011 Steady-state level of bone morphogenetic protein-15 in goat ovaries and its influence on in vitro development and survival of preantral follicles. Molecular and Cellular Endocrinology 338 1–9. (https://doi.org/10.1016/j.mce.2011.02.007)
Cheng Y, Kawamura K, Takae S, Deguchi M, Yang Q, Kuo C & Hsueh AJ 2013 Oocyte-derived R-spondin2 promotes ovarian follicle development. FASEB Journal 27 2175–2184. (https://doi.org/10.1096/fj.12-223412)
Chinkers M, Garbers DL, Chang MS, Lowe DG, Chin HM, Goeddel DV & Schulz S 1989 A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor. Nature 338 78–83. (https://doi.org/10.1038/338078a0)
Chusho H, Tamura N, Ogawa Y, Yasoda A, Suda M, Miyazawa T, Nakamura K, Nakao K, Kurihara T & Komatsu Y et al. 2001 Dwarfism and early death in mice lacking C-type natriuretic peptide. PNAS 98 4016–4021. (https://doi.org/10.1073/pnas.071389098)
Cortvrindt R, Smitz J & Van Steirteghem AC 1996 In-vitro maturation, fertilization and embryo development of immature oocytes from early preantral follicles from prepuberal mice in a simplified culture system. Human Reproduction 11 2656–2666. (https://doi.org/10.1093/oxfordjournals.humrep.a019188)
Cortvrindt R, Hu Y & Smitz J 1998 Recombinant luteinizing hormone as a survival and differentiation factor increases oocyte maturation in recombinant follicle stimulating hormone-supplemented mouse preantral follicle culture. Human Reproduction 13 1292–1302. (https://doi.org/10.1093/humrep/13.5.1292)
Craig J, Orisaka M, Wang H, Orisaka S, Thompson W, Zhu C, Kotsuji F & Tsang BK 2007 Gonadotropin and intra-ovarian signals regulating follicle development and atresia: the delicate balance between life and death. Frontiers in Bioscience 12 3628–3639. (https://doi.org/10.2741/2339)
Dutto I, Tillhon M, Cazzalini O, Stivala LA & Prosperi E 2015 Biology of the cell cycle inhibitor p21(CDKN1A): molecular mechanisms and relevance in chemical toxicology. Archives of Toxicology 89 155–178. (https://doi.org/10.1007/s00204-014-1430-4)
Eppig JJ 2001 Oocyte control of ovarian follicular development and function in mammals. Reproduction 122 829–838. (https://doi.org/10.1530/rep.0.1220829)
Eppig JJ, Wigglesworth K & Pendola FL 2002 The mammalian oocyte orchestrates the rate of ovarian follicular development. PNAS 99 2890–2894. (https://doi.org/10.1073/pnas.052658699)
Fenwick MA, Mora JM, Mansour YT, Baithun C, Franks S & Hardy K 2013 Investigations of TGF-beta signaling in preantral follicles of female mice reveal differential roles for bone morphogenetic protein 15. Endocrinology 154 3423–3436. (https://doi.org/10.1210/en.2012-2251)
Geister KA, Brinkmeier ML, Hsieh M, Faust SM, Karolyi IJ, Perosky JE, Kozloff KM, Conti M & Camper SA 2013 A novel loss-of-function mutation in Npr2 clarifies primary role in female reproduction and reveals a potential therapy for acromesomelic dysplasia, Maroteaux type. Human Molecular Genetics 22 345–357. (https://doi.org/10.1093/hmg/dds432)
Gore-Langton RE & Daniel SA 1990 Follicle-stimulating hormone and estradiol regulate antrum-like reorganization of granulosa cells in rat preantral follicle cultures. Biology of Reproduction 43 65–72. (https://doi.org/10.1095/biolreprod43.1.65)
Halpin DM, Charlton HM & Faddy MJ 1986 Effects of gonadotrophin deficiency on follicular development in hypogonadal (hpg) mice. Journal of Reproduction and Fertility 78 119–125. (https://doi.org/10.1530/jrf.0.0780119)
Hayashi M, Mcgee EA, Min G, Klein C, Rose UM, van Duin M & Hsueh AJ 1999 Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology 140 1236–1244. (https://doi.org/10.1210/endo.140.3.6548)
Hiradate Y, Hoshino Y, Tanemura K & Sato E 2014 C-type natriuretic peptide inhibits porcine oocyte meiotic resumption. Zygote 22 372–377. (https://doi.org/10.1017/S0967199412000615)
Huang DH, Zhang SW, Zhao H & Zhang L 2011 The role of C-type natriuretic peptide in rat testes during spermatogenesis. Asian Journal of Andrology 13 275–280. (https://doi.org/10.1038/aja.2010.147)
Hunter MG, Robinson RS, Mann GE & Webb R 2004 Endocrine and paracrine control of follicular development and ovulation rate in farm species. Animal Reproduction Science 82–83 461–477. (https://doi.org/10.1016/j.anireprosci.2004.05.013)
Jiang L, Huang J, Li L, Chen Y, Chen X, Zhao X & Yang D 2015 MicroRNA-93 promotes ovarian granulosa cells proliferation through targeting CDKN1A in polycystic ovarian syndrome. Journal of Clinical Endocrinology and Metabolism 100 E729–E738. (https://doi.org/10.1210/jc.2014-3827)
Kake T, Kitamura H, Adachi Y, Yoshioka T, Watanabe T, Matsushita H, Fujii T, Kondo E, Tachibe T & Kawase Y et al. 2009 Chronically elevated plasma C-type natriuretic peptide level stimulates skeletal growth in transgenic mice. American Journal of Physiology. Endocrinology and Metabolism 297 E1339–E1348. (https://doi.org/10.1152/ajpendo.00272.2009)
Kawamura K, Cheng Y, Kawamura N, Takae S, Okada A, Kawagoe Y, Mulders S, Terada Y & Hsueh AJ 2011 Pre-ovulatory LH/hCG surge decreases C-type natriuretic peptide secretion by ovarian granulosa cells to promote meiotic resumption of pre-ovulatory oocytes. Human Reproduction 26 3094–3101. (https://doi.org/10.1093/humrep/der282)
Kobayashi N, Orisaka M, Cao M, Kotsuji F, Leader A, Sakuragi N & Tsang BK 2009 Growth differentiation factor-9 mediates follicle-stimulating hormone-thyroid hormone interaction in the regulation of rat preantral follicular development. Endocrinology 150 5566–5574. (https://doi.org/10.1210/en.2009-0262)
Latham KE, Wigglesworth K, Mcmenamin M & Eppig JJ 2004 Stage-dependent effects of oocytes and growth differentiation factor 9 on mouse granulosa cell development: advance programming and subsequent control of the transition from preantral secondary follicles to early antral tertiary follicles. Biology of Reproduction 70 1253–1262. (https://doi.org/10.1095/biolreprod.103.023937)
Lee KB, Zhang M, Sugiura K, Wigglesworth K, Uliasz T, Jaffe LA & Eppig JJ 2013 Hormonal coordination of natriuretic peptide type C and natriuretic peptide receptor 3 expression in mouse granulosa cells. Biology of Reproduction 88 42. (https://doi.org/10.1095/biolreprod.112.104810)
Lima IM, Brito IR, Rossetto R, Duarte AB, Rodrigues GQ, Saraiva MV, Costa JJ, Donato MA, Peixoto CA & Silva JR et al. 2012 BMPRIB and BMPRII mRNA expression levels in goat ovarian follicles and the in vitro effects of BMP-15 on preantral follicle development. Cell and Tissue Research 348 225–238. (https://doi.org/10.1007/s00441-012-1361-4)
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 402–408. (https://doi.org/10.1006/meth.2001.1262)
Lumsden NG, Khambata RS & Hobbs AJ 2010 C-type natriuretic peptide (CNP): cardiovascular roles and potential as a therapeutic target. Current Pharmaceutical Design 16 4080–4088. (https://doi.org/10.2174/138161210794519237)
Machado MF, Caixeta ES, Sudiman J, Gilchrist RB, Thompson JG, Lima PF, Price CA & Buratini J 2015 Fibroblast growth factor 17 and bone morphogenetic protein 15 enhance cumulus expansion and improve quality of in vitro-produced embryos in cattle. Theriogenology 84 390–398. (https://doi.org/10.1016/j.theriogenology.2015.03.031)
Mcgee E, Spears N, Minami S, Hsu SY, Chun SY, Billig H & Hsueh AJ 1997 Preantral ovarian follicles in serum-free culture: suppression of apoptosis after activation of the cyclic guanosine 3',5'-monophosphate pathway and stimulation of growth and differentiation by follicle-stimulating hormone. Endocrinology 138 2417–2424. (https://doi.org/10.1210/endo.138.6.5164)
Mcnatty KP, Reader K, Smith P, Heath DA & Juengel JL 2007 Control of ovarian follicular development to the gonadotrophin-dependent phase: a 2006 perspective. Society of Reproduction and Fertility Supplement 64 55–68. (https://doi.org/10.5661/RDR-VI-55)
Miyoshi T, Otsuka F, Nakamura E, Inagaki K, Ogura-Ochi K, Tsukamoto N, Takeda M & Makino H 2012 Regulatory role of kit ligand-c-kit interaction and oocyte factors in steroidogenesis by rat granulosa cells. Molecular and Cellular Endocrinology 358 18–26. (https://doi.org/10.1016/j.mce.2012.02.011)
Nishikimi T, Kuwahara K & Nakao K 2011 Current biochemistry, molecular biology, and clinical relevance of natriuretic peptides. Journal of Cardiology 57 131–140. (https://doi.org/10.1016/j.jjcc.2011.01.002)
Orisaka M, Orisaka S, Jiang JY, Craig J, Wang Y, Kotsuji F & Tsang BK 2006 Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage. Molecular Endocrinology 20 2456–2468. (https://doi.org/10.1210/me.2005-0357)
Orisaka M, Jiang JY, Orisaka S, Kotsuji F & Tsang BK 2009 Growth differentiation factor 9 promotes rat preantral follicle growth by up-regulating follicular androgen biosynthesis. Endocrinology 150 2740–2748. (https://doi.org/10.1210/en.2008-1536)
Orisaka M, Hattori K, Fukuda S, Mizutani T, Miyamoto K, Sato T, Tsang BK, Kotsuji F & Yoshida Y 2013 Dysregulation of ovarian follicular development in female rat: LH decreases FSH sensitivity during preantral-early antral transition. Endocrinology 154 2870–2880. (https://doi.org/10.1210/en.2012-2173)
Potter LR, Abbey-Hosch S & Dickey DM 2006 Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocrine Reviews 27 47–72. (https://doi.org/10.1210/er.2005-0014)
Ren L, Wang Z, An L, Zhang Z, Tan K, Miao K, Tao L, Cheng L, Zhang Z & Yang M et al. 2015 Dynamic comparisons of high-resolution expression profiles highlighting mitochondria-related genes between in vivo and in vitro fertilized early mouse embryos. Human Reproduction 30 2892–2911. (https://doi.org/10.1093/humrep/dev228)
Sadr SZ, Ebrahimi B, Shahhoseini M, Fatehi R & Favaedi R 2015 Mouse preantral follicle development in two-dimensional and three-dimensional culture systems after ovarian tissue vitrification. European Journal of Obstetrics, Gynecology, and Reproductive Biology 194 206–211. (https://doi.org/10.1016/j.ejogrb.2015.09.028)
Sato Y, Cheng Y, Kawamura K, Takae S & Hsueh AJ 2012 C-type natriuretic peptide stimulates ovarian follicle development. Molecular Endocrinology 26 1158–1166. (https://doi.org/10.1210/me.2012-1027)
Su YQ, Denegre JM, Wigglesworth K, Pendola FL, O’Brien MJ & Eppig JJ 2003 Oocyte-dependent activation of mitogen-activated protein kinase (ERK1/2) in cumulus cells is required for the maturation of the mouse oocyte-cumulus cell complex. Developmental Biology 263 126–138. (https://doi.org/10.1016/S0012-1606(03)00437-8)
Xi G, An L, Jia Z, Tan K, Zhang J, Wang Z, Zhang C, Miao K, Wu Z & Tian J 2018 Natriuretic peptide receptor 2 (NPR2) localized in bovine oocyte underlies a unique mechanism for C-type natriuretic peptide (CNP)-induced meiotic arrest. Theriogenology 106 198–209. (https://doi.org/10.1016/j.theriogenology.2017.09.003)
Xu B, Gao L, Cui Y, Gao L, Dai X, Li M, Zhang Y, Ma X, Diao F & Liu J 2013 SET protein up-regulated testosterone production in the cultured preantral follicles. Reproductive Biology and Endocrinology 11 9. (https://doi.org/10.1186/1477-7827-11-9)
Yagci R, Totan Y, Ozluk E, Ozyurt H, Akbay G & Eksioglu M 2008 Serum levels of natriuretic peptides in patients with Behcet’s disease. Clinical Rheumatology 27 1153–1158. (https://doi.org/10.1007/s10067-008-0886-0)
Yan W, Zhou S, Shen W, Cheng J, Yuan S, Ye S, Jin Y, Luo A & Wang S 2019 Suppression of SEMA6C promotes preantral follicles atresia with decreased cell junctions in mice ovaries. Journal of Cellular Physiology 234 4934–4943. (https://doi.org/10.1002/jcp.27294)
Zhang M, Su YQ, Sugiura K, Xia G & Eppig JJ 2010 Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science 330 366–369. (https://doi.org/10.1126/science.1193573)
Zhang CP, Yang JL, Zhang J, Li L, Huang L, Ji SY, Hu ZY, Gao F & Liu YX 2011 Notch signaling is involved in ovarian follicle development by regulating granulosa cell proliferation. Endocrinology 152 2437–2447. (https://doi.org/10.1210/en.2010-1182)
Zhang Y, Wang H, Liu W, Yang Y, Wang X, Zhang Z, Guo Q, Wang C & Xia G 2017 Natriuretic peptides improve the developmental competence of in vitro cultured porcine oocytes. Reproductive Biology and Endocrinology 15 41. (https://doi.org/10.1186/s12958-017-0258-1)
Zhong Y, Lin J, Liu X, Hou J, Zhang Y & Zhao X 2015 C-Type natriuretic peptide maintains domestic cat oocytes in meiotic arrest. Reproduction, Fertility, and Development 28 1553–1559. (https://doi.org/10.1071/RD14425)
