Global transcriptomic response of bovine endometrium to blastocyst-stage embryos

in Reproduction
Authors:
C PassaroSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by C Passaro in
Current site
Google Scholar
PubMed
Close
,
D TuttSchool of Veterinary Science, The University of Queensland, Gatton, Queensland, Australia

Search for other papers by D Tutt in
Current site
Google Scholar
PubMed
Close
,
S Bagés-ArnalSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by S Bagés-Arnal in
Current site
Google Scholar
PubMed
Close
,
C MaicasSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by C Maicas in
Current site
Google Scholar
PubMed
Close
,
R Laguna-BarrazaDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Madrid, Spain

Search for other papers by R Laguna-Barraza in
Current site
Google Scholar
PubMed
Close
,
A Gutierrez-AdánDepartamento de Reproducción Animal, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Madrid, Spain

Search for other papers by A Gutierrez-Adán in
Current site
Google Scholar
PubMed
Close
,
J A BrowneSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by J A Browne in
Current site
Google Scholar
PubMed
Close
,
D RathInstitute of Farm Animal Genetics, Friedrich-Loeffler-Institut, Neustadt-Mariensee, Germany

Search for other papers by D Rath in
Current site
Google Scholar
PubMed
Close
,
S K BehuraDivision of Animal Sciences, University of Missouri, Columbia, Missouri, USA

Search for other papers by S K Behura in
Current site
Google Scholar
PubMed
Close
,
T E SpencerDivision of Animal Sciences, University of Missouri, Columbia, Missouri, USA

Search for other papers by T E Spencer in
Current site
Google Scholar
PubMed
Close
,
T FairSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by T Fair in
Current site
Google Scholar
PubMed
Close
, and
P LonerganSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland

Search for other papers by P Lonergan in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to P Lonergan; Email: pat.lonergan@ucd.ie
Free access

The aims of this study were (i) to investigate changes in the global transcriptome of bovine endometrial explants induced by exposure to blastocysts, (ii) to investigate if male and female blastocysts elicit a differential response in the endometrial transcriptome in vitro and (iii) to determine whether bovine endometrium responds to the presence of murine embryos. In Experiment 1, endometrial explants from the same uterus were cultured for 6 h with or without 20 in vitro-produced bovine blastocysts. In Experiment 2, endometrial explants were cultured with male or female bovine blastocysts produced in vitro by IVF either using sex-sorted semen or conventional unsorted semen followed by embryo sexing based on a biopsy. In Experiment 3, endometrial explants were cultured alone or in the presence of bovine blastocysts (n = 25) or murine blastocysts (n = 25). Following culture, explants were snap frozen and stored at −80°C until RNA extraction, qPCR or RNA-Seq. Culture with bovine blastocysts increased endometrial expression of 40 transcripts, all of which were interferon-tau induced. Culture with male or female bovine blastocysts increased transcript abundance of five classic interferon-stimulated genes (MX1, MX2, ISG15, OASY1, RSAD2) in explants; however, there was no difference in abundance of transcripts previously reported to be related to embryonic sex (IFNAR1, IFNAR2, CTGF, ARTN, SLC2A1, SLC2A5). Exposure to murine blastocysts did not elicit any detectable change in transcript abundance. These findings, coupled with our previous data, indicate that very local, interferon-tau-induced changes in endometrial gene expression occur in response to blastocysts; whether such changes play any role in subsequent pregnancy recognition remains to be established.

Abstract

The aims of this study were (i) to investigate changes in the global transcriptome of bovine endometrial explants induced by exposure to blastocysts, (ii) to investigate if male and female blastocysts elicit a differential response in the endometrial transcriptome in vitro and (iii) to determine whether bovine endometrium responds to the presence of murine embryos. In Experiment 1, endometrial explants from the same uterus were cultured for 6 h with or without 20 in vitro-produced bovine blastocysts. In Experiment 2, endometrial explants were cultured with male or female bovine blastocysts produced in vitro by IVF either using sex-sorted semen or conventional unsorted semen followed by embryo sexing based on a biopsy. In Experiment 3, endometrial explants were cultured alone or in the presence of bovine blastocysts (n = 25) or murine blastocysts (n = 25). Following culture, explants were snap frozen and stored at −80°C until RNA extraction, qPCR or RNA-Seq. Culture with bovine blastocysts increased endometrial expression of 40 transcripts, all of which were interferon-tau induced. Culture with male or female bovine blastocysts increased transcript abundance of five classic interferon-stimulated genes (MX1, MX2, ISG15, OASY1, RSAD2) in explants; however, there was no difference in abundance of transcripts previously reported to be related to embryonic sex (IFNAR1, IFNAR2, CTGF, ARTN, SLC2A1, SLC2A5). Exposure to murine blastocysts did not elicit any detectable change in transcript abundance. These findings, coupled with our previous data, indicate that very local, interferon-tau-induced changes in endometrial gene expression occur in response to blastocysts; whether such changes play any role in subsequent pregnancy recognition remains to be established.

Introduction

Following hatching of the ruminant blastocyst, communication between the elongating conceptus and the maternal endometrium is essential for maternal recognition of pregnancy, prevention of luteolysis and maintenance of progesterone secretion from the corpus luteum. Partly due to its minute size, communication between the pre-hatching, zona-enclosed embryo and the endometrium is more challenging to demonstrate and is apparently not essential for pregnancy establishment, as evidenced by the fact that pregnancies are established after embryo transfer to a uterus not previously exposed to an embryo.

There are very few, if any, global transcriptomic data sets available highlighting alterations in transcript abundance induced in the endometrium by the presence of a blastocyst(s). Indeed, many such studies carried out in vivo, including some of our own work (Forde et al. 2011) and that of others (Bauersachs et al. 2012), have failed to identify changes in the endometrial transcriptome prior to Day 15/16, by which time the elongated conceptus is secreting copious amounts of IFNT.

Using qRT-PCR, we have recently shown that bovine endometrial explants respond to the presence of 8-day-old blastocysts by upregulating the expression of classical interferon-stimulated genes (ISG) (Passaro et al. 2018). This effect was (i) specific to the blastocyst stage – earlier stages did not induce gene expression changes, (ii) dependent on the number of blastocysts present – a minimum of five blastocysts were required to detect such changes and (iii) independent of direct contact – the effect was induced by embryos co-cultured on endometrial explants using a cell culture insert (preventing direct contact) as well as by blastocyst-conditioned medium (Passaro et al. 2018). Others have reported differential expression of a small number of other transcripts in the endometrium in vivo, induced by the presence of a single blastocyst (Sponchiado et al. 2017) or in cultured endometrial cells (Talukder et al. 2017, Gómez et al. 2018a ), which we failed to detect in endometrial explants using qPCR (Passaro et al. 2018).

A significant volume of evidence suggests that preimplantation embryo development (Bermejo-Alvarez et al. 2010a ), metabolism (Tiffin et al. 1991, Gómez et al. 2018b ) and gene expression (Bermejo-Alvarez et al. 2010a ) are influenced by the sex of the embryo and development during this period can be further exacerbated by environmental (Hansen et al. 2016) and culture conditions (Larson et al. 2001). Male bovine embryos have been reported to develop faster (Avery et al. 1992) and reach the blastocyst stage more frequently (Xu et al. 1992) than female embryos. Indeed, bovine female in vitro-fertilized blastocysts display lower cell numbers and increased apoptosis than their male counterparts (Oliveira et al. 2010). Gómez et al. (2013) reported differential protein expression in Day 8 uterine fluid recovered from heifers following the transfer of Day 5 male or female embryos. More recently, Gómez et al. (2018a) described an embryo sex-dependent response of cultured bovine uterine epithelial (but not stromal) cells, suggesting that male and female embryos may differentially release signalling factors that induce sexually dimorphic responses in such cells.

Implantation in ruminants differs from that of rodents and primates where the conceptus enters a receptive uterus, hatches and almost immediately attaches to the uterine luminal epithelium (haemochorial placentation) (Cha & Dey 2015, Su & Fazleabas 2015). In contrast, the ruminant conceptus remains unattached for almost 3 weeks prior to implantation, during which time it rapidly elongates prior to implantation (synepitheliochorial placentation) (Lonergan & Forde 2014, Spencer et al. 2016). Elongation in ruminant embryos is a maternally driven process – it has not been successfully recapitulated in vitro (Brandão et al. 2004, Alexopoulos et al. 2005) and does not occur in vivo in the absence of uterine glands and associated secretions (Gray et al. 2002). However, whether the ruminant embryo is intrinsically programmed to elongate or whether this is exclusively driven by the maternal uterine environment is not known. Evidence for a component intrinsic to the embryo comes from the significant variation in the size of age-matched conceptuses (Betteridge et al. 1980), even among those recovered from the same uterus following embryo transfer (Clemente et al. 2009, Sánchez et al. 2019). Such variation in conceptus length is also evident in porcine conceptuses, despite growing in a common uterine environment, and rapid progression through this phase has been associated with conceptus competency (Blomberg et al. 2010).

Here, we used an endometrial explant-embryo co-culture model to elucidate the fine dialogue between the early conceptus and endometrium. Endometrial explants maintain normal cellular and extracellular architecture and allow for communication between resident populations of endometrial cells which cannot be achieved using a 2D culture system. To extend our previous findings, the aims of this study were (i) to investigate changes in the global transcriptome of endometrial explants induced by exposure to blastocysts using RNA sequencing (RNA-Seq), (ii) to investigate if male and female blastocysts elicit a differential response in the endometrial transcriptome in vitro and (iii) to determine whether the bovine endometrium responds to the presence of murine embryos, which do not exhibit post-hatching elongation prior to implantation.

Materials and methods

Unless otherwise stated, all chemicals were sourced from Sigma-Aldrich.

Experiment 1: Global transcriptome analysis of endometrial response to bovine blastocysts

The aim of this experiment was to interrogate the global transcriptomic response of the bovine endometrium to the presence of blastocysts. Endometrial explants from the same uterus were cultured for 6 h with medium alone (control) or with 20 Day 8 in vitro-produced blastocysts using a polyester mesh to retain the embryos directly above the endometrial surface as recently described (Passaro et al. 2018). Five replicates (i.e. explants from five different uteri) were carried out. After incubation, explants were snap frozen and stored at −80°C until RNA extraction and RNA-Seq analysis.

Experiment 2: Endometrial response to male and female blastocysts

To investigate the transcriptomic response of the endometrium to the presence of male and female embryos, Day 8 blastocysts were produced in vitro by IVF either using (i) sex-sorted (X- or Y-sorted) semen or (ii) conventional unsorted semen followed by embryo sexing based on a biopsy taken on Day 6, as detailed below.

Experiment 2(a): Blastocyst production with sex-sorted semen

Bovine ovaries were collected at a local abattoir and transported to the laboratory in PBS at 35°C within 4 h. Cumulus-oocytes complexes (COCs) were aspirated from surface visible antral follicles using an 18-gauge needle attached to a 5 mL syringe. In vitro maturation, fertilization and culture were carried out as previously described (Rizos et al. 2002). Briefly, grade 1 COCs were matured for 24 h in TCM-199 supplemented with 10% fetal calf serum (FCS) and 10 ng/mL epidermal growth factor (EGF) at 38.5°C under an atmosphere of 5% CO2 in air with maximum humidity. Fertilization (Day 0) was performed with X- or Y-sorted sperm from one of three different bulls, as previously described (Bermejo-Alvarez et al. 2010b ). Matured COCs were inseminated with frozen-thawed, Percoll-separated, semen added at a final concentration of 2 × 106 sperm/mL. Gametes were co-incubated at 38.5°C in an atmosphere of 5% CO2 in air with maximum humidity. At approximately 20 h post-insemination, presumptive zygotes were denuded of surrounding cumulus cells and accessory sperm and cultured in 25 µL drop of synthetic oviduct fluid (SOF) supplemented with 5% FCS until Day 8 at 38.5°C in an atmosphere of 5% CO2, 5% O2 with maximum humidity. On Day 8, blastocysts produced from X- and Y-sorted sperm from each bull were pooled together according to sex in groups of approximately 20 and cultured on endometrial explants for 6 h. Five replicates (i.e., separate days of ovary collection) were conducted. After incubation, explants were snap frozen and stored at −80°C until RNA extraction, reverse transcription and qPCR analysis.

Experiment 2(b): Blastocyst production and sexing by embryo biopsy

On Day 6 post fertilization, morula stage embryos were biopsied by blastomere extrusion (Tominaga & Hamada 2004) of three to eight cells for sex identification. After biopsy, embryos were returned to culture until Day 8, when those embryos that reached the blastocyst stage were cultured on an endometrial explant for 6 h in groups of 12–15 according to sex in a total of four replicates. After incubation, explants were snap frozen and stored at −80°C until RNA extraction, reverse transcription and qPCR analysis.

For Experiments 2(a-b), transcript abundance of genes previously shown by us to be induced in endometrial explants by the presence of blastocysts (MX1, MX2, ISG15, OASY1, RSAD2; Passaro et al. 2018) as well as genes reported by others to be altered by embryos in a sex-specific manner in cultured uterine epithelial cells (IFNAR1, IFNAR2, CTGF, ARTN, SLC2A1, SLC2A5; Gómez et al. 2018a ) was investigated.

Experiment 3: Response of bovine endometrium to bovine vs murine blastocysts

In order to compare the response of bovine endometrium to embryos which intrinsically elongate (bovine) vs those that do not (murine), endometrial explants from the same uterus were cultured: (i) alone (control) or in the presence of (ii) Day 8 bovine blastocysts (n = 25) or (iii) murine blastocysts (n = 25). Following culture, explants were snap frozen and stored at −80°C until RNA extraction and RNA-Seq analysis. Five replicates were carried out.

To generate murine embryos, B6D2F1 female mice were superovulated by intraperitoneal injection of 7.5 IU equine chorionic gonadotrophin (Folligon 500, Intervet) followed by 7.5 IU hCG (Veterin Corion, Equinvest) 48 h later. On the night of the hCG injection, females were mated with males. Presence of a vaginal plug the next morning was designated as Day 0.5 postcoitum. Females (n = 17) were killed by cervical dislocation on Day 2.5 and embryos were recovered by oviduct flushing. Morula stage embryos (n = 335) were cultured in 25 µL droplets of K+-modified simplex optimized medium (KSOM; Millipore) under mineral oil until Day 4. Dishes were incubated at 37°C in a humidified atmosphere of 5% CO2 in air.

Embryo sexing by PCR

In Experiment 2, PCR was used to identify embryonic sex from entire embryos following explant co-culture (Experiment 2a) and from biopsy samples (Experiment 2b), to verify the accuracy of embryo sex selection. Briefly, two primer sets were used to determine embryo sex: Y-chromosome-specific primers (TSPY, 5′ GGTACACAAGAGCAGCGTTC forward, 5′ GAGGGTGGCATAATCTGCTT reverse, 535 bp amplicon) and bovine-specific satellite sequence primers (Park et al. 2001) (Sat 1.715, 5′ TGGAAGCAAAGAACCCCGCT forward, 5′ TCGTGAGAAACCGCACACTG reverse, 216 bp amplicon). Samples were thawed, boiled at 100°C for 10 min, and then held on ice. PCR reaction mix (45 µL), consisting of Dream Taq Green Master Mix (Thermo Fisher Scientific) and the primer set for TSPY (1 µM final concentration) was added and the tube transferred to the thermocycler. The PCR programme used an initial denaturation step at 95°C for 3 min, and then TSPY was pre-amplified for ten cycles of 95°C for 30 s, 60°C for 45 s, 72°C for 50 s. After ten cycles, the tubes were held at 4°C while the primer set for satellite 1.715 (1 µM final concentration) was added, and then returned to the thermocycler for another 35 cycles on the same programme. A final extension step at 72°C for 5 min was included at the end of 35 cycles. Products were visualized on an ethidium bromide-stained 2% agarose gel under ultraviolet illumination for the positive 534 bp band of TSPY and 216 bp of the satellite sequence. Samples that exhibited both bands were assigned as male, while samples exhibiting only a satellite sequence band were assigned as female. Each PCR was carried out with three controls: negative (no template) control, female genomic DNA, male genomic DNA (Fig. 1).

Figure 1
Figure 1

Representative gels from embryo sexing by PCR. A single PCR using both Y-chromosome-specific primers (TSPY) and bovine-specific satellite sequence primers (Sat 1.715) was carried out. Lane 1: No template control. Lane 2: female gDNA. Lane 3: male gDNA. (A) From Lane 4 on: female embryos with a 216 bp specific product of Sat. (B) From lane 4 on: male embryos, a 535 bp Y-chromosome-specific product (TSPY) appears in the top lane.

Citation: Reproduction 158, 3; 10.1530/REP-19-0064

Endometrial explant preparation

Bovine uteri from females estimated to be between Day 5 and 10 of the oestrous cycle based on ovarian morphology (Ireland et al. 1980) were collected at a local abattoir from post-pubertal non-pregnant heifers. Uteri were transported to the laboratory on ice and processed as described previously (Passaro et al. 2018). Briefly, the external surfaces of the uterus were washed in 70% ethanol and the uterine horn ipsilateral to the corpus luteum was opened longitudinally with sterile scissors. The exposed endometrium was washed in Dulbecco’s PBS supplemented with 100 IU/mL penicillin, 100 µg/mL streptomycin and 0.25 µg/mL amphotericin B. Tissue was collected from the intercaruncular areas of the endometrium from the distal part of the uterine horn (upper third) ipsilateral to the corpus luteum using a sterile 4-mm-diameter biopsy punch (Stiefel Laboratories Ltd, High Wycome, UK). Each explant was immediately transferred to Hank’s Balanced Salt Solution (HBSS) supplemented with 100 IU/mL penicillin, 100 µg/mL streptomycin and 0.25 µg/mL amphotericin B, before washing twice in unsupplemented HBSS. Under sterile conditions within a class II biological safety cabinet, explants were transferred to 24-well plate, so that each well contained a single explant in 1.0 mL of complete medium. Complete medium comprised Roswell Park Memorial Institute medium (RPMI 1640), supplemented with 100 IU/mL penicillin, 100 µg/mL streptomycin and 0.25 µg/mL amphotericin B. The explants of intact endometrium were orientated with the epithelial surface uppermost and cultured in a humidified atmosphere with 5% CO2 in air at 38.5°C. The culture medium was changed twice (every 2 h) before applying the specific treatment, according to the experimental design.

Apart from Experiment 1, in which a polyester mesh was used, cell culture inserts with a 12 μM pore size (MILLICELL-PCF 12.0 μM, Catalogue Number PIX01250, Millipore) were used during the 6 h co-culture to ensure the embryos were maintained directly above the endometrial surface (Fig. 2). A control explant (insert without embryos) was included in each replicate. To mitigate against potential variation, in each experiment, within a replicate (i.e. on a given day), each treatment was applied to explants from the same uterus, and this was replicated across multiple animals.

Figure 2
Figure 2

Representation of endometrial explant with cell culture insert used to retain in vitro-produced Day 8 blastocysts during co-culture.

Citation: Reproduction 158, 3; 10.1530/REP-19-0064

RNA extraction and cDNA synthesis

Total RNA was isolated using TRIzol reagent (Molecular Research Center) as per the manufacturer’s instructions followed by on-column RNA clean-up using the Qiagen RNeasy mini kit (Qiagen). Briefly, 30 mg of tissue was homogenized in 1.0 mL of TRIzol using a steel bead and the Qiagen tissue lyzer (2 × 120 s at maximum speed). After homogenization, 100 µL of 1-Bromo-3-chloro-propane was added to each sample. Following centrifugation (12,000 g , 15 min), the upper aqueous phase was transferred directly into a RNeasy column and RNA was purified as per the manufacturer’s instruction. RNA was quantified using a NanoDrop-ND1000 Spectrophotometer (Thermo Fisher Scientific).

In Experiment 2 (a-b), for each sample, cDNA was prepared from 500 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. The purified cDNA was then diluted in RNase- and DNase-free water up to a volume of 300 µL and stored at −20°C for subsequent use.

RNA-Seq analysis

In Experiments 1 and 3, RNA was extracted from endometrial explants following 6-h culture. Quantity and quality of RNA were determined using the Nano Drop 1000 (Thermo Fisher Scientific) and the Agilent Bioanalyzer (Agilent Technologies), respectively. The mean RNA integrity number (RIN) ± the standard deviation was 7.4 ± 0.4 for experiment 1 and 7.6 ± 0.4 for Experiment 3. RNA library preparation and sequencing and RNA-Seq data mapping and quantification of read counts for genes were performed as described previously (Moraes et al. 2018). The differential gene expression analysis was performed by edger-R robust (Zhou et al. 2014).

Pathway and process enrichment analysis

Pathway and process enrichment analysis was carried out with using Metascape (http://metascape.org), an online gene annotation and analysis resource. All genes in the genome were used as the enrichment background. Terms with a P value <0.01, a minimum count of 3 and an enrichment factor >1.5 (the ratio between the observed counts and the counts expected by chance) are collected and grouped into clusters based on their membership similarities. More specifically, P values were calculated based on the accumulative hypergeometric distribution (Zar 1999), and q values were calculated using the Benjamini–Hochberg procedure to account for multiple testing (Hochberg & Benjamini 1990). Kappa scores (Cohen 1960) were used as the similarity metric when performing hierachical clustering on the enriched terms, and sub-trees with a similarity of >0.3 were considered a cluster. The most statistically significant term within a cluster is chosen to represent the cluster.

qPCR analysis of candidate genes

In Experiment 2 (a-b), qPCR was used to investigate changes in endometrial gene expression due to the presence of male or female embryos, as previously described (Passaro et al. 2018). Unless otherwise specified, all primers were designed using Primer-Blast software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 1). A total of eight potential reference genes (GAPDH, ACTB, RPL18, PPIA, YWHAZ, RNF11, H3F3A, SDHA) were analysed using the geNorm function within the qbase+ computer program (Biogazelle, Zwijnaarde, Belgium). For each independent sample set, geNorm was used to identify the best reference genes (Vandesompele et al. 2002). For Experiment 2(a), ACTB and YWHAZ were shown to be the most stably expressed (average geNorm M ≤ 0.5), while for Experiment 2(b), H3F3A and YWHAZ were the most stably expressed. Gene expression analysis was carried out for the following genes: MX1, MX2, ISG15, OASY1, RSAD2, IFNAR1, IFNAR2, CTGF, ARTN, SLC2A1, SLC2A5. For Experiment 2 (a-b), one-way ANOVA was performed on the log transformed data.

Table 1

Gene abbreviation, accession number, primers sequence and reference for all genes analysed with qPCR.

Entrez gene symbol Accession number Primer sequence (5′–3′) Fragment size (bp) Reference
YWHAZ NM_174814.2 TGAAGCCATTGCTGAACTTG 114 This study
TCTCCTTGGGTATCCGATGT
H3F3A NM_001014389.2 CATGGCTCGTACAAAGCAGA 136 This study
ACCAGGCCTGTAACGATGAG
ACTB NM_173979.3 CAGCAGATGTGGATCAGCAAGC 91 This study
AACGCAGCTAACAGTCCGCC
MX1 NM_173940.2 CGAGCCGAGTTCTCCAAATG 114 Passaro et al. 2018
CAACTCTCTGCCACGATACC
MX2 NM_173941.2 ACTTTCAAGGACACAGCCAA 146 Passaro et al. 2018
ACCAGCTTCTCCATCCTGAA
ISG15 NM_174366.1 CCAACCAGTGTCTGCAGAGA 76 Passaro et al. 2018
CCCTAGCATTCTCACCGTCA
OASY1 NM_001040606.1 CCCGGCGGACCCTACAGGAA 84 Forde et al. 2011
TCCAGCCAGACCAAAGCCGC
RSAD2 NM_001045941.1 AACAGATAACCGCGCTCAAC 129 Passaro et al. 2018
CTTCAAACTCCTCGTCGCTG
INFAR1 NM_174552.2 ACCTCCTTCCTCTGTTGACG 88 Passaro et al. 2018
ACATCTTTCCGTTTGTTCCTCA
INFAR2 NM_174553.2 CTGGTCATTTGTATGGGCTCTTT 128 Sponchiado et al. 2017
GTATCCCGGGACTGTCGAATT
CTGF NM_174030.2 CACCCGGGTTACCAATGACA 138 This paper
TTGGAGATTTTGGGGGTCCG
ARTN XM_002686516.2 AGAGAACCCAGCAGTGTGAG 89 Gómez et al. 2018a
AGGCACTTCGGCAACGAAT
SLC2A1 NM_174602.2 CCTGGGGCTCTTTCCTTCAG 66 This paper
CTGGAGCCGTTAGTGTCCTG
SLC2A5 NM_001101042.2 ACCATCGGAATCCTTGTGGC 95 This paper
GGGATCCCAGTCAATCCGAG

Results

Experiment 1: Global transcriptome analysis of endometrial response to bovine blastocysts

Analysis of the RNA-Seq data resulted in the identification of 63 differentially expressed transcripts (61 upregulated and 2 downregulated) in endometrial explants exposed to 20 Day 8 blastocysts for 6 h compared to control explants (P ≤ 0.001; Table 2 and Supplementary Table 1, see section on supplementary data given at the end of this article). The most highly upregulated transcripts included RSAD2, OAS1Y, IFI44, MX1, MX2, USP18 and ISG15. Pathway and process enrichment analysis showed that Gene Ontologies (GO) associated with specific biological processes such as defence response to virus (GO:0051607), regulation of multi-organism process (GO:0043900) and regulation of type I interferon production (GO:0032479) are significantly enriched by the differentially expressed genes. In addition, we also identified specific Reactome Gene Sets associated with Interferon Signalling (R-HSA-913531) and ISG15 antiviral mechanism (R-HSA-1169408) are also significantly enriched (Table 3).

Table 2

Gene symbol, gene description, logarithm of fold change (log FC) of differentially expressed genes in bovine endometrial explants following co-culture with Day 8 blastocysts for 6 h (Experiment 1).

Gene symbol Gene description log FC DE
KCND2 Potassium voltage-gated channel subfamily D member 2 5.76 UP
RSAD2 Radical S-adenosyl methionine domain containing 2 5.61 UP
MX2 MX dynamin-like GTPase 2 5.53 UP
IFI44 Interferon-induced protein 44 5.39 UP
LOC100139670 Interferon-induced protein with tetratricopeptide repeats 1 5.01 UP
IFIT3 Interferon-induced protein with tetratricopeptide repeats 3 4.86 UP
CLEC4F C-type lectin domain family 4 member F 4.41 UP
IFI44L Interferon-induced protein 44 like 4.34 UP
ISG15 ISG15 ubiquitin-like modifier 4.34 UP
OAS1X 2′-5′-Oligoadenylate synthetase 40/46 kDa 3.95 UP
OAS2 2′-5′-Oligoadenylate synthetase 2 3.80 UP
USP18 Ubiquitin specific peptidase 18 3.77 UP
LOC112441507 Bone marrow stromal antigen 2-like 3.74 UP
SAMD9 Sterile alpha motif domain containing 9 3.69 UP
LOC100298356 Bone marrow stromal antigen 2 3.68 UP
MX1 MX dynamin like GTPase 1 3.59 UP
OAS1Y 2′-5′-Oligoadenylate synthetase 40/46 kDa 3.57 UP
OAS1Z 2′-5′-Oligoadenylate synthetase 40/46 kDa 3.53 UP
IFIT2 Interferon-induced protein with tetratricopeptide repeats 2 3.50 UP
KRT75 Keratin 75 3.46 UP
UBA7 Ubiquitin-like modifier activating enzyme 7 3.46 UP
LOC507055 Guanylate-binding protein 4 3.19 UP
SLFN11 Schlafen family member 11 3.03 UP
ZBP1 Z-DNA binding protein 1 2.97 UP
LOC509283 E3 ubiquitin protein ligase RNF213 2.90 UP
PARP14 Poly(ADP-ribose) polymerase family member 14 2.77 UP
EPSTI1 Epithelial stromal interaction 1 2.77 UP
CMPK2 Cytidine/uridine monophosphate kinase 2 2.65 UP
DDX58 DExD/H-box helicase 58 2.61 UP
CCDC194 Coiled-coil domain containing 194 2.53 UP
IFIH1 Interferon-induced with helicase C domain 1 2.52 UP
HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 2.45 UP
RTP4 Receptor transporter protein 4 2.45 UP
ZNFX1 Zinc finger NFX1-type containing 1 2.44 UP
BATF2 Basic leucine zipper ATF-like transcription factor 2 2.42 UP
LOC618737 Bone marrow stromal antigen 2 2.40 UP
LOC511531 Guanylate-binding protein 1 2.37 UP
EIF2AK2 Eukaryotic translation initiation factor 2 alpha kinase 2 2.27 UP
HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2.22 UP
PLAC8 Placenta-specific 8 2.15 UP
IRF9 Interferon regulatory factor 9 2.04 UP
IFI27 Putative ISG12(a) protein 1.99 UP
DTX3L Deltex E3 ubiquitin ligase 3L 1.98 UP
CGAS Cyclic GMP-AMP synthase 1.90 UP
TIFA TRAF-interacting protein with forkhead-associated domain 1.85 UP
DHX58 DExH-box helicase 58 1.80 UP
LOC100336669 Guanylate-binding protein 4 1.71 UP
LOC512869 Ring finger protein 213-like 1.67 UP
IRF7 Interferon regulatory factor 7 1.66 UP
XAF1 XIAP-associated factor 1 1.66 UP
PML Promyelocytic leukaemia 1.60 UP
PARP9 Poly(ADP-ribose) polymerase family member 9 1.59 UP
LOC616948 Tripartite motif-containing protein 5-like 1.59 UP
IFIT5 Interferon-induced protein with tetratricopeptide repeats 5 1.57 UP
SP110 SP110 nuclear body protein 1.56 UP
TRIM5 Tripartite motif-containing 5 1.55 UP
PNPT1 Polyribonucleotide nucleotidyltransferase 1 1.44 UP
PARP12 Poly(ADP-ribose) polymerase family member 12 1.37 UP
PARP10 Poly(ADP-ribose) polymerase family member 10 1.30 UP
LOC512486 Interferon-induced guanylate-binding protein 1 1.27 UP
IFI16 Interferon gamma inducible protein 16 1.15 UP
LOC788077 Histone H3 −5.70 DOWN
GFY Golgi-associated olfactory signalling regulator −5.71 DOWN
Table 3

Gene ontology (GO) analysis of differentially expressed genes in bovine endometrial explants following co-culture with Day 8 blastocysts for 6 h (Experiment 1).

GO Category Description Count % Log10(P)
GO:0051607 GO Biological Processes Defence response to virus 26 50.98 −38.24
R-HSA-913531 Reactome Gene Sets Interferon signalling 21 41.18 −29.77
GO:0043900 GO Biological Processes Regulation of multi-organism process 16 31.37 −16.09
R-HSA-1169408 Reactome Gene Sets ISG15 antiviral mechanism 9 17.65 −13.3
GO:0032479 GO Biological Processes Regulation of type I interferon production 10 19.61 −13.25
GO:0060333 GO Biological Processes Interferon-gamma-mediated signalling pathway 8 15.69 −10.58
GO:0050688 GO Biological Processes Regulation of defence response to virus 7 13.72 −9.76
GO:0060760 GO Biological Processes Positive regulation of response to cytokine stimulus 6 11.76 −8.72
GO:0035455 GO Biological Processes Response to interferon-alpha 4 7.84 −6.96
R-HSA-197264 Reactome Gene Sets Nicotinamide salvaging 3 5.88 −4.98
GO:0000209 GO Biological Processes Protein polyubiquitination 6 11.76 −4.68
GO:0045824 GO Biological Processes Negative regulation of innate immune response 3 5.88 −3.81
GO:2000779 GO Biological Processes Regulation of double-strand break repair 3 5.88 −3.36
GO:0050707 GO Biological Processes Regulation of cytokine secretion 4 7.84 −3.21
GO:0030099 GO Biological Processes Myeloid cell differentiation 5 9.8 −2.68
GO:0002244 GO Biological Processes Haematopoietic progenitor cell differentiation 3 5.88 −2.66
GO:0051260 GO Biological Processes Protein homo-oligomerisation 4 7.84 −2.22
GO:0061025 GO Biological Processes Membrane fusion 3 5.88 −2.02

Count refers to the number of genes in the given ontology term. % is the percentage of all the genes that are found in the given ontology term. Log10(P) is the P value in log base 10.

Experiment 2: Endometrial response to male and female blastocysts

In vitro development of bovine embryos produced using sex-sorted sperm

Embryo development following IVF with X- and Y-sorted sperm from each bull is shown in Table 4. Cleavage was assessed at 48 h post insemination and blastocyst yield was recorded on Day 8. Overall, while cleavage rates were not different, IVF with X-sorted sperm resulted in lower (P < 0.05) blastocyst development (8.4 ± 2.9%) than insemination with Y-sorted sperm (20.6 ± 2.8%).

Table 4

Cleavage rate and blastocyst yield following insemination of in vitro-matured bovine oocytes with X- or Y-sorted spermatozoa (Experiment 2a).

No. oocytes % Cleaved % Blastocyst
Bull 1
 X sorted 439 50.2 ± 5.8 7.6 ± 3.9
 Y sorted 415 58.6 ± 5.8 17.2 ± 3.9
Bull 2
 X sorted 308 75.0 ± 6.6 10.5 ± 4.4
 Y sorted 394 70.4 ± 5.8 18.5 ± 3.9
Bull 3
 X sorted 397 51.6 ± 5.8 7.2 ± 3.9
 Y sorted 385 68.8 ± 5.8 26.3 ± 3.9
Total
 X sorted 1144 58.9 ± 4.3 8.4 ± 2.9*
 Y sorted 1194 65.9 ± 4.2 20.6 ± 2.8

Five replicates per bull. Values are mean ± s.e.m.

*,†Values with different superscripts within the same column differ significantly (P < 0.05).

Sex ratio of Day 8 blastocysts

Day 8 blastocysts selected for explant culture as either male or female were predominantly of the correct sex; however, as expected, there were some inaccuracies from embryos produced with sex-sorted sperm (Table 5) and from sexing of biopsy samples (Table 6). In Experiment 2a, over the five replicates, 80.2% of the blastocysts selected as male, based on IVF with Y-sorted semen, were male and 94.1% of the blastocysts selected as female, based on IVF with Y-sorted semen, were female. In Experiment 2b, over the four replicates, 95.8% of the blastocysts selected as male, based on a biopsy taken at Day 6, were male and 76.2% of the blastocysts selected as female were female.

Table 5

Verification of blastocyst sex following IVF with X- or Y-sorted sperm and subsequent blastocyst co-culture with bovine endometrial explants for 6 h (Experiment 2a, 5 replicates).

No. of blastocysts sexed % Male (n) % Female (n)
X sorted 85 5.9 (5) 94.1 (80)
Y sorted 86 80.2 (69) 19.8 (17)
Table 6

Verification of blastocyst sex following embryo biopsy at Day 6, culture until Day 8 and subsequent blastocyst co-culture with bovine endometrial explants for 6 h (Experiment 2b, 4 replicates).

No. embryos biopsied on Day 6 % (n) blastocysts on Day 8 No. males based on biopsy sexing % (n) males based on blastocyst sexing No. females based on biopsy sexing % (n) females based on blastocyst sexing
355 45.1 (160) 48 95.8 (46) 63 76.2 (48)

Response of endometrial explants to male or female blastocysts

In Experiment 2a we confirmed our previous data (Passaro et al. 2018) reporting an increase in transcript abundance (P < 0.01) for the five classic ISG (MX1, MX2, ISG15, OASY1, RSAD2) in endometrial explants co-cultured with Day 8 blastocysts for 6 h. However, there were no differences related to embryonic sex (Fig. 3A). Similarly, in Experiment 2b, an increase (P < 0.05) in transcript abundance for three of the five ISG (MX1, MX2, ISG15) was observed following co-culture for 6 h in the presence of blastocysts; as in Experiment 2a, this was not related to embryonic sex (Fig. 3B). No difference in the relative abundance of IFNAR1, IFNAR2, CTGF, ARTN, SLC2A1, SLC2A5 was observed.

Figure 3
Figure 3

Quantitative real-time PCR analysis of five ISGs candidate genes (MX1, MX2, OAS1Y, ISG15, RSAD2) in bovine endometrial explants following 6-h co-culture with male or female blastocysts produced with sex-sorted semen (A) or by sexed by biopsy prior to culture (B) (Experiment 2). Relative expression values are shown (mean ± 95% confidence interval) for endometrial response to medium alone (Control, white bars); female blastocysts (black bars); male blastocysts (grey bars). Differences in gene expression between treatments (P < 0.01) are indicated by different superscript letters (a, b).

Citation: Reproduction 158, 3; 10.1530/REP-19-0064

Experiment 3: Response of bovine endometrium to bovine vs murine blastocysts

Representative images of bovine and murine blastocysts used for co-culture with bovine endometrial explants are shown in Fig. 4. Exposure of a bovine endometrial explants to 25 bovine blastocysts for 6 h resulted in the upregulation of 24 transcripts (Supplementary Table 2). In contrast, exposure to murine blastocysts did not elicit any detectable change in transcript abundance following RNA-Seq (Supplementary Table 2). Combining the data from Experiments 1 and 3 in terms of response of explants to bovine blastocysts (n = 10 replicates) revealed the differential expression of 40 transcripts (Supplementary Table 2). Among the most enriched GO terms were response to type I interferon, regulation of defence response to virus and regulation of response to cytokine stimulus (Supplementary Table 3).

Figure 4
Figure 4

Representative images of bovine (left) and murine (right) blastocysts used for co-culture with bovine endometrial explants (Experiment 3).

Citation: Reproduction 158, 3; 10.1530/REP-19-0064

Comparison of the list of differentially expressed genes in bovine endometrial explants following 6-h culture with blastocyst-stage embryos (from the combined analysis of Experiments 1 and 3 in the current study) with the common list of genes altered in endometrial explants following 6 h culture with 100 ng/mL interferon-tau (IFNT) or a Day 15 conceptus (from Sánchez et al. 2019) indicated that all the DEG induced in the endometrium by blastocyst-stage embryos are IFNT related (Fig. 5).

Figure 5
Figure 5

Comparison of list of differentially expressed genes in bovine endometrial explants following 6-h culture with blastocyst stage embryos (right, from the combined analysis of Experiments 1 and 3 in the current study; in yellow) with the common list of transcripts altered in endometrial explants following 6 h culture with 100 ng/mL interferon-tau (IFNT) or a Day 15 long or short conceptus (left, from Sánchez et al. 2019; in blue). Data indicate that all the DEG induced in the endometrium by a blastocyst are IFNT related (in contrast to Day 15 when a significant number of IFNT-independent genes are induced (Sánchez et al. 2019)).

Citation: Reproduction 158, 3; 10.1530/REP-19-0064

Discussion

The main findings of this study are (i) exposure of bovine endometrium to blastocyst-stage embryos results in the alteration of a number of transcripts, all of which are IFNT related; (ii) the expression of a number of candidate genes in bovine endometrium was not affected by the sex of the blastocyst and (iii) murine embryos did not elicit any detectable transcriptomic response in bovine endometrium following 6-h co-culture.

We recently demonstrated that short-term exposure of endometrial explants to bovine blastocysts (Passaro et al. 2018) altered the expression of classical ISGs. Here, we extended those data by examining the global transcriptome of endometrial explants exposed to blastocysts. Results of Experiment 1 revealed the differential expression of 63 transcripts. Among the most upregulated were RSAD2, MX2, ISG15 and OAS2. Interestingly, two transcripts (Histone H3, Golgi-associated olfactory signalling regulator, GFY) were downregulated. Histone H3 expression levels have been used as a marker of endometrial proliferation in macaque and human endometrium (Brenner et al. 2003), while, to our knowledge, GFY has not been previously reported as differentially expressed in endometrium. Combining the data from Experiments 1 and 3 (to give a total of ten replicates per group) confirmed the upregulation of 40 transcripts in blastocyst-exposed endometrial explants compared to the control; neither Histone H3 nor GFY was in this list. Comparison of this list of DEG with the common list of genes altered in endometrial explants following culture with 100 ng/mL IFNT or a Day 15 conceptus (from Sánchez et al. 2019) indicated that all the DEG induced in the endometrium by blastocyst-stage embryos were IFNT stimulated. It is important to note that it was not a forgone conclusion that all the transcripts altered by a blastocyst-stage embryo would be IFNT related. Two recent studies from our group (Mathew et al. 2019, Sánchez et al. 2019) indicate that by Day 15, while the majority of altered endometrial transcripts are IFNT related, a significant number of transcripts are altered in an IFNT-independent manner. Thus, it was, we believe, not unreasonable to hypothesise that some of the changes induced at Day 8 might also be independent of IFNT.

Conceptus-derived IFNT is the primary maternal recognition of pregnancy signal in cattle (reviewed by Bazer & Thatcher 2017, Forde & Lonergan 2017) that inhibits upregulation of oxytocin receptors in the endometrial epithelia of the uterus, thereby preventing the production of luteolytic prostaglandin F2 alpha (PGF2α) pulses to maintain progesterone production by the corpus luteum (Hansen et al. 2017). In the endometrium, IFNT induces or upregulates a large number of classical ISG and regulates the expression of many other genes in a cell-specific manner that are likely important for conceptus elongation, implantation and establishment of pregnancy (Spencer et al. 2008). Bovine embryos begin to express IFNT upon blastocyst formation (Farin et al. 1990), although there is considerable variation between individual embryos in the amount they produce (Hernandez-Ledezma et al. 1992). This variation has been related to the origin of the embryo (Stojkovic et al. 1999), the age at which blastocyst formation occurs (Kubisch et al. 1998, 2001a ), the group size in which culture takes place (Larson & Kubisch 1999), medium composition (Stojkovic et al. 1995, Wrenzycki et al. 1999, Kubisch et al. 2001b , Rizos et al. 2003) and the sex of the embryo (Larson et al. 2001). In contrast, later during preimplantation development, IFNT may not be the only conceptus-derived product which acts on the endometrium. For example, Mamo et al. (2012) described transcripts for conceptus ligands that potentially interact with corresponding receptors on the endometrium during the critical window of maternal recognition of pregnancy. Analysis of the protein content of Day 16 conceptus-conditioned culture medium with uterine luminal fluid (ULF) from cyclic and pregnant heifers on Day 16 identified 30 proteins unique to ULF from pregnant heifers which were also secreted by the conceptus in vitro (Forde et al. 2015). Lastly, comparison of transcripts altered in endometrial explants by the presence of a conceptus compared with those induced by 100 ng/mL IFNT revealed the altered expression of >100 IFNT-independent transcripts in endometrium (Mathew et al. 2019, Sánchez et al. 2019). Later during the preimplantation phase (Days 18–20), the transcriptomic response of the endometrium to pregnancy is quite specific to the type of conceptus present (AI-derived, IVF-derived, cloned) (Bauersachs et al. 2009, Mansouri-Attia et al. 2009), suggesting the endometrium is a biosensor of the developmental competency or origin of the embryo (Sandra et al. 2011).

The aim of Experiment 2 was to investigate sexual dimorphic alterations in the bovine endometrial transcriptome following in vitro exposure to Day 8 male or female blastocysts. The interest in sexual dimorphism is based on the knowledge that one-third of the transcripts present at the blastocyst stage in cattle are regulated by the sex of the embryo (Bermejo-Alvarez et al. 2010a ). Consistent with our previous study (Passaro et al. 2018) and data from Experiment 1, in Experiment 2a, we observed an increase in transcript abundance of five ISG (MX1, MX2, ISG15, OASY1, RSAD2) in explants co-cultured with male or female blastocysts produced with sex-sorted semen; however, expression was not affected by embryonic sex. Similarly, in Experiment 2b, while transcript abundance for three of the five ISG (MX1, MX2, ISG15) was significantly upregulated by the presence of male or female blastocysts, there were no differences due to embryonic sex. These data are consistent with our previous study in which we failed to detect conceptus-sex-related alterations in the endometrial transcriptome in vivo at the initiation of implantation on Day 19 (Forde et al. 2016). In contrast, Gómez et al. (2013) reported differential protein expression in Day 8 uterine fluid recovered from heifers following the transfer of 60 Day 5 male or female embryos. More recently, Gómez et al. (2018a) described an embryo sex-dependent response of cultured bovine uterine epithelial (but not stromal) cells; single male embryos induced downregulation of SLC2A1, SLC2A5, CTGF, ARTN, IFNAR1 and IFNAR2. While these transcripts were detectable in our dataset, they were not differentially expressed. It is important to note that these authors used cultured epithelial cells rather than intact endometrium as used here, and a much longer co-culture period (48vs 6 h) which may partly explain the different observations.

Conceptus elongation is a maternally driven process dependent on secretions of the endometrium in vivo; it does not occur in vitro or in vivo in the absence of uterine glands (Gray et al. 2002). Development of bovine embryos to the blastocyst stage is supported by the reproductive tracts of other species following embryo transfer (sheep: Eyestone et al. 1987, Enright et al. 2000) or culture ex vivo (Mouse: Rizos et al. 2010). Indeed, bovine conceptuses will elongate in the ovine uterus (Rexroad & Powell 1999, Black et al. 2010). However, to what extent elongation is intrinsic to the embryo or whether the endometrium responds differently to embryos destined to elongate (e.g., ruminant, porcine) compared to those that do not elongate (e.g., rodent, primate, equine) is unknown. As a first step to address this intriguing question we tested the hypothesis that murine embryos would elicit a different response from bovine endometrium than bovine embryos. Exposure to murine blastocysts did not induce any detectable changes in transcript abundance in bovine endometrial explants. While this observation is somewhat surprising, it is consistent with our previous observation that the presence of oocytes or embryos up to the morula stage did not induce changes in the expression of candidate ISG (Passaro et al. 2018).

In conclusion, these findings, coupled with our previous data, indicate that very local, IFNT-induced, changes in endometrial gene expression occur in response to blastocysts; whether such changes play any role in subsequent pregnancy recognition remains to be established. We believe the described blastocyst-induced alterations in transcript abundance are novel (not shown previously) and solid (based on ten replicates – five from each of two independent experiments in the manuscript). Further validation of these transcripts comes from the fact that they were also detected in an independent study using Day 15 conceptuses (Sánchez et al. 2019). Future studies we may in the future do some proteomic work on these or similar tissues in a much larger study, looking at the expression of one or two proteins here would be somewhat gratuitous and would not add much in our view.

Supplementary data

This is linked to the online version of the paper at https://doi.org/10.1530/REP-19-0064.

Declaration of interest

Trudee Fair is a member of the Editorial Board of Reproduction. Trudee Fair was not involved in the review or editorial process for this paper, on which she is listed as an author. The other authors have nothing to disclose.

Funding

This work was supported by Science Foundation Ireland (13/IA/1983).

Acknowledgements

The authors thank Mary Wade (UCD) for excellent technical assistance and Dr Constantine Simintiras (UCD) for help in drafting a figure.

References

  • Alexopoulos NI, Vajta G, Maddox-Hyttel P, French AJ & Trounson AO 2005 Stereomicroscopic and histological examination of bovine embryos following extended in vitro culture. Reproduction, Fertility, and Development 17 . (https://doi.org/10.1071/RD04104)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Avery B, Jørgensen CB, Madison V & Greve T 1992 Morphological development and sex of bovine in vitro-fertilized embryos. Molecular Reproduction and Development 32 . (https://doi.org/10.1002/mrd.1080320312)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bauersachs S, Ulbrich SE, Zakhartchenko V, Minten M, Reichenbach M, Reichenbach HD, Blum H, Spencer TE & Wolf E 2009 The endometrium responds differently to cloned versus fertilized embryos. PNAS 106 . (https://doi.org/10.1073/pnas.0811841106)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bauersachs S, Ulbrich SE, Reichenbach HD, Reichenbach M, Büttner M, Meyer HH, Spencer TE, Minten M, Sax G & Winter G et al. 2012 Comparison of the effects of early pregnancy with human interferon, alpha 2 (IFNA2), on gene expression in bovine endometrium. Biology of Reproduction 86 46. (https://doi.org/10.1095/biolreprod.111.094771)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bazer FW & Thatcher WW 2017 Chronicling the discovery of interferon tau. Reproduction 154 F11F20. (https://doi.org/10.1530/REP-17-0257)

  • Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P & Gutierrez-Adan A 2010a Sex determines the expression level of one third of the actively expressed genes in bovine blastocysts. PNAS 107 . (https://doi.org/10.1073/pnas.0913843107)

    • Search Google Scholar
    • Export Citation
  • Bermejo-Alvarez P, Lonergan P, Rath D, Gutiérrez-Adan A & Rizos D 2010b Developmental kinetics and gene expression in male and female bovine embryos produced in vitro with sex-sorted spermatozoa. Reproduction, Fertility, and Development 22 . (https://doi.org/10.1071/RD09142)

    • Search Google Scholar
    • Export Citation
  • Betteridge KJ, Eaglesome MD, Randall GC & Mitchell D 1980 Collection, description and transfer of embryos from cattle 10–16 days after oestrus. Journal of Reproduction and Fertility 59 . (https://doi.org/10.1530/jrf.0.0590205)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Black SG, Arnaud F, Burghardt RC, Satterfield MC, Fleming JA, Long CR, Hanna C, Murphy L, Biek R & Palmarini M et al. 2010 Viral particles of endogenous betaretroviruses are released in the sheep uterus and infect the conceptus trophectoderm in a transspecies embryo transfer model. Journal of Virology 84 . (https://doi.org/10.1128/JVI.00950-10)

    • Search Google Scholar
    • Export Citation
  • Blomberg LA, Schreier L & Li RW 2010 Characteristics of peri-implantation porcine concepti population and maternal milieu influence the transcriptome profile. Molecular Reproduction and Development 77 . (https://doi.org/10.1002/mrd.21253)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brandão DO, Maddox-Hyttel P, Løvendahl P, Rumpf R, Stringfellow D & Callesen H 2004 Post hatching development: a novel system for extended in vitro culture of bovine embryos. Biology of Reproduction 71 . (https://doi.org/10.1095/biolreprod.103.025916)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brenner RM, Slayden OD, Rodgers WH, Critchley HO, Carroll R, Nie XJ & Mah K 2003 Immunocytochemical assessment of mitotic activity with an antibody to phosphorylated histone H3 in the macaque and human endometrium. Human Reproduction 18 . (https://doi.org/10.1093/humrep/deg255)

    • Search Google Scholar
    • Export Citation
  • Cha JM & Dey SK 2015 Reflections on rodent implantation. Advances in Anatomy, Embryology, and Cell Biology 216 . (https://doi.org/10.1007/978-3-319-15856-3_5)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Clemente M, de La Fuente J, Fair T, Al Naib A, Gutierrez-Adan A, Roche JF, Rizos D & Lonergan P 2009 Progesterone and conceptus elongation in cattle: a direct effect on the embryo or an indirect effect via the endometrium? Reproduction 138 . (https://doi.org/10.1530/REP-09-0152)

    • Search Google Scholar
    • Export Citation
  • Cohen J 1960 A coefficient of agreement for nominal scales. Educational and Psychological Measurement 20 . (https://doi.org/10.1177/001316446002000104)

    • Search Google Scholar
    • Export Citation
  • Enright BP, Lonergan P, Dinnyes A, Fair T, Ward FA, Yang X & Boland MP 2000 Culture of in vitro produced bovine zygotes in vitro vs in vivo: implications for early embryo development and quality. Theriogenology 54 . (https://doi.org/10.1016/S0093-691X(00)00381-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eyestone WH, Leibfried-Rutledge ML, Northey DL, Gilligan BG & First NL 1987 Culture of one- and two-cell bovine embryos to the blastocyst stage in the ovine oviduct. Theriogenology 28 . (https://doi.org/10.1016/0093-691X(87)90179-8)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Farin CE, Imakawa K, Hansen TR, McDonnell JJ, Murphy CN, Farin PW & Roberts RM 1990 Expression of trophoblastic interferon genes in sheep and cattle. Biology of Reproduction 43 . (https://doi.org/10.1095/biolreprod43.2.210)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Forde N & Lonergan P 2017 Interferon-tau and fertility in ruminants. Reproduction 154 F33F43. (https://doi.org/10.1530/REP-17-0432)

  • Forde N, Carter F, Spencer TE, Bazer FW, Sandra O, Mansouri-Attia N, Okumu LA, McGettigan PA, Mehta JP & McBride R et al. 2011 Conceptus-induced changes in the endometrial transcriptome: how soon does the cow know she is pregnant? Biology of Reproduction 85 . (https://doi.org/10.1095/biolreprod.110.090019)

    • Search Google Scholar
    • Export Citation
  • Forde N, Bazer FW, Spencer TE & Lonergan P 2015 ‘Conceptualizing’ the endometrium: identification of conceptus-derived proteins during early pregnancy in cattle. Biology of Reproduction 92 156. (https://doi.org/10.1095/biolreprod.115.129296)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Forde N, Maillo V, O’Gaora P, Simintiras CA, Sturmey RG, Ealy AD, Spencer TE, Gutierrez-Adan A, Rizos D & Lonergan P 2016 Sexually dimorphic gene expression in bovine conceptuses at the initiation of implantation. Biology of Reproduction 95 92. (https://doi.org/10.1095/biolreprod.116.139857)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez E, Caamaño JN, Corrales FJ, Díez C, Correia-Álvarez E, Martín D, Trigal B, Carrocera S, Mora MI & Pello-Palma J et al. 2013 Embryonic sex induces differential expression of proteins in bovine uterine fluid. Journal of Proteome Research 12 . (https://doi.org/10.1021/pr300845e)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez E, Sánchez-Calabuig MJ, Martin D, Carrocera S, Murillo A, Correia-Alvarez E, Herrero P, Canela N, Gutiérrez-Adán A & Ulbrich S et al. 2018a In vitro cultured bovine endometrial cells recognize embryonic sex. Theriogenology 108 . (https://doi.org/10.1016/j.theriogenology.2017.11.038)

    • Search Google Scholar
    • Export Citation
  • Gómez E, Carrocera S, Martin D, Herrero P, Canela N & Muñoz M 2018b Differential release of cell-signaling metabolites by male and female bovine embryos cultured in vitro. Theriogenology 114 . (https://doi.org/10.1016/j.theriogenology.2018.03.038)

    • Search Google Scholar
    • Export Citation
  • Gray CA, Burghardt RC, Johnson GA, Bazer FW & Spencer TE 2002 Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction 124 . (https://doi.org/10.1530/rep.0.1240289)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hansen PJ, Dobbs KB, Denicol AC & Siqueira LGB 2016 Sex and the preimplantation embryo: implications of sexual dimorphism in the preimplantation period for maternal programming of embryonic development. Cell and Tissue Research 363 . (https://doi.org/10.1007/s00441-015-2287-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hansen TR, Sinedino LDP & Spencer TE 2017 Paracrine and endocrine actions of interferon tau (IFNT). Reproduction 154 F45F59. (https://doi.org/10.1530/REP-17-0315)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Hernandez-Ledezma JJ, Sikes JD, Murphy CN, Watson AJ, Schultz GA & Roberts RM 1992 Expression of bovine trophoblast interferon in conceptuses derived by in vitro techniques. Biology of Reproduction 47 . (https://doi.org/10.1095/biolreprod47.3.374)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hochberg Y & Benjamini Y 1990 More powerful procedures for multiple significance testing. Statistics in Medicine 9 . (https://doi.org/10.1002/sim.4780090710)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ireland JJ, Murphee RL & Coulson PB 1980 Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. Journal of Dairy Science 63 . (https://doi.org/10.3168/jds.S0022-0302(80)82901-8)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kubisch HM, Larson MA & Roberts RM 1998 Relationship between age of blastocyst formation and interferon-tau secretion by in vitro-derived bovine embryos. Molecular Reproduction and Development 49 . (https://doi.org/10.1002/(SICI)1098-2795(199803)49:3<254::AID-MRD5>3.0.CO;2-N)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kubisch HM, Larson MA & Kiesling DO 2001a Control of interferon-tau secretion by in vitro-derived bovine blastocysts during extended culture and outgrowth formation. Molecular Reproduction and Development 58 . (https://doi.org/10.1002/1098-2795(20010401)58:4<390::AID-MRD6>3.0.CO;2-V)

    • Search Google Scholar
    • Export Citation
  • Kubisch HM, Larson MA, Ealy AD, Murphy CN & Roberts RM 2001b Genetic and environmental determinants of interferon-tau secretion by in vivo- and in vitro-derived bovine blastocysts. Animal Reproduction Science 66 . (https://doi.org/10.1016/S0378-4320(01)00086-0)

    • Search Google Scholar
    • Export Citation
  • Larson MA & Kubisch HM 1999 The effects of group size on development and interferon-tau secretion by in-vitro fertilized and cultured bovine blastocysts. Human Reproduction 14 . (https://doi.org/10.1093/humrep/14.8.2075)

    • Search Google Scholar
    • Export Citation
  • Larson MA, Kimura K, Kubisch HM & Roberts RM 2001 Sexual dimorphism among bovine embryos in their ability to make the transition to expanded blastocyst and in the expression of the signaling molecule IFN-tau. PNAS 98 . (https://doi.org/10.1073/pnas.171305398)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lonergan P & Forde N 2014 Maternal-embryo interaction leading up to the initiation of implantation of pregnancy in cattle. Animal 8 (Supplement 1) . (https://doi.org/10.1017/S1751731114000470)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mamo S, Mehta JP, Forde N, McGettigan P & Lonergan P 2012 Conceptus-endometrium crosstalk during maternal recognition of pregnancy in cattle. Biology of Reproduction 87 6, 16, 9. (https://doi.org/10.1095/biolreprod.112.099945)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Mansouri-Attia N, Sandra O, Aubert J, Degrelle S, Everts RE, Giraud-Delville C, Heyman Y, Galio L, Hue I & Yang X et al. 2009 Endometrium as an early sensor of in vitro embryo manipulation technologies. PNAS 106 . (https://doi.org/10.1073/pnas.0812722106)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mathew DJ, Sánchez JM, Passaro C, Charpigny G, Behura SK, Spencer TE & Lonergan P 2019 Title: interferon tau-dependent and independent effects of the bovine conceptus on the endometrial transcriptome. Biology of Reproduction 100 . (https://doi.org/10.1093/biolre/ioy199)

    • Search Google Scholar
    • Export Citation
  • Moraes JGN, Behura SK, Geary TW, Hansen PJ, Neibergs HL & Spencer TE 2018 Uterine influences on conceptus development in fertility-classified animals. PNAS 115 E1749E1758. (https://doi.org/10.1073/pnas.1721191115)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Oliveira CS, Saraiva NZ, de Souza MM, Tetzner TAD, de Lima MR & Garcia JM 2010 Effects of histone hyperacetylation on the preimplantation development of male and female bovine embryos. Reproduction, Fertility, and Development 22 . (https://doi.org/10.1071/RD09238)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Park JH, Lee JH, Choi KM, Joung SY, Kim JY, Chung GM, Jin DI & Im KS 2001 Rapid sexing of preimplantation bovine embryo using consecutive and multiplex polymerase chain reaction (PCR) with biopsied single blastomere. Theriogenology 55 . (https://doi.org/10.1016/S0093-691X(01)00526-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Passaro C, Tutt D, Mathew DJ, Sánchez JM, Browne JA, Boe-Hansen GB, Fair T & Lonergan P 2018 Blastocyst-induced changes in the bovine endometrial transcriptome. Reproduction 156 . (https://doi.org/10.1530/REP-18-0188)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rexroad CE & Powell AM 1999 The ovine uterus as a host for in vitro-produced bovine embryos. Theriogenology 52 . (https://doi.org/10.1016/S0093-691X(99)00134-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rizos D, Ward F, Duffy P, Boland MP & Lonergan P 2002 Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Molecular Reproduction and Development 61 . (https://doi.org/10.1002/mrd.1153)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rizos D, Gutiérrez-Adán A, Pérez-Garnelo S, De La Fuente J, Boland MP & Lonergan P 2003 Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biology of Reproduction 68 . (https://doi.org/10.1095/biolreprod.102.007799)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rizos D, Ramirez MA, Pintado B, Lonergan P & Gutierrez-Adan A 2010 Culture of bovine embryos in intermediate host oviducts with emphasis on the isolated mouse oviduct. Theriogenology 73 . (https://doi.org/10.1016/j.theriogenology.2009.10.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sánchez JM, Mathew DJ, Behura SK, Passaro C, Charpigny G, Butler ST, Spencer TE & Lonergan P 2019 Bovine endometrium responds differentially to age-matched short and long conceptuses. Biology of ReproductionEpub. (https://doi.org/10.1093/biolre/ioz060).

    • Search Google Scholar
    • Export Citation
  • Sandra O, Mansouri-Attia N & Lea RG 2011 Novel aspects of endometrial function: a biological sensor of embryo quality and driver of pregnancy success. Reproduction, Fertility, and Development 24 . (https://doi.org/10.1071/RD11908)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Spencer TE, Sandra O & Wolf E 2008 Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches. Reproduction 135 . (https://doi.org/10.1530/REP-07-0327)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Spencer TE, Forde N & Lonergan P 2016 Insights into conceptus elongation and establishment of pregnancy in ruminants. Reproduction, Fertility, and Development 29 . (https://doi.org/10.1071/RD16359)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sponchiado M, Gomes NS, Fontes PK, Martins T, Del Collado M, Pastore AA, Pugliesi G, Nogueira MFG & Binelli M 2017 Pre-hatching embryo-dependent and -independent programming of endometrial function in cattle. PLoS ONE 12 e0175954. (https://doi.org/10.1371/journal.pone.0175954)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stojkovic M, Wolf E, Büttner M, Berg U, Charpigny G, Schmitt A & Brem G 1995 Secretion of biologically active interferon tau by in vitro-derived bovine trophoblastic tissue. Biology of Reproduction 53 . (https://doi.org/10.1095/biolreprod53.6.1500)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stojkovic M, Büttner M, Zakhartchenko V, Riedl J, Reichenbach HD, Wenigerkind H, Brem G & Wolf E 1999 Secretion of interferon-tau by bovine embryos in long-term culture: comparison of in vivo derived, in vitro produced, nuclear transfer and demi-embryos. Animal Reproduction Science 55 . (https://doi.org/10.1016/S0378-4320(99)00015-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Su RW & Fazleabas AT 2015 Implantation and establishment of pregnancy in human and nonhuman primates. Advances in Anatomy, Embryology, and Cell Biology 216 . (https://doi.org/10.1007/978-3-319-15856-3_10)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Talukder AK, Yousef MS, Rashid MB, Awai K, Acosta TJ, Shimizu T, Okuda K, Shimada M, Imakawa K & Miyamoto A 2017 Bovine embryo induces an anti-inflammatory response in uterine epithelial cells and immune cells in vitro: possible involvement of interferon tau as an intermediator. Journal of Reproduction and Development 63 . (https://doi.org/10.1262/jrd.2017-056)

    • Search Google Scholar
    • Export Citation
  • Tiffin GJ, Rieger D, Betteridge KJ, Yadav BR & King WA 1991 Glucose and glutamine metabolism in pre-attachment cattle embryos in relation to sex and stage of development. Journal of Reproduction and Fertility 93 . (https://doi.org/10.1530/jrf.0.0930125)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tominaga K & Hamada Y 2004 Efficient production of sex-identified and cryosurvived bovine in-vitro produced blastocysts. Theriogenology 61 . (https://doi.org/10.1016/j.theriogenology.2003.07.008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A & Speleman F 2002 Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3 RESEARCH0034. (https://doi.org/10.1186/gb-2002-3-7-research0034)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wrenzycki C, Herrmann D, Carnwath JW & Niemann H 1999 Alterations in the relative abundance of gene transcripts in preimplantation bovine embryos cultured in medium supplemented with either serum or PVA. Molecular Reproduction and Development 53 . (https://doi.org/10.1002/(SICI)1098-2795(199905)53:1<8::AID-MRD2>3.0.CO;2-K)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xu KP, Yadav BR, King WA & Betteridge KJ 1992 Sex-related differences in developmental rates of bovine embryos produced and cultured in vitro. Molecular Reproduction and Development 31 . (https://doi.org/10.1002/mrd.1080310404)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zar JH 1999 Biostatistical Analysis, 4th ed. India: Pearson Education.

  • Zhou X, Lindsay H & Robinson MD 2014 Robustly detecting differential expression in RNA sequencing data using observation weights. Nucleic Acids Research 42 e91. (https://doi.org/10.1093/nar/gku310)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery

    Representative gels from embryo sexing by PCR. A single PCR using both Y-chromosome-specific primers (TSPY) and bovine-specific satellite sequence primers (Sat 1.715) was carried out. Lane 1: No template control. Lane 2: female gDNA. Lane 3: male gDNA. (A) From Lane 4 on: female embryos with a 216 bp specific product of Sat. (B) From lane 4 on: male embryos, a 535 bp Y-chromosome-specific product (TSPY) appears in the top lane.

  • View in gallery

    Representation of endometrial explant with cell culture insert used to retain in vitro-produced Day 8 blastocysts during co-culture.

  • View in gallery

    Quantitative real-time PCR analysis of five ISGs candidate genes (MX1, MX2, OAS1Y, ISG15, RSAD2) in bovine endometrial explants following 6-h co-culture with male or female blastocysts produced with sex-sorted semen (A) or by sexed by biopsy prior to culture (B) (Experiment 2). Relative expression values are shown (mean ± 95% confidence interval) for endometrial response to medium alone (Control, white bars); female blastocysts (black bars); male blastocysts (grey bars). Differences in gene expression between treatments (P < 0.01) are indicated by different superscript letters (a, b).

  • View in gallery

    Representative images of bovine (left) and murine (right) blastocysts used for co-culture with bovine endometrial explants (Experiment 3).

  • View in gallery

    Comparison of list of differentially expressed genes in bovine endometrial explants following 6-h culture with blastocyst stage embryos (right, from the combined analysis of Experiments 1 and 3 in the current study; in yellow) with the common list of transcripts altered in endometrial explants following 6 h culture with 100 ng/mL interferon-tau (IFNT) or a Day 15 long or short conceptus (left, from Sánchez et al. 2019; in blue). Data indicate that all the DEG induced in the endometrium by a blastocyst are IFNT related (in contrast to Day 15 when a significant number of IFNT-independent genes are induced (Sánchez et al. 2019)).