Abstract
A favorable outcome of pregnancy depends greatly on an adequate balance of immune protection and fetal tolerance at the fetomaternal interface. IL-21 is a pro-inflammatory cytokine associated with altering immune responses in autoimmune diseases. IL-21 has pleiotropic functions, including induction of Th17 T cells, inhibition of Treg development, and modulation of antibody responses of B lymphocytes. Genetic polymorphisms of IL21 have been associated to poor pregnancy outcomes. However, the mechanism of IL-21 actions needs further evaluation. Here, we postulate that IL-21 affects splenic B cell function during pregnancy and shapes immune responses. We show that splenic B cells from CBA/J × BALB/c mice with favorable pregnancy outcome expressed lower IL21R levels than in CBA/J × DBA/2J mice, a mouse model for immune-induced bad pregnancy outcome. As a consequence, B cells from CBA/J × BALB/c mice reacted less sensitively to IL-21 than B cells from non-pregnant mice (NPM) or from CBA/J × DBA/2J mice. Also, LPS-induced apoptotic rates were altered in NPM and CBA/J × DBA/2J but not in CBA/J × BALB/c mice. This is accompanied by improved survival of B cells that produce the anti-inflammatory cytokine IL-10 upon stimulation with LPS. We also observed lower numbers of CD4+CXCR5+Bcl-6+ follicular T-helper cells (Tfh) in normal pregnant mice, compared to non-pregnant and mice with disturbed pregnancies. Our data indicate that alterations of the Tfh/IL-21/IL-10 axis may have important influence on pregnancy outcome.
Introduction
Interleukin-21 (IL-21) is a type I cytokine and member of the γc-dependent cytokine family. It is produced by activated T helper cells and NK cells (Ozaki et al. 2000, Parrish-Novak et al. 2000, Asao et al. 2001). Its receptors are expressed on T, NK cells, and predominantly on activated B cells (Parrish-Novak et al. 2000, Mehta et al. 2004). Multiple IL-21-mediated effects on those cells have been demonstrated in vitro (Collins et al. 2003). IL-21 receptor knock-out (IL-21R-/-) mice, however, do not display obvious signs of disease and conserve normal lymphocyte development (Kasaian et al. 2002, Ozaki et al. 2002). Additionally, IL-21R-/- mice respond weakly to immunization in terms of CD8+ T cell expansion, IgG1, and IgE production (Ozaki et al. 2002). The lack of IL-21R also means protection against autoimmune disorders in mouse models of autoimmunity, diabetes type I, myocarditis, and transplantation (Bubier et al. 2009, McGuire et al. 2011, Iwamoto et al. 2014, Shi et al. 2016, Yang et al. 2017).
The effect of IL-21 on B cells is complex and depends on the type of the antigen stimulation and T-helper signals (Jin et al. 2004, Mehta et al. 2004). While innate signals like lipopolysaccharide (LPS) and CpG induce growth arrest and apoptosis, T helper dependent B cell receptor (BCR) signaling favors B cell proliferation and promotes antibody responses and class switching (Ozaki et al. 2002, Jin et al. 2004). IL-21 is also an important determinant of the proportions of marginal zone (MZ) respect to follicular zone (FO) splenic B cells (Tortola et al. 2010).
The IL21 gene has been suggested as susceptibility locus for immune disorders such as SLE and juvenile idiopathic arthritis (Sawalha et al. 2008, Thompson et al. 2010). Further, polymorphic alleles have been associated with recurrent spontaneous miscarriage (Messaoudi et al. 2011).
Although the role of IL-21 during pregnancy has not been deeply investigated, its pro-inflammatory nature suggests a possible implication on T-helper Th1/Th17 balance. Pregnancy success is associated to a switch to Th2 responses, while predominant Th1 and Th17 responses are linked to poor pregnancy outcome (Lin et al. 1993, Raghupathy 1997). This phenomenon has been also replicated in mouse models as the CBA/J × DBA/2J matings (Clark et al. 1986, Raghupathy 1997). In this case, fetal resorptions are a consequence of an immune rejection against paternal antigens accompanied by a failure in regulatory T cell (Treg) generation (Clark et al. 1986, 2004). Additionally, the pro-inflammatory Th1/Th17 types' responsiveness is increased in maternal CBA/J T cells, which has been observed to be primed by microbiota derived LPS (Clark et al. 2003).
It has been also demonstrated that B cells undergo changes during normal pregnant mice (CBA/J × BALB/c) but differ in the CBA/J × DBA/2J mice (Clark et al. 1980, Ahmed et al. 2010). B cells of normal pregnancies adopt a tolerogenic phenotype, with lower antigen-presenting capacity, higher IL-10 production, and a switch to T-independent responses driven by MZ B cells compared to B cells from disturbed pregnancies (Jensen et al. 2013, Muzzio et al. 2014a , 2016, Einenkel et al. 2019a ).
The predominant pro-inflammatory tone of CBA/J × DBA/2J pregnancies accounts for several of the phenotypic properties observed. As a pro-inflammatory cytokine, IL-21 is known to control several aspects of B cell functionality which are also affected in CBA/J × DBA/2J pregnancies. This includes IL-10 production, antibody secretion, the MZ/FO B cell proportions, and expression of many surface molecules. Taking this into account, we used the CBA/J × DBA/2J mouse model to study the IL-21/IL-21R pathway in splenic B cells during pregnancy.
Materials and methods
Animals
CBA/J (H2k) female and DBA/2J (H2d) male mice were purchased from Charles River or Janvier Labs (Saint-Berthevin Cedex, France). BALB/c (H2d) males were bred in our Central Service and Research Facility for Animals (ZSFV). The animals were kept co-housed in a 12 h light:12 h darkness cycle with food and water available ad libitum. Eight- to twelve-week-old CBA/J female mice were either paired with DBA/2J males, to obtain immune-induced pathological pregnancies, or with BALB/c males, to generate normal pregnancies. In CBA/J × DBA/2J pregnancies, fetal resorptions are caused by an immune rejection against paternal antigens (Clark et al. 1986). Surviving fetuses show significant growth restriction (Girardi et al. 2006). CBA/J × DBA/2J pregnancies are also characterized by increased pro-inflammatory cytokines that contribute to the disturbed phenotype (Clark et al. 1998). After mating, mice were checked for vaginal plug every morning. Observation of plug was declared day 0 of pregnancy, and the female was separated from the male. Mice were killed at day 14 post plug (14 dpp); spleen was collected. The uterus was extracted and the pregnancy outcome was documented. Non-pregnant CBA/J female mice were randomly killed and used as control (NPM).
Human samples were obtained from healthy pregnant donors during routine controls by the medical staff of the Clinic of Obstetrics and Gynecology. Blood from non-pregnant woman was obtained in the context of blood donation. The absence of infections was checked by medical staff as part of the routine. Only women in reproductive age were included in the study.
Cell preparation
Single cell suspensions from spleen were obtained. The tissue was carefully squeezed through a 40 μm nylon cell strainer and washed with PBS. An erythrocyte lysis with 10 mL Lysis Buffer (0.89% NH4Cl, 0.1% KHCO3, and 0.003% EDTA) was performed and stopped after 5 min with 3 mL FBS. After washing, the cell suspension was filtered a second time with a 40 μm cell strainer. The cell counts of the suspensions were determined using a Neubauer chamber.
Human samples were processed immediately after collection. Peripheral blood mononuclear cells (PBMCs) were isolated using density gradient (Lymphoprep, Stemcell; Oslo, Norway). CD3+ cells were then isolated by positive selection using EasySep human CD3+ T-Cell isolation kit, purchased from STEMCELL Technologies (Vancouver, BC, Canada).
Flow cytometry
The following anti-mouse antibodies were used: CXCR5 (2G8), IL-21 Receptor (4A9), CD4 (RM4-4), CD19 (1D3), CD21/CD35 (7G6), CXCR5 (2Gb), B220 (RA3-6B2), and CD23 (B3B4), purchased from BD Biosciences (Heidelberg, Germany). PD-1 (RMP1-30) was purchased from eBioscience (Darmstadt, Germany).
For human samples, following antibodies were used: CXCR5 (RF8B2), CD4 (SK3), Bcl-6 (K112-91), PD-1 (EH12.1), ICOS (DX29) from BD Biosciences (Heidelberg, Germany).
Flow cytometry was applied to evaluate the expression of IL-21 receptor (IL-21R) and activation markers on B cells from spleen, as well as for the distribution of murine and human Tfh. Cell suspensions were first stained with Fixable Viability Dye (eBioscience, San Diego, CA, USA) for 30 min and later washed with FACS buffer (1% BSA, 0.1% NaN3, and 0.955% PBS). Samples were then incubated with CD16/32 mAb Fc block (BD Pharmingen, Heidelberg, Germany) for 5 min on ice. Staining with fluorochrome-labeled specific antibodies was performed for 30 min at 4°C in the dark. Characterization of Tfh required intracellular staining. Samples were fixed in Fixation and Permeabilization solution (BD Pharmingen, Heidelberg, Germany), permeabilized adding the Perm/ Wash buffer (BD Pharmingen, Heidelberg, Germany), and finally incubated with specific antibodies against Bcl-6 or ICOS.
Data were acquired on FACSCanto (BD Biosciences) and analyzed by using FlowJo software (FlowJo, LLC, Ashland, TN, USA). Information about gating strategies is provided in Supplementary Figs 1, 2, and 4 (see section on supplementary materials given at the end of this article).
Cell isolation and stimulation
PBS, FBS, PenStrep, PMA, and RPMI 1640 were purchased from Merck Millipore and LPS from Sigma-Aldrich Chemie GmbH (Munich, Germany).
To assess their sensitivity to IL-21, CD19+ cells were first isolated using CD19 mouse MicroBeads (Miltenyi Biotec GmbH, Teterow, Germany). Supplier’s instructions were followed. MACS buffer was prepared in-house (0.5% BSA, 0.4% 0.5 M EDTA in PBS).
0.25 × 106 splenic lymphocytes were cultured in 500 μL RPMI 1640 culture medium supplemented with 10% FBS and antibiotics on 48-well flat-bottom suspension plates. Apoptosis was assessed by a method published by Nicoletti et al. (1991) after 24 h. Cell proliferation, cell death, and mRNA levels were assessed after 48 h of culture. The stimulation was performed with either 10 μg/mL LPS 0111:B4 (Sigma-Aldrich Chemie GmbH, Munich, Germany), 1 μg/mL anti-CD40 3/23 (BD Pharmingen, Heidelberg, Germany), or 1 μg/mL anti-IgM (F(ab´)2 Anti-Mouse IgM; eBioscience, Darmstadt, Germany), the latter to mimick B cell receptor (BCR) activation. In order to examine the influence of IL-21 on treated B cells, cells were stimulated with 30 ng/mL recombinant IL-21 (BioLegend; Koblenz, Germany). After stimulation, cells and supernatants were separated by 5 min centrifugation at 1300 g . The supernatants were stored at −80°C, and the cells were directly used for Flow Cytometry.
Determination of cell cycle phase and apoptosis
After treatment, CD19+ cells were harvested, washed, and resuspended in 5 µg/mL propidium iodide (PI) (Sigma-Aldrich) in hypotonic solution (0.1% sodium citrate, 0.1% Triton-X-100), following a method based on a previously published protocol by Nicolletti et al. (Nicoletti et al. 1991). Samples were measured within 15 min by flow cytometry. Apoptotic nuclei display lower PI signal and are detected left on the histograms. Nuclei from proliferating cells (in the G2/M + S phases of the cell cycle) show higher PI staining and are detected on the right part of the histograms.
Determination of cell proliferation
Magnetically isolated splenic CD19+ cells were stained with 1 µM carboxyfluorescein succinimidyl ester (CFSE) for 10 min at room temperature. The staining was stopped with 5% FBS in PBS and followed by 5 min incubation on ice. Cells were washed three times using 5% FBS in PBS and used for in vitro experiments. Samples were measured by flow cytometry before and after the treatment, and the mean fluorescence intensity (MFI) of the CFSE signal was analyzed.
Cytokine and immunoglobulin production
The level of IL-10 in supernatants of 24-h and 48-h stimulated B cells were measured using an ELISA kit for IL-10 (DuoSet ELISA Development System). The test was performed following the instruction manual.
To characterize the Ig profile in the supernatant of 24 h stimulated B cells, we used the ProcartaPlex Mouse Antibody Isotyping Panel 7-Plex (eBioscience; Darmstadt, Germany) following the instruction manual.
Real-time PCR
Magnetic isolated splenic CD19+ B cells were treated with TriFast™ peqGOLD (VWR, Radnor, PA, USA). RNA isolation, cDNA synthesis, and real-time PCR were performed as previously described (Doster et al. 2016, Packhäuser et al. 2017). RNA concentration was evaluated spectrophotometrically using the NanoPhotometer PEARL (IMPLEN, Munich, Germany). RNA was reverse-transcribed by using the High Capacity cDNA Archive Kit (Applied Biosystems). Samples were amplified in duplicate and non-template samples were used as controls. Primer pairs were chosen to span an exon–exon junction and so avoided unwanted genomic DNA amplification. Real-time PCR was performed using SYBR® Green (AB/Life Technologies, Darmstadt, Germany) in a 7300 Real-time PCR System (Applied Biosystems) with Actb as housekeeping gene. Primer sequences were the following: Actb Fw: TGGAATCCTGTGGCATCCATGAAAC; Actb Rv: TAAAACGCAGCTCAGTAACAGTCC; Il10 Fw: GAAGACCCTCAGGATGCGG; Il10 Rv: CCTGCTCCACTGCCTTGC; (Eurofines Genomics; Ebersberg, Germany).
Statistical analysis
IL-21 treatment data are being presented as percentage normalized to the mean of respective untreated controls. Means of treated vs untreated groups were analyzed using Student’s t-test. Normality was assessed by D’Agostino and Pearson omnibus normality test. MFI-data from IL-21R expression and murine Tfh counts were analyzed using Kruskal–Wallis test with Dunn’s posttest. Human data was analyzed by ANOVA followed by Dunnett’s posttest. Significant differences between groups were indicated with asterisks as follows: *P < 0.05; **P < 0.01; and ***P < 0.001. Data shown in the manuscript as normalized are provided as absolute numbers or percentages in the Supplementary Figs 1 and 3.
LPS-mediated apoptosis and cell death are differentially affected by IL-21 on splenic B cells from non-pregnant mice (NPM), CBA/J × BALB/c or CBA/J × DBA/2J mice. Magnetically isolated CD19+ B cells were examined for IL-21 responses under stimulation with LPS (left) and antibodies against CD40 (middle) or anti-IgM (right) during 24 h (B and C) or 48 h (A and D). Cell death (A), apoptosis (B), and cell proliferation (C: cells in the G2/S+M phases of cell cycle; D: loss of CFSE signal intensity) were assessed by flow cytometry. White, light gray, and dark gray bars represent non-pregnant (n = 5), BALB/c paired (n = 5), and DBA/2J paired (n = 9) CBA/J mice, respectively. Data are presented as relative percentage respect to untreated (w/o IL-21) controls. Gating strategies and raw data are provided as supplementary material. All experiments were performed in duplicate. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Significant differences are indicated (*P ≤ 0.05 and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
LPS-mediated apoptosis and cell death are differentially affected by IL-21 on splenic B cells from non-pregnant mice (NPM), CBA/J × BALB/c or CBA/J × DBA/2J mice. Magnetically isolated CD19+ B cells were examined for IL-21 responses under stimulation with LPS (left) and antibodies against CD40 (middle) or anti-IgM (right) during 24 h (B and C) or 48 h (A and D). Cell death (A), apoptosis (B), and cell proliferation (C: cells in the G2/S+M phases of cell cycle; D: loss of CFSE signal intensity) were assessed by flow cytometry. White, light gray, and dark gray bars represent non-pregnant (n = 5), BALB/c paired (n = 5), and DBA/2J paired (n = 9) CBA/J mice, respectively. Data are presented as relative percentage respect to untreated (w/o IL-21) controls. Gating strategies and raw data are provided as supplementary material. All experiments were performed in duplicate. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Significant differences are indicated (*P ≤ 0.05 and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
LPS-mediated apoptosis and cell death are differentially affected by IL-21 on splenic B cells from non-pregnant mice (NPM), CBA/J × BALB/c or CBA/J × DBA/2J mice. Magnetically isolated CD19+ B cells were examined for IL-21 responses under stimulation with LPS (left) and antibodies against CD40 (middle) or anti-IgM (right) during 24 h (B and C) or 48 h (A and D). Cell death (A), apoptosis (B), and cell proliferation (C: cells in the G2/S+M phases of cell cycle; D: loss of CFSE signal intensity) were assessed by flow cytometry. White, light gray, and dark gray bars represent non-pregnant (n = 5), BALB/c paired (n = 5), and DBA/2J paired (n = 9) CBA/J mice, respectively. Data are presented as relative percentage respect to untreated (w/o IL-21) controls. Gating strategies and raw data are provided as supplementary material. All experiments were performed in duplicate. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Significant differences are indicated (*P ≤ 0.05 and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
Results
IL-21 promotes LPS-mediated cell death on B cells from pregnant mice
Taking into account the effects of IL-21 on the effector function of B cells, we investigated the effect of the cytokine on CD19+ isolated B cells from pregnant and non-pregnant CBA/J mice. First, the effect of IL-21 on B cell death (assessed as percentage of cells that took up a viability dye) was analyzed. We did not observe a significant induction of cell death by IL-21 on LPS-treated B cells from NPM. However, B cells from pregnant mice experienced significant increments of cell death upon treatment with LPS and IL-21 (147.6 ± 25.09 and 151.4 ± 6.951% for CBA/J × BALB/c and CBA/J × DBA/2J mice, respectively; Fig. 1A, left).
Other than LPS stimulation, treatment of IL-21 upon CD40 engagement using anti-CD40 antibody leads to significantly lower percentages of B cell death in NPM (80.79 ± 7.130% of control), but not in pregnant mice (Fig. 1A, middle).
Using an anti-IgM antibody, BCR responses to cell death were also evaluated in the presence or absence of IL-21. The cytokine was able to significantly reduce the proportion of dead cells in non-pregnant (64.04 ± 9.756%) as well as in pregnant mice (74.54 ± 11.42 and 63.25 ± 3.012% in CBA/J × BALB/c and CBA/J × DBA/2J mice, respectively; Fig. 1A, right).
IL-21 promotes LPS-mediated apoptosis in B cells from NPM and CBA/J × DBA/2J but not from CBA/J × BALB/c mice
To gain more insights of the pathway leading to cell death after 48 h of treatment with IL-21, we analyzed apoptosis in response to IL-21 after 24 h of treatment in vitro. Depending on the stimulatory and co-stimulatory signals, IL-21 can induce apoptosis of B cells (Jin et al. 2004). We found that treatment with IL-21 induced apoptosis in LPS-treated B cells from NP mice and CBA/J × DBA/2J mice (348.6 ± 24.06 and 365 ± 48.23%, respectively; Fig. 1B, left). However, no significant differences were observed in the case of CBA/J × BALB/c mice, whose percentage (135.4 ± 39.37) was significantly lower than those observed in the other groups (P < 0.05 and P < 0.001).
When we evaluated the effect of IL-21 upon CD40 engagement, no significant differences were observed between IL-21 treated and non-treated B cells stimulated with anti-CD40 (Fig. 1B, middle).
IL-21 treatment of anti-IgM stimulated B cells (Fig. 1C, right) resulted in significantly lower proportions of apoptotic B cells in the case of CBA/J × BALB/c mice (62.41 ± 10.84%) and especially in CBA/J × DBA/2J mice (53.00 ± 5.074%).
IL-21 treatment does not influence cell proliferation of B cells from NPM and CBA/J × BALB/c mice
We extended our study of IL-21 effect on B cell life cycle by analyzing cell proliferation after 24 h (Fig. 1C) and 48 h (Fig. 1D). We did not observe any significant differences between IL-21 treated and non-treated B cells of any group under stimulation with LPS or anti-CD40 using after 24 h. After 48 h, we observed a mild promotion of B cell proliferation in CBA/J × DBA/2J mice (92.31 ± 13.34% of CFSE MFI compared to the control; Fig. 1D, left). Treatment with IL-21 influenced cell proliferation of anti-IgM stimulated B cells, with a significant reduction of proliferation on B cells from CBA/J × BALB/c mice (68.15 ± 10.19%, P < 0.05 by Nicoletti’s method; Fig. 1C, right) and especially CBA/J × DBA/2J mice after 24 and 48 h (60.66 ± 6.420%, P < 0.001 by Nicoletti’s method and 224 ± 21.24%, P < 0.05 by CFSE staining compared to controls; Fig. 1C and D, right).
IL-21 treatment alters antigen presentation capacity of splenic B cells depending on the type of stimulation
Since B cells from CBA/J × DBA/2J are thought to activate Th17 responses through antigen presentation and differential expression of co-stimulatory molecules (Muzzio et al. 2014b ), we wondered how IL-21 influenced these characteristics in the three groups of mice (Supplementary Fig. 2).
When stimulated with LPS, IL-21 treated cells of all groups of mice showed significant reductions of the expression of CD69, CD80, and CD86 molecules. In contrast, the expression of the major histocompatibility molecule type II (MHCII) was increased in all groups of mice. Interestingly, the highest relative increment was observed in CBA/J × DBA/2J mice (Supplementary Fig. 2D). MHCII, on the other hand, was reduced after IL-21 treatment of anti-CD40 stimulated cells, and no significant effect was observed in anti-IgM treated cells.
Similar to the stimulation with LPS, IL-21 treatment reduced CD86 expression of anti-CD40 stimulated cells (Supplementary Fig. 2H). However, IL-21 induced an increment of CD86 expression when anti-IgM antibody was present. Finally, the effect of IL-21 on CD69 and CD80 was less evident in anti-CD40 and anti-IgM treated cells than with LPS treatment (Supplementary Fig. 2B and E).
IL-21 induces Ig production especially in B cells from CBA/J × DBA/2J mice
We moved forward to evaluate the effect of IL-21 on B cell secretory function. We first characterized the Ig profile of the supernatants of IL-21 treatments with different stimulants (Fig. 2A). Under LPS stimulation, treatment with IL-21 induced a significantly higher Ig release in mice with disturbed pregnancy, but not in non-pregnant or CBA/J × BALB/c mice (153.9 ± 20.98% for IgG1, 181.3 ± 38.73% for IgG2a, 232.6 ± 69.91% for IgG2b, 226.0 ± 62.67% for IgG3, 156.5 ± 21.71% for IgA, and 164.1 ± 27.66% for IgM). The treatment also induced higher release of IgE in both groups of pregnant mice (145.4 ± 36.29% in CBA/J × BALB/c mice and 170.3 ± 22.79% in mice with disturbed pregnancy).
IL-21 induces Ig secretion mainly on CBA/J × DBA/2J mice and IL-10 production on CBA/J × BALB/c mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. Immunoglobulin and IL-10 production of magnetically isolated splenic CD19+ B cells after treatment with LPS and the presence or absence of IL-21. (A) Bars display immunoglobulin levels on supernatants of stimulated B cells presented as relative percentage respect to untreated (w/o IL-21) controls after 24 h. (B) Bars represent IL-10 measured on supernatants of cell culture after 24 h (plain bars) and 48 h (striped bars) of stimulation. (C) Bars show Il10 mRNA levels from treated B cells after 48 h. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Supernatants are representative of five non-pregnant, five BALB/c paired, and nine DBA/2J paired CBA/J mice. mRNA is representative of ten non-pregnant, eight BALB/c paired, and seven DBA/2J paired CBA/J mice. All experiments were performed in duplicate. Raw data from (A) are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
IL-21 induces Ig secretion mainly on CBA/J × DBA/2J mice and IL-10 production on CBA/J × BALB/c mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. Immunoglobulin and IL-10 production of magnetically isolated splenic CD19+ B cells after treatment with LPS and the presence or absence of IL-21. (A) Bars display immunoglobulin levels on supernatants of stimulated B cells presented as relative percentage respect to untreated (w/o IL-21) controls after 24 h. (B) Bars represent IL-10 measured on supernatants of cell culture after 24 h (plain bars) and 48 h (striped bars) of stimulation. (C) Bars show Il10 mRNA levels from treated B cells after 48 h. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Supernatants are representative of five non-pregnant, five BALB/c paired, and nine DBA/2J paired CBA/J mice. mRNA is representative of ten non-pregnant, eight BALB/c paired, and seven DBA/2J paired CBA/J mice. All experiments were performed in duplicate. Raw data from (A) are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
IL-21 induces Ig secretion mainly on CBA/J × DBA/2J mice and IL-10 production on CBA/J × BALB/c mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. Immunoglobulin and IL-10 production of magnetically isolated splenic CD19+ B cells after treatment with LPS and the presence or absence of IL-21. (A) Bars display immunoglobulin levels on supernatants of stimulated B cells presented as relative percentage respect to untreated (w/o IL-21) controls after 24 h. (B) Bars represent IL-10 measured on supernatants of cell culture after 24 h (plain bars) and 48 h (striped bars) of stimulation. (C) Bars show Il10 mRNA levels from treated B cells after 48 h. Data were statistically analyzed by paired Student’s t-test and displayed as mean ± s.e.m. Supernatants are representative of five non-pregnant, five BALB/c paired, and nine DBA/2J paired CBA/J mice. mRNA is representative of ten non-pregnant, eight BALB/c paired, and seven DBA/2J paired CBA/J mice. All experiments were performed in duplicate. Raw data from (A) are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
IL-10 expression is promoted after treatment with IL-21 in CBA/J × BALB/c but not in CBA/J × DBA/2J mice
Given the influence of IL-21 in the IL-10 production on B and T cells (Bubier et al. 2009, Yoshizaki et al. 2012) and the very well-studied role of IL-10 on pregnancy success (Chatterjee et al. 2014, Cheng & Sharma 2015), we aimed to evaluate the effect of IL-21 treatment on IL-10 production on B cells from pregnant and non-pregnant mice (Fig. 2B and C). Considering that LPS is a strong stimulus for IL-10 production on B cells, we analyzed the supernatants of 24-h and 48-h stimulated B cells in the presence or the absence of IL-21. As expected, time-dependent LPS stimulation of B cells led to an increased accumulation of IL-10 in the supernatants (~9, ~18, and ~4 fold for non-pregnant mice, CBA/J × BALB/c mice, and mice with disturbed pregnancies, respectively). However, in the presence of IL-21, only supernatants from B cells of CBA/J × BALB/c mice underwent a significant increment of IL-10 accumulation upon LPS treatment (from 40.53 ± 10.66 pg/mL after 24 h to 153.4 ± 24.56 pg/mL after 48 h stimulation: Fig. 2B).
In all groups of mice, treatment with IL-21 induced a significant accumulation of IL-10 in the supernatants after 24 h (2.6-fold for NPM, P < 0.05; 2.2-fold for CBA/J × BALB/c, P < 0.05; and 1.4-fold in CBA/J × DBA/2J mice, P < 0.01), but induced a significant slowdown after 48 h (0.42-fold for NPM, P < 0.05; 0.46-fold for CBA/J × BALB/c, P < 0.01; and 0.62-fold for CBA/J × DBA/2J mice, P < 0.05). The fact that, under IL-21 treatment, IL-10 accumulation over time was still significant in CBA/J × BALB/c, we wondered if IL-10 producing cells were preferably maintained. Interestingly, after 48 h of treatment we could not observe any increment in Il10 mRNA levels in B cells from CBA/J × DBA/2J mice. In non-pregnant and CBA/J × BALB/c, the ability of IL-21 to increase Il10 expression remained intact (228.8 ± 50.16 and 244.0 ± 28.89% compared to respective controls; Fig. 2C).
B cell expression of IL-21R is higher in CBA/J × DBA/2J than in CBA/J × BALB/c mice
Considering the different sensitivities of the B cells from the different groups of mice toward IL-21, we wondered if different IL-21 receptor (IL-21R) expression levels could account for these observations. We observed that B cells from CBA/J × BALB/c mice expressed lower levels of IL-21R than CBA/J × DBA/2J mice (8.991 ± 1.681 vs 23.62 ± 1.924 MFI, respectively; Fig. 3A). A deeper analysis within the major splenic B cell populations depicted that the difference occurs predominantly on marginal zone (MZ) B cells (26.00 ± 1.762 vs 43.34 ± 4.262 MFI).
Normal pregnancy is associated to lower IL-21R expression on splenic B cells and a reduction of follicular T helper cells (Tfh). (A) Boxes and whiskers show mean fluorescence intensity (MFI) corresponding to the expression of IL-21R on total B cells, follicular zone (FO), marginal zone (MZ), and transitional (TN) B cells. (B) Bars show numbers of CD4+CXCR5+Bcl-6+ follicular T helper cells (Tfh) within splenic lymphocytes of CBA/J female mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. (C) Bars show percentages of peripheral blood CD4+ICOS+CXCR5+PD-1+ Tfh within CD3+ lymphocytes from non-pregnant women (NP), women on the first, or third trimester of pregnancy. Data were analyzed by ANOVA with Kruskal-Wallis posttest (A and B) or ANOVA with Dunnett’s comparison Test (C). Data are representative of eight mice per group (A), nine non-pregnant, nine BALB/c paired, and eight DBA/2J paired CBA/J mice (B), or eight non-pregnant women, eight women on the first trimester of pregnancy, or five woman on the third trimester of pregnancy (C). Data are displayed as boxes (mean and 25th to 75th percentiles) and whiskers (min to max) (A) or mean ± s.e.m. (B and C). Gating strategies are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
Normal pregnancy is associated to lower IL-21R expression on splenic B cells and a reduction of follicular T helper cells (Tfh). (A) Boxes and whiskers show mean fluorescence intensity (MFI) corresponding to the expression of IL-21R on total B cells, follicular zone (FO), marginal zone (MZ), and transitional (TN) B cells. (B) Bars show numbers of CD4+CXCR5+Bcl-6+ follicular T helper cells (Tfh) within splenic lymphocytes of CBA/J female mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. (C) Bars show percentages of peripheral blood CD4+ICOS+CXCR5+PD-1+ Tfh within CD3+ lymphocytes from non-pregnant women (NP), women on the first, or third trimester of pregnancy. Data were analyzed by ANOVA with Kruskal-Wallis posttest (A and B) or ANOVA with Dunnett’s comparison Test (C). Data are representative of eight mice per group (A), nine non-pregnant, nine BALB/c paired, and eight DBA/2J paired CBA/J mice (B), or eight non-pregnant women, eight women on the first trimester of pregnancy, or five woman on the third trimester of pregnancy (C). Data are displayed as boxes (mean and 25th to 75th percentiles) and whiskers (min to max) (A) or mean ± s.e.m. (B and C). Gating strategies are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
Normal pregnancy is associated to lower IL-21R expression on splenic B cells and a reduction of follicular T helper cells (Tfh). (A) Boxes and whiskers show mean fluorescence intensity (MFI) corresponding to the expression of IL-21R on total B cells, follicular zone (FO), marginal zone (MZ), and transitional (TN) B cells. (B) Bars show numbers of CD4+CXCR5+Bcl-6+ follicular T helper cells (Tfh) within splenic lymphocytes of CBA/J female mice. White, light gray, and dark gray bars represent non-pregnant, BALB/c paired, and DBA/2J paired CBA/J mice, respectively. (C) Bars show percentages of peripheral blood CD4+ICOS+CXCR5+PD-1+ Tfh within CD3+ lymphocytes from non-pregnant women (NP), women on the first, or third trimester of pregnancy. Data were analyzed by ANOVA with Kruskal-Wallis posttest (A and B) or ANOVA with Dunnett’s comparison Test (C). Data are representative of eight mice per group (A), nine non-pregnant, nine BALB/c paired, and eight DBA/2J paired CBA/J mice (B), or eight non-pregnant women, eight women on the first trimester of pregnancy, or five woman on the third trimester of pregnancy (C). Data are displayed as boxes (mean and 25th to 75th percentiles) and whiskers (min to max) (A) or mean ± s.e.m. (B and C). Gating strategies are provided as supplementary material. Significant differences are indicated (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).
Citation: Reproduction 159, 3; 10.1530/REP-19-0407
CBA/J × BALB/c mice have lower proportions of Tfh
Among the IL-21 producing T cells, Tfh represent plausible candidates because of their follicular localization and their ability to interact with maturating B cells. We observed that, during normal pregnancies, the numbers of Tfh are significantly reduced (60 587 ± 7 276 cells in non-pregnant vs 15 624 ± 3 528 cells in normal pregnant mice; Fig. 3B). Contrarily, the number remained high in CBA/J × DBA/2J pregnancies (93 019 ± 22 233 cells).
We wondered then if Tfh were also altered in human pregnancies. We analyzed the percentage of CD4+PD1+CXCR5+ICOS+ within CD3+ lymphocytes in non-pregnant women and pregnant women at first and third trimester of pregnancy. We observed that there is a ~3-fold reduction of the percentages of CD4+PD1+CXCR5+ICOS+ cells at the beginning of pregnancy (from 5.510 ± 2.494 to 1.652 ± 1.387%; Fig. 3C).
Discussion
An immune balance between fetal tolerance and defense against pathogens is important for the maintenance of pregnancy (Racicot et al. 2014, Mor et al. 2017). The complexity of this phenomenon rises when the tolerance vs control of commensal bacteria is taken into account (Nuriel-Ohayon et al. 2016, Einenkel et al. 2019b ). The immune system undergoes several adaptations during pregnancy, including changes in the number and functionality of B lymphocytes (Medina et al. 1993, Muzzio et al. 2014a , Packhäuser et al. 2017, Einenkel et al. 2019a ). Among these adaptations, a preference for the development of the innate-like marginal zone B cells subtype can be observed in different mouse strains (Muzzio et al. 2014a , 2016).
IL-21 has been shown to induce a prevalence of adaptive responses, prioritizing B cell responses to T-dependent antigens and interfering with T-independent responses (Jin et al. 2004). Our results suggest that during normal pregnancies, B cells acquire resistance to IL-21 mediated effects upon LPS stimulation. The down-regulation of IL-21R on B cells seems to minimize the apoptotic potential of IL-21 toward LPS-stimulated B cells. This may represent a counteracting response to maintain the first line of humoral defense in the context of a reduction in the number B cells occurring during pregnancy.
We showed that the most evident difference of IL-21R expression occurred on MZ B cells. Remarkably, this subset is enriched in CBA/J × BALB/c mice and a possible involvement of Tfh promoting this phenomenon has been proposed (Muzzio et al. 2016). In our experiments, however, we observed that B cells from CBA/J × DBA/2J mice (which express higher levels of IL-21R than CBA/J × BALB/c) produced in vitro higher levels of all Ig serotypes than B cells from CBA/J × BALB/c mice. This included innate-like antibodies (IgM and IgA), which in serum from CBA/J × BALB/c mice are present in higher titers than in CBA/J × DBA/2J. These data suggest that the differential IL-21R expression observed in both mouse groups may be a quantitative rather than a qualitative determinant of the Ig production during pregnancy.
Interestingly, in spite of the lower IL-21R expression on B cells of normal pregnant mice vs disturbed pregnancy mice, IL-21 induced Il10 expression in normal but not in disturbed pregnancy mice. These results suggest that, during pregnancy, the reduction of IL-21R may protect IL-10 producing B cell from IL-21 induced apoptosis. Actually, it has been already reported that CBA/J females paired with BALB/c males can produce higher levels of IL-10 than when they are paired with DBA/J males (Chaouat et al. 1995). Because IL-10 is a strong anti-inflammatory cytokine that can rescue CBA/J pregnant mice from abortions, a decreased IL-21 production or a decreased sensitivity of B cells toward the cytokine may collaborate to pregnancy well-being by maintaining a subset of IL-10 producing B cells.
Considering a third aspect of B cell interaction with other immune cells, we analyzed the effect of IL-21 on the expression of molecules important for antigen presentation (Supplementary Fig. 2). Although all groups behaved similarly upon IL-21 treatment, MHCII underwent a substantial up-regulation in pregnant mice with disturbed pregnancies. Antigen presentation in B cells through MHCII can lead to activation of CD4+ effector T cells that would propagate an inflammatory response (Adler et al. 2017). In our experiments, however, this up-regulation is accompanied by a strong down-regulation of accessory molecules, which seems very unlikely to represent a mechanism collaborating to fetal rejection in DBA/2J-paired CBA/J mice.
Our data suggest that the effects of IL-21 are more apparent when the antigen is T-independent. This may represent a way to maintain IL-10 mediated tolerance toward unspecific threat-signals (like microbiome derived-LPS) while maintaining the potential to react against more serious threats. It has been already demonstrated that LPS from gut microflora affects the outcome of CBA/J pregnant mice, priming the immune responses that lead to fetal rejection (Clark et al. 2002). However, it is important to take into consideration that we performed our in vitro experiments using the same concentration of IL-21 for all mouse groups. In vivo, pregnancy disturbance was also associated to higher numbers of Tfh. Higher proportions of IL-21 producing cells could potentiate the effect we observed in vitro for T-dependent antigens as well for mice with disturbed pregnancies.
The phenotypification and functional characterization of Tfh during human pregnancy and pregnancy associated problems are still under elucidation (Zeng et al. 2016, Luan et al. 2017, Monteiro et al. 2017). We aimed to gain insights into Tfh changes during human pregnancy by performing a limited characterization of circulating CD4+PD1+CXCR5+ICOS+ Tfh cells. In this experiment, a reduction of Tfh cells during pregnancy could be observed. It is important to mention that the correlation between peripheral and splenic Tfh needs to be further investigated. Furthermore, we did not look for factors that may influence circulating Tfh distribution, such as the phase of menstrual cycle, the use of contraconceptives, parity, and so on.
All this data together suggest that, during normal pregnancy, the IL-21/IL-21R pathway needs to be reduced to support pregnancy. IL-21 is also known to induce Th17 cells and reduce Tregs development (Korn et al. 2007, Nurieva et al. 2007, Zhou et al. 2007). As IL-21R has been described not only on B cells but also in T and NK cells, it is surprising that no much attention has put on studying the IL-21 pathway during disturbed pregnancy. Therapeutic blocking of IL-21R has been already been tested in several animal models and in clinical trials (Spolski & Leonard 2014). Whether IL-21R blocking may also represent a tool to handle threatened pregnancies requires further investigation.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-19-0407.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The study was supported by intramural funding from Greifswald University.
Ethics statement
Animal experiments were carried out according to institutional guidelines approved by the Landesamt für Landwirtschaſt, Lebensmittelsicherheit und Fischerei Mecklenburg-Vorpommern (LALLF-MV; 7221.3-1-068/13 to D M). The experiments were conducted in conformity with the European Communities Council Directive 86/609/EEC. Experiments with human samples were reviewed and approved by the Ethics Committee of the Medical Faculty, Greifswald University (BB 126/13). All individuals were properly informed and gave their written consent before sampling.
Author contribution statement
C F performed experiments, analyzed data, and contributed to the elaboration of the manuscript. J E and D K performed experiments. D T recruited donors, collected samples, discussed the data, and read the manuscript. M Z contributed with reagents, the design of experiments, and the writing of the manuscript. D M conceived and designed the experiments, analyzed data, wrote the paper, and supervised the work.
Acknowledgements
The authors thank the German Academic Scholarship Foundation (Studienstiftung des deutschen Volkes) for their support to C F.
References
Adler LN, Jiang W, Bhamidipati K, Millican M, Macaubas C, Hung SC & Mellins ED 2017 The other function: class II-restricted antigen presentation by B cells. Frontiers in Immunology 319. (https://doi.org/10.3389/fimmu.2017.00319)
Ahmed A, Singh J, Khan Y, Seshan SV & Girardi G 2010 A new mouse model to explore therapies for preeclampsia. PLoS ONE e13663. (https://doi.org/10.1371/journal.pone.0013663)
Asao H, Okuyama C, Kumaki S, Ishii N, Tsuchiya S, Foster D & Sugamura K 2001 Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. Journal of Immunology 1–5. (https://doi.org/10.4049/jimmunol.167.1.1)
Bubier JA, Sproule TJ, Foreman O, Spolski R, Shaffer DJ, Morse HC, 3rd, Leonard WJ & Roopenian DC 2009 A critical role for IL-21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB-Yaa mice. PNAS 1518–1523. (https://doi.org/10.1073/pnas.0807309106)
Chaouat G, Assal Meliani A, Martal J, Raghupathy R, Elliott JF, Mosmann T & Wegmann TG 1995 IL-10 prevents naturally occurring fetal loss in the CBA x DBA/2 mating combination, and local defect in IL-10 production in this abortion-prone combination is corrected by in vivo injection of IFN-tau. Journal of Immunology 4261–4268. (https://doi.org/10.4049/jimmunol.175.5.3447-d)
Chatterjee P, Chiasson VL, Bounds KR & Mitchell BM 2014 Regulation of the anti-inflammatory cytokines interleukin-4 and interleukin-10 during pregnancy. Frontiers in Immunology 253. (https://doi.org/10.3389/fimmu.2014.00253)
Cheng SB & Sharma S 2015 Interleukin-10: a pleiotropic regulator in pregnancy. American Journal of Reproductive Immunology 487–500. (https://doi.org/10.1111/aji.12329)
Clark DA, McDermott MR & Szewczuk MR 1980 Impairment of host-versus-graft reaction in pregnant mice. II. Selective suppression of cytotoxic T-cell generation correlates with soluble suppressor activity and with successful allogeneic pregnancy. Cellular Immunology 106–118. (https://doi.org/10.1016/0008-8749(80)90404-9)
Clark DA, Chaput A & Tutton D 1986 Active suppression of host-vs-graft reaction in pregnant mice. VII. Spontaneous abortion of allogeneic CBA/J x DBA/2 fetuses in the uterus of CBA/J mice correlates with deficient non-T suppressor cell activity. Journal of Immunology 1668–1675.
Clark DA, Chaouat G, Arck PC, Mittruecker HW & Levy GA 1998 Cytokine-dependent abortion in CBA x DBA/2 mice is mediated by the procoagulant fgl2 prothrombinase [correction of prothombinase]. Journal of Immunology 545–549.
Clark DA, Chaouat G & Gorczynski RM 2002 Thinking outside the box: mechanisms of environmental selective pressures on the outcome of the materno-fetal relationship. American Journal of Reproductive Immunology 275–282. (https://doi.org/10.1034/j.1600-0897.2002.01093.x)
Clark DA, Yu G, Arck PC, Levy GA & Gorczynski RM 2003 MD-1 is a critical part of the mechanism causing Th1-cytokine-triggered murine fetal loss syndrome. American Journal of Reproductive Immunology 297–307. (https://doi.org/10.1034/j.1600-0897.2003.00045.x)
Clark DA, Manuel J, Lee L, Chaouat G, Gorczynski RM & Levy GA 2004 Ecology of danger-dependent cytokine-boosted spontaneous abortion in the CBA x DBA/2 mouse model. I. Synergistic effect of LPS and (TNF-alpha + IFN-gamma) on pregnancy loss. American Journal of Reproductive Immunology 370–378. (https://doi.org/10.1111/j.1600-0897.2004.00237.x)
Collins M, Whitters MJ & Young DA 2003 IL-21 and IL-21 receptor: a new cytokine pathway modulates innate and adaptive immunity. Immunologic Research 131–140. (https://doi.org/10.1385/IR:28:2:131)
Doster A, Schwarzig U, Zygmunt M, Rom J, Schutz F & Fluhr H 2016 Unfractionated heparin selectively modulates the expression of CXCL8, CCL2 and CCL5 in endometrial carcinoma cells. Anticancer Research 1535–1544.
Einenkel R, Packhäuser KRH, Ehrhardt J, Tüngler A, Zygmunt M & Muzzio DO 2019a CD83 is locally regulated and differentially expressed in disturbed murine pregnancy. Reproduction 323–333. (https://doi.org/10.1530/REP-19-0171)
Einenkel R, Zygmunt M & Muzzio DO 2019b Microorganisms in the healthy upper reproductive tract: from denial to beneficial assignments for reproductive biology. Reproductive Biology 113–118. (https://doi.org/10.1016/j.repbio.2019.04.001)
Girardi G, Yarilin D, Thurman JM, Holers VM & Salmon JE 2006 Complement activation induces dysregulation of angiogenic factors and causes fetal rejection and growth restriction. Journal of Experimental Medicine 2165–2175. (https://doi.org/10.1084/jem.20061022)
Iwamoto T, Suto A, Tanaka S, Takatori H, Suzuki K, Iwamoto I & Nakajima H 2014 Interleukin-21-producing c-Maf-expressing CD4+ T cells induce effector CD8+ T cells and enhance autoimmune inflammation in scurfy mice. Arthritis and Rheumatology 2079–2090. (https://doi.org/10.1002/art.38658)
Jensen F, Muzzio D, Soldati R, Fest S & Zenclussen AC 2013 Regulatory B10 cells restore pregnancy tolerance in a mouse model. Biology of Reproduction 90. (https://doi.org/10.1095/biolreprod.113.110791)
Jin H, Carrio R, Yu A & Malek TR 2004 Distinct activation signals determine whether IL-21 induces B cell costimulation, growth arrest, or Bim-dependent apoptosis. Journal of Immunology 657–665. (https://doi.org/10.4049/jimmunol.173.1.657)
Kasaian MT, Whitters MJ, Carter LL, Lowe LD, Jussif JM, Deng B, Johnson KA, Witek JS, Senices M & Konz RF et al. 2002 IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Immunity 559–569. (https://doi.org/10.1016/s1074-7613(02)00295-9)
Korn T, Bettelli E, Gao W, Awasthi A, Jager A, Strom TB, Oukka M & Kuchroo VK 2007 IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature 484–487. (https://doi.org/10.1038/nature05970)
Lin H, Mosmann TR, Guilbert L, Tuntipopipat S & Wegmann TG 1993 Synthesis of T helper 2-type cytokines at the maternal-fetal interface. Journal of Immunology 4562–4573.
Luan X, Kang X, Li W & Dong Q 2017 An investigation of the relationship between recurrent spontaneous abortion and memory T follicular helper cells. American Journal of Reproductive Immunology 78 e12714. (https://doi.org/10.1111/aji.12714)
McGuire HM, Walters S, Vogelzang A, Lee CM, Webster KE, Sprent J, Christ D, Grey S & King C 2011 Interleukin-21 is critically required in autoimmune and allogeneic responses to islet tissue in murine models. Diabetes 867–875. (https://doi.org/10.2337/db10-1157)
Medina KL, Smithson G & Kincade PW 1993 Suppression of B lymphopoiesis during normal pregnancy. Journal of Experimental Medicine 1507–1515. (https://doi.org/10.1084/jem.178.5.1507)
Mehta DS, Wurster AL & Grusby MJ 2004 Biology of IL-21 and the IL-21 receptor. Immunological Reviews 84–95. (https://doi.org/10.1111/j.0105-2896.2004.00201.x)
Messaoudi S, Al-Khateeb GM, Dendana M, Sater MS, Jazia KB, Nouira M, Almawi WY & Mahjoub T 2011 Genetic variations in the interleukin-21 gene and the risk of recurrent idiopathic spontaneous miscarriage. European Cytokine Network 123–126. (https://doi.org/10.1684/ecn.2011.0287)
Monteiro C, Kasahara TM, Castro JR, Sacramento PM, Hygino J, Centuriao N, Cassano T, Lopes LMF, Leite S & Silva VG et al. 2017 Pregnancy favors the expansion of circulating functional follicular helper T cells. Journal of Reproductive Immunology 1–10. (https://doi.org/10.1016/j.jri.2017.04.007)
Mor G, Aldo P & Alvero AB 2017 The unique immunological and microbial aspects of pregnancy. Nature Reviews: Immunology 469–482. (https://doi.org/10.1038/nri.2017.64)
Muzzio DO, Soldati R, Ehrhardt J, Utpatel K, Evert M, Zenclussen AC, Zygmunt M & Jensen F 2014a B cell development undergoes profound modifications and adaptations during pregnancy in mice. Biology of Reproduction 115. (https://doi.org/10.1095/biolreprod.114.122366)
Muzzio DO, Soldati R, Rolle L, Zygmunt M, Zenclussen AC & Jensen F 2014b B-1a B cells regulate T cell differentiation associated with pregnancy disturbances. Frontiers in Immunology 6. (https://doi.org/10.3389/fimmu.2014.00006)
Muzzio DO, Ziegler KB, Ehrhardt J, Zygmunt M & Jensen F 2016 Marginal zone B cells emerge as a critical component of pregnancy well-being. Reproduction 29–37. (https://doi.org/10.1530/REP-15-0274)
Nicoletti I, Migliorati G, Pagliacci MC, Grignani F & Riccardi C 1991 A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. Journal of Immunological Methods 271–279. (https://doi.org/10.1016/0022-1759(91)90198-o)
Nuriel-Ohayon M, Neuman H & Koren O 2016 Microbial changes during pregnancy, birth, and infancy. Frontiers in Microbiology 1031. (https://doi.org/10.3389/fmicb.2016.01031)
Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, Schluns K, Tian Q, Watowich SS & Jetten AM et al. 2007 Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature 480–483. (https://doi.org/10.1038/nature05969)
Ozaki K, Kikly K, Michalovich D, Young PR & Leonard WJ 2000 Cloning of a type I cytokine receptor most related to the IL-2 receptor beta chain. PNAS 11439–11444. (https://doi.org/10.1073/pnas.200360997)
Ozaki K, Spolski R, Feng CG, Qi CF, Cheng J, Sher A, Morse HC, 3rd, Liu C, Schwartzberg PL & Leonard WJ 2002 A critical role for IL-21 in regulating immunoglobulin production. Science 1630–1634. (https://doi.org/10.1126/science.1077002)
Packhäuser KRH, Roman-Sosa G, Ehrhardt J, Krüger D, Zygmunt M & Muzzio DO 2017 A kinetic study of CD83 reveals an upregulation and higher production of sCD83 in lymphocytes from pregnant mice. Frontiers in Immunology 486. (https://doi.org/10.3389/fimmu.2017.00486)
Parrish-Novak J, Dillon SR, Nelson A, Hammond A, Sprecher C, Gross JA, Johnston J, Madden K, Xu W & West J et al. 2000 Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 57–63. (https://doi.org/10.1038/35040504)
Racicot K, Kwon JY, Aldo P, Silasi M & Mor G 2014 Understanding the complexity of the immune system during pregnancy. American Journal of Reproductive Immunology 107–116. (https://doi.org/10.1111/aji.12289)
Raghupathy R 1997 Th1-type immunity is incompatible with successful pregnancy. Immunology Today 478–482. (https://doi.org/10.1016/s0167-5699(97)01127-4)
Sawalha AH, Kaufman KM, Kelly JA, Adler AJ, Aberle T, Kilpatrick J, Wakeland EK, Li QZ, Wandstrat AE & Karp DR et al. 2008 Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus. Annals of the Rheumatic Diseases 458–461. (https://doi.org/10.1136/ard.2007.075424)
Shi X, Que R, Liu B, Li M, Cai J, Shou D, Wen L, Liu D, Chen L & Liang T et al. 2016 Role of IL-21 signaling pathway in transplant-related biology. Transplantation Reviews 27–30. (https://doi.org/10.1016/j.trre.2015.06.003)
Spolski R & Leonard WJ 2014 Interleukin-21: a double-edged sword with therapeutic potential. Nature Reviews: Drug Discovery 379–395. (https://doi.org/10.1038/nrd4296)
Thompson SD, Sudman M, Ramos PS, Marion MC, Ryan M, Tsoras M, Weiler T, Wagner M, Keddache M & Haas JP et al. 2010 The susceptibility loci juvenile idiopathic arthritis shares with other autoimmune diseases extend to PTPN2, COG6, and ANGPT1. Arthritis and Rheumatism 3265–3276. (https://doi.org/10.1002/art.27688)
Tortola L, Yadava K, Bachmann MF, Muller C, Kisielow J & Kopf M 2010 IL-21 induces death of marginal zone B cells during chronic inflammation. Blood 5200–5207. (https://doi.org/10.1182/blood-2010-05-284547)
Yang F, Wei XM, Liang WW, Mo WH, Tan BP & Wang H 2017 A critical role for IL-21 receptor signaling in the coxsackievirus B3-induced myocarditis. Inflammation 1428–1435. (https://doi.org/10.1007/s10753-017-0586-5)
Yoshizaki A, Miyagaki T, DiLillo DJ, Matsushita T, Horikawa M, Kountikov EI, Spolski R, Poe JC, Leonard WJ & Tedder TF 2012 Regulatory B cells control T-cell autoimmunity through IL-21-dependent cognate interactions. Nature 264–268. (https://doi.org/10.1038/nature11501)
Zeng W, Liu Z, Zhang S, Ren J, Ma X, Qin C, Tian F, Zhang Y & Lin Y 2016 Characterization of T follicular helper cells in allogeneic normal pregnancy and PDL1 blockage-induced abortion. Scientific Reports 36560. (https://doi.org/10.1038/srep36560)
Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ & Littman DR 2007 IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nature Immunology 967–974. (https://doi.org/10.1038/ni1488)
