Abstract
Blind enucleation is used in porcine somatic cell nuclear transfer (SCNT) to remove the metaphase II (MII) spindle from the oocyte. Deviation of the MII spindle location, however, leads to incomplete enucleation (IE). Here, we report that the rate of complete enucleation (CE) using the blind method was 80.2 ± 1.7%, although this significantly increased when the polar body-MII deviation was minimized (≦45°). While it is established that IE embryos will not survive to full term, the effect of IE on early stage development is unknown. We have previously demonstrated in mice and pigs that ETV2 deletion results in embryonic lethality due to the lack of hematoendothelial lineages. We observed that ETV2-null cloned embryos derived from blindly and incompletely enucleated oocytes had both WT and mutant sequences at E18 and, using FISH analysis, we observed triploidy. We also compared SCNT embryos generated from either CE or intentionally IE oocytes using the spindle viewer system. We observed a higher in vitro blastocyst rate in the IE versus the CE-SCNT embryos (31.9 ± 3.2% vs 21.0 ± 2.1%). Based on known processes in normal fertilization, we infer that the IE-SCNT embryos extruded the haploid second PB after fusion with donor fibroblasts and formed a near-triploid aneuploid nucleus in each blastomere. These studies demonstrate the peri-implantation survival of residual haploid nuclei following IE and emphasize the need for complete enucleation especially for the analysis of SCNT embryos in the peri-implantation stage and will, further, impact the field of reverse xenotransplantation.
Introduction
The mammalian somatic cell nucleus can be reprogrammed by the cytoplasm of an enucleated mature oocyte during the metaphase II (MII) developmental stage (Wilmut et al. 1997). Using the somatic cell nuclear transfer (SCNT) technique, genetically identical embryos are produced by introducing the somatic nucleus from the same cell source into enucleated MII oocytes. Successful enucleation requires the removal of the MII chromosomes together with minimal amounts of cytoplasm (ooplasm). Mammalian species, which are of significant translational value, present greater challenges regarding the visualization and removal of the MII plate. Multiple methods of enucleation are available for the purpose of SCNT yet most methods have limitations (Smith 1993, Iuso et al. 2013). Physical enucleation methods are performed to aspirate the MII chromosomes using the presence of the first polar body (PBI) as a guide (Lai & Prather 2003, Yuan et al. 2017). This method of blind enucleation has the limitation of depleting oocyte volume due to the withdrawal of excessive ooplasm and this method also has a high occurrence of incomplete enucleation. A visually guided method of physical enucleation using polarized light microscopy, which allows for the observation of birefringence, assures complete enucleation. Both methods of physical enucleation require significant training and manual dexterity. Other methods which include the use of DNA stains have been utilized (Smith 1993), although UV exposure is detrimental for embryo development. Chemically assisted enucleation has also been used. Demecolcine treatment, for example, forces the DNA to telophase II so that an oocyte is enucleated without UV exposure by aspirating a small cytoplasmic protrusion near the PBI (Iuso et al. 2013). This method, however, has a toxic effect on embryo development and it is time consuming. Polarized light microscopy was developed as a non-invasive method to detect the MII spindle in living oocytes; therefore, it has been widely used to study the meiotic spindle in human embryos (Moon et al. 2003, Rienzi et al. 2004), whereas only a limited number of publications have used this technique to produce porcine SCNT generated embryos (Li et al. 2010, Caamaño et al. 2011).
In the present study, we investigated our enucleation rate by blind physical enucleation and its correlation with PBI-MII deviation in porcine oocytes. We also analyzed the E18 SCNT embryos which were generated using blindly enucleated oocytes and ETV2-null fibroblasts followed by embryo transfer (Das et al. 2020). These ETV2-null embryos were generated to create a niche (a porcine embryo that lacks the genes to produce vasculature and blood) to allow for blastocyst complementation with human cells (Das et al. 2020). Additionally, we generated cloned ETV2-null embryos from oocytes that had complete (CE) and intentionally incomplete enucleation (IE) oocytes under polarized light microscopy. The early developmental competences of CE- and IE-SCNT embryos were compared in vitro, and the ploidy difference between them was examined by metaphase chromosome spreading. We also utilized fluorescence in situ hybridization (FISH) to analyze the ploidy of ETV2-null E18 cloned embryos, which were assumed to be derived from IE oocytes (using the blind method) as they had a WT genotype and phenotype. Here, we demonstrate the necessity of CE when engineering cloned embryos that are to be analyzed at early stages. Importantly, we have determined that IE embryos display falsely increased blastocyst rates that will not translate to successful full term development of the embryo.
Materials and methods
The performance of these studies were approved by the Institutional Animal Care and Use Committee (IACUC) guidelines at Midwest Research Swine (MRS) and in collaboration with the University of Minnesota.
In vitro maturation (IVM) of porcine oocytes
Porcine oocytes aspirated from ovaries were cultured as previously described (Yuan et al. 2017). Briefly, cumulus-oocyte-complexes (COCs) matured for 40–42 h in Medium-199 (Corning, #10-060-CV) supplemented with 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng/mL EGF, 0.5 μg/mL LH, 10 ng/mL FSH, 0.1% (w/v) polyvinyl alcohol, 20 ng/mL LIF, 20 ng/mL IGF1 and 40 ng/mL FGF2. COCs were denuded of cumulus cells by vortexing in 0.1% hyaluronidase medium.
MII spindle deviation measurement
Denuded oocytes were fixed with 4% paraformaldehyde and incubated with 10 µg/mL DAPI for 5 min to visualize the MII spindle. Each oocyte was immobilized using a holding pipette and rotated using an injection pipette to visualize the maximum deviation. The images were acquired using a fluorescence microscope (IX83, Olympus) with CellSense Dimension software (Olympus). The center of an oocyte was identified using the Concentric Circles plugin function for ImageJ software (https://imagej.nih.gov/ij/plugins/concentric-circles.html) after drawing a circle along the boundary of the oolema. Then, the angle between two lines connecting the oocyte center with either the PBI or the MII spindle was measured (Fig. 1A). The deviation angles were categorized into four grades: Grade I, 15° or less; Grade II, over 15° to 45°; Grade III, over 45° to 90° or less; and Grade IV, over 90°.
MII spindle deviation of mature oocytes and enucleation rate using the blind method. (A) Measurement of the deviation between PBI and MII plate. (B) MII spindle deviation of mature oocytes was measured and graded in three different experiments. (C) The enucleation rate using the blind method was measured in the same experiment and the correlation shown.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
MII spindle deviation of mature oocytes and enucleation rate using the blind method. (A) Measurement of the deviation between PBI and MII plate. (B) MII spindle deviation of mature oocytes was measured and graded in three different experiments. (C) The enucleation rate using the blind method was measured in the same experiment and the correlation shown.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
MII spindle deviation of mature oocytes and enucleation rate using the blind method. (A) Measurement of the deviation between PBI and MII plate. (B) MII spindle deviation of mature oocytes was measured and graded in three different experiments. (C) The enucleation rate using the blind method was measured in the same experiment and the correlation shown.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Strategy for comparison of CE vs IE embryos
To compare and contrast the results of blind enucleation versus spindle viewer assisted enucleation, we undertook an experimental strategy, as schematized in Fig. 2, using either ETV2-null or GFP-expressing fibroblasts. Specifically, blind enucleation methods (Fig. 2A) were used to generate ETV2-null embryos, which developed in vivo. The Spindle Viewer system was used to perform CE (Fig. 2B) or to intentionally perform IE (Fig. 2C), and then CE and IE oocytes were subsequently used to generate embryos cloned with GFP-labeled porcine fibroblasts. These embryos were evaluated after 6 days of in vitro development.
Construction protocol for SCNT embryos using different enucleation methods. (A) ETV2−/−SCNT embryos were derived from blindly enucleated oocytes, transferred into a gilt at E4, and harvested at E18. (B) Spindle viewer system used to generate complete enucleation (CE) and intentionally incomplete enucleation (IE, C). In vitro development of CE- and IE-SCNT embryos were analyzed up to 6 days.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Construction protocol for SCNT embryos using different enucleation methods. (A) ETV2−/−SCNT embryos were derived from blindly enucleated oocytes, transferred into a gilt at E4, and harvested at E18. (B) Spindle viewer system used to generate complete enucleation (CE) and intentionally incomplete enucleation (IE, C). In vitro development of CE- and IE-SCNT embryos were analyzed up to 6 days.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Construction protocol for SCNT embryos using different enucleation methods. (A) ETV2−/−SCNT embryos were derived from blindly enucleated oocytes, transferred into a gilt at E4, and harvested at E18. (B) Spindle viewer system used to generate complete enucleation (CE) and intentionally incomplete enucleation (IE, C). In vitro development of CE- and IE-SCNT embryos were analyzed up to 6 days.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Generation and culture of genetically modified porcine embryonic fibroblasts
GFP-labeled porcine embryonic fibroblasts were a gift from Dr Randall Prather (National Swine Resource and Research Center, University of Missouri) and these fibroblasts were cultured as previously described (Whitworth et al. 2014). Our previous studies demonstrate that Etv2 is a master regulator of the hematoendothelial lineages (Rasmussen et al. 2012, 2013, Chan et al. 2013, Behrens et al. 2014, Singh et al. 2015, Garry 2016, Gong et al. 2017, Koyano-Nakagawa & Garry 2017) and that the Etv2-null mouse lacks the hematoendothelial lineages (Rasmussen et al. 2012, Koyano-Nakagawa et al. 2015, Singh et al. 2015). In these studies, we used previously described ETV2-null porcine fibroblasts (Das et al. 2020) which were generated by the CRISPR/Cas9 system to be used as nuclear donor cells to generate ETV2 null porcine embryos. Specific gRNAs flanking porcine ETV2 (5′: cagcagacgtcacaatccgc and 3′: tggtaccgactagatcctcc) were cloned into the mammalian-codon-optimized Cas9 expressing plasmid pX459 (#48139, Addgene) as described elsewhere (Koyano-Nakagawa et al. 2015). Six micrograms of all-in-one CRISPR/Cas9 plasmid were delivered into approximately 6 × 105 of porcine fetal fibroblasts using the Nucleofector 2b device (Lonza) with the Basic Nucleofector™ Kit for Primary Mammalian Fibroblasts (#VPI-1002, Lonza). They were cultured for 2−3 days in 5% CO2 at 38.5°C, and then 50 cells were plated on a 10 cm plate. After 2 weeks of culture, colonies were picked using cloning cylinders. After resuspending the cells, one-third of them were lysed in 40 mM Tris (pH 8.9), 0.9% Triton X-100, 0.4 mg/mL proteinase K (NEB) solution and analyzed using PCR.
Enucleation of porcine oocytes under polarized light microscopy
Denuded mature oocytes were placed in a drop of the manipulation medium (Medium-199 (Gibco, #31100-035) supplemented with 0.6 mM NaHCO3, 2.9 mM HEPES, 12 mM NaCl, 10 µg/mL gentamicin, 7 µg/mL cytochalasin B and 3 mg/mL BSA) on a glass bottom dish (MatTek, #P50G-1.5-14) and were immobilized with a holding pipette. The MII spindle was visualized using the Oosight™ spindle viewer system (Hamilton Thorne), which was coordinated with the 20× objective of the inverted microscope. For CE, the MII spindle was aspirated with PBI and ooplasm into a microcapillary tube connected to the microinjector (IM-11-2, Narishige), and enucleation was confirmed by the presence of MII plate in the injection capillary. For IE, the PBI and equal amounts of ooplasm were aspirated while avoiding the MII spindle. For blind enucleation, the PBI and approximately 10% of cytoplasm adjacent to the PBI were aspirated without using the spindle viewer system.
Somatic cell nuclear transfer technology and embryo transfer
Cloned embryos were produced using somatic nuclear transfer techniques as previously described (Yuan et al. 2017). The nuclei from ETV2-null fibroblasts were introduced into blindly enucleated oocytes, and the GFP-labeled nuclei from the fibroblasts were introduced into IE- and CE-oocytes. After placing a donor fibroblast cell into the perivitelline space of each enucleated oocyte, electric fusion was induced using double DC pulses at 1.2 kV/cm for 30 μsec in the fusion medium (0.3 M mannitol, 0.1 mM CaCl2, 0.1 mM MgCl2, and 0.5 mM Hepes). Fusion in CE and IE was confirmed by expression of GFP in fused embryos 30 min after fusion. The fused embryos were activated in 200 μM Thimerosal (T8784, Sigma-Aldrich) for 10 min and in 8 mM Dithiothreitol (D5545, Sigma-Aldrich) for 30 min. The activated embryos were cultured in PZM-MU2 medium supplemented with 0.5 μM Scriptaid (S7817, Sigma-Aldrich) for 16 h in 5% CO2 and 5% O2 in the air at 38.5°C, and then were moved into fresh PZM-MU2. The blastocyst formation of IE- and CE-SCNT embryos was counted at day 6 of in vitro culture. The ETV2-null cloned embryos at E4 were surgically transferred into the oviduct of a gilt 4 days following the onset of estrus, as previously described (Das et al. 2020). Embryos were harvested at E18 following uterine isolation at the local abattoir.
PCR analysis and genotype of ETV2 deletion
Genomic DNA was extracted from ETV2 null fibroblasts or E18 SCNT embryos using the Wizard SV Genomic DNA Purification System (Promega). PCR was performed using GoTaq Green Master Mix (Promega) with 1 µL of DNA extract and primers to detect the shortened or internal ETV2 locus. The cycling program included: an initial 2 min denaturation at 98°C, followed by 33 cycles of 10 s at 98°C, 30 s at 58°C, and 30 s at 72°C.
Immunohistochemistry of the E18 SCNT embryos
E18 embryos were genotyped to confirm the inclusion of internal sequences of ETV2, sectioned and immunohistochemistry was performed as previously described (Koyano-Nakagawa et al. 2012) using rat anti-TIE2 (1:500, eBioscience 14-5987) and rabbit anti-VWF (1:300, Dako A0082) antisera. Secondary antibodies included: Cy3-donkey anti-rat and Cy3-donkey anti-rabbit sera at 1:400 dilution. These antibodies were previously characterized and demonstrated to cross react with porcine proteins.
Fluorescence in situ hybridization (FISH) for the E18 SCNT embryos
Cryosections of ETV2-null SCNT embryos were processed for FISH. Two porcine BAC clones (RP44-258H15 and RP44-285D12, CHORI BACPAC Resources, Oakland, CA, USA), which hybridized to pig chromosome 1, combined to generate a 400 kb probe. BACs were cultured and DNA was extracted using plasmid maxiprep kit (Invitrogen). Porcine DNA probes were labeled by Nick Translation Kit (Abott Molecular) using Orange-552 dUTP (Enzo Life Science). The labeled DNA was precipitated in COT-1 DNA, salmon sperm DNA, sodium acetate and 95% ethanol, then dried and resuspended in 50% formamide FISH hybridization buffer. The slide was pretreated in RNase/2X SSC solution and pepsin followed by denaturation with the probe/hybridization buffer mix, the sections were co-denatured at 75°C for 5 min and hybridized for 48 h at 37°C in a humidified chamber. The FISH sections were washed in 2× SSC at 72°C for 5 to 10 s and counterstained with DAPI. Fluorescent signals were visualized on an Olympus BX61 microscope workstation (Applied Spectral Imaging, Vista, CA, USA) with DAPI and Texas Red filter sets. FISH images were captured using FISHView ASI software.
Nuclear staining and metaphase chromosome spreading for the in vitro SCNT embryos
The in vitro SCNT embryos were fixed in 4% paraformaldehyde (PFA) for 15 min (either 30 min after fusion or at 24 h after activation). Fixed embryos were stained with 10 µg/mL DAPI for 10 min and observed under the fluorescence microscope. For the ploidy analysis of the in vitro SCNT embryos, the metaphase chromosomes were spread on the slide glass as previously described (Wramsby & Liedholm 1984). At E6, 6 CE- and 16 IE SCNT embryos were collected. After 8 h of culture in 0.1 μg/mL demecolcine (D1925, Sigma-Aldrich), the embryos were treated with 1% sodium citrate for 10 min. Each embryo was transferred to Fixative A (distilled water, ethanol and acetic acid (5:4:1)). After the embryos became transparent in 15 s, they were moved to a glass slide where three drops of Fixative B (ethanol and acetic acid (3:1)) were placed on each embryo, then the slides were dried on a warming plate, and stained with Modified Giemsa Stain (GS500, Sigma-Aldrich) for 30 min. The slides were observed using a 100X oil objective lens, and the images were captured using the BandView (Applided Spectral Imaging) digital karyotyping system software.
Statistical analysis
Differences of the mean values between groups were evaluated by Wilcoxon test or Mann–Whitney test using Prism 8 (GraphPad Software, Inc.) as indicated in the figure legends. All mean values were shown as mean ± s.e.m.
Results
Complete enucleation rate using blind enucleation methodology
In 12 sets of blind enucleation experiments using a total of 569 oocytes, we achieved CE in 80.2 ± 1.7% of the oocytes. The range of CE varied from 73.2 to 94.4%. In three of those experiments, the MII spindle deviation was also measured in the oocytes, and it showed wide range of deviation (Fig. 1A). As anticipated, we observed an association between low spindle deviation and high CE rate (Fig. 1B). Specifically, when grade I and II deviations were present in 94.9% of a subset of oocytes, the CE rate was 94.4%. When grade I and II deviations were present in 84.2% of a subset of oocytes, the CE rate was 84.0% and when the grade I and II deviations were present in 75.3% of a subset of oocytes, the CE rate was 81.3% (Fig. 1C). These data indicate that greater spindle deviation is associated with increased IE.
IE embryos generated with blind enucleation display triploid chromosomes in each nucleus
Deletion of ETV2 in the donor fibroblasts was confirmed by the presence of shortened 5′F/3′R amplification and the absence of internal F/R amplification (Fig. 3A, B and C). Seven and five embryos, respectively, were harvested at E18 from two different gilts after ETV2-null SCNT embryos were transferred. Using PCR analysis, the shortened ETV2 fragment was amplified with the 5′F/3′R primer set in all embryos. The internal fragments, however, were also amplified in 4 of 12 embryos (Fig. 3C), consistent with a WT genotype. We further observed that these embryos displayed the normal development of vascular and hematoendothelial lineages (Fig. 3D). Using immunohistochemistry, we confirmed the presence of hematoendothelial lineages as we observed positive staining with TIE2 and VWF antibodies (Fig. 3E and F) in IE-SCNT embryos. In contrast, embryos with a confirmed ETV2-null genotype and without WT genotype were negative for these hematoendothelial lineage markers and lacked these lineages (Fig. 3H, I and J). Additionally, IE embryos were determined to have triploid chromosomes in each nucleus as determined by the chromosome 1-specific DNA probes using FISH analysis (Fig. 3G) as opposed to the ETV2-null CE embryo which has diploid chromosomes in each nucleus (Fig. 3K).
In vivo development of the ETV2 mutant embryos generated using the blind methodology at E18. (A and B) Primer designation to detect the ETV2 mutation and PCR analysis of E18 embryos. (C) Genotypic analysis of embryos using. WT, wild type DNA. DF, donor fibroblasts. (D, E, F and G) Embryo which contains both shortened and internal ETV2 sequences. Note the presence of hematoendothelial lineage markers TIE2 (E) and VWF (F) and the observation of triploidy using FISH analysis of chromosome1-specific DNA probe (G). (H, I, J and K) Analysis of ETV2-null embryos. A representative example of an ETV2-null embryo, which displays no evidence of hematoendothelial lineages (I and J) and has diploid nuclei (K). Scale bars represent 500 µm in D and H, 100 µm in E, F, I and J, and 10 µm in G and K.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
In vivo development of the ETV2 mutant embryos generated using the blind methodology at E18. (A and B) Primer designation to detect the ETV2 mutation and PCR analysis of E18 embryos. (C) Genotypic analysis of embryos using. WT, wild type DNA. DF, donor fibroblasts. (D, E, F and G) Embryo which contains both shortened and internal ETV2 sequences. Note the presence of hematoendothelial lineage markers TIE2 (E) and VWF (F) and the observation of triploidy using FISH analysis of chromosome1-specific DNA probe (G). (H, I, J and K) Analysis of ETV2-null embryos. A representative example of an ETV2-null embryo, which displays no evidence of hematoendothelial lineages (I and J) and has diploid nuclei (K). Scale bars represent 500 µm in D and H, 100 µm in E, F, I and J, and 10 µm in G and K.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
In vivo development of the ETV2 mutant embryos generated using the blind methodology at E18. (A and B) Primer designation to detect the ETV2 mutation and PCR analysis of E18 embryos. (C) Genotypic analysis of embryos using. WT, wild type DNA. DF, donor fibroblasts. (D, E, F and G) Embryo which contains both shortened and internal ETV2 sequences. Note the presence of hematoendothelial lineage markers TIE2 (E) and VWF (F) and the observation of triploidy using FISH analysis of chromosome1-specific DNA probe (G). (H, I, J and K) Analysis of ETV2-null embryos. A representative example of an ETV2-null embryo, which displays no evidence of hematoendothelial lineages (I and J) and has diploid nuclei (K). Scale bars represent 500 µm in D and H, 100 µm in E, F, I and J, and 10 µm in G and K.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
IE-SCNT embryos display higher blastocyst rate and abnormality in ploidy than CE embryos at E6
In 13 separate experiments, using the spindle viewer, a total of 619 CE-oocytes and 668 IE-oocytes were fused with the porcine fetal fibroblasts using electrical stimulation. The fusion rates of CE- and IE-oocytes were 95.5 ± 0.7% and 95.3 ± 1.3%, respectively (Fig. 4A). Thirty minutes after fusion, 77.1 ± 7.6% of IE-SCNT embryos extruded a secondary polar body (PBII), while polar body extrusion was not observed in any of the CE-SCNT embryos (Fig. 4B, C, D and E). After 24 h of in vitro culture, a single nucleus was found in each blastomere of the IE-SCNT embryos (Fig. 4F and G).
Fusion rate and in vitro development of IE- or CE-SCNT embryos using the mitotic spindle viewer. (A) Fusion rates between CE- and IE-SCNT embryos are not significantly different. (B, C, D and E) SCNT embryos derived from CE- (B and C) and IE-oocytes (D and E) stained with DAPI 30 min after fusion. Arrows indicate the PBII. (F and G) Representative IE-SCNT embryo in the 2-cell stage 24 h after fusion. (H) Blastocyst rate at E6 embryos demonstrated an increased rate of IE embryos compared to CE embryos. (I) Total cell number of CE and IE blastocysts at E6 are not significantly different. (J and K) The metaphase chromosomes of embryos were spread on slide glasses and stained with Giemsa Stain. (L) The number of chromosomes in each nucleus was counted and graphically displayed. P values were calculated by Wilcoxon test (A and H) or Mann–Whitney test (I and L). Scale bar represents 20 µm in B.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Fusion rate and in vitro development of IE- or CE-SCNT embryos using the mitotic spindle viewer. (A) Fusion rates between CE- and IE-SCNT embryos are not significantly different. (B, C, D and E) SCNT embryos derived from CE- (B and C) and IE-oocytes (D and E) stained with DAPI 30 min after fusion. Arrows indicate the PBII. (F and G) Representative IE-SCNT embryo in the 2-cell stage 24 h after fusion. (H) Blastocyst rate at E6 embryos demonstrated an increased rate of IE embryos compared to CE embryos. (I) Total cell number of CE and IE blastocysts at E6 are not significantly different. (J and K) The metaphase chromosomes of embryos were spread on slide glasses and stained with Giemsa Stain. (L) The number of chromosomes in each nucleus was counted and graphically displayed. P values were calculated by Wilcoxon test (A and H) or Mann–Whitney test (I and L). Scale bar represents 20 µm in B.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
Fusion rate and in vitro development of IE- or CE-SCNT embryos using the mitotic spindle viewer. (A) Fusion rates between CE- and IE-SCNT embryos are not significantly different. (B, C, D and E) SCNT embryos derived from CE- (B and C) and IE-oocytes (D and E) stained with DAPI 30 min after fusion. Arrows indicate the PBII. (F and G) Representative IE-SCNT embryo in the 2-cell stage 24 h after fusion. (H) Blastocyst rate at E6 embryos demonstrated an increased rate of IE embryos compared to CE embryos. (I) Total cell number of CE and IE blastocysts at E6 are not significantly different. (J and K) The metaphase chromosomes of embryos were spread on slide glasses and stained with Giemsa Stain. (L) The number of chromosomes in each nucleus was counted and graphically displayed. P values were calculated by Wilcoxon test (A and H) or Mann–Whitney test (I and L). Scale bar represents 20 µm in B.
Citation: Reproduction 159, 5; 10.1530/REP-19-0382
In seven sets of SCNT experiments using the spindle viewer, 228 CE-oocytes and 229 IE-oocytes were used. The blastocyst rate of SCNT embryos in IE group embryos at E6 was significantly higher (31.9 ± 3.2%) than those of CE group (21.0 ± 2.1%; Fig. 4H). In one of the experiments, ten embryos were collected from each group and their total cell numbers were counted. There was no significant difference between the total cell numbers of CE- and IE-SCNT embryos (54.7 ± 5.2 vs 48.0 ± 4.2 cells; Fig. 4I). Metaphase chromosomes were counted in spindle viewer derived CE (n = 6) and IE (n = 15) embryos. We observed a significant increase in the number of chromosomes in each nucleus in the IE group versus the CE group. The average number of chromosomes were 36.2 ± 1.2 and 63.3 ± 4.9 in the CE- and IE-SCNT embryos, respectively (Fig. 4J, K and L). Of the six CE-SCNT chromosome sets, four were complete diploids (2n = 38) and two were near-diploid aneuploids. Of the 15 IE-SCNT chromosome sets, 11 were near-triploid, 1 was near-tetraploid and 1 was near-heptaploid aneuploids and 2 were complete tetraploid (Table 1).Together, these data indicate that IE embryos display extrusion of PBII and have a significantly higher rate of abnormal chromosome counts when compared to CE.
Chromosomal constitution in CE- and IE-SCNT embryos at E6.
| Ploidy | CE (n = 6) | IE (n = 15) | ||
|---|---|---|---|---|
| Complete | Aneuploidy | Complete | Aneuploidy | |
| 2n | 4 | 2 | ||
| 3n | 11 | |||
| 4n | 2 | 1 | ||
| 7n | 1 | |||
The chromosome counts of the 2 CE embryos that displayed aneuploidy were 31 and 34. The chromosome counts of the 11 IE embryos that displayed aneuploidy (3n) were: 1 embryo each with 64, 62, and 53 chromosomes; 2 embryos each with 52 and 50 chromosomes; 4 embryos each with 51 chromosomes. The 4n embryo had a chromosome count of 67 and the 7n embryo had a chromosome count of 126.
Discussion
The application of somatic cell nuclear transfer technology requires enhanced methodological efficiency. It has been previously reported that a significant percentage of in vitro-matured pig oocytes have deviations between the positions of the PBI and the MII spindle apparatus (Jeon et al. 2012, Lin et al. 2015). In the present study, we observed a wide range of deviation in porcine oocytes. We also examined PBI-MII deviations and the association with successful enucleation. Our data suggest that IE occurs in oocytes with significant polar body deviations and, therefore, the enucleation rates cannot be improved unless the PB-MII deviation is controlled. Although we did not investigate the cause of deviation in this study, we predict that in vitro maturation conditions or physical manipulation of COCs may promote PB deviation. Attempts at earlier denuding, prior to PBI extrusion, to reduce dislocation by physical shock during vortexing or pipetting, however, have been minimally effective in reducing deviation (Jeon et al. 2012, Lin et al. 2015). It was also observed that early denuding causes detrimental effects on the quality of oocytes and on the development of the embryos (Lin et al. 2015). While the blind enucleation method is rapid and it does not damage the oocyte (Lai et al. 2002), there is no assurance that enucleation is complete, therefore, we hypothesize that the use of blind enucleation will not generate reliable and interpretable data.
To further explore these methodological strategies, we attempted to produce cloned ETV2-null embryos by introducing the nucleus of ETV2 null porcine fetal fibroblasts into the blindly enucleated oocytes. We have previously demonstrated that Etv2 regulates the hematoendothelial lineage specification and that the Etv2-null mouse lacked blood and vasculature at an early implantation stage (Koyano-Nakagawa & Garry 2017). We have recently demonstrated the same phenotype in the pig. In the current study, using blind enucleation, we observed that 4 out of 12 embryos from 2 separate experiments contained the internal sequence of the ETV2 gene (WT) and the shortened sequence of the ETV2 gene (null), and that these embryos displayed a WT phenotype. Given that the donor fibroblasts were confirmed to be ETV2-/-, these data suggest that the WT ETV2 genotype/phenotype in the SCNT embryos was a result of incomplete enucleation. Importantly, we demonstrated triploidy of these embryos as evidenced by FISH analysis. The observation of triploidy further supported the hypothesis that IE results in a WT phenotype. To confirm this hypothesis, we intentionally generated IE oocytes using a mitotic spindle viewer to produce SCNT embryos for which we used WT GFP fibroblasts as the nuclear donor and investigated their fate. The spindle viewer allows for visualization of the MII spindle without nuclear staining or chemical damage, and thus, we were able to intentionally perform incomplete enucleation by aspiration of the PBI and adjacent cytoplasm without removal of the MII spindle. First, we observed that the SCNT embryos derived from IE-oocytes extruded the PBII leaving half of the chromosomes after fusion and these embryos subsequently formed a single nucleus with donor chromosomes within each blastomere. Therefore, the abnormal IE-SCNT embryos were not distinguishable from CE-SCNT embryos based on the number of nuclei. From this, we are able to infer that the near-triploidy in the majority of IE-SCNT embryos was caused by the fusion of the remaining haploid (host) and the diploid (donor) chromosomes. Notably, we observed that the chromosome numbers in IE-SCNT embryos varied from triploid to heptoploid and that most of them were aneuploid. During IE, physical damage of the MII plate due to needle aspiration is unavoidable as the plate is close to the polar body and, therefore, is likely damaged and disrupts separation. The high frequency of chromosome abnormalities in mammalian SCNT embryos has been reported (Bureau et al. 2003). It was speculated that this was due to the physical manipulation of the oocytes (Yamagata et al. 2012). Notably, we also observed the incidence of aneuploidy in the CE-SCNT embryos; however, the occurrence is lower than the IE-SCNT embryos.
In previous studies, the development of cloned embryos generated from blindly enucleated oocytes has been compared with those from CE oocytes using the spindle viewer system (Li et al. 2010). In contrast to our findings, the blastocyst rate was higher when oocytes were completely enucleated using the spindle viewer versus those generated using the blind method. There may be several reasons for these conflicting data. For example, the blind enucleation likely rendered both CE and IE embryos in the previous study although that was not evaluated. Although not described, the blind method typically results in the removal of a greater amount of cytoplasm (to ensure CE), which is detrimental to the development of the embryo (Li et al. 2004). In the current study, we minimized the amount of cytoplasm aspirated during the enucleation step using the spindle viewer to ensure that the aspirate was not significantly different between the IE and CE groups.
In our studies, the blastocyst rate was significantly higher in the triploid SCNT embryos derived from IE oocytes. Tetraploid SCNT embryos have been constructed following the introduction of a somatic nucleus into an MII oocyte without enucleation by Fu et al. (2016). They reported faster and enhanced development of the tetraploid SCNT embryos compared to the diploid SCNT derived by using conventional SCNT. Collectively, these results suggested that the number of chromosome sets per blastomere could positively affect developmental competency in early-stage embryos. Accordingly, we calculated triploidy based on our blind enucleation rate (80.2%) and the blastocyst rate of both CE- and IE-SCNT embryos (21.0 and 31.9%). Therefore, it could be predicted that approximately 27.3% of SCNT blastocysts ((19.8% × 31.9%)/{(80.2% × 21.0%) + (19.8% × 31.9%)}) generated after blind enucleation were from IE-oocytes which contained triploid chromosomes.
In this study, we observed the implantation of the triploid embryos derived from unintentional IE. The full term survival of a triploid cloned piglet has never been demonstrated in spite of the number of studies that use blind enucleation methods, which invariably generated triploid, IE-SCNT embryos. Furthermore, it is well established in mouse and human, that most of triploid fetuses were lethal prior to mid-term (McFadden & Robinson 2005). Given the potential of triploid embryos to develop and implant normally early during gestation, the analysis of these embryos at peri-implantation stages (which is often necessary to capture the phenotype in genetically modified SCNT embryos) may present confounding results. An additional problem may be that the implantation of triploid cloned embryos could consume space and nutrients in the endometrium of the surrogate; hence the chance of implantation of healthy cloned embryos may be reduced yielding a decrease in overall production efficiency. Since we have been utilizing the spindle viewer system, we have never observed hematoendothelial cells in the embryos when the ETV2-null cloned embryos were transferred into gilts and harvested at E18.
In summary, our studies demonstrate that we cannot expect complete enucleation using the blind method because of unpredictable MII dislocation in mature porcine oocytes. Furthermore, we observed normal development of triploid embryos up until the peri-implantation stage. Intentionally generated IE-SCNT embryos demonstrate that the haploid chromosomes left in IE-oocytes cause triploidy after SCNT. These data emphasize the need for CE when early stage analysis of embryos is performed to prevent misinterpretation of data and interruption to the implantation of healthy cloned embryos by the development of triploid embryos.
Declaration of interest
Drs Daniel J and Mary G Garry are co-founders of NorthStar Genomics, LLC. The other authors have nothing to disclose.
Funding
This work was supported by the American Heart Association (grant number 18TPA34220008).
Author contribution statement
M G, G M, D G conceived of the study. G M and M G wrote the manuscript. G M, W G, D Y, and S D provided critical input, designed, performed experiments, and analyzed data. M G and D G supervised the project.
Acknowledgements
Special thanks to LeAnn Oseth in the Masonic Cancer Center at the University of Minnesota for her assistance with FISH.
References
Behrens AN, Zierold C, Shi X, Ren Y, Koyano-Nakagawa N, Garry DJ & Martin CM 2014 Sox7 is regulated by ETV2 during cardiovascular development. Stem Cells and Development 23 2004–2013. (https://doi.org/10.1089/scd.2013.0525)
Bureau WS, Bordignon V, Léveillée C, Smith LC & King WA 2003 Assessment of chromosomal abnormalities in bovine nuclear transfer embryos and in their donor cells. Cloning and Stem Cells 5 123–132. (https://doi.org/10.1089/153623003322234722)
Caamaño JN, Maside C, Gil MA, Muñoz M, Cuello C, Díez C, Sánchez-Osorio JR, Martín D, Gomis J & Vazquez JM et al.2011 Use of polarized light microscopy in porcine reproductive technologies. Theriogenology 76 669–677. (https://doi.org/10.1016/j.theriogenology.2011.03.020)
Chan SS-K, Shi X, Toyama A, Arpke RW, Dandapat A, Iacovino M, Kang J, Le G, Hagen HR & Garry DJ et al.2013 Mesp1 patterns mesoderm into cardiac, hematopoietic, or skeletal myogenic progenitors in a context-dependent manner. Cell Stem Cell 12 587–601. (https://doi.org/10.1016/j.stem.2013.03.004)
Das S, Koyano-Nakagawa N, Gafni O, Maeng G, Singh BN, Rasmussen T, Pan X, Choi K-D, Mickelson D & Gong W et al.2020 Generation of human endothelium in pig embryos deficient in ETV2. Nature Biotechnology. In press (https://doi.org/10.1038/s41587-019-0373-y)
Fu B, Liu D, Ma H, Guo ZH, Wang L, Li ZQ, Peng FG & Bai J 2016 Development of porcine tetraploid somatic cell nuclear transfer embryos is influenced by oocyte nuclei. Cell Biology International 40 214–222. (https://doi.org/10.1002/cbin.10554)
Garry DJ 2016 Etv2 is a master regulator of hematoendothelial lineages. Transactions of the American Clinical and Climatological Association 127 212–223.
Gong W, Rasmussen TL, Singh BN, Koyano-Nakagawa N, Pan W & Garry DJ 2017 Dpath software reveals hierarchical haemato-endothelial lineages of Etv2 progenitors based on single-cell transcriptome analysis. Nature Communications 8 14362. (https://doi.org/10.1038/ncomms14362)
Iuso D, Czernik M, Zacchini F, Ptak G & Loi P 2013 A simplified approach for oocyte enucleation in mammalian cloning. Cellular Reprogramming 15 490–494. (https://doi.org/10.1089/cell.2013.0051)
Jeon RH, Maeng GH, Lee WJ, Kim TH, Lee YM, Lee JH, Kumar BM, Lee SL & Rho GJ 2012 Removal of cumulus cells before oocyte nuclear maturation enhances enucleation rates without affecting the developmental competence of porcine cloned embryos. Japanese Journal of Veterinary Research 60 191–203. (https://doi.org/10.14943/jjvr.60.4.191)
Koyano-Nakagawa N & Garry DJ 2017 Etv2 as an essential regulator of mesodermal lineage development. Cardiovascular Research 113 1294–1306. (https://doi.org/10.1093/cvr/cvx133)
Koyano-Nakagawa N, Kweon J, Iacovino M, Shi X, Rasmussen TL, Borges L, Zirbes KM, Li T, Perlingeiro RCR & Kyba M et al.2012 Etv2 is expressed in the yolk sac hematopoietic and endothelial progenitors and regulates Lmo2 gene expression. Stem Cells 30 1611–1623. (https://doi.org/10.1002/stem.1131)
Koyano-Nakagawa N, Shi X, Rasmussen TL, Das S, Walter CA & Garry DJ 2015 Feedback mechanisms regulate ets variant 2 (Etv2) gene expression and hematoendothelial lineages. Journal of Biological Chemistry 290 28107–28119. (https://doi.org/10.1074/jbc.M115.662197)
Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, Samuel M, Bonk A, Rieke A & Day BN et al.2002 Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295 1089–1092. (https://doi.org/10.1126/science.1068228)
Lai L & Prather RS 2003 Production of cloned pigs by using somatic cells as donors. Cloning and Stem Cells 5 233–241. (https://doi.org/10.1089/153623003772032754)
Li GP, White KL & Bunch TD 2004 Review of enucleation methods and procedures used in animal cloning: state of the art. Cloning and Stem Cells 6 5–13. (https://doi.org/10.1089/15362300460743781)
Li Y, Liu J, Dai J, Xing F, Fang Z, Zhang T, Shi Z, Zhang D & Chen X 2010 Production of cloned miniature pigs by enucleation using the spindle view system. Reproduction in Domestic Animals 45 608–613. (https://doi.org/10.1111/j.1439-0531.2008.01311.x)
Lin T, Diao YF, Choi HS, Oqani RK, Kang JW, Lee JE & Jin DIl 2015 Procedure used for denuding pig oocytes influences oocyte damage, and development of in vitro and nuclear transfer embryos. Animal Reproduction Science 152 65–76. (https://doi.org/10.1016/j.anireprosci.2014.11.009)
McFadden DE & Robinson WP 2006 Phenotype of triploid embryos. Journal of Medical Genetics 43 609–612. (https://doi.org/10.1136/jmg.2005.037747)
Moon JH, Hyun CS, Lee SW, Son WY, Yoon SH & Lim JH 2003 Visualization of the metaphase II meiotic spindle in living human oocytes using the polscope enables the prediction of embryonic developmental competence after ICSI. Human Reproduction 18 817–820. (https://doi.org/10.1093/humrep/deg165)
Rasmussen TL, Shi X, Wallis A, Kweon J, Zirbes KM, Koyano-Nakagawa N & Garry DJ 2012 VEGF/Flk1 signaling cascade transactivates Etv2 gene expression. PLoS ONE 7 e50103. (https://doi.org/10.1371/journal.pone.0050103)
Rasmussen TL, Martin CM, Walter CA, Shi X, Perlingeiro R, Koyano-Nakagawa N & Garry DJ 2013 Etv2 rescues Flk1 mutant embryoid bodies. Genesis 51 471–480. (https://doi.org/10.1002/dvg.22396)
Rienzi L, Martinez F, Ubaldi F, Minasi MG, Iacobelli M, Tesarik J & Greco E 2004 Polscope analysis of meiotic spindle changes in living metaphase II human oocytes during the freezing and thawing procedures. Human Reproduction 19 655–659. (https://doi.org/10.1093/humrep/deh101)
Singh BN, Kawakami Y, Akiyama R, Rasmussen TL, Garry MG, Gong W, Das S, Shi X, Koyano-Nakagawa N & Garry DJ 2015 The Etv2-miR-130a network regulates mesodermal specification. Cell Reports 13 915–923. (https://doi.org/10.1016/j.celrep.2015.09.060)
Smith LC 1993 Membrane and intracellular effects of ultraviolet irradiation with hoechst 33342 on bovine secondary oocytes matured in vitro. Journal of Reproduction and Fertility 99 39–44. (https://doi.org/10.1530/jrf.0.0990039)
Whitworth KM, Lee K, Benne JA, Beaton BP, Spate LD, Murphy SL, Samuel MS, Mao J, O’Gorman C & Walters EM et al.2014 Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biology of Reproduction 91 78. (https://doi.org/10.1095/biolreprod.114.121723)
Wilmut I, Schnieke AE, McWhir J, Kind AJ & Campbell KH 1997 Viable offspring derived from fetal and adult mammalian cells. Nature 385 810–813. (https://doi.org/10.1038/385810a0)
Wramsby H & Liedholm P 1984 A gradual fixation method for chromosomal preparations of human oocytes. Fertility and Sterility 41 736–738. (https://doi.org/10.1016/S0015-0282(16)47841-6)
Yamagata K, Iwamoto D, Terashita Y, Li C, Wakayama S, Hayashi-Takanaka Y, Kimura H, Saeki K & Wakayama T 2012 Fluorescence cell imaging and manipulation using conventional halogen lamp microscopy. PLoS ONE 7 e31638. (https://doi.org/10.1371/journal.pone.0031638)
Yuan Y, Spate LD, Redel BK, Tian Y, Zhou J, Prather RS & Roberts RM 2017 Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. PNAS 114 E5796–E5804. (https://doi.org/10.1073/pnas.1703998114)
