Abstract
Primordial follicle oocytes are extremely vulnerable to DNA damage caused by exogenous agents, such as those commonly used to treat cancer. Consequently, female cancer patients often have diminished ovarian reserve, which if severe enough, can cause premature ovarian failure and early menopause. Advances in cancer therapies have resulted in significantly improved cancer survival rates; therefore, it is becoming increasingly important to devise strategies to protect the ovarian reserve from cancer treatments, to avoid loss of fertility and endocrine dysfunction. In this study, we aimed to determine whether supplementation with nicotinamide mononucleotide (NMN) could preserve the ovarian reserve following exposure to DNA-damaging cancer treatments. Adult female mice (n = 5–6/group) received saline or NMN (500 mg/kg/day) for 8 days. Mice were left untreated or exposed to γ-irradiation (0.1 Gy) or cyclophosphamide (150 mg/kg) on day 7 and ovaries and serum collected for analysis on day 12. We report that γ-irradiation treatment significantly reduced the number of primordial follicles, but supplementation with NMN did not prevent the observed follicle loss. Similarly, cyclophosphamide treatment significantly reduced primordial follicle numbers, but these losses were not prevented by NMN supplementation. In conclusion, depletion of the ovarian reserve following γ-irradiation or cyclophosphamide was not protected by NMN supplementation under the conditions employed in this study.
Introduction
Female germ cells reside in the ovary in structures called primordial follicles. Each primordial follicle contains a small, immature and meiotically arrested oocyte, surrounded by a single layer of squamous somatic cells, known as granulosa cells (Hutt et al. 2006). The pool of primordial follicles is established in the ovary before birth, and it remains widely accepted that this pool is not replenished after this time under normal physiological conditions (Faddy & Gosden 2007, Findlay et al. 2015). While most primordial follicles remain dormant, some become activated every day to undergo folliculogenesis, a developmental program that results in the production of large hormone-producing follicles and oocytes ready for ovulation and fertilization (Hsueh et al. 2015). Thus, the supply of primordial follicles gradually depletes over time, leading to a loss of fertility and eventually menopause (Faddy & Gosden 1995).
Cancer treatments, such as radiotherapy or chemotherapies like cisplatin and cyclophosphamide, have the ability to directly damage the DNA of primordial follicle oocytes (Kerr et al. 2012, Nguyen et al. 2019). DNA damage in primordial follicle oocytes leads to the activation of TAp63, followed by the transcriptional induction of the pro-apoptotic protein PUMA, ultimately causing cell death (Suh et al. 2006, Livera et al. 2008, Kerr et al. 2012, Kim et al. 2018, Nguyen et al. 2018, 2019, Tuppi et al. 2018). Premature depletion of the ovarian reserve of primordial follicles can result in infertility and premature menopause, which is associated with a number of adverse health effects, including increased risk of osteoporosis, death from cardiovascular disease and psychosexual dysfunction (Shuster et al. 2010). Consequently, early loss of follicles due to endogenous or exogenous insult can have an effect on long-term health in addition to reducing reproductive capacity. As survival rates for cancer improve with the advent of early detection and improved treatments, it is becoming increasingly important to ensure the fertility and health of patients following cancer treatment.
Nicotinamide mononucleotide (NMN) is a naturally occurring vitamin that is converted into the antioxidant nicotinamide adenine dinucleotide (NAD+) via the enzyme nicotinamide mononucleotide adenylyltransferase (Nmnat) (Imai & Guarente 2014). NAD+ is an essential substrate used by Poly (ADP-ribose) polymerases (PARPs) and Sirtuins (SIRTs) for regulating many cell functions including metabolism, cell survival and DNA repair (Li et al. 2017). In particular, PARP1 has an established role in DNA repair, and SIRT1 (a deacetylase) has been implicated in ageing in somatic cells (Tatone et al. 2015). Recently, it was reported that NMN supplementation reduced DNA damage in human fibroblasts, as seen by a reduction of γH2AX foci, a biomarker of DNA double-strand breaks (Li et al. 2017). NMN supplementation also reduced DNA damage in white blood cells, lymphocytes and haemoglobin following DNA insult by γ-irradiation (Li et al. 2017). Furthermore, NMN treatment (4 days 500 mg/kg/day) reduced cisplatin-induced apoptosis in kidneys in a SIRT1-dependent manner (Guan et al. 2017). Given this previous work in other organ systems suggesting a protective role of NMN against DNA damage and cell death, our objective was to determine if supplementation with NMN could reduce follicle loss caused by γ-irradiation and the commonly used DNA-damaging cancer treatment, cyclophosphamide.
Methods
Animals
C57BL/6J mice were housed in a temperature-controlled high-barrier facility (Monash University ARL) with free access to mouse chow and water, and a 12-h light-dark cycle. All animal procedures were approved by the Animal Ethics Committee at Monash University and procedures were performed in accordance with the NHMRC Australian Code of Practice for the Care and Use of Animals. The treatment scheme is shown in Supplementary Fig. 1 (see section on supplementary materials given at the end of this article). Seven-8-week-old wild-type C57BL6 female mice were randomly assigned to two groups and injected intraperitoneally (IP) with 500 mg/kg of NMN (Sigma-Aldrich, N3501) or an equivalent volume of saline for 8 consecutive days. Previous studies have shown that 500 mg/kg/day of NMN delivered by intraperitoneal (IP) injection for 7 consecutive days is the minimum dose required in order to provide DNA-protective effects (Li et al. 2017). On the seventh day of treatment, mice were exposed to either whole body γ-irradiation (0.1 Gy) or were untreated or received an IP injection of cyclophosphamide (150 mg/kg) or vehicle (n = 5–6 mice/group). A dose of 0.1 Gy of γ-irradiation or cyclophosphamide have been shown to be sufficient to cause ~80% loss of oocytes in wild-type female mice (Suh et al. 2006, Goldman et al. 2017). All animals in all groups were handled in the same way throughout the experiment. Ovaries and serum were collected on day 12 (i.e. 5 days after γ-irradiation or cyclophosphamide).
Stereology
One ovary from each mouse (n = 5–6 mice/group) was fixed in Bouins’ fluid and then processed into glycolmethacrylate resin. These ovaries were serially sectioned every 20 µm, with every third section stained with Periodic Acid Schiff (PAS) and counterstained with haematoxylin. Primordial, transitional and primary follicles were classified as previously described (Myers et al. 2004). Briefly, oocytes with a partial or complete layer of squamous granulosa cells were classified as primordial. Oocytes surrounded by a partial or single layer of a mixture of squamous and cuboidal granulosa cells were considered transitional follicles. Oocytes surrounded by a single layer of cuboidal granulosa cells were classified as primary follicles.
The optical disector method was used to quantify primordial, transitional and primary follicles numbers as previously described (Myers et al. 2004). Briefly, ovarian sections were observed using an Olympus Microscope (Olympus BX50) with a motorised stage, using a ×100 oil immersion magnification (Immersion Oil Type-F, Olympus, IMMOIL-F30CC). A Stereo Investigator stereological system and Stereo Investigator 11 software was used to outline an area encompassing the ovary and set up a sampling grid. Each sampling grid square was overlaid with a counting frame consisting of inclusion and exclusion barriers. Oocytes with a clearly defined nuclei that lay within the counting frame or on the inclusion boundary were counted to give a raw count (Q−). In order to estimate the total number of primordial or primary follicles per ovary (n), the raw count was multiple by the reciprocal of the sampling fraction. The sample fraction is defined by the section number interval (f1 = 1/section interval); the size of each counting frame and the area covered when moving to the next square (X-axis × Y-axis) known as the stepper distance (f2 = counting frame/stepper distance); and the thickness of each section taking into account a guard area to avoid cutting artefacts (f3 = section thickness). In this case, every third section was counted (f1 = 1/3) and the counting frame was 2256 μm2 with a stepper distance of 10,000 (f2 = 2256/10,000). The first 3 µm of each section was set as a guard area, the next 10 µm of the 20 µm section was optionally sectioned and oocytes counted as the nuclei came into clear focus (f3 = 10/20). To calculate follicle numbers, these parameters were applied to the following equation N = Q− (follicle)·(1/f1)·(1/f2)·(1/f3).
Quantification of growing and atretic follicles
Numbers of secondary or antral follicles per ovary were estimated by counting every ninth 20 µm-thick serial section using a light microscope employing a ×10 magnification. Follicles were counted when a clearly defined nuclei was visible in the oocyte. Growing follicles were classified as described (Myers et al. 2004). Briefly, follicles with more than one layer of granulosa cells without any visible antral spaces were classified as secondary and follicles with clearly visible antral space were classified as antral. Secondary or antral follicles with 10% or more apoptotic granulosa cells were classified as atretic. Apoptotic granulosa cells were identified using the classical morphological criteria; highly condensed, pyknotic or fragment nuclei. To get an estimated amount of growing and atretic follicle number for the whole ovary, raw counts were multiplied by 9 as every ninth section was counted.
Quantification of corpus luteum
Due to the large size of corpus luteum (CL) they can often span across many serial sections. Therefore, in order to avoid miscount, every third 20 µm section was imaged using an Olympus Provis Light microscope with a ×4 magnification. Every section was then analysed to produce a raw count of CLs per ovary that was directly used for analysis.
Anti-Mullerian hormone (AMH) serum ELISA
Serum AMH concentrations were determined using the AMH Gen II ELISA (Beckman Coulter, A73818) according to the manufacturer’s instructions.
Polymerase chain reaction
RNA was extracted from ovarian tissue using the RNeasy Mini Kit (Qiagen, 74104). A Turbo DNA-free kit (Ambion Life Technologies, AM1907) was used to remove any contaminating DNA from the RNA product. Reverse transcription was performed using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, 18080-051). Quantitative PCR (qPCR) analysis was performed in technical triplicate for each biological sample using primers for AMH (forward GACCTCTGACCCAGGCTTC and reverse GGGTCTGACAGGTTGACCA) in addition to housekeeping genes, β-actin (forward CTAAGGCCAACCGTGAAAAG, reverse ACCAGAGGCATACAGGGACA) and GAPDH (forward TCCATGACAACTTTGGCATTG, reverse CAGTCTTCTGGGTGGCAGTGA). Thermocycling was performed on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Relative expression levels were determined using CFX Manager software by normalisation against housekeeping genes
Statistical analysis
Statistical analysis and graph generation for all results was performed using GraphPad Prism 7 software (GraphPad Software). Statistical comparisons that compared one treatment variable (i.e. irradiation or NMN) were performed using a Student’s t-test. Sample distributions that were not parametric were compared using a Mann–Whitney U test. Statistical comparisons that compared one treatment intervention of more than two groups were performed using an ordinary one-way ANOVA with Tukey’s post hoc test for multiple comparisons. Statistical significance was set to P < 0.05. All results are presented as mean ± s.e.m.
Results
NMN supplementation does not protect the ovarian reserve from γ-irradiation
To evaluate the potential ovo-protectant effect of NMN, mice were supplemented with NMN (500 mg/kg) or saline for 8 consecutive days. On the seventh day, mice were exposed to 0.1 Gy of γ-irradiation or no treatment and ovarian morphology assessed and follicle numbers estimated 5 days later (Supplementary Fig. 1).
Overall morphology was grossly similar in all treatment groups, with all stages of follicles present and no overt differences apparent (Fig. 1A). A comparison between non-irradiated control mice receiving saline or NMN, revealed that NMN treatment itself did not alter follicle numbers (Fig. 1B, C, D, E, F and G). In mice that were not supplemented with NMN, a comparison of follicle numbers between untreated controls and γ-irradiated groups confirmed that γ-irradiation reduced the number of primordial follicles, while all other stages of follicle development were not significantly affected (Fig. 1B, C, D, E and F). The number of atretic follicles within the growing follicle population was significantly reduced in by NMN treatment in non-irradiated control animals, but was similar between all other groups (Fig. 1G). Growing follicles produce the hormone AMH, which can be used as a biomarker of growing follicle numbers. We found that ovarian mRNA expression levels for AMH and serum AMH concentrations were not changed by γ-irradiation (Fig. 2A and B). Collectively, these findings are consistent with previous studies indicating that primordial follicles are readily depleted by exposure to γ-irradiation, whereas growing follicles are relatively resistant (Kerr et al. 2012).
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) (A) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) (A) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) (A) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and serum AMH (A) and ovarian AMH mRNA (B) expression determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and serum AMH (A) and ovarian AMH mRNA (B) expression determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and serum AMH (A) and ovarian AMH mRNA (B) expression determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
We next evaluated the ability of NMN to preserve follicle numbers in γ-irradiated mice. Primordial, transitional and primary follicle numbers were significantly lower in the NMN + γ-irradiation group than the NMN + control group (Fig. 1B, C and D). Furthermore, primordial, transitional and primary follicles numbers in the saline + γ-irradiation and NMN + γ-irradiation groups were similar (Fig. 1B, C and D). Thus, NMN supplementation did not protect against the depletion of the primordial and transitional follicle populations caused by γ-irradiation.
Corpora lutea (CL) numbers were also evaluated as an indication of recent ovulation. CLs were observed in all animal and numbers were similar across all groups (Fig. 3A and B).
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and CL (A) numbers determined 5 days later. Data shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CL are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and CL (A) numbers determined 5 days later. Data shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CL are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with whole-body γ-irradiation (0.1 Gy). Mice (n = 5–6/group) were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were untreated (controls) or treated with γ-irradiation (0.1 Gy) and CL (A) numbers determined 5 days later. Data shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CL are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
NMN supplementation does not protect the ovarian reserve from cyclophosphamide
A similar strategy was used to evaluate the potential ovo-protectant effect of NMN against a commonly used chemotherapy drug known to cause depletion of the ovarian reserve and compromise fertility. In this study, mice were supplemented with NMN (500 mg/kg/day) or saline for 8 consecutive days. On the seventh day, mice were exposed to vehicle or cyclophosphamide (150 mg/kg) and ovarian morphology assessed and follicle numbers estimated 5 days later (Supplementary Fig. 1).
Overall morphology was grossly similar in all treatment groups, with all stages of follicles present and no overt differences were apparent (Fig. 4A). A comparison between vehicle-treated control mice receiving saline or NMN revealed that NMN treatment itself did not alter follicle numbers (Fig. 4B, C, D, E, F and G), consistent with our findings in the γ-irradiation study. In mice that were not supplemented with NMN, a comparison of follicle numbers between vehicle-treated controls and cyclophosphamide-treated groups confirmed that cyclophosphamide significantly reduced the number of primordial follicles, while transitional, primary, secondary and antral follicle number were unaffected (Fig. 4B, C, D, E and F). The number of atretic follicles within the growing follicle population was also similar between vehicle-treated saline and NMN groups (Fig. 4G). However, cyclophosphamide treatment significantly increased the number of atretic follicles (Fig. 4G). We found that ovarian mRNA expression levels for AMH and serum AMH concentrations were not changed by cyclophosphamide (Fig. 5A and B). Collectively, these findings are consistent with previous studies indicating that primordial follicles are readily depleted by exposure to cyclophosphamide (Nguyen et al. 2018).
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were or treated with vehicle or cyclophosphamide (A) (150 mg/kg) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers were determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were or treated with vehicle or cyclophosphamide (A) (150 mg/kg) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers were determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
Follicle numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were or treated with vehicle or cyclophosphamide (A) (150 mg/kg) and primordial (B), transitional (C), primary (D), secondary (E), antral (F) and atretic (G) follicle numbers were determined 5 days later. Data are shown as mean ± s.e.m. Bars that do not share a superscript are significantly different from each other, P < 0.05.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and serum AMH (A) and ovarian AMH mRNA (B) expression was determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and serum AMH (A) and ovarian AMH mRNA (B) expression was determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
AMH levels in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and serum AMH (A) and ovarian AMH mRNA (B) expression was determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
We next evaluated the ability of NMN to preserve primordial follicle numbers in cyclophosphamide-treated mice. Primordial follicle numbers were significantly lower in the NMN + cyclophosphamide-treated group than the saline + vehicle group (Fig. 4B). Furthermore, primordial follicle numbers in the saline + cyclophosphamide and NMN + cyclophosphamide groups were similar (Fig. 4B and C). Thus, NMN supplementation did not protect against the depletion of the primordial follicle populations caused by cyclophosphamide. NMN treatment also did not reduce the number of atretic follicles associated with cyclophosphamide treatment (Fig. 4G).
Corpora lutea (CL) numbers were also evaluated as an indication of recent ovulation. CLs were observed in all animal and numbers were similar across all groups (Fig. 6A and B).
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and CL (A) numbers determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CLs are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and CL (A) numbers determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CLs are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
CL numbers in mice supplemented with NMN (500 mg/kg) and treated with cyclophosphamide (150 mg/kg). Mice were supplemented for 8 days with saline or NMN (500 mg/kg/day). On day 7 mice were treated with vehicle or cyclophosphamide (150 mg/kg) and CL (A) numbers determined 5 days later. Data are shown as mean ± s.e.m. No significant differences were observed between groups. (B) Representative images of PAS-stained ovarian sections from each cohort are shown. CLs are circled with a dotted line. Scale bar = 50 μm.
Citation: Reproduction 159, 2; 10.1530/REP-19-0337
Discussion
Improvements in cancer therapy have resulted in an increase in cancer survival rates. While this is favourable, it means that more women are exploring reproductive options following exposure to genotoxic cancer treatments, which may have depleted their ovarian reserve of primordial follicles. In this study, we investigated the possibility that NMN supplementation could protect against depletion of the ovarian reserve caused by γ-irradiation and cyclophosphamide, both of which are known to damage the DNA of primordial follicles oocytes, leading to their apoptosis (Kerr et al. 2012, Nguyen et al. 2018, 2019). However, we found that primordial follicle numbers were not improved in NMN-supplemented mice 5 days after exposure to γ-irradiation or treatment compared to control animals.
Others have previously shown that supplementation of NMN in mice increases hepatic NAD+ concentration, which is associated with reduced DNA damage following γ-irradiation and a decrease in the pathophysiological effects of aging in somatic cells (Li et al. 2017, Rajman et al. 2018). While the underlying mechanisms are unclear, some evidence suggests that the beneficial effects of increasing NAD+ levels are mediated via PARP1, a protein critical for various forms of DNA repair (Li et al. 2017). PARP1 is inhibited by deletion in breast cancer 1 (DCB1), and in turn, DCB1 itself can be inhibited through binding to NAD+ (Li et al. 2017). Consequently, low NAD+ levels leave PARP1 susceptible to inhibition, thereby reducing cellular DNA repair activity. Conversely, when NAD+ concentrations are increased, NAD+ binds to DCB1, freeing PARP1 and thus promoting DNA repair (Li et al. 2017). NAD+ is also important for the Sirtuins, which are protein lysine deacylases that regulate various physiological functions, including the deacetylation of histones, and the control of energy metabolism, cell survival, DNA repair, tissue regeneration, inflammation, neuronal signaling, and circadian rhythms (Rajman et al. 2018). Notably, roles for PARP1, Sirtuins and NAD+ have been described in oocytes, including maintaining meiotic spindle and chromosome integrity during ageing (Qian et al. 2010, Wei et al. 2013, Tatone et al. 2018, Wu et al. 2019). However, in contrast to the previously reported protective effects of NMN against DNA damage and ageing in somatic cells, we found that an 8-day course of NMN pre-treatment did not protect against depletion of primordial follicles caused by γ-irradiation or cyclophosphamide.
One possible explanation for the failure of NMN to prevent primordial follicle depletion caused by DNA-damaging treatment is that the supplementation regimen we used was inadequate. For this study, we mimicked a treatment protocol (500 mg/kg/day) previously shown to increase NAD+ concentration in the testis and liver and protect against γ-irradiation-induced damage in white blood cells, lymphocytes and haemoglobin (Li et al. 2017). Previous studies also show that even a single bolus intraperitoneal dose of NMN (62.5–500 mg/kg) is sufficient to rapidly increase NMN and NAD+ levels in peripheral organs such as the liver, pancreas, white adipose tissue and brain (Yoshino et al. 2011, Peek et al. 2013, Stein & Imai 2014, Toon et al. 2015, Lin et al. 2016, Park et al. 2016, Wei et al. 2017). These previous works strongly suggest our protocol would be effective at raising the intra-ovarian or intra-oocyte concentration of NAD+, but we did not directly confirm this. To do this, an analysis of ovarian NMN and NAD+ levels at the time of genotoxic treatment would be necessary. While the time point we used for this study (4 days after last NMN supplementation) was appropriate for follicle quantification, too much time had passed for NAD+ levels to be meaningful. Thus, alternative study designs, such as varying the dose and treatment length, could be investigated in the future and confirmation of NAD+ levels should be obtained.
There were some limitations associated with this study that should be considered when interpreting or extrapolating the results. Importantly, the finding that NMN was unable to protect primordial follicles from radiation or cyclophosphamide relates only to the specific regimen used in this study. In this study, only one NMN concentration and treatment regimen was used and we were unable to confirm that NMN reached the ovaries in sufficient levels to raise NAD+ levels. It is possible that other treatment protocols will prove effective. Furthermore, only one chemotherapy (cyclophosphamide) was evaluated and NMN may indeed protect primordial follicles from death caused by other chemotherapies. It is also worth noting that the estrous cycle was not assessed in this study because our primary endpoint is follicle number requiring samples to be collected on a specific day after treatment (and thus animals may be at different cycle stages). Finally, the induction and of DNA damage by cyclophosphamide or radiation was not directly assessed in this study and future studies could address this issue.
In conclusion, in this study, we have shown that 500 mg/kg/day NMN does not prevent the depletion of the pool of primordial follicles caused by 0.1 Gy γ-irradiation or 150 mg/kg cyclophosphamide in young adult C57Bl6 mice. While these single exposures significantly deplete follicles, they are in fact relatively mild when compared to multi-cycle therapeutic regimens that may be used clinically, suggesting that NMN at this dose is unlikely to be of therapeutic value. However, future studies are necessary to determine if increasing NMN dose or frequency of delivery will protect the follicular pool from depletion caused by radiation or cyclophosphamide exposure, or if NMN has the capacity to protect against other genotoxic agents, such as cisplatin.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-19-0337.
Declaration of interest
K H is on the editorial board of Reproduction. K H was not involved in the review or editorial process for this paper, on which she is listed as an author. The other authors have nothing to disclose.
Funding
This work was supported by the National Health and Medical Research Council (K H) (#1050130, 1100219). This work was made possible through Victorian State Government Operational Infrastructure Support and Australian Government NHMRC IRIISS.
Author contribution statement
J S, E G and S L performed experiment, analysed data and prepared the figures. K H conceived the study and wrote the paper.
References
Faddy MJ & Gosden RG 1995 A mathematical model of follicle dynamics in the human ovary. Human Reproduction 770–775. (https://doi.org/10.1093/oxfordjournals.humrep.a136036)
Faddy M & Gosden R 2007 Numbers of ovarian follicles and testing germ line renewal in the postnatal ovary: facts and fallacies. Cell Cycle 1951–1952. (https://doi.org/10.4161/cc.6.15.4517)
Findlay JK, Hutt KJ, Hickey M & Anderson RA 2015 How is the number of primordial follicles in the ovarian reserve established? Biology of Reproduction 111. (https://doi.org/10.1095/biolreprod.115.133652)
Goldman KN, Chenette D, Arju R, Duncan FE, Keefe DL, Grifo JA & Schneider RJ 2017 mTORC1/2 inhibition preserves ovarian function and fertility during genotoxic chemotherapy. PNAS 3186–3191. (https://doi.org/10.1073/pnas.1617233114)
Guan Y, Wang SR, Huang XZ, Xie QH, Xu YY, Shang D & Hao CM 2017 Nicotinamide mononucleotide, an NAD(+) precursor, rescues age-associated susceptibility to AKI in a sirtuin 1-dependent manner. Journal of the American Society of Nephrology 2337–2352. (https://doi.org/10.1681/ASN.2016040385)
Hsueh AJ, Kawamura K, Cheng Y & Fauser BC 2015 Intraovarian control of early folliculogenesis. Endocrine Reviews 1–24. (https://doi.org/10.1210/er.2014-1020)
Hutt KJ, McLaughlin EA & Holland MK 2006 Primordial follicle activation and follicular development in the juvenile rabbit ovary. Cell and Tissue Research 809–822. (https://doi.org/10.1007/s00441-006-0223-3)
Imai S & Guarente L 2014 NAD+ and sirtuins in aging and disease. Trends in Cell Biology 464–471. (https://doi.org/10.1016/j.tcb.2014.04.002)
Kerr JB, Hutt KJ, Michalak EM, Cook M, Vandenberg CJ, Liew SH, Bouillet P, Mills A, Scott CL & Findlay JK et al.2012 DNA damage-induced primordial follicle oocyte apoptosis and loss of fertility require TAp63-mediated induction of Puma and noxa. Molecular Cell 343–352. (https://doi.org/10.1016/j.molcel.2012.08.017)
Kim SY, Cordeiro MH, Serna VA, Ebbert K, Butler LM, Sinha S, Mills AA, Woodruff TK & Kurita T 2013 Rescue of platinum-damaged oocytes from programmed cell death through inactivation of the p53 family signaling network. Cell Death and Differentiation 987–997. (https://doi.org/10.1038/cdd.2013.31)
Li J, Bonkowski MS, Moniot S, Zhang D, Hubbard BP, Ling AJ, Rajman LA, Qin B, Lou Z & Gorbunova V et al.2017 A conserved NAD(+) binding pocket that regulates protein-protein interactions during aging. Science 1312–1317. (https://doi.org/10.1126/science.aad8242)
Lin JB, Kubota S, Ban N, Yoshida M, Santeford A, Sene A, Nakamura R, Zapata N, Kubota M & Tsubota K et al.2016 NAMPT-mediated NAD(+) biosynthesis is essential for vision in mice. Cell Reports 69–85. (https://doi.org/10.1016/j.celrep.2016.08.073)
Livera G, Petre-Lazar B, Guerquin MJ, Trautmann E, Coffigny H & Habert R 2008 p63 null mutation protects mouse oocytes from radio-induced apoptosis. Reproduction 3–12. (https://doi.org/10.1530/REP-07-0054)
Myers M, Britt KL, Wreford NG, Ebling FJ & Kerr JB 2004 Methods for quantifying follicular numbers within the mouse ovary. Reproduction 569–580. (https://doi.org/10.1530/rep.1.00095)
Nguyen QN, Zerafa N, Liew SH, Morgan FH, Strasser A, Scott CL, Findlay JK, Hickey M & Hutt KJ 2018 Loss of PUMA protects the ovarian reserve during DNA-damaging chemotherapy and preserves fertility. Cell Death and Disease 618. (https://doi.org/10.1038/s41419-018-0633-7)
Nguyen QN, Zerafa N, Liew SH, Findlay JK, Hickey M & Hutt KJ 2019 Cisplatin- and cyclophosphamide-induced primordial follicle depletion is caused by direct damage to oocytes. Molecular Human Reproduction 433–444. (https://doi.org/10.1093/molehr/gaz020)
Park JH, Long A, Owens K & Kristian T 2016 Nicotinamide mononucleotide inhibits post-ischemic NAD(+) degradation and dramatically ameliorates brain damage following global cerebral ischemia. Neurobiology of Disease 102–110. (https://doi.org/10.1016/j.nbd.2016.07.018)
Peek CB, Affinati AH, Ramsey KM, Kuo HY, Yu W, Sena LA, Ilkayeva O, Marcheva B, Kobayashi Y & Omura C et al.2013 Circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice. Science 1243417. (https://doi.org/10.1126/science.1243417)
Qian H, Xu J, Lalioti MD, Gulle K & Sakkas D 2010 Oocyte numbers in the mouse increase after treatment with 5-aminoisoquinolinone: a potent inhibitor of poly(ADP-ribosyl)ation. Biology of Reproduction 1000–1007. (https://doi.org/10.1095/biolreprod.109.080697)
Rajman L, Chwalek K & Sinclair DA 2018 Therapeutic potential of NAD-boosting molecules: the in vivo evidence. Cell Metabolism 529–547. (https://doi.org/10.1016/j.cmet.2018.02.011)
Shuster LT, Rhodes DJ, Gostout BS, Grossardt BR & Rocca WA 2010 Premature menopause or early menopause: long-term health consequences. Maturitas 161–166. (https://doi.org/10.1016/j.maturitas.2009.08.003)
Stein LR & Imai S 2014 Specific ablation of Nampt in adult neural stem cells recapitulates their functional defects during aging. EMBO Journal 1321–1340. (https://doi.org/10.1002/embj.201386917)
Suh EK, Yang A, Kettenbach A, Bamberger C, Michaelis AH, Zhu Z, Elvin JA, Bronson RT, Crum CP & McKeon F 2006 p63 protects the female germ line during meiotic arrest. Nature 624–628. (https://doi.org/10.1038/nature05337)
Tatone C, Di Emidio G, Vitti M, Di Carlo M, Santini S Jr, D’Alessandro AM, Falone S & Amicarelli F 2015 Sirtuin functions in female fertility: possible role in oxidative stress and aging. Oxidative Medicine and Cellular Longevity 659687. (https://doi.org/10.1155/2015/659687)
Tatone C, Di Emidio G, Barbonetti A, Carta G, Luciano AM, Falone S & Amicarelli F 2018 Sirtuins in gamete biology and reproductive physiology: emerging roles and therapeutic potential in female and male infertility. Human Reproduction Update 267–289. (https://doi.org/10.1093/humupd/dmy003)
Tuppi M, Kehrloesser S, Coutandin DW, Rossi V, Luh LM, Strubel A, Hötte K, Hoffmeister M, Schäfer B & De Oliveira T et al.2018 Oocyte DNA damage quality control requires consecutive interplay of CHK2 and CK1 to activate p63. Nature Structural and Molecular Biology 261–269. (https://doi.org/10.1038/s41594-018-0035-7)
Wei Q, Ding W & Shi F 2013 Roles of poly (ADP-ribose) polymerase (PARP1) cleavage in the ovaries of fetal, neonatal, and adult pigs. Reproduction 593–602. (https://doi.org/10.1530/REP-13-0174)
Wei CC, Kong YY, Hua X, Li GQ, Zheng SL, Cheng MH, Wang P & Miao CY 2017 NAD replenishment with nicotinamide mononucleotide protects blood-brain barrier integrity and attenuates delayed tissue plasminogen activator-induced haemorrhagic transformation after cerebral ischaemia. British Journal of Pharmacology 3823–3836. (https://doi.org/10.1111/bph.13979)
Wu X, Hu F, Zeng J, Han L, Qiu D, Wang H, Ge J, Ying X & Wang Q 2019 NMNAT2-mediated NAD(+) generation is essential for quality control of aged oocytes. Aging Cell e12955. (https://doi.org/10.1111/acel.12955)
Yoon MJ, Yoshida M, Johnson S, Takikawa A, Usui I, Tobe K, Nakagawa T, Yoshino J & Imai S 2015 SIRT1-mediated eNAMPT secretion from adipose tissue regulates hypothalamic NAD+ and function in mice. Cell Metabolism 706–717. (https://doi.org/10.1016/j.cmet.2015.04.002)
Yoshino J, Mills KF, Yoon MJ & Imai S 2011 Nicotinamide mononucleotide, a key NAD(+) intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell Metabolism 528–536. (https://doi.org/10.1016/j.cmet.2011.08.014)
