Abstract
Equine placentitis is associated with alterations in maternal peripheral steroid concentrations, which could negatively affect pregnancy outcome. This study aimed to elucidate the molecular mechanisms related to steroidogenesis and steroid-receptor signaling in the equine placenta during acute placentitis. Chorioallantois (CA) and endometrial (EN) samples were collected from mares with experimentally induced placentitis (n = 4) and un-inoculated gestationally age-matched mares (control group; n = 4). The mRNA expression of genes coding for steroidogenic enzymes (3βHSD, CYP11A1, CYP17A1, CYP19A1, SRD5A1, and AKR1C23) was evaluated using qRT-PCR. The concentration of these enzyme-dependent steroids (P5, P4, 5αDHP, 3αDHP, 20αDHP, 3β-20αDHP, 17OH-P, DHEA, A4, and estrone) was assessed using liquid chromatography-tandem mass spectrometry in both maternal circulation and placental tissue. Both SRD5A1 and AKR1C23, which encode for the key progesterone metabolizing enzymes, were downregulated (P < 0.05) in CA from the placentitis group compared to controls, and this downregulation was associated with a decline in tissue concentrations of 5αDHP (P < 0.05), 3αDHP (P < 0.05), and 3β-20αDHP (P = 0.052). In the EN, AKR1C23 was also downregulated in the placentitis group compared to controls, and this downregulation was associated with a decline in EN concentrations of 3αDHP (P < 0.01) and 20αDHP (P < 0.05). Moreover, CA expression of CYP19A1 tended to be lower in the placentitis group, and this reduction was associated with lower (P = 0.057) concentrations of estrone in CA. Moreover, ESR1 (steroid receptors) gene expression was downregulated (P = 0.057) in CA from placentitis mares. In conclusion, acute equine placentitis is associated with a local withdrawal of progestins in the placenta and tended to be accompanied with estrogen withdrawals in CA.
Introduction
Steroid hormones are vital for pregnancy maintenance and fetal development (Sanderson 2009, Conley 2016, Esteller-Vico et al. 2017). During equine pregnancy, both pregnanes and estrogens are synthesized and secreted from luteal and placental tissues with the later becoming the primary source of these steroids during the second half of gestation (Conley & Mason 1990, Conley et al. 1994, Conley 2016). In brief, primary and secondary corpora lutea are the principal sources of maternal peripheral pregnanes during the first 110 days of equine gestation (Pashen 1984, Conley 2016). The luteo-placental shift commences around week 16 of gestation, and thereafter, the placenta becomes the primary source for progestins (Short 1959, Squires & Ginther 1975, Holtan et al. 1979, Scholtz et al. 2014, Legacki et al. 2016a ). Beginning near the luteo-placental shift, peripheral concentrations of 5α-dihydroprogesterone (5α-DHP, also known as DHP) exceed those of progesterone (P4), and P4 concentrations become very low or undetectable beyond D200 of gestation. DHP is a biopotent progestin and serves to maintain pregnancy in the mare in the absence of P4 (Scholtz et al. 2014, Legacki et al. 2016b ). Moreover, fetal-gonadal growth begins around week 14 of gestation and is accompanied with increased dehydroepiandrosterone (DHEA) which acts as the precursor of placental estrogen synthesis (Wesson & Ginther 1980, Legacki et al. 2016b ). Because of this complex mechanism for steroidal synthesis and metabolism, a number of steroidogenic enzymes within the placenta are key to maintain this steroidogenic balance. Therefore, the placental steroidogenic enzyme profile determines placental steroid synthesis and metabolism, which in turn shapes the peripheral steroid profile during the second half of gestation in mares (Legacki et al. 2016b ). Briefly, hydroxy-delta-5-steroid dehydrogenase (3βHSD) and cytochrome P450 family 17A1 (CYP17A1) control progesterone (P4) and androgen (A4) synthesis, respectively, and cytochrome P450 family 19A1 (CYP19A1) converts androgen to estrogens as illustrated in Figure 1 (Conley & Mason 1990, Conley et al. 1994, Conley & Hinshelwood 2001, Legacki et al. 2017, 2018). Thereafter, P4 is metabolized to several 5α-reduced pregnanes by P4 metabolizing enzymes. The key P4 metabolizing enzymes are 5α-reductase type 1 (5α-R1) and aldo-keto reductase family 1 member C23 (AKRIC23), encoded by steroid 5 alpha-reductase (SRD5A1) and AKR1C23 (also known as, AKR1C1 and 20α-HSD) genes, respectively (Brown et al. 2006, Lee et al. 2008, Scholtz et al. 2014, Legacki et al. 2017, 2018). The 5α-R1 enzyme directly converts P4 to 5α-dihydroprogesterone (5α-DHP), which is then metabolized into allopregnanolone (3αDHP), 20α-hydroxy-5α dihydroprogesterone (20αDHP), and 5α-pregnan-3β, 20α-diol (3β,20αDHP) by AKR1C23 as illustrated in Fig. 1 (Holtan et al. 1991, Brown et al. 2006, Fowden et al. 2008, Guzeloglu-Kayisli et al. 2015, Conley 2016, Legacki et al. 2016a ,b ).
Schematic illustration showing the metabolic relationship among the measured placental steroids and the role of the placental steroidogenic enzymes (A). Steroids analyzed and listed by class (pregnanes, androstanes, and estranes) with chemical names and abbreviations used in the text (B). Key; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Schematic illustration showing the metabolic relationship among the measured placental steroids and the role of the placental steroidogenic enzymes (A). Steroids analyzed and listed by class (pregnanes, androstanes, and estranes) with chemical names and abbreviations used in the text (B). Key; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Schematic illustration showing the metabolic relationship among the measured placental steroids and the role of the placental steroidogenic enzymes (A). Steroids analyzed and listed by class (pregnanes, androstanes, and estranes) with chemical names and abbreviations used in the text (B). Key; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
A clear example of physiological alteration of equine placental steroidogenesis is normal parturition; withdrawal of 5α-reduced pregnanes in post-parturient placenta is coincident with significant downregulation of placental mRNA expression of SRD5A1, and consequently, reduction in the maternal peripheral concentration of 5α-reduced pregnanes around parturition (Legacki et al. 2016a , 2018). On the other hand, acute equine placentitis is associated with a decline in peripheral steroid concentrations (Wynn et al. 2018). However, steroid synthesis and metabolism have not been studied so far at the tissue level in the CA and EN during placentitis. Also, it is not known which placental steroidogenic enzyme(s) are influenced by the disease. The current lack of information in the pathophysiology of this steroidogenic change hinders our interpretation of potential endocrine markers and the development of effective treatments for equine placentitis, which remains the single most common cause of abortions, stillbirths, and perinatal losses in the equine breeding industry (Troedsson & Zent 2004, LeBlanc 2010, Lof et al. 2010).
Steroid hormones provoke their action through specific steroid receptors in the target tissue(s). In brief, progestins (bioactive pregnanes) act through nuclear progesterone receptors (PR) to maintain uterine quiescence during pregnancy in all placental mammals (Merlino et al. 2007, Mesiano et al. 2011, Wu & DeMayo 2017). Similarly, estrogens act through estrogen receptor 1 (ESR1, also known as ERα) and 2 (ESR2, also known as ERβ) (Enmark et al. 1997). Again, any decline in the availability of one of these steroid receptors in the target tissue will result in functional withdrawal of the corresponding steroid (Brown et al. 2004). Recently, we have reported that equine placentitis is associated with the downregulation of PR (functional progestin withdrawal) and both ESR1 and ESR2 in the myometrium retrieved from placentitis cases in comparison to those from control mares (El-Sheikh Ali et al. 2019). To date, there has been no study elucidating the effect of equine placentitis on the expression of steroid receptors in the placenta.
The current study aimed to evaluate the mRNA expression of genes coding for steroidogenic enzymes and the concentration of their dependent steroids in the uteroplacental unit (CA and EN) and maternal circulation in mares with experimentally induced placentitis in comparison to un-inoculated gestationally age-matched mares as controls. Moreover, we evaluated the effect of placentitis on the mRNA expression of nuclear steroid receptors for estrogens and progestins.
Materials and methods
Ethics
All animal and study procedures were completed following the Institutional Animal Care and Use Committee of the University of Kentucky (Approval No. #2014-1341).
Animals
Eight reproductively normal mares (Equus caballus) were included in the current study, maintained in pastures with free access to hay, water, and trace minerals. These mares ranged from 4 to 9 years of age. They were pasture bred and pregnancy was confirmed by transrectal ultrasonography between 18 and 35 days of gestation. Gestational age was determined based upon the size and ultrasonographic morphology of the conceptus (Ginther 1979).
Experimental design
Placentitis was induced in four mares at approximately 290 days of gestation (placentitis group), while the remaining four mares with gestationally age-matched pregnancies did not receive any treatment (control group). For the induction of placentitis, Streptococcus equi ssp. zooepidemicus was inoculated intracervically as previously described (Canisso et al. 2014). After inoculation, all mares in both groups were monitored daily with transrectal ultrasonography to assess the combined thickness of the uterus and placenta (CTUP) and the degree of placental separation as a measure of disease progression (Renaudin et al. 1997, El-Sheikh Ali et al. 2019, Loux et al. 2019).
Euthanasia and tissue collection and preparation
Mares in the placentitis group were killed when they displayed sufficient signs of the disease (i.e. an increase in CTUP of 3+ mm and/or >50% of the original thickness, plus measurable placental separation) (Renaudin et al. 1997). Mares in the control group were also killed at corresponding gestational ages. Killing was carried out with sodium pentobarbital, according to the American Veterinary Medical Association (AVMA) guidelines for the killing of animals (Leary et al. 2013). The mares in the placentitis group were killed within 3–5 days of inoculation. Gestational ages at killing were similar for placentitis and control groups (292.5 ± 1.56 vs 289.8 ± 2.18, respectively). Immediately after killing, the gravid uterus was removed and the CA and EN were collected from the region with active placentitis lesion and distinct separation of the CA from the EN (caudal pole of the placenta in control group).
Collected samples were preserved in RNAlater™ (#AM7021; Invitrogen), kept at 4°C overnight, and then preserved at −80°C until RNA isolation. Additional samples were flash-frozen for subsequent protein immunoblot and mass spectrometry analysis to measure steroid concentrations. In addition, intact sections of CA and EN were immediately fixed in 10% formaldehyde for 24 h and then transferred to 100% methanol for further histopathological examination and immunohistochemistry (IHC).
Total RNA extraction
Total RNA was isolated from all samples using RNeasy Mini Kit (#74104; Qiagen). All procedures were performed according to the manufacturer’s instructions. After extraction, RNA concentration and quality were analyzed using a Nanodrop 2000 spectrophotometer (#ND-2000; Thermo Fisher Scientific) and Bioanalyzer® (Agilent). All samples had a 260/280 ratio >2.0 and RNA integrity number (RIN) >8.0.
Quantitative RT-PCR
For gene expression analysis, total RNA (2 μg/reaction) was reverse-transcribed using TaqMan™ RT Reagents (#4368814; Invitrogen). qRT-PCR was performed in duplicate (50 ng cDNA/reaction) using PowerUp™ SYBR™ Green Master Mix (#A25741; Applied Biosystems) along with specific primers based on previous literature (Legacki et al. 2017, El-Sheikh Ali et al. 2019, Fernandes et al. 2019) as described in Table 1. For CA, actin beta (ACTB) and glucuronidase beta (GUSB) were used as housekeeping genes (Legacki et al. 2018). ACTB and beta-2 microglobulin (B2M) served as the housekeeping genes for EN (Klein et al. 2011). In the current study, gene expression data represent the relative expression values, and this was evaluated using the delta CT (ΔCT) method (Livak & Schmittgen 2001). In brief, ΔCT values calculated where ΔCT = (CT value of mRNA of interest – the geometric mean of the CT values of the housekeeping genes).
Forward and reverse primer sequences used for qRT-PCR analysis.
| Gene | Accession ID | Product size (bp) | Primer sequence 5′–3′ | Tm |
|---|---|---|---|---|
| AKR1C23 | AY955082 | 148 | Forward: CATGAAAGTCCTAGATGGCCTAAAC | 59.47 |
| Reverse: CACTATCCACACACAGGGCTTC | 60.94 | |||
| CYP11A1 | NM_001082521.3 | 98 | Forward: GTCCCCATCCGGAACGATTT | 60.11 |
| Reverse: CCAGGCGTCTGAGCTCTTAAA | 60.07 | |||
| CYP17A1 | D30688.1 | 60 | Forward: GCATGCTGGACTTACTGATCC | 58.78 |
| Reverse: CTGGGCCAGTGTTGTTATTG | 56.98 | |||
| CYP19A1 | AF031520.1 | 60 | Forward: CCACATCATGAAACACGATCA | 56.62 |
| Reverse: TACTGCAACCCAAATGTGCT | 58.01 | |||
| ESR1 | NM_001081772 | 125 | Forward: TCCATGGAGCACCCAGGAAAGC | 64.85 |
| Reverse: CGGAGCCGAGATGACGTAGCC | 64.88 | |||
| ESR2 | XM_001915519 | 116 | Forward: TCCTGAATGCTGTGACCGAC | 60.04 |
| Reverse: GTGCCTGACGTGAGAAAGGA | 59.97 | |||
| HSD3B1 | D89666.1 | 62 | Forward: AGCAAATACCATGAGCACGA | 57.6 |
| Reverse: TAACGTGGGCATCTTGTGAA | 57.45 | |||
| PR | XM_001498494 | 81 | Forward: CTTCCCCGACTGCGCGTACC | 65.55 |
| Reverse: TTGTGTGGCTGGAAGTCGCCG | 65.74 | |||
| SRD5A1 | XM_014734978.1 | 75 | Forward: GCTTTTTATTCACCAGAGCACA | 57.5 |
| Reverse: TCCTGAACTTCGGATAATCTTCA | 57.07 | |||
| ACTB | NM_001081838 | 100 | Forward: CGACATCCGTAAGGACCTGT | 59.18 |
| Reverse: CAGGGCTGTGATCTCCTTCT | 58.8 | |||
| GUSB | XM_001493514 | 117 | Forward: GGGATTCGCACTGTGGCTGTCA | 65.32 |
| Reverse: CCAGTCAAAGCCCTTCCCTCGGA | 66.25 | |||
| B2M | NM_001082502 | 103 | Forward: GTGTTCCGAAGGTTCAGGTT | 58.04 |
| Reverse: ATTTCAATCTCAGGCGGATG | 55.88 |
Primers were generated based on previous literatures (Legacki et al. 2017, El-Sheikh Ali et al. 2019, Fernandes et al. 2019).
AKR1C23, Aldo-keto reductase family 1, member C23; B2M, beta-2-microglobulin; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; ESR, Estrogen receptor; GUSB, Glucuronidase Beta; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; NCBI, National Center for Biotechnology Information; PR, Progesterone receptor; qRT-PCR, quantitative Real time polymerase chain reaction; SRD5A1, Steroid 5 alpha-reductase 1.
Immunoblot
Immunoblot analysis was conducted using flash-frozen CA and EN. Tissues were lysed using the T-PER Tissue Protein Extraction Reagent (#78510; Thermo Fisher Scientific) according to the manufacturer’s instructions. Protein concentration was determined using the BCA Protein Assay Kit (#23227; Thermo Fisher Scientific). Equivalent amounts of protein (20 µg) were added to 2× Laemmli buffer (#1610737EDU; BioRad), and samples were heated to 95°C for 5 min, loaded on 4–20% precast polyacrylamide gels (#456-1093; BioRad), run at 200 V for 45 min, and transferred to a nitrocellulose membrane. Membranes were incubated for 1 h in 1× PBS with 0.1% Tween (1× PBS-T) with 5% non-fat dry milk at room temperature to block non-specific binding followed by incubation with primary antibodies directed against AKR1C23 (provided by Dr Jean Sirois, 1:500) (Brown et al. 2006), human P450arom (provided by Dr Nobuhiro Harada, 1:500) (Conley et al. 1996, Walters et al. 2000), bovine ESR1 (SC-787, Santa Cruz Biotechnology Inc., 1:1000), human PR (#MA1-12626, Thermo Scientific, 1:1000), GAPDH (loading control; #MA5-15738, Thermo Scientific, 1:1000), and β-Actin (loading control; #SC-47778, Santa Cruz Biotechnology, Inc.) diluted in 1×PBS-T with 0.3% BSA overnight at 4°C with rocking. Membranes were washed three times with PBS-T for 10 min each time at room temperature. Horseradish peroxidase-conjugated goat anti-mouse secondary antibody (Santa Cruz Biotechnology, Inc.) was diluted in 1× PBS-T with 0.3% BSA (1: 10,000) and incubated with membranes for 60 min. Membranes were washed three times in PBST for 5 min each and visualized using SuperSignal West Pico Chemiluminescent substrate (#34557, Thermo Fisher Scientific) according to the manufacturer’s protocol. Quantitative measurement of immunoblots (densitometry) was performed using Image J (National Institutes of Health, Bethesda, MD, USA) (Schneider et al. 2012).
Tissue preparation for histopathological examination and immunohistochemical staining
The formalin-fixed samples were embedded in paraffin using routine methods, and 5 μm sections on positively charged slides were used for further analysis. For histopathological examination, sections were stained with hematoxylin and eosin. For IHC, immunostaining of sectioned tissues was conducted using primary antibodies directed against AKR1C23 (provided by Dr Jean Sirois) (Brown et al. 2006), SRD5A1 (provided by Dr Alan Conley) (Thigpen et al. 1993), and human P450arom (provided by Dr Nobuhiro Harada) (Conley et al. 1996, Walters et al. 2000). Paraffin sections were processed with the Leica BOND-MAX system (Leica Microsystems) as described elsewhere (Short 1959). Negative controls were prepared with rabbit IgG (Santa Cruz Biotechnology, Inc.).
Mass spectrometry
Steroids (P5, P4, 5αDHP, 3αDHP, 20αDHP, 3β-20αDHP, 17-OHP, DHEA, A4, and estrone) were extracted from placental tissue (CA and EN) and maternal plasma and analyzed using liquid chromatography-tandem mass spectrometry as described previously (Legacki et al. 2017)
Data analysis
The qRT-PCR results are presented as −ΔCT (negative ΔCT is more intuitive than ΔCT). Since, qRT-PCR data were normally distributed and mass spectrometry data were not, parametric and nonparametric statistical tests were used, respectively. One-way ANOVA was used to evaluate the significance of any changes in mRNA expression of tested targets between the placentitis and control groups for each tissue, followed by a pairwise comparison of means using unpaired t-test. Parametric and nonparametric comparison tests were implemented using SPSS for Windows (version 21.0; SPSS Inc.). Differences of P < 0.05 were considered as statistically significant and any difference of 0.1 > P ≥ 0.05 was considered a trend. Descriptive statistics are expressed below as the mean ± s.e.m. for parametric data or as the median for non-parametric data unless otherwise stated.
Results
Placentitis induction
The current model successfully induced placentitis in mares inoculated with Streptococcus equi ssp. zooepidemicus, as confirmed by histological evaluation, which indicated marked inflammatory changes and leukocyte infiltration in both CA and EN from placentitis group in comparison to control group (Fig. 2).
Histopathological appearance and immunohistochemical localization of steroid 5 alpha-reductase 1 (SRD5A1), Aldo-keto reductase family 1, member C23 (AKR1C23), and cytochrome P450 family 19A1 (CYP19A1) in placental tissue obtained from both control and placentitis mares.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Histopathological appearance and immunohistochemical localization of steroid 5 alpha-reductase 1 (SRD5A1), Aldo-keto reductase family 1, member C23 (AKR1C23), and cytochrome P450 family 19A1 (CYP19A1) in placental tissue obtained from both control and placentitis mares.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Histopathological appearance and immunohistochemical localization of steroid 5 alpha-reductase 1 (SRD5A1), Aldo-keto reductase family 1, member C23 (AKR1C23), and cytochrome P450 family 19A1 (CYP19A1) in placental tissue obtained from both control and placentitis mares.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroidogenic enzymes protein localization in equine placenta
The protein localization and staining intensity for SRD5A1, AKR1C23, and aromatase in equine placentas retrieved from both control and placentitis groups are shown in Fig. 2. SRD5A1 immunolabeling was evident in cytoplasm of chorionic villi and endometrial crypts as well as in the cytoplasm and nucleus of EN glandular epithelial cells. SRD5A1 staining intensity was relatively higher in equine placenta retrieved from control group compared to placentitis group. AKR1C23 immunolabeling was evident in cytoplasm of chorionic villi and endometrial crypts as well as in the cytoplasm and nucleus of EN glandular epithelial cells. AKR1C23 staining intensity was relatively higher in equine placenta retrieved from control group compared to placentitis group. Aromatase immunolabeling was evident in cytoplasm of chorionic villi and cytoplasm of EN glandular epithelial cells with higher intensity in the basement membrane of chorionic villi. Aromatase immunostaining intensity was relatively higher in equine placenta retrieved from control group compared to placentitis group.
The expression of CA steroidogenic enzymes and the CA concentrations of their dependent steroids
The mRNA expression of genes coding for steroidogenic enzymes in CA and their dependent steroid concentrations in CA are illustrated in Figs 3 and 4, respectively. The mRNA expression of CYP11A1 and CYP17A1 in CA did not reveal any significant changes in the placentitis group compared to the control group. Correspondingly, the median concentrations of P5, 17αOHP, DHEA, and A4 in CA did not show any significant changes between groups. On the other hand, the mRNA expression of SRD5A1 was downregulated (P < 0.05) in placentitis compared to control (Fig. 3F). This downregulation was accompanied by a marked decline (P < 0.05) in the median concentrations of 5αDHP in placentitis compared to control in CA (Fig. 4C). Moreover, the mRNA expression of AKR1C23 was downregulated (P < 0.05) in placentitis in comparison to control (Fig. 3G). The immunoblot analysis of AKR1C23 for protein quantification revealed a decreased immunoreactive protein in placentitis compared to control samples (P < 0.05; Fig. 3H). This downregulation was accompanied with a marked decline in the median concentrations of 5αDHP (P < 0.05), 3αDHP (P < 0.05), and 3β,20αDHP (P = 0.052) in placentitis in comparison to control CA (Fig. 4C, D and F). Moreover, the mRNA expression of CYP19A1 and 3βHSD in CA tended to be lower in the placentitis group in comparison to the control group (Fig. 3C and E). The expression of CYP19A1 protein was lower (P < 0.05) in placentitis group compared to control group (Fig. 3I) and this was associated with a decline (P = 0.057) in estrone concentrations in placentitis in comparison to control in CA (Fig. 4J). The lower expression of 3βHSD was not associated with any changes in P4 but was associated with downstream changes in other pregnanes.
The expression of steroidogenic enzymes in CAs retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G) in the CA from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and GUSB, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent the standard error of the mean (s.e.m.). Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in CA retrieved from placentitis and control mares and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The expression of steroidogenic enzymes in CAs retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G) in the CA from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and GUSB, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent the standard error of the mean (s.e.m.). Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in CA retrieved from placentitis and control mares and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The expression of steroidogenic enzymes in CAs retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G) in the CA from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and GUSB, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent the standard error of the mean (s.e.m.). Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in CA retrieved from placentitis and control mares and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in CAs from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in CAs from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in CAs from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The expression of EN steroidogenic enzymes and the EN concentrations of their dependent steroids
The mRNA expression of AKR1C23 was downregulated (P < 0.05) in placentitis in comparison to control in EN (Fig. 5G). This downregulation was accompanied with a marked decline in the median concentrations of 3αDHP (P < 0.01) and 20αDHP (P < 0.05) in placentitis in comparison to control (Fig. 6D and E). The immunoblot analysis of AKR1C23 protein expression supported the qRT-PCR and revealed a decline in immunoreactive AKR1C23 in placentitis compared to control EN (P < 0.05; Fig. 5H). The concentrations of P5, P4, 5αDHP, 3β,20αDHP, 17-OHP, DHEA, A4, and estrone did not differ significantly in placentitis in comparison to control in EN (Fig. 6).
The expression of steroidogenic enzymes in EN retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G), in the endometrium from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and B2M, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in EN retrieved from placentitis and control mares (H) and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The expression of steroidogenic enzymes in EN retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G), in the endometrium from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and B2M, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in EN retrieved from placentitis and control mares (H) and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The expression of steroidogenic enzymes in EN retrieved from mares with experimentally induced placentitis in comparison to those recovered from control mares. The mRNA expression of CYP11A1 (A), CYP17A1 (B), CYP19A1 (C), HSD3B1 (E), SRD5A1 (F), and AKR1C23 (G), in the endometrium from the placentitis (n = 4) and control groups (n = 4) was determined by qRT-PCR, normalized to ACTB and B2M, and expressed as −∆CT. qRT-PCR data are presented as dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Immunoblot analysis of AKR1C23 (H) and CYP19A1 (I) in EN retrieved from placentitis and control mares (H) and β-Actin was used as a loading control. Immunoblot data are presented as a dot plot, and the middle horizontal line represents the median. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; ∆CT, Delta of cycle threshold; AKR1C23, Aldo-keto reductase family 1, member C23; HSD3B1, hydroxy-delta-5-steroid dehydrogenase; CYP11A1, cytochrome P450 family 11A1; CYP17A1, cytochrome P450 family 17A1; CYP19A1, cytochrome P450 family 19A1; SRD5A1, Steroid 5 alpha-reductase 1.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in EN from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in EN from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The steroid concentrations in EN from placentitis (n = 4) and control groups (n = 4). Mass spectrometry was used to quantify steroid concentrations; P5 (A), P4 (B), 3αDHP (C), 5αDHP (D), 20αDHP (E), 3β,20αDHP (F), 17-OHP (G), DHEA (H), A4 (I), and estrone (J). Data are presented as a dot plot and the middle horizontal line represents the median. Key; P5, pregnenolone; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; 17α-OHP, 17α-hydroxyprogesterone; A4, Androstenedione.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The maternal peripheral concentration of steroids
The maternal peripheral concentration of different steroids in placentitis and control groups are illustrated in Supplementary Fig. 1 (see section on supplementary materials given at the end of this article). The peripheral maternal steroid concentrations did not show any significant difference between placentitis and control groups on the day of killing and tissue collection.
Expression of steroid receptors
The mRNA and protein expression of steroids receptors in CA and EN are illustrated in Figs 7 and 8, respectively. In CA, the mRNA expression of PR and ESR2 did not reveal any significant changes in the placentitis group in comparison to the control group. Similarly, the expression of PR protein did not reveal any significant changes between the placentitis and control groups. On the other hand, the mRNA expression of ESR1 was downregulated in placentitis in comparison to control (P = 0.057). Similarly, the protein expression of ESR1 was lower (P < 0.05) in placentitis group compared to control group (Fig. 8E). In EN, the mRNA expression of PR, ESR1, and ESR2 did not reveal any significant changes in the placentitis group in comparison to the control group. Similarly, the expression of PR and ESR1 protein did not reveal any significant changes between the placentitis and control groups.
The mRNA expression of steroid receptors: PR (A), ESR1 (B), and ESR2 (C) in CA (-1) and EN (-2) in placentitis (n = 4) and control groups (n = 4). Expression of each mRNA was determined by qRT-PCR, normalized to GAPDH and GUSB, and expressed as −∆CT. Data are presented as a dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Key; ∆CT, Delta of cycle threshold; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The mRNA expression of steroid receptors: PR (A), ESR1 (B), and ESR2 (C) in CA (-1) and EN (-2) in placentitis (n = 4) and control groups (n = 4). Expression of each mRNA was determined by qRT-PCR, normalized to GAPDH and GUSB, and expressed as −∆CT. Data are presented as a dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Key; ∆CT, Delta of cycle threshold; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The mRNA expression of steroid receptors: PR (A), ESR1 (B), and ESR2 (C) in CA (-1) and EN (-2) in placentitis (n = 4) and control groups (n = 4). Expression of each mRNA was determined by qRT-PCR, normalized to GAPDH and GUSB, and expressed as −∆CT. Data are presented as a dot plot and the middle horizontal line represents the mean while error bars represent s.e.m. Asterisks indicate the presence of a significant difference between groups (*P < 0.05; **P < 0.01). Key; ∆CT, Delta of cycle threshold; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Immunoblot analysis of PR and ESR1 in CA (A-1) and EN (A-2) retrieved from placentitis (n = 4) and control mares (n = 4). The protein expression of PR (B) and ESR1 (C) was determined by Western blotting and GAPDH was used as loading control. Data are presented as a dot plot and the middle horizontal line represents the median Asterisks indicate the presence of a significant difference between groups (*P < 0.05). Key; PR, Progesterone receptor; ESR, Estrogen receptor; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Immunoblot analysis of PR and ESR1 in CA (A-1) and EN (A-2) retrieved from placentitis (n = 4) and control mares (n = 4). The protein expression of PR (B) and ESR1 (C) was determined by Western blotting and GAPDH was used as loading control. Data are presented as a dot plot and the middle horizontal line represents the median Asterisks indicate the presence of a significant difference between groups (*P < 0.05). Key; PR, Progesterone receptor; ESR, Estrogen receptor; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Immunoblot analysis of PR and ESR1 in CA (A-1) and EN (A-2) retrieved from placentitis (n = 4) and control mares (n = 4). The protein expression of PR (B) and ESR1 (C) was determined by Western blotting and GAPDH was used as loading control. Data are presented as a dot plot and the middle horizontal line represents the median Asterisks indicate the presence of a significant difference between groups (*P < 0.05). Key; PR, Progesterone receptor; ESR, Estrogen receptor; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Discussion
To the best of our knowledge, this is the first study evaluating the influence of equine placentitis on steroid synthesis and metabolism at the tissue level in the fetal and maternal tissues of the placenta. The most significant findings of this study indicate that during acute placentitis, both CA and EN were experiencing progestin withdrawal, although this was not associated with detectable changes in maternal blood progestin concentrations.
Progestin withdrawal is implicated in the initiation of labor in several species and depends on the synthesis and/or metabolism of pregnanes (Liggins & Thorburn 1994). The present study revealed that equine placentitis was associated with the downregulation of the key genes coding for P4 metabolizing enzymes (SRD5A1 and AKR1C23) in the CA. This downregulation was accompanied by a marked decline in tissue concentrations of 5α-DHP, 3α-DHP, and 3β-20αDHP in the CA. In accordance, we recently reported the same mRNA expression profile for both genes in equine myometrium during placentitis, and this was also accompanied by a marked decline in myometrial concentrations of 5α-DHP, 3α-DHP, and 20αDHP (El-Sheikh Ali et al. 2019). Similarly, equine post-parturient placenta is associated with withdrawal of 5α-reduced pregnanes concurrent with a significant downregulation of placental mRNA expression of SRD5A1 (Legacki et al. 2018) and AKR1C23 (Ball and Loux, unpublished data). In a similar manner, the mRNA expression of SRD5A1 but not AKR1C1 is significantly lower in the chorioamniotic membranes from women with spontaneous and induced labor when compared to those not in labor (Lee et al. 2008). On the other hand, EN in the current study exhibited downregulation of mRNA expression of AKR1C23 accompanied by a decline of 3α-DHP and 3β-20αDHP tissue concentrations. These findings demonstrate that acute equine placentitis negatively affects progestin metabolism in the placenta with consequent progestin withdrawal at the tissue level.
Rationally, any obvious alteration in placental steroids will be reflected in the maternal peripheral circulation at a certain point. Recently, our laboratory has reported that acute induced placentitis is associated with a significant decline in 5α-DHP and its downstream metabolites in maternal circulation during the last 2–3 days preceding abortion (i.e <8 days after inoculation in mares with acute disease) in comparison to gestationally matched control mares (Wynn et al. 2018). In the current study, using the same inoculation model, mares were euthanized when they developed clinical signs of placentitis (i.e within 3–5 days of inoculation) before any experienced abortion. Although, our results revealed a significant decrease in CA tissue concentrations of 5α-DHP and 3α-DHP, we could not detect any significant change in these progestins in maternal peripheral concentrations. Taking into account the difference in timing of tissue collection in relation to induction of placentitis, these findings suggest that the early stage of the disease is associated with a localized progestin withdrawal in the CA which precedes a significant decline in peripheral concentrations of maternal progestins.
Progestins, acting through nuclear PR, are ultimately responsible for maintaining uterine quiescence in all placental mammals (Merlino et al. 2007, Mesiano et al. 2011, Wu & DeMayo 2017). We reported that equine placentitis is associated with progestin withdrawal and downregulation of PR (functional progestin withdrawal) in the myometrium (El-Sheikh Ali et al. 2019). Unlike our finding in the myometrium, the current study revealed that CA and EN are only associated with progestin withdrawal without any alteration in PR mRNA and protein expression.
Equine pregnancy is also associated with very high concentrations of peripheral estrogens derived from the feto-placental unit (Legacki et al. 2016b ) and a decline of estradiol and/or estrone sulfate is indicative of feto-placental demise or abnormality (Kasman et al. 1988, Canisso et al. 2017, Shikichi et al. 2017). However, the role of estrogens during equine pregnancy remains unclear. In the current study, the mRNA and protein expression of CYP19A1 was lower in CA retrieved from the placentitis group compared to the control group, and this reduced expression was associated with decline in CA concentrations of estrone. In support of this observation, placentitis is associated with a decline in peripheral estradiol-17β and estrone sulfate concentrations (Canisso et al. 2017, Shikichi et al. 2017). In addition, the present study revealed that the mRNA and protein expression of ESR1 but not ESR2 was lower in CA from placentitis group in comparison to controls. In a similar manner, we reported that equine myometrium is associated with significant downregulation of mRNA expression of both ESR1 and ESR2 during placentitis (El-Sheikh Ali et al. 2019). However, the role of this decline in estrogen signaling remains uncertain.
In conclusion, equine placentitis alters steroid synthesis and metabolism in the placenta. Both tissues exhibited a localized alteration in pregnane metabolism associated with progestin withdrawal, although this was not associated with marked changes in maternal blood progestin concentrations. This finding suggests that the early stage of the disease is associated with only localized placental progestin withdrawal. Further, CA tended to be associated with estrone withdrawal and downregulation of ESR1. Our working model is summarized in Fig. 9. The current study improves our understanding of molecular mechanisms underlying steroid synthesis and metabolism in equine placenta during placentitis.
The effect of equine placentitis on steroidogenesis and steroid receptors in the placenta. Asterisks indicate the presence of a significant difference between placentitis and control group (*P < 0.05). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; CYP19A1, cytochrome P450 family 19A1; AKR1C23, Aldo-keto reductase family 1, member C23; SRD5A1, Steroid 5 alpha-reductase 1; A4, Androstenedione; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The effect of equine placentitis on steroidogenesis and steroid receptors in the placenta. Asterisks indicate the presence of a significant difference between placentitis and control group (*P < 0.05). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; CYP19A1, cytochrome P450 family 19A1; AKR1C23, Aldo-keto reductase family 1, member C23; SRD5A1, Steroid 5 alpha-reductase 1; A4, Androstenedione; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
The effect of equine placentitis on steroidogenesis and steroid receptors in the placenta. Asterisks indicate the presence of a significant difference between placentitis and control group (*P < 0.05). Dagger (†) indicates the presence of a trend (0.1 > P ≥ 0.05). Key; CYP19A1, cytochrome P450 family 19A1; AKR1C23, Aldo-keto reductase family 1, member C23; SRD5A1, Steroid 5 alpha-reductase 1; A4, Androstenedione; P4, progesterone; 5αDHP, 5α-dihydroprogesterone; 3αDHP, allopregnanolone; 3β,20αDHP, 5α-pregnan-3β,20α-diol; 20αDHP, 20α-hydroxy-5α-dihydroprogesterone; PR, Progesterone receptor; ESR, Estrogen receptor.
Citation: Reproduction 159, 3; 10.1530/REP-19-0420
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-19-0420.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This research was supported by the Albert G. Clay Endowment, the Clay Fellowship and the Mellon postdoctoral scholarship of the University of Kentucky and the John P. Hughes Endowment of the University of California-Davis.
Author contribution statement
H E A performed experiments, analyzed data, shared in conceiving the study, and wrote the paper. E L L, S D S, and A J C performed mass spectrometry analysis and discussed the results. K E S performed experiments and analyzed data. S C L, P D and A E discussed the results and reviewed the manuscript. B A B conceived the study, analyzed data, provided resources, supervision, discussed the results and reviewed the manuscript. All authors read the manuscript and approved it.
References
Brown AG, Leite RS & Strauss JF 3rd 2004 Mechanisms underlying ‘functional’ progesterone withdrawal at parturition. Annals of the New York Academy of Sciences 36–49. (https://doi.org/10.1196/annals.1335.004)
Brown KA, Boerboom D, Bouchard N, Dore M, Lussier JG & Sirois J 2006 Human chorionic gonadotropin-dependent induction of an equine aldo-keto reductase (AKR1C23) with 20alpha-hydroxysteroid dehydrogenase activity during follicular luteinization in vivo. Journal of Molecular Endocrinology 449–461. (https://doi.org/10.1677/jme.1.01987)
Canisso IF, Ball BA, Cray C, Williams NM, Scoggin KE, Davolli GM, Squires EL & Troedsson MH 2014 Serum amyloid A and haptoglobin concentrations are increased in plasma of mares with ascending placentitis in the absence of changes in peripheral leukocyte counts or fibrinogen concentration. American Journal of Reproductive Immunology 376–385. (https://doi.org/10.1111/aji.12278)
Canisso IF, Ball BA, Esteller-Vico A, Williams NM, Squires EL & Troedsson MH 2017 Changes in maternal androgens and oestrogens in mares with experimentally-induced ascending placentitis. Equine Veterinary Journal 244–249. (https://doi.org/10.1111/evj.12556)
Conley AJ 2016 Review of the reproductive endocrinology of the pregnant and parturient mare. Theriogenology 355–365. (https://doi.org/10.1016/j.theriogenology.2016.04.049)
Conley A & Hinshelwood M 2001 Mammalian aromatases. Reproduction 685–695. (https://doi.org/10.1530/rep.0.1210685)
Conley AJ & Mason JI 1990 Placental steroid hormones. Baillière’s Clinical Endocrinology and Metabolism 249–272. (https://doi.org/10.1016/s0950-351x(05)80050-3)
Conley A, Mason J, Conley A & Mason J 1994 Endocrine function of the placenta. Textbook of Fetal Physiology pp 16–29; Oxford, UK: Oxford University Press
Conley AJ, Corbin CJ, Hinshelwood MM, Liu Z, Simpson ER, Ford JJ & Harada N 1996 Functional aromatase expression in porcine adrenal gland and testis. Biology of Reproduction 497–505. (https://doi.org/10.1095/biolreprod54.2.497)
El-Sheikh Ali H, Legacki EL, Loux SC, Esteller-Vico A, Dini P, Scoggin KE, Conley AJ, Stanley SD & Ball BA 2019 Equine placentitis is associated with a downregulation in myometrial progestin signaling. Biology of Reproduction 162–176. (https://doi.org/10.1093/biolre/ioz059)
Enmark E, Pelto-Huikko M, Grandien K, Lagercrantz S, Lagercrantz J, Fried G, Nordenskjold M & Gustafsson JA 1997 Human estrogen receptor beta-gene structure, chromosomal localization, and expression pattern. Journal of Clinical Endocrinology and Metabolism 4258–4265. (https://doi.org/10.1210/jcem.82.12.4470)
Esteller-Vico A, Ball BA, Troedsson MHT & Squires EL 2017 Endocrine changes, fetal growth, and uterine artery hemodynamics after chronic estrogen suppression during the last trimester of equine pregnancy. Biology of Reproduction 414–423. (https://doi.org/10.1095/biolreprod.116.140533)
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B & Esteller-Vico A 2019 Uterine cervix as a fundamental part of the pathogenesis of pregnancy loss associated with ascending placentitis in mares. Theriogenology Epub. (https://doi.org/10.1016/j.theriogenology.2019.10.017)
Fowden AL, Forhead AJ & Ousey JC 2008 The endocrinology of equine parturition. Experimental and Clinical Endocrinology and Diabetes 393–403. (https://doi.org/10.1055/s-2008-1042409)
Ginther O 1979 Reproductive Biology of the Mare-Basic and Applied Aspects.
Guzeloglu-Kayisli O, Kayisli UA, Semerci N, Basar M, Buchwalder LF, Buhimschi CS, Buhimschi IA, Arcuri F, Larsen K & Huang JS et al. 2015 Mechanisms of chorioamnionitis-associated preterm birth: interleukin-1beta inhibits progesterone receptor expression in decidual cells. Journal of Pathology 423–434. (https://doi.org/10.1002/path.4589)
Holtan DW, Squires EL, Lapin DR & Ginther OJ 1979 Effect of ovariectomy on pregnancy in mares. Journal of Reproduction and Fertility: Supplement 27 457–463.
Holtan DW, Houghton E, Silver M, Fowden AL, Ousey J & Rossdale PD 1991 Plasma progestagens in the mare, fetus and newborn foal. Journal of Reproduction and Fertility: Supplement 517–528.
Kasman LH, Hughes JP, Stabenfeldt GH, Starr MD & Lasley BL 1988 Estrone sulfate concentrations as an indicator of fetal demise in horses. American Journal of Veterinary Research 184–187.
Klein C, Rutllant J & Troedsson MH 2011 Expression stability of putative reference genes in equine endometrial, testicular, and conceptus tissues. BMC Research Notes 120. (https://doi.org/10.1186/1756-0500-4-120)
Leary SL, Underwood W, Anthony R, Gwaltney-Brant S, Poison A & Meyer R 2013 AVMA Guidelines for the Euthanasia of Animals, 2013 ed. Schaumburg, IL: American Veterinary Medical Association.
LeBlanc MM 2010 Ascending placentitis in the mare: an update. Reproduction in Domestic Animals = Zuchthygiene (Supplement 2) 28–34. (https://doi.org/10.1111/j.1439-0531.2010.01633.x)
Lee RH, Stanczyk FZ, Stolz A, Ji Q, Yang G & Goodwin TM 2008 AKR1C1 and SRD5A1 messenger RNA expression at term in the human myometrium and chorioamniotic membranes. American Journal of Perinatology 577–582. (https://doi.org/10.1055/s-0028-1085626)
Legacki EL, Corbin CJ, Ball BA, Wynn M, Loux S, Stanley SD & Conley AJ 2016a Progestin withdrawal at parturition in the mare. Reproduction 323–331. (https://doi.org/10.1530/REP-16-0227)
Legacki EL, Scholtz EL, Ball BA, Stanley SD, Berger T & Conley AJ 2016b The dynamic steroid landscape of equine pregnancy mapped by mass spectrometry. Reproduction 421–430. (https://doi.org/10.1530/REP-15-0547)
Legacki EL, Ball BA, Corbin CJ, Loux SC, Scoggin KE, Stanley SD & Conley AJ 2017 Equine fetal adrenal, gonadal and placental steroidogenesis. Reproduction 445–454. (https://doi.org/10.1530/REP-17-0239)
Legacki EL, Corbin CJ, Ball BA, Scoggin KE, Stanley SD & Conley AJ 2018 Steroidogenic enzyme activities in the pre- and post-parturient equine placenta. Reproduction 51–59. (https://doi.org/10.1530/REP-17-0472)
Liggins G & Thorburn G 1994 Initiation of Parturition, Marshall’s Physiology of Reproduction. Springer, pp 863–1002.
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 402–408. (https://doi.org/10.1006/meth.2001.1262)
Lof H, Pires-Neves A, Gregory J, Winter G, Garbade P, Wolf C, Richter G, Jobim M, Gregory R & Mattos R 2010 Evaluation of the combined utero-placental thickness (CUPT) and of vulvar conformation as indicators of placentitis in pregnant mares. Animal Reproduction Science 329–330. (https://doi.org/10.1016/j.anireprosci.2010.04.134)
Loux SC, Fernandes CB, Dini P, Wang K, Wu X, Baxter D, Scoggin KE, Troedsson MHT, Squires EL & Ball BA 2019 Small RNA (sRNA) expression in the chorioallantois, endometrium and serum of mares following experimental induction of placentitis. Reproduction, Fertility, and Development 1144–1156. (https://doi.org/10.1071/RD18400)
Merlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM & Mesiano S 2007 Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. Journal of Clinical Endocrinology and Metabolism 1927–1933. (https://doi.org/10.1210/jc.2007-0077)
Mesiano S, Wang Y & Norwitz ER 2011 Progesterone receptors in the human pregnancy uterus: do they hold the key to birth timing? Reproductive Sciences 6–19. (https://doi.org/10.1177/1933719110382922)
Pashen RL 1984 Maternal and foetal endocrinology during late pregnancy and parturition in the mare. Equine Veterinary Journal 233–238. (https://doi.org/10.1111/j.2042-3306.1984.tb01918.x)
Renaudin CD, Troedsson MH, Gillis CL, King VL & Bodena A 1997 Ultrasonographic evaluation of the equine placenta by transrectal and transabdominal approach in the normal pregnant mare. Theriogenology 559–573. (https://doi.org/10.1016/s0093-691x(97)00014-9)
Sanderson JT 2009 Placental and fetal steroidogenesis. Methods in Molecular Biology 127–136. (https://doi.org/10.1007/978-1-60327-009-0_7)
Schneider CA, Rasband WS & Eliceiri KW 2012 NIH image to ImageJ: 25 years of image analysis. Nature Methods 671–675. (https://doi.org/10.1038/nmeth.2089)
Scholtz EL, Krishnan S, Ball BA, Corbin CJ, Moeller BC, Stanley SD, McDowell KJ, Hughes AL, McDonnell DP & Conley AJ 2014 Pregnancy without progesterone in horses defines a second endogenous biopotent progesterone receptor agonist, 5alpha-dihydroprogesterone. PNAS 3365–3370. (https://doi.org/10.1073/pnas.1318163111)
Shikichi M, Iwata K, Ito K, Miyakoshi D, Murase H, Sato F, Korosue K, Nagata S & Nambo Y 2017 Abnormal pregnancies associated with deviation in progestin and estrogen profiles in late pregnant mares: a diagnostic aid. Theriogenology 75–81. (https://doi.org/10.1016/j.theriogenology.2017.04.024)
Short RV 1959 Progesterone in blood. IV. Progesterone in the blood of mares. Journal of Endocrinology 207–210. (https://doi.org/10.1677/joe.0.0190207)
Squires EL & Ginther OJ 1975 Collection technique and progesterone concentration of ovarian and uterine venous blood in mares. Journal of Animal Science 275–281. (https://doi.org/10.2527/jas1975.402275x)
Thigpen AE, Silver RI, Guileyardo JM, Casey ML, McConnell JD & Russell DW 1993 Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. Journal of Clinical Investigation 903–910. (https://doi.org/10.1172/JCI116665)
Troedsson M & Zent W 2004 Clinical Ultrasonographic Evaluation of the Equine Placenta as a Method to Successfully Identify and Treat Mares with Placentitis, pp. 66–67.
Walters KW, Corbin CJ, Anderson GB, Roser JF & Conley AJ 2000 Tissue-specific localization of cytochrome P450 aromatase in the equine embryo by in situ hybridization and immunocytochemistry. Biology of Reproduction 1141–1145. (https://doi.org/10.1095/biolreprod62.5.1141)
Wesson JA & Ginther OJ 1980 Fetal and maternal gonads and gonadotropins in the Pony1. Biology of Reproduction 735–743. (https://doi.org/10.1095/biolreprod22.4.735)
Wu SP & DeMayo FJ 2017 Chapter 6 – Progesterone receptor signaling in uterine myometrial physiology and preterm birth. In Current Topics in Developmental Biology. Eds Forrest D & Tsai S. Academic Press, pp. 171–190. (https://doi.org/10.1016/bs.ctdb.2017.03.001)
Wynn MAA, Ball BA, May J, Esteller-Vico A, Canisso I, Squires E & Troedsson M 2018 Changes in maternal pregnane concentrations in mares with experimentally-induced, ascending placentitis. Theriogenology 130–136. (https://doi.org/10.1016/j.theriogenology.2018.09.001)
