Abstract
Steroid production varies widely among species, with these differences becoming more pronounced during pregnancy. As a result, each species has its own distinct pattern of steroids, steroidogenic enzymes, receptors, and transporters to support its individual physiological requirements. Although the circulating steroid profile is well characterized during equine pregnancy, there is much yet to be explored regarding the factors that support steroidogenesis and steroid signaling. To obtain a holistic view of steroid-related transcripts, we sequenced chorioallantois (45 days, 4 months, 6 months, 10 months, 11 months, and post-partum) and endometrium (4 months, 6 months, 10 months, 11 months, and diestrus) throughout gestation, then looked in-depth at transcripts related to steroid synthesis, conjugation, transportation, and signaling. Key findings include: 1) differential expression of HSD17B isoforms among tissues (HSD17B1 high in the chorioallantois, while HSD17B2 is the dominant form in the endometrium) 2) a novel isoform with homology to SULT1A1 is the predominant sulfotransferase transcript in the chorioallantois; and 3) nuclear estrogen (ESR1, ESR2) and progesterone (PGR) expression is minimal to nonexistant in the chorioallantois and pregnant endometrium. Additionally, several hypotheses have been formed, including the possibility that the 45-day chorioallantois is able to synthesize steroids de novo from acetate and that horses utilize glucuronidation to clear estrogens from the endometrium during estrous, but not during pregnancy. In summary, these findings represent an in-depth look at equine steroid-related transcripts through gestation, providing novel hypotheses and future directions for equine endocrine research.
Introduction
Endocrine regulation of equine pregnancy has been studied extensively for almost 100 years by numerous investigators, revealing numerous species-specific characteristics (Ginther 1992, Conley 2016, Conley & Ball 2019). Regulation of steroidogenesis is arguably one of the best studied aspects of equine pregnancy, largely due to the ease of sampling circulating hormones as well as in vitro techniques for analyzing steroidogenic enzyme activity. Even so, much remains poorly understood, particularly in regard to tissue-level factors including metabolic enzymes and receptors associated with steroid hormones. Although we can draw on research in other species to some degree, regulation of steroidogenesis can vary greatly, making it difficult to draw conclusions about the presence, kinetics, and functions of enzymes based solely on research in other animals, particularly due to the unique aspects of steroidogenesis during equine pregnancy.
Equid gestational steroid synthesis is arguably the most similar to that of the human among non-primate species studied to date (Conley 2016). In both horses and humans, pregnanes are placentally derived, with similar patterns of secretion throughout gestation (Hill et al. 2007, Conley 2016). Moreover, in both, high levels of the androgen DHEA are synthesized in non-placental fetal tissues and transported to the placenta where they are converted to estrogens, resulting in high concentrations of maternal estrogens circulating during both equine and human gestation (Legacki et al. 2016b, 2019, Berkane et al. 2017). The site of DHEA production varies by species, but includes the fetal gonad (horse) (Legacki et al. 2017) and adrenal gland (human) (Diczfalusy 1969). Another endocrinological similarity during pregnancy is the production of chorionic gonadotropins, a phenomenon thought to be exclusive to equids and primates (Conley 2016).
Progesterone is the major circulating pregnane in most species; however, in the mare, a 5α-reduced form of progesterone (DHP) is the major known bioactive pregnane during mid-late gestation (Holtan et al. 1975, Scholtz et al. 2014). Similar to estrogens, secretion of 5α-reduced pregnanes during equine pregnancy appears to be dependent upon fetoplacental synthesis involving production of pregnenolone (P5) by the fetus (likely gonadal) with subsequent production of progesterone, DHP, and its metabolites in the placenta representing a luteo-placental shift in pregnane synthesis (Conley & Ball 2019). Circulating progesterone concentrations in the mare are at or below the limit of detection by 180 days of gestation (Scholtz et al. 2014), while DHP and its metabolites are the dominant pregnanes in circulation, with metabolites of DHP reaching concentrations up to ten-fold higher than that of DHP itself (Conley 2016, Legacki et al. 2017, Wynn et al. 2018). The metabolism of progesterone to DHP is mediated by placental 5α-reductase (SRD5A1) and further reduction of DHP and its metabolites is thought to be largely mediated by enzymes of the aldo-keto reductase (AKR; probably AKR1C) family (Byrns 2011).
Aldo-keto reductases exhibit broad and varied oxido-reductase activities and include aldehyde reductase (AKR1A1), aldose reductase (AKR1B1), 3α(20α)-hydroxysteroid dehydrogenase (AKR1C1), and steroid 5β-reductase (AKR1D1) (Penning 2015). These myriad activities allow AKRs to play integral roles in steroidogenesis; for example, AKR1D1 mediates the conversion of progesterone to 5β-dihydroprogesterone, while AKR1C1 mediates the conversion of progesterone and 5β-dihydroprogesterone to their 20α- or 3α-hydroxy-products, including the neurosteroid allopregnanolone (Byrns 2011). Many AKRs are active in prostaglandin synthesis pathways as well (Watanabe 2011).
Steroid biology during equine pregnancy is influenced not only by active oxido-reductase activities but also by conjugation of steroids that alters their tissue bioavailability and elimination half-lives. Although free steroids are hydrophobic and can pass freely through cell membranes, the conjugation of steroids by sulfation or glucuronidation means that cellular or tissue uptake requires the expression of transporters. This limits access to steroid receptors expressed in potential target or responsive tissues providing an additional level of regulation of steroid action. Conversely, the conjugation of steroids increases their aqueous solubility and thereby facilitates excretion by the kidney. Sulfated steroids have long been known to reach high concentration in the urine of pregnant mares (Raeside & Rosskopf 1979). Members of the steroid sulfotransferase (SULT) family are primarily responsible for sulfonation of steroids, while enzymes such as steroid sulfatase (STS) remove the sulfate group in the target tissue, restoring biological activity. Further metabolism involving hydroxylation is largely carried out by members of the hydroxysteroid dehydrogenase (HSD) family (Cole et al. 2019). Additional methods of steroid inactivation include glucuronidation by UDP glucuronosyltransferases (UGT), a process known to help clear active estrogens from the endometrium during diestrus in pigs (Hankele et al. 2018) and cows (Owen et al. 2018). Steroid glucuronidation has not been studied extensively in the horse (Wong et al. 2016) and, to the best of our knowledge, there are no studies which quantitatively compare sulfonation to glucuronidation.
Steroid transporters such as organic anion transporter proteins (OATP), encoded by solute carrier organic anion transporter (SLCO) genes; ATP-binding cassette transporters (ABC), as well as other solute carrier family members (SLC) are required for efficient influx and efflux of conjugated steroids across the cell membrane. For example, OATP1B1 (encoded by SLCO2B1) transports sulfonated estrogens, as well as sulfonated dehydroepiandrosterone (DHEA-S) (Grube et al. 2007, Ugele et al. 2008, Schweigmann et al. 2014), acting together with ABCG2 to mediate basolateral-to-apical transport in multiple tissues, including human placenta (Grube et al. 2007).
Active steroids exert many of their effects by binding to and activating specific nuclear receptors (NR), a class which includes estrogen receptors (ER), progesterone receptor (PR), and androgen receptor (AR) among others. Specifically, NR are ligand-dependent transcription factors which, when bound to their specific steroid activator, bind (Type I) and/or release from genomic DNA (Type II) to stimulate their respective effects on gene transcription(Cole et al. 2019). In addition to NR, some steroids have specific membrane bound receptors, such as G-protein-coupled estrogen receptor (GPER) (Hamilton et al. 2017) and the progestin – adipoQ receptor (PAQR) family. Rather than acting directly on the genomic DNA, these membrane-associated receptors utilize second messenger systems to exert their effects on the cell.
Despite all which is currently known, previous research in steroidogenesis in pregnant mares has focused on the major known pathways targeting specific transcripts by PCR which have only allowed the study of a limited number of genes. In this study, we utilized next-generation sequencing to observe changes to the transcriptome in the chorioallantois (CA) and endometrium (EN) in a holistic fashion across gestation in the mare. This approach allows us to take a broad account of all steroidogenesis-related genes, even those not previously investigated in the horse.
Materials and methods
Animal use and tissue collection
All animal procedures were approved by and completed in accordance with the Institutional Animal Care and Use Committee of the University of Kentucky (Protocols #2014-1215 and 2014-1341). All horses (Equus caballus) used in this study were mares ranging from 250 to 600 kg and from 4 to 16 years of age. Mares were housed on pasture with free-choice grass hay available at all times.
Fetal and/or maternal components of the placenta were collected at 45 days, 4 months, 6 months, 10 months, 11 months, and post-partum, as detailed subsequently. Forty-five-day CA samples were collected by transcervical uterine lavage, collecting the entire conceptus. Matched fetal and maternal placenta were collected from mares at 4, 6, 10, and 11 months of gestation as detailed in Loux et al. (2019) (n = 4/time point). Post-partum CA samples (n = 4) were collected within 2 h of normal foaling, immediately following full release from the EN. Lastly, EN was collected from diestrous mares (n = 3) following transrectal ultrasound showing a distinct corpus luteum, minimal follicular activity, and no observable endometrial folding. Diestrus was confirmed by a serum progesterone (P4) concentration >5 ng/mL. Sections of all isolated tissues were stored in RNAlater (Thermo Fisher Scientific), with samples held at 4°C for 24 h, then frozen at −80°C until use.
RNA isolation and sequencing
Isolation of RNA from tissue was performed using RNeasy Mini Kit (Qiagen), per manufacturer’s instructions. After extraction, RNA was analyzed by NanoDrop® (Thermo Fisher Scientific) and Bioanalyzer® (Agilent) to evaluate concentration, purity, and integrity. All samples had a 230/260 ratio >1.8, a 260/280 ratio >2.0 and an RNA integrity number >8.0.
Library preparation was performed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina), per manufacturer’s instructions. The adapter for read 1 was AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG, with NNNNNN signifying the index sequence. The read 2 adapter was AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT. All reads were quantified with qPCR. Sequencing was performed on a HiSeq 4000 (Illumina) using a HiSeq 4000 sequencing kit version 1, generating 150 bp paired-end reads (University of Illinois Roy J. Carver Biotechnology Center). FASTQ files were generated and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina).
Sequence read archive
Our data are publicly available in NCBI’s sequence read archive (http://ncbi.nlm.nih.gov/sra/) via Gene Expression Omnibus with accession numbers GSE136691 and GSE108279. Additional sequencing data were downloaded in fasta/fastq format from the sequence read archive to better make global comparisons of transcripts in tissue. These data are detailed in Table 1 and processed using the same pipeline as our generated data, as described subsequently. Publications from these data include Coleman et al. 2013, Fushan et al. 2015, Marth et al. 2015, Mansour et al. 2017, Burns et al. 2018, and Janecka et al. 2018.
Equus caballus-derived sequencing data.
| Sample | Replicates | SRA identifier | Publication |
|---|---|---|---|
| Adipose | 2 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Adrenal cortex | 2 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Cerebellum | 2 | SRP022567 | Coleman et al. 2013; PMID 23922931 |
| Cerebellum | 3 | SRP082342 | Mansour et al. 2017; PMID 28107812 |
| Chorioallantois – 45 days | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Chorioallantois – 4 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Chorioallantois – 6 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Chorioallantois – 10 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Chorioallantois – 11 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Chorioallantois – post-partum | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – 4 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – 6 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – 10 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – 11 months | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – diestrus | 4 | SRP219950 | Loux et al. 2019; PMID 31725741 |
| Endometrium – estrus | 5 | SRP051087 | Marth et al. 2015; PMID 25989818 |
| Endometrium – diestrus | 5 | SRP051087 | Marth et al. 2015; PMID 25989818 |
| Kidney | 3 | SRP017611 | Fushan et al. 2015; PMID 25677554 |
| Liver – mare/fetus – pooled | 1 | n/a | Unpublished |
| Liver – stallion | 1 | n/a | Unpublished |
| Liver – mare | 2 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Lung | 2 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Ovary | 2 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Skin | 4 | ERP108802 | Burns et al. 2018; PMID 30311254 |
| Testes – pooled (n = 3) | 1 | n/a | Unpublished |
| Testes | 2 | SRP126383 | Janecka et al. 2018; PMID 30054462 |
SRA, sequence read archive.
RNASeq data analysis
The internally and externally derived sequencing data were initially trimmed for adapters and quality using TrimGalore Version 0.4.4 (Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk), then mapped to EquCab3.0 (Kalbfleisch et al. 2018) using STAR-2.5.2b (github.com/alexdobin/STAR). Cufflinks-2.2.1 (cole-trapnell-lab.github.io/cufflinks/) was used to quantify data, with the Equus_caballus_Ensembl_95 gtf file used for annotation (-G). All quantified data are presented in Supplementary Table 1 (see section on supplementary materials given at the end of this article).
To select genes of interest, a list of all known major genes associated with steroidogenic enzymes in any species was made. This list was supplemented with other steroid-related genes such as transporters, sulfotransferases, receptors, and so on. There was no attempt to identify differentially expressed genes prior to selection to keep the list as unbiased as possible.
Quantitative PCR
Quantitative PCR was used to validate select novel findings from the manuscript, namely the expression patterns of SULT1A1, SULT1E1, HSD17B1, and HSD17B2 across tissues and gestation. Primers were designed using Primer-BLAST from the National Center for Biotechnology Information (Ye et al. 2012), with primer sequences presented in Table 2. Real-time qPCR of duplicate samples was performed using the ViiA-7 Real-Time PCR System (Thermo Fisher Scientific). Reactions contained a mixture of cDNA (5 ng), primers (25 ng each), and a SYBR Green Master Mix. Cycle parameters of PCR were: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min, and then a dissociation step of 95°C for 15 s. Melting curves for each sample were assessed to evaluate the specificity of the reaction. All reactions were pipetted using the epMotion Automated Pipetting Systems (Eppendorf; Hauppauge, NY, USA).
PCR primers.
| Forward | Reverse | |
|---|---|---|
| HSD17B1 | CTCGGGACGCATATTGGTGA | CTTCGATCGCGAACTTGCTG |
| HSD17B2 | ACAAAGGTGCAACGACTCTCT | CCCAGCACTACGGTGACAG |
| SULT1A1 | GGAAGTAGGCCACATTCTGGT | ATACTTCAGTGGTGGGCGG |
| SULT1E1 | TGGGAAGGAAACCATCAGAGG | CCAGTCTCCCACAATCCCTTT |
| ACTB | CGACATCCGTAAGGACCTGT | CAGGGCTGTGATCTCCTTCT |
The ΔC T for each gene of interest was calculated by subtracting the C T of the housekeeping gene (actin b; ACTB) from the C T of the gene of interest. Gene expression data are presented as relative quantification values, with the lowest expressed gene set to 1. PCR efficiency was calculated using LinRegPCR (medischebiologie.nl/files). Changes in relative abundance of specific transcripts were examined by calculating the fold change using the 2−ΔΔCt method (Livak & Schmittgen 2001).
Statistical analysis
Initial identification of differentially expressed genes was performed using one-way ANOVA, with the Benjamini–Hochberg correction for false discovery rate (FDR P < 0.05). Gene expression as measured by fragments per kilobase per million reads mapped (FPKM) was compared across gestational ages. All statistical analyses were performed in JMP (SAS Institute, version 14.0.0) unless otherwise stated. Descriptive statistics are expressed as mean ± s.e.
Results and discussion
Transcriptome analyses
The current investigation examined the transcriptome of the equine placenta at various stages of gestation to make inferences about the presence and function of steroidogenesis-related transcripts. Although confirming previous research on steroid secretion and transcript abundance in the equine placenta, transcript abundance is not always reflective of enzyme activity or even protein expression. Similarly, differential transcript expression across tissues does not necessarily imply a physiological importance, and enzyme function in terms of substrate preferences and potential products are not always conserved among species (Guengerich 1997). Therefore, inferences drawn from research conducted in other animal models should be considered with caution, with respect to applicability in the context of equine biology. Adding to that, the fluidity of gene annotation both within and across species requires both care and flexibility as abundance and even gene identity may change as major databases (e.g. NCBI, Ensembl) update their annotation and genome assemblies. A basic outline of steroidogenesis is provided in Fig. 1.
Overview of steroidogenesis. CYP, cytochrome P450; HSD, hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; SRD5A, 5a-reductase; AKR, aldo keto reductase.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Overview of steroidogenesis. CYP, cytochrome P450; HSD, hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; SRD5A, 5a-reductase; AKR, aldo keto reductase.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Overview of steroidogenesis. CYP, cytochrome P450; HSD, hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; SRD5A, 5a-reductase; AKR, aldo keto reductase.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Cholesterol and Δ5 steroids
The early stages of steroidogenesis (cholesterol → P5 → 17α-OH P5 → DHEA) are thought to occur primarily in the fetal gonad in equine pregnancy (Ainsworth & Ryan 1966, Legacki et al. 2017), with DHEA transported to the placenta for further metabolism (Legacki et al. 2017). Although data previously reported by this laboratory support these findings in later gestation (4 months through parturition), the 45-day CA has surprisingly high expression of transcript for STAR, CYP11A1 (SCC), and CYP17A1 (Fig. 2). Combined with other data in this manuscript, the elevation in expression of these transcripts suggests that the 45-day CA may be able to initiate synthesis of steroids de novo from cholesterol. At all later time points, all three of these transcripts were minimally expressed, consistent with the low levels of P5 and DHEA previously measured in CA at these time points (Legacki et al. 2017). In addition, the CA also expresses transcripts for all enzymes required for de novo cholesterol synthesis, with a peak expression at 45-day gestation (data not shown). This is consistent with early studies which showed that embryos of some species are capable of de novo cholesterol synthesis at a very early stage; 6 day rabbit blastocysts are able to synthesize cholesterol and pregnenolone from acetate (Huff & Eik-Nes 1966). Studies on steroid synthesis in equine embryos have been conducted with added steroid substrates (Heap et al. 1991, Raeside et al. 2009, 2015); however, if de novo steroid synthesis (from acetate) by equine trophoblast has been investigated, the autors are not aware.
Relative expression of (A) STAR, CYP11A1, and (B) CYP17A1 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Arrows indicate the conversion the resultant enzymes are believed to mediate. P5, pregnenolone; 17α-OH P5, 17α-hydroxypregnenolone; DHEA, dehydroepiandrosterone; STAR, steroidogenic acute regulatory protein; CYP11A1, cholesterol side-chain cleavage enzyme; CYP171A1, cytochrome P450 17A1; PP, post-partum. Error bars represent s.e.m. Differing letters indicate statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) STAR, CYP11A1, and (B) CYP17A1 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Arrows indicate the conversion the resultant enzymes are believed to mediate. P5, pregnenolone; 17α-OH P5, 17α-hydroxypregnenolone; DHEA, dehydroepiandrosterone; STAR, steroidogenic acute regulatory protein; CYP11A1, cholesterol side-chain cleavage enzyme; CYP171A1, cytochrome P450 17A1; PP, post-partum. Error bars represent s.e.m. Differing letters indicate statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) STAR, CYP11A1, and (B) CYP17A1 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Arrows indicate the conversion the resultant enzymes are believed to mediate. P5, pregnenolone; 17α-OH P5, 17α-hydroxypregnenolone; DHEA, dehydroepiandrosterone; STAR, steroidogenic acute regulatory protein; CYP11A1, cholesterol side-chain cleavage enzyme; CYP171A1, cytochrome P450 17A1; PP, post-partum. Error bars represent s.e.m. Differing letters indicate statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Hydroxysteroid dehydrogenases (HSD)
Oxidation/reduction at the C-3 position of the steroid nucleus can be performed by members of the 17-β hydroxysteroid dehydrogenase family. Different family members promote different reactions; for example, HSD17B1, 5, and 7 oxidize at the C-3 position in vivo, while HSD17B2 and 4 reduce it (Hilborn et al. 2017). Ergo, HSD17B1 can catalyze the conversion of DHEA to androstenediol, as well as E1 to E2, while HSD17B2 is able to reverse both of these conversions (Hilborn et al. 2017) (Fig. 3). While there are ten separate isozymes for 17-β hydroxysteroid dehydrogenase identified in the horse, HSD17B1 is expressed at the highest level in the CA, while HSD17B2 is expressed at the highest levels in the EN (Fig. 3). This suggests that the CA and EN may play opposing roles in regulating steroid levels, with HSD17B1 in the CA promoting 17β-estradiol synthesis, while HSD17B2 in the EN balances estradiol synthesis by promoting estrone synthesis. The relatively high level of HSD17B2 is also consistent with the much higher levels of E1 compared to E2 in maternal circulation (Legacki et al. 2019). The abundance of HSD17B1 and HSD17B2 across tissue and gestational age was confirmed by qPCR (Supplementary Fig. 1A and B). Results from both methods were correlated for all targets, including HSD17B1 (r = 0.755, P < 0.05) and HSD17B2 (r = 0.986, P < 0.0001).
Area plot demonstrating relative expression of HSD17β1, 2, 4, 6, 7, 8, 10, 11, 12, and 14 in the (A) chorioallantois and (B) endometrium through gestation as determined by RNA-sequencing. Arrows indicate the direction of the reaction the HSD17β enzymes mediate, with the specific family member suffixes in corresponding boxes. HSD17β, 17β-hydroxysteroid dehydrogenase; DHEA, dehydroepiandrosterone; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Area plot demonstrating relative expression of HSD17β1, 2, 4, 6, 7, 8, 10, 11, 12, and 14 in the (A) chorioallantois and (B) endometrium through gestation as determined by RNA-sequencing. Arrows indicate the direction of the reaction the HSD17β enzymes mediate, with the specific family member suffixes in corresponding boxes. HSD17β, 17β-hydroxysteroid dehydrogenase; DHEA, dehydroepiandrosterone; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Area plot demonstrating relative expression of HSD17β1, 2, 4, 6, 7, 8, 10, 11, 12, and 14 in the (A) chorioallantois and (B) endometrium through gestation as determined by RNA-sequencing. Arrows indicate the direction of the reaction the HSD17β enzymes mediate, with the specific family member suffixes in corresponding boxes. HSD17β, 17β-hydroxysteroid dehydrogenase; DHEA, dehydroepiandrosterone; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Another hydroxysteroid dehydrogenase family member, 3β-HSD plays multiple roles in the metabolism of sex steroids by catalyzing the conversion of Δ5 steroids to Δ4 steroids (e.g. P5 → P4). Although two isozymes exist in the transcriptome of the horse (3β-HSD2 and 3β-HSD7), 3β-HSD2 transcript is much more prevalent (Fig. 4A). There are significant but opposing changes across gestation in CA and EN; transcript abundance increases significantly in CA through gestation with a marked increase in postpartum CA, while it decreases nominally in EN (Fig. 4A). In addition to 3β-HSD, the conversion of DHEA to androstenediol and pregnenolone to progesterone can also be catalyzed by GSTA3 (Fig. 4B) in both the horse and the human (Lindstrom et al. 2019). This enzyme has a higher catalytic efficiency than 3β-HSD2 in in vitro studies, suggesting that it may play a role in the conversion of Δ5 to Δ4 steroids despite its relatively lower abundance. However, humans deficient in 3β-HSD2 have an overabundance of Δ5 steroids (Baquedano et al. 2018), suggesting that GSTA3 is not sufficient to replace 3β-HSD2, but can only supplement its activity.
Relative expression of (A) HSD3B2, HSD3B7, and (B) GSTA3 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in (C) indicate the conversions of Δ5 to Δ4 steroids mediated by the resultant enzymes. HSD3β, 3β-hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Differing letters denote statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) HSD3B2, HSD3B7, and (B) GSTA3 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in (C) indicate the conversions of Δ5 to Δ4 steroids mediated by the resultant enzymes. HSD3β, 3β-hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Differing letters denote statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) HSD3B2, HSD3B7, and (B) GSTA3 transcripts in the chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in (C) indicate the conversions of Δ5 to Δ4 steroids mediated by the resultant enzymes. HSD3β, 3β-hydroxysteroid dehydrogenase; GSTA3, glutathione transferase A3-3; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Differing letters denote statistically significant differences (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Pregnanes
In the mare, progesterone levels are at or below the limit of detection during mid-late gestation, with a 5α-reduced form of progesterone (DHP) acting as the major known bioactive pregnane during this time (Holtan et al. 1975, Scholtz et al. 2014). Three 5α-reductase family members have been identified in the horse, encoded by SRD5A1, SRD5A2, and SRD5A3. Of the three, SRD5A1 is the most prevalent overall in equine tissues, with the highest expression seen in the pregnant EN, followed closely by the CA (Fig. 5A). Expression patterns were consistent with what has been previously reported in the horse (Corbin et al. 2016, Legacki et al. 2017), including work which showed a marked decrease in SRD5A1 expression in the PP CA compared to 11-month CA, with concurrent reduction in reductase activity and tissue pregnane levels (Legacki et al. 2016a). Despite its prevalence in human tissues, including liver, prostate, and testis (Fagerberg et al. 2014), SRD5A2 was only identified in the adrenal gland in the horse (Fig. 5C).
Relative expression of SRD5A1, SRD5A2, and SRD5A3 transcripts in the (A) chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in B indicate the conversions mediated by the resultant enzymes. Relative expression of these transcripts is also shown in (C) adrenal gland; (D) testes, ovary, and diestrous endometrium; and (E) skin, lung, kidney, ICM, cerebellum, adipose, and liver. SRD5A, 5α-reductase; EN, endometrium; ICM, inner cell mass; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted in (A) by * (chorioallantois) and † (endometrium) in the graph legend. B and C use differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of SRD5A1, SRD5A2, and SRD5A3 transcripts in the (A) chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in B indicate the conversions mediated by the resultant enzymes. Relative expression of these transcripts is also shown in (C) adrenal gland; (D) testes, ovary, and diestrous endometrium; and (E) skin, lung, kidney, ICM, cerebellum, adipose, and liver. SRD5A, 5α-reductase; EN, endometrium; ICM, inner cell mass; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted in (A) by * (chorioallantois) and † (endometrium) in the graph legend. B and C use differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of SRD5A1, SRD5A2, and SRD5A3 transcripts in the (A) chorioallantois and endometrium through gestation as determined by RNA-sequencing. Red arrows in B indicate the conversions mediated by the resultant enzymes. Relative expression of these transcripts is also shown in (C) adrenal gland; (D) testes, ovary, and diestrous endometrium; and (E) skin, lung, kidney, ICM, cerebellum, adipose, and liver. SRD5A, 5α-reductase; EN, endometrium; ICM, inner cell mass; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted in (A) by * (chorioallantois) and † (endometrium) in the graph legend. B and C use differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Of the three different transcripts encoding 5α-reductase isozymes, SRD5A3 is the most prevalent transcript in the non-pregnant (diestrus) EN, with an increased abundance also seen in the ovary and testes (Fig. 5D). Although its role in steroid reduction is controversial, one publication reported that a SRD5A3 knock-down in a prostate cancer cell line resulted in a significant decrease in DHT production, suggesting that it mediates the reduction of testosterone (Uemura et al. 2008). In contrast, cells transfected with either hamster or human SRD5A3 had no detectable reductase activity (Chavez et al. 2015). Whether or not SRD5A3 has significant steroid reductase activity, it is well established that this enzyme plays an important role in N-linked protein glycosylation, acting to convert polyprenol to dolichol (Cantagrel et al. 2010).
Early embryos have significant 5α-reductase activity, with progesterone being readily converted to 3β, 5α-tetrahydroprogesterone, the major product, as well as 5α-dihydroprogesterone to a lesser extent by embryos as young as 20-day gestation (Raeside et al. 2015). These findings suggest that there are one or several 5α-reductases present in early embryos, in addition to an AKR, likely AKR1C1, to be able to produce this particular combination of reduced pregnanes. Although the major product of progesterone was 3β,5α-tetrahydroprogesterone, only 3β,5α-tetrahydrotestosterone, not 5α-dihydrotestosterone, was seen when testosterone was the substrate (Raeside et al. 2015). As 5α-dihydrotestosterone is not seen in adult horses (AJ Conley, personal communication), it is possible that this metabolite is bypassed or rapidly converted to other products; alternatively, it could suggest that a different isozyme is responsible for the 5α-reduction of testosterone in the horse.
Moreover, non-embryonic tissues other than the gonads may have 5α-reductase activity, as large quantities of progesterone are reduced to DHP rapidly when injected into ovariectomized mares and geldings; this reduction does not seem to be occurring in the blood or the liver (Conley et al. 2018). Looking at the transcriptome from a wide range of tissues, it appears that the skin has higher expression of SRD5A1 than any other observed tissue excluding CA (Fig. 5E) and may be responsible for the extra-uterine reduction of progesterone. The elevated expression of SRD5A1 in skin may account for the rapid reduction of P4 to DHP in the horse following systemic administration of P4 to either geldings or ovariectomized mares (Conley et al. 2018). Since rapid metabolism of P4 to DHP was not catalyzed in vitro by either whole blood or hepatic microsomes, skin may represent a significant site outside the reproductive tract for progesterone metabolism in the horse.
DHP itself is further reduced to its 20α-and 3β-hydroxy metabolites, a process performed by members of the aldo-keto reductase family (AKRs). These AKRs have a wide range of enzymatic activities, including progesterone metabolism and prostaglandin synthesis (Byrns 2011, Penning 2015). In our dataset, AKR1C1 was by far the most abundant AKR transcript in the EN throughout gestation, as well as having moderate expression at 6 and 10 months of gestation in the CA (Fig. 6A). This enzyme is known in humans for its ability to convert progesterone, 5α-DHP, and 5β-DHP to their 20α- and 3β-hydroxy metabolites, including the neurosteroid allopregnanolone (Byrns 2011). AKR1C1 also acts in the prostaglandin synthesis pathway, reducing prostaglandin D2 to 9α,11β-PGF2; however, other family members such as AKR1C3 are significantly more efficient at this conversion (Nishizawa et al. 2000, Komoto et al. 2006, Watanabe 2011). This is a moot point for equids, as neither AKR1C2 nor AKR1C3 have been identified in the horse, with AKR1C2 largely limited to primates (Ensembl v 96). The other AKR1C family member identified in the horse, AKR1C23, has not been studied extensively; however, it has a shorter protein sequence that is otherwise highly homologous to that of AKR1C1 and has similar 20α-HSD activity (Brown et al. 2006). Elevated expression of AKR1C1 in EN beginning at 4 to 6 months of gestation corresponds to the increased maternal concentrations of 20α-hydroxylated metabolites such as 20α-DHP and 20α,3β-DHP that increase dramatically in mares in late gestation (Ousey et al. 2003, Legacki et al. 2016b, Conley & Ball 2019). This suggests that endometrial metabolism of 5α-reduced pregnanes by AKR1C1 may be responsible for these changes in steroid metabolism in equine gestation.
Relative expression of (A) AKR family member transcripts and (B) CYP19A1 (aromatase) through gestation as determined by RNA-sequencing. AKR, aldo keto reductase; CYP19A1, cytochrome P450 family 19 subfamily A member 1; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A). B uses differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) AKR family member transcripts and (B) CYP19A1 (aromatase) through gestation as determined by RNA-sequencing. AKR, aldo keto reductase; CYP19A1, cytochrome P450 family 19 subfamily A member 1; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A). B uses differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of (A) AKR family member transcripts and (B) CYP19A1 (aromatase) through gestation as determined by RNA-sequencing. AKR, aldo keto reductase; CYP19A1, cytochrome P450 family 19 subfamily A member 1; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A). B uses differing letters to indicate statistically significant differences by time point (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Our data also showed abundant levels of AKR1A1 in the CA, with peak expression at 45 days (Fig. 6A). This enzyme is an aldehyde reductase (Penning 2015) with significant prostaglandin F synthase activity and is indeed a much more potent prostaglandin F synthase than even AKR1C1-3′ (Lacroix Pepin et al. 2013), equivalent to that of AKR1B1. Although AKR1B1 exhibited low levels of transcript expression, there were significant changes in chorioallantoic expression throughout gestation (Fig. 6A). Other AKR transcripts identified in the horse include AKR1D1 (limited to 45 d CA). Although 5β-DHP has not been reported in equine pregnancy, it is a major metabolite in human pregnancy with high levels of AKR1D1 found in human placenta (Byrns 2011). One might speculate that if 5β-DHP is detectable in equine pregnancy, it would be present in early gestation due to AKR1D1 expression being limited to the 45-day CA.
Estrogens
Horses have very high levels of circulating estrogens during late gestation (Conley 2016), including B-ring unsaturated estrogens such as equilin (Raeside 2017), levels known to be produced in substantial quantities only by equids. Although little is known about the production of B-ring unsaturated estrogens, the more common estrogens are formed by the conversion of androstenedione and testosterone to estrone (E1) and estradiol (E2) by aromatase (CYP19A1). CYP19A1 is one of the seven most abundant transcripts in the CA (Loux et al. 2019), with expression peaking at 6 months (Fig. 6B), corresponding with the peak of circulating estrogens in the pregnant mare (Nett et al. 1973, Legacki et al. 2019). Estrogen synthesis appears to be inherent within even early embryos, as uterine flush fluids from pregnant mares and conceptus culture media were shown to contain estrogens (Zavy et al. 1979), even as early as 12 days of gestation (Zavy et al. 1984). Estrogen synthesis occurs both within the extra-embryonic membranes and within the embryo proper as early as 25 days (Walters et al. 2000, Raeside et al. 2009, 2012). In these embryos, relatively high levels of oxidation and low levels of reduction were seen, resulting in E1 as the major product (Raeside et al. 2009), suggestive of dissimilar ratios of HSD17B1 and HSD17B2 across tissues, as we see here (Fig. 3).
Sulfotransferases
Horses have high levels of circulating sulfonated estrogens throughout gestation, with estrone sulfate representing the most prominent sulfonated steroid with levels peaking at 26 weeks of gestation (Legacki et al. 2019). This sulfonation is believed to largely occur via SULT1E1, known as an estrogen sulfotransferase, which also sulfonates a wide variety of steroids, including E1, E2, tamoxifen, diethylstilbesterol, pregnenolone, and DHEA (Falany et al. 1995, Song et al. 1995). Levels of SULT1E1 in the EN peaks at 4 months of gestation then drop significantly by 6 months (Fig. 7A), suggesting another sulfotransferase is working concurrently to sulfonate estrogens during late gestation. ENSECAG00000021518 (SULT1A1 (predicted)), a novel transcript within the CA with significant homology to SULT1A1, may be involved in the synthesis of estrogen sulfates in equine placental tissue. SULT1A1 (predicted) is the most abundant sulfotransferase transcript in the CA, with expression levels mirroring those of estrogens during gestation (Fig. 7A). In other species, SULT1A1 is best known for its ability to sulfoconjugate phenols, but has demonstrable ability to sulfonate both naturally occurring and synthetic estrogens such as tamoxifen (Liu et al. 2017, Sanchez-Spitman et al. 2018). The additive effect of these two sulfotransferases could well explain the levels of estrone sulfate seen in maternal circulation. The expression levels of SULT1A1 and SULT1E1 have been confirmed with qPCR (Supplemental Fig. 1C and D). Results were highly correlated between methods for both SULT1A1 (r = 0.858, P < 0.01) and SULT1E1 (r = 0.933, P < 0.0001).
Relative expression of transcripts involved in steroid conjugation through gestation as determined by RNA-sequencing, including (A) SULT family members, (B) PAPPS1 and PAPPS2, (C) STS, and (D) UGT family members. SULT, sulfotransferase; PAPPS, phosphosulfate synthetase; STS, steroid sulfatase; UGT, uridine diphosphate-glucuronosyltransferase; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A, B, D). C uses differing letters to indicate statistically significant differences by time point and tissue (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of transcripts involved in steroid conjugation through gestation as determined by RNA-sequencing, including (A) SULT family members, (B) PAPPS1 and PAPPS2, (C) STS, and (D) UGT family members. SULT, sulfotransferase; PAPPS, phosphosulfate synthetase; STS, steroid sulfatase; UGT, uridine diphosphate-glucuronosyltransferase; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A, B, D). C uses differing letters to indicate statistically significant differences by time point and tissue (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of transcripts involved in steroid conjugation through gestation as determined by RNA-sequencing, including (A) SULT family members, (B) PAPPS1 and PAPPS2, (C) STS, and (D) UGT family members. SULT, sulfotransferase; PAPPS, phosphosulfate synthetase; STS, steroid sulfatase; UGT, uridine diphosphate-glucuronosyltransferase; CA, chorioallantois; EN, endometrium; PP, post-partum. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A, B, D). C uses differing letters to indicate statistically significant differences by time point and tissue (P < 0.05).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Sulfonation also requires the presence of a PAPS synthase isoform (PAPSS1 or PAPSS2) (Kauffman 2004, Mueller et al. 2018). These enzymes catalyze the transformation of inorganic sulfates to the activated sulfate compound, 3′-phosphoadenosine 5′-phosphosulphate (PAPS) (Kauffman 2004). While both PAPSS1 and PAPSS2 were present in CA and EN throughout gestation, changes in PAPSS2 expression were significantly correlated with those of SULT1E1 in the pregnant EN (P < 0.001; r = 0.76; Fig. 7B), suggesting that these two enzymes may be coordinately regulated.
Although sulfonation has long been believed to have the dual purposes of inactivation and aiding in excretion, recent evidence suggests that peripheral tissues are able to uptake the sulfonated steroids and activate them via steroid sulfatase (STS)-mediated desulfation (Garbacz et al. 2017). In our dataset, STS is observed primarily in the CA, with increasing abundance throughout gestation (Fig. 7C). Looking at the other sequenced tissues, expression is moderate in lung, kidney, cerebellum, ovary, and adrenal glands. Expression in non-pregnant mare and stallion liver is relatively low (FPKM = 0.22 ± 0.03), with the exception of a single RNA sample derived from pooled pregnant mare and fetal liver with over 20-fold higher expression (FPKM = 4.69). While it is difficult to draw definitive conclusions from a single sample, these data suggest that fetal liver and/or pregnant mare liver may be transporting and activating estrogens from circulation more actively than liver from non-pregnant horses.
UDP-glucuronosyltransferases (UGT)
In other species, including cattle and swine, glucuronidation is a major mechanism for clearing estrogens from the EN during diestrus (Hankele et al. 2018, Owen et al. 2018), while in the horse, glucuronidation is used to clear pyrenes (Saengtienchai et al. 2014) and other molecules (Corado et al. 2017) from circulation. Indeed, glucuronated pyrene is present in higher concentrations in equine urine than any other tested species, excluding deer (Saengtienchai et al. 2014). Despite this, there has been no research into whether the mare uses glucuronidation to clear estrogens from the EN.
Although there are only a few UGT-related transcripts expressed in our CA or EN data during pregnancy, ENSECAG00000033324 (UGT2C1 (predicted)) is present in the EN with much higher levels seen in diestrus than estrus (Fig. 7D). The pattern in cyclic mares is similar to that seen in pigs (Hankele et al. 2018) and cows (Owen et al. 2018), where UGTs are theorized to help clear estrogens from the EN. Interestingly, no sulfotransferase transcripts are up-regulated in the EN during diestrus (Fig. 7A), raising the possibility that estrogens may be primarily sulfonated by the EN during pregnancy, while being glucuronidated in the cyclic mare.
Steroid transporters
Of the annotated ABC, SLC, SLCO, and OAT transporters, SLCO2A1 expression is substantially higher than any other transporter transcript in the CA or EN (Table 3). SLCO2A1 encodes the prostaglandin transporter protein (PGT) and is downregulated in fetal membranes during late gestation (Alzamil et al. 2014) and placental infection (Petrovic et al. 2015) in humans. While our data show a similar trend in the equine EN, we see a consistent up-regulation throughout gestation in CA, with expression peaking in postpartum CA.
Steroid transporter transcripts in the chorioallantois and endometrium through gestation in Equus caballus.
| ENSEMBL_ID | gene_ID | protein_ID | CA 45days | CA 4 mo | CA 6 mo | CA 10 mo | CA 11 mo | CA PP | EN 4 mo | EN 6 mo | EN 10 mo | EN 11 mo | EN Diestrus |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ENSECAG00000008852 | ABCA1 | ABCA1 | 3.54 ± 1.4 | 1.50 ± 0.1 | 1.38 ± 0.0 | 0.52 ± 0.0 | 0.34 ± 0.0 | 1.30 ± 0.5 | 2.94 ± 0.3 | 2.57 ± 0.4 | 6.01 ± 1.4 | 5.84 ± 0.5 | 11.6 ± 1.2 |
| ENSECAG00000017842 | ABCB1 | MDR1 | 10.2 ± 1.5 | 18.4 ± 1.6 | 19.4 ± 1.4 | 13.4 ± 1.9 | 14.7 ± 1.6 | 35.6 ± 3.4 | 9.35 ± 0.9 | 9.83 ± 0.7 | 10.3 ± 2.6 | 11.6 ± 3.2 | 1.94 ± 0.1 |
| ENSECAG00000006784 | ABCC1 | MRP1 | 1.50 ± 0.2 | 2.09 ± 0.1 | 2.60 ± 0.1 | 2.77 ± 0.1 | 2.47 ± 0.5 | 3.01 ± 0.7 | 16.5 ± 3.8 | 10.4 ± 1.9 | 4.88 ± 0.7 | 2.42 ± 0.3 | 4.71 ± 0.2 |
| ENSECAG00000005169 | ABCC10 | MRP7 | 3.73 ± 0.5 | 3.30 ± 0.1 | 3.27 ± 0.0 | 3.42 ± 0.2 | 2.61 ± 0.3 | 2.15 ± 0.1 | 2.73 ± 0.2 | 2.01 ± 0.1 | 1.59 ± 0.1 | 1.08 ± 0.2 | 3.24 ± 0.3 |
| ENSECAG00000019541 | ABCC12 | MRP9 | 0.01 ± 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| ENSECAG00000017168 | ABCC4 | MRP4 | 0.41 ± 0.1 | 0.12 ± 0.0 | 0.10 ± 0.0 | 0.14 ± 0.0 | 0.14 ± 0.0 | 0.18 ± 0.0 | 0.81 ± 0.1 | 0.53 ± 0.1 | 0.89 ± 0.0 | 1.22 ± 0.1 | 1.00 ± 0.2 |
| ENSECAG00000007961 | ABCC5 | MRP5 | 13.2 ± 2.0 | 7.46 ± 1.5 | 6.79 ± 0.4 | 6.56 ± 1.2 | 6.54 ± 0.3 | 5.38 ± 0.7 | 2.83 ± 0.1 | 2.66 ± 0.1 | 2.17 ± 0.3 | 2.16 ± 0.3 | 25.3 ± 4.5 |
| ENSECAG00000008870 | ABCC6 | MRP6 | 1.23 ± 0.3 | 1.26 ± 0.1 | 1.34 ± 0.1 | 1.73 ± 0.2 | 0.70 ± 0.2 | 0.91 ± 0.1 | 0.28 ± 0.1 | 0.41 ± 0.1 | 0.25 ± 0.0 | 0.02 ± 0.0 | 0.14 ± 0.0 |
| ENSECAG00000019065 | ABCG1 | ABCG1 | 12.71 ± 2.1 | 11.30 ± 0.9 | 13.09 ± 0.3 | 8.12 ± 0.0 | 8.10 ± 1.3 | 16.87 ± 1.9 | 9.77 ± 1.0 | 7.65 ± 0.3 | 4.70 ± 0.7 | 4.43 ± 0.7 | 5.08 ± 0.3 |
| ENSECAG00000009773 | ABCG2 | ABCG2 | 34.20 ± 2.1 | 24.59 ± 4.7 | 20.20 ± 3.6 | 32.53 ± 4.5 | 21.52 ± 1.3 | 26.83 ± 2.1 | 8.99 ± 0.7 | 10.41 ± 1.3 | 12.35 ± 3.7 | 9.40 ± 2.0 | 11.74 ± 0.1 |
| ENSECAG00000014873 | OAT | OAT | 44.86 ± 3.7 | 21.98 ± 0.8 | 29.08 ± 2.8 | 44.80 ± 10. | 32.15 ± 1.9 | 21.65 ± 1.5 | 57.14 ± 9.6 | 54.74 ± 5.4 | 32.00 ± 1.5 | 25.84 ± 5.9 | 7.11 ± 0.6 |
| ENSECAG00000010602 | SLC22A6 | OAT1 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| ENSECAG00000008551 | SLC22A7 | OAT2 | 0.04 ± 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| ENSECAG00000012673 | SLC22A8 | OAT3 | 0.45 ± 0.4 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.01 ± 0.0 | 0.0 | 0.01 ± 0.0 | 0.0 | 0.0 |
| n/a | SLC22A9 | OAT7 | – | – | – | – | – | – | – | – | – | – | – |
| ENSECAG00000032146 | SLC22A11 | OAT4 | 0.22 ± 0.0 | 0.08 ± 0.0 | 0.51 ± 0.1 | 0.84 ± 0.4 | 0.56 ± 0.1 | 0.06 ± 0.0 | 3.50 ± 0.5 | 3.96 ± 0.7 | 2.68 ± 0.6 | 3.16 ± 0.8 | 0.11 ± 0.0 |
| ENSECAG00000014100 | SLC22A13 | OAT10 | 0.08 ± 0.0 | 0.05 ± 0.0 | 0.07 ± 0.0 | 0.04 ± 0.0 | 0.05 ± 0.0 | 0 ± 0 | 0.06 ± 0.0 | 0.04 ± 0.0 | 0.05 ± 0.0 | 0 ± 0 | 0 ± 0.0 |
| ENSECAG00000024975 | SLC22A18 | SLC22A1L | 0.12 ± 0.0 | 35.2 ± 7.9 | 41.1 ± 4.7 | 41.3 ± 14. | 21.1 ± 2.4 | 21.3 ± 5.9 | 7.99 ± 2.5 | 12.07 ± 2.7 | 7.96 ± 2.5 | 0.98 ± 0.4 | 0.02 ± 0.0 |
| n/a | SLC22A19 | OAT5 | – | – | – | – | – | – | – | – | – | – | – |
| n/a | SLC22A20 | OAT6 | – | – | – | – | – | – | – | – | – | – | – |
| ENSECAG00000017481 | SLCO1A2 | OATP1A2 | 0.0 | 0.03 ± 0.0 | 0.0 | 0.01 ± 0.0 | 0.02 ± 0.0 | 0.0 | 0.93 ± 0.2 | 0.71 ± 0.1 | 1.02 ± 0.4 | 0.60 ± 0.1 | 76.47 ± 6.8 |
| ENSECAG00000019552 | SLCO1C1 | OATP1C1 | 0.01 ± 0.0 | 0.0 | 0.0 | 0.01 ± 0.0 | 0.02 ± 0.0 | 0.0 | 0.0 | 0.0 | 0.01 ± 0.0 | 0.0 | 0.01 ± 0.0 |
| ENSECAG00000024948 | SLCO2A1 | OATP2A1, PGT | 87.05 ± 11.1 | 155.5 ± 4.02 | 173.56 ± 6.6 | 192.50 ± 11.8 | 209. ± 16.9 | 240.75 ± 12.9 | 300.82 ± 42.9 | 256.66 ± 40.5 | 146.58 ± 28.5 | 49.20 ± 18.0 | 1.32 ± 0.0 |
| ENSECAG00000024423 | SLCO2B1 | OATP2B1 | 20.06 ± 3.9 | 33.75 ± 1.2 | 31.51 ± 3.3 | 20.73 ± 2.9 | 14.52 ± 2.2 | 7.64 ± 0.5 | 4.00 ± 0.6 | 4.11 ± 0.6 | 2.29 ± 0.6 | 1.54 ± 0.6 | 0.69 ± 0.0 |
| ENSECAG00000013398 | SLCO3A1 | OATP3A1 | 5.35 ± 0.9 | 13.97 ± 0.3 | 12.30 ± 0.7 | 16.05 ± 0.8 | 15.84 ± 0.7 | 26.46 ± 2.2 | 4.50 ± 0.7 | 4.74 ± 0.2 | 4.82 ± 1.2 | 3.25 ± 0.9 | 2.77 ± 0.4 |
| ENSECAG00000016658 | SLCO4A1 | OATP4A1 | 0.44 ± 0.2 | 1.63 ± 0.1 | 2.07 ± 0.3 | 2.97 ± 0.2 | 1.87 ± 0.3 | 1.99 ± 0.4 | 7.91 ± 0.4 | 6.66 ± 0.8 | 8.92 ± 1.0 | 8.03 ± 1.7 | 2.07 ± 0.7 |
| ENSECAG00000009100 | SLCO4C1 | OATP4C1 | 4.87 ± 1.0 | 6.02 ± 1.0 | 10.47 ± 0.3 | 8.49 ± 1.1 | 8.24 ± 0.6 | 9.11 ± 1.1 | 22.93 ± 1.5 | 24.12 ± 2.2 | 17.0 ± 2.5 | 9.05 ± 4.0 | 0.06 ± 0.0 |
| ENSECAG00000016284 | SLCO5A1 | OATP5A1 | 0.05 ± 0.0 | 0.44 ± 0.1 | 1.01 ± 0.1 | 0.48 ± 0.1 | 0.27 ± 0.0 | 0.62 ± 0.0 | 0.25 ± 0.0 | 0.41 ± 0.0 | 0.39 ± 0.1 | 0.09 ± 0.0 | 0.15 ± 0.0 |
| ENSECAG00000007048 | SLCO6A1 | OATP6A1 | 0.0 | 0.02 ± 0.0 | 0.02 ± 0.0 | 0.09 ± 0.0 | 0.06 ± 0.0 | 0.07 ± 0.0 | 0.01 ± 0.0 | 0.02 ± 0.0 | 0.02 ± 0.0 | 0.0 | 0.0 |
| ENSECAG00000007962 | SOAT1 | ACAT | 5.89 ± 1.1 | 2.36 ± 0.2 | 2.49 ± 0.2 | 2.54 ± 0.1 | 1.84 ± 0.2 | 2.22 ± 0.3 | 5.90 ± 0.6 | 5.90 ± 0.8 | 6.29 ± 0.3 | 5.21 ± 0.5 | 6.15 ± 0.5 |
| ENSECAG00000020109 | SOAT2 | ACAT2 | 0.93 ± 0.8 | 0.0 | 0.01 ± 0.0 | 0.0 | 0.02 ± 0.0 | 0.0 | 0.01 ± 0.0 | 0.02 ± 0.0 | 0.02 ± 0.0 | 0.0 | 1.21 ± 0.1 |
| ENSECAG00000021765 | TSPO | TSPO | 3.47 ± 1.1 | 3.26 ± 0.3 | 2.50 ± 0.2 | 4.11 ± 0.1 | 2.26 ± 0.5 | 2.47 ± 0.6 | 2.83 ± 0.2 | 2.28 ± 0.1 | 2.45 ± 0.1 | 1.41 ± 0.2 | 9.67 ± 0.8 |
ABC, ATP-binding cassette transporters; ACAT, Acyl-CoA cholesterol acyltransferase; CA, chorioallantois; EN, endometrium; MDR, multi-drug resistance; MRP, multidrug resistance-associated protein; mo, months; OATP, organic anion transporter protein; PGT, prostaglandin transporter; SLC, solute carrier; SLCO, solute carrier organic anion transporter; TSPO, mitochondrial translocator protein.
Expression of transporter transcripts shows markedly different expression patterns in the CA and EN. In the pregnant EN, SLCO4C1 exhibits the second highest expression behind only SLCO2A1, while expression of ABCC5 and SLCO1A2 rise drastically during diestrus, overtaking all other transcripts. The product of SLO4C1, OATP4C1 is a known estrone sulfate transporter, which acts to move estrone sulfate to the apical cell surface in a pH dependent manner (Kuo et al. 2012), with gene mutations leading to decreased gestational health, including an increased risk of preeclampsia in women (Morrison et al. 2010). The other two transporters have not been previously studied in the EN, although SLCO1A2 product OATP1A2 is a known estrone sulfate transporter (Giton et al. 2015). Granted, ABCC5 encoded protein MRP5 is not a known steroid transporter, but has been reported to transport cGMP across the basal membrane of the human placenta (Meyer Zu Schwabedissen et al. 2005).
Chorioallantoic transporter expression is more complex, with SLCOB21, SLC22A18, and ABCG2 showing consistently high expression through gestation, while SLCO3A1 and ABCB1 have moderate expression throughout gestation, but are dramatically upregulated in the PP CA. SLCO2B1 encodes OATP2B1, a transporter known to mediate basolateral uptake of sulfated steroid conjugates (St-Pierre et al. 2002, Ugele et al. 2003), particularly estrogens. Some studies have suggested that it is also able to transport DHEA-S, though certainly not all (Grube et al. 2007, Ugele et al. 2008, Schweigmann et al. 2014).
SLC22A18 is a maternally expressed imprinted gene associated with lifetime total number born in pigs and mice (Onteru et al. 2011, Lambertini et al. 2012), with data from our lab suggesting it is also imprinted in horses (P. Dini, unpublished data). The normal function of this gene has not been well characterized, but it is known that it acts as an organic cation transporter (Bhutia et al. 2016) which plays a role in regulating intracellular free fatty acids (Ito et al. 2019). SLCO3A1 encodes OATPD, an anion transporter which transports estrone sulfate as well as PGE1 and PGE2 (Tamai et al. 2000). Contrary to our data, OATPD was down-regulated in third-trimester human placenta (Patel et al. 2003). ABCG2 and ABCB1 are arguably the most highly studied of these transporters, valued particularly for their integral role in drug efflux and influx, respectively, in the placenta (Grube et al. 2007, Petrovic et al. 2015, Halwachs et al. 2016, Szilagyi et al. 2017).
Mitochondrial translocator protein (TSPO) transcript was expressed at a low but steady level in both CA and EN throughout gestation, significantly increasing only in the diestrous EN (Table 3). One of the most highly expressed steroid transporters in human placenta, OAT4 (encoded by SLC22A11), (Ugele et al. 2003) was conspicuously absent, with little to no expression of this transcript in equine CA and only minimal expression in the pregnant EN (Table 3).
Steroid receptors
To exert a cellular response, steroids need to bind to either a membrane receptor or a nuclear receptor and probably activate multiple receptor sub-types concurrently. Estrogens, for example, can bind either nuclear receptors ERα (encoded by ESR1) or ERβ (ESR2) or can exert their action through membrane-bound GPER1. Curiously, despite high estrogen concentrations in circulation, expression of these receptors in the CA is low (Fig. 8A). There is, however, evidence of moderate to high levels of estrogen-related receptor alpha (ESRRA) transcript in both the CA and EN throughout gestation. Although ESRRA cannot bind estrogens, it is a key regulator of mitochondrial function and autophagy (Kim et al. 2018). In the EN, there is minimal ESR1 expression throughout gestation, much lower than that seen in the cyclic mare (Fig. 8A and C), with patterns largely matching those described in Silva et al. (2014). ESR2 expression is present, but exceptionally low in both tissues at all time points, with peak concentrations seen in diestrus EN (FPKM 1.09 ± 0.28).
Relative expression of receptors through gestation (A and B) and estrous (C) as determined by RNA-sequencing. Includes (A) estrogen and estrogen-related receptors and (B) other nuclear receptors. ESR, estrogen receptor; GPER, G-coupled estrogen receptor; ESSR, estrogen related receptor; NR, nuclear receptor. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A and B). Significant differences (P < 0.05) between estrus and diestrus as identified by a paired t-test are noted by ** (C).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of receptors through gestation (A and B) and estrous (C) as determined by RNA-sequencing. Includes (A) estrogen and estrogen-related receptors and (B) other nuclear receptors. ESR, estrogen receptor; GPER, G-coupled estrogen receptor; ESSR, estrogen related receptor; NR, nuclear receptor. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A and B). Significant differences (P < 0.05) between estrus and diestrus as identified by a paired t-test are noted by ** (C).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Relative expression of receptors through gestation (A and B) and estrous (C) as determined by RNA-sequencing. Includes (A) estrogen and estrogen-related receptors and (B) other nuclear receptors. ESR, estrogen receptor; GPER, G-coupled estrogen receptor; ESSR, estrogen related receptor; NR, nuclear receptor. Error bars represent s.e.m. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend (A and B). Significant differences (P < 0.05) between estrus and diestrus as identified by a paired t-test are noted by ** (C).
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Transcript for the canonical progesterone receptor (PGR) is minimal in the CA and EN, with quantifiable levels only seen in the diestrus EN (Fig. 9A). This finding is in contrast with an earlier immunohistochemistry-based study which identified PGR in trophoblastic nuclei through mid-late gestation (Abd-Elnaeim et al. 2009). The immediate cause for the discrepancy is not clear; however, Abd-Elnaeim et al. used a human progesterone receptor antibody. While there is a relatively high identity among the progesterone receptor proteins of these species (86%), the human progesterone receptor also shares identity with the equine glucocorticoid receptor (encoded by NR3C1; 56%) and mineralocorticoid receptor (NR3C2; 55%), both of which have high levels of transcript present in the CA throughout gestation (Fig. 8B) and both of which would be expected to have similar nuclear localization as the progesterone receptor.
Area plot demonstrating relative expression of (A) nuclear (PGR) and membrane-bound progesterone family members (PGRMC1, PGRMC2, NENF, and CYB5D2) and (B) PAQR-family receptors as determined by RNA-sequencing. PGRMC, membrane-associated progesterone receptor; NENF, neuron-derived neurotrophic factor; CYB5D2, neuferricin; PAQR, progestin and adipoQ receptor; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Area plot demonstrating relative expression of (A) nuclear (PGR) and membrane-bound progesterone family members (PGRMC1, PGRMC2, NENF, and CYB5D2) and (B) PAQR-family receptors as determined by RNA-sequencing. PGRMC, membrane-associated progesterone receptor; NENF, neuron-derived neurotrophic factor; CYB5D2, neuferricin; PAQR, progestin and adipoQ receptor; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Area plot demonstrating relative expression of (A) nuclear (PGR) and membrane-bound progesterone family members (PGRMC1, PGRMC2, NENF, and CYB5D2) and (B) PAQR-family receptors as determined by RNA-sequencing. PGRMC, membrane-associated progesterone receptor; NENF, neuron-derived neurotrophic factor; CYB5D2, neuferricin; PAQR, progestin and adipoQ receptor; PP, post-partum. Significant differences (P < 0.05) across gestation are denoted by * (chorioallantois) and † (endometrium) in the graph legend.
Citation: Reproduction 160, 1; 10.1530/REP-20-0015
Whether or not PGR is present in these tissues, membrane-bound progestin receptor transcripts are abundant. The most ubiquitous of these is the progesterone receptor membrane component 1 (PGRMC1), with the highest transcript level of any receptor in both CA and EN (Fig. 9A). Although there is evidence to suggest that very early equine embryos (7–14 days) express PGR transcript, it is only for a limited time and may not be translated into protein (Rambags et al. 2008). This lack of PGR in placental tissues suggests that, although PGR binding and activation has traditionally been how progestin bioactivity is assessed, future placental research should include progesterone membrane receptors such as PGRMC1 and the PAQR receptor family. This does not minimize the importance of the PGR; this receptor is present in the equine cervix (Fernandes et al. 2017) and myometrium, where it plays an integral role in maintaining myometrial quiescence (El-Sheikh Ali et al. 2019).
Other progesterone receptor transcripts produced by 7–14 day embryos include PGRMC1 and PAQR8 (Rambags et al. 2008), both of which continue to be expressed in CA throughout gestation, with PAQR8 being the dominant adipoQ receptor in the 45-day CA (Fig. 9B). In all later gestational time points, PAQR7 is the most abundant adipoQ receptor. The pattern of adipoQ receptors in the EN is quite different than that of the CA (Fig. 9B). Here, PAQR5 is the predominant receptor during pregnancy, followed by PAQR3 and then PAQR7, with PAQR8 and PAQR9 expression nearly zero. Of these, PAQR6 possesses the highest affinity for progesterone (Pang et al. 2013), though it is not clear that PAQR3 binds to progesterone with high affinity, instead regulating cell metabolism and leptin signaling (Wang et al. 2013). Even so, these receptors elicit different responses when bound by progestogens (Petersen et al. 2013), hinting at a physiological role beyond those suggested by the differential expression patterns across tissues. Furthermore, the interaction of 5α-reduced pregnanes with these receptors remains unexplored.
Other nuclear receptors (NR) may also mediate some of the physiological effects of steroid hormones. Although there are over 15 NR present in the CA and EN, including the mineralocorticoid (NR3C2) and glucocorticoid receptor (NR3C1), the most abundant NR in equine placental tissues is NR4A1 (Fig. 8B). Considered an orphan nuclear receptor, NR4A1 may play multiple roles in reproduction, including the regulation of luteal function (Qi et al. 2018), litter size (Kumchoo & Mekchay 2015), uterine fibroids (Yin et al. 2013) and steroidogenesis (Song et al. 2002, Inaoka et al. 2008), and is down-regulated in response to dexamethasone (Ing et al. 2014). Despite its prevalence in the equine placenta, there have been no studies assessing the function of NR4A1 during gestation in the horse. Expression of NR5A1 (steroidogenic factor-1; SF-1) is not apparent in either the CA or EN, although it plays an integral role in gonadal development and steroidogenesis in other species (Meinsohn et al. 2019).
Conclusions
The data described in this manuscript are largely based on the transcriptome from CA and EN. The data confirm and significantly extend previous research on steroidogenesis and steroid-related factors in the horse. Transcriptome analysis is a powerful tool with which we can quickly and efficiently identify expressed genes of interest and develop new hypotheses. These data represent the first holistic examination of the steroid-related transcriptome in the placenta of the mare. They not only confirm previous research, but also provide novel hypotheses to help better understand the steroid control of pregnancy.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-20-0015.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was funded by the Kentucky Thoroughbred Association/Kentucky Thoroughbred Breeders and Owners and the Albert Clay Endowment.
Author contribution statement
S C L designed experiments, performed statistics, and wrote the manuscript. A J C assisted with experimental design and editing the manuscript. K E S extracted RNA, ran qPCR, and edited the manuscript. H E S A assisted with experimental design and editing the manuscript. P D assisted with experimental design and editing. B A B provided funding for this study, aided in experimental design, and editing the manuscript.
Acknowledgements
The authors wish to thank Dr Claudia Fernandes for her generous assistance with this project.
References
Abd-Elnaeim MM, Derar IR, Wilsher S, Allen WR, Leiser R & Schuler G 2009 Immunohistochemical localization of oestrogen receptors alpha and beta, progesterone receptor and aromatase in the equine placenta. Reproduction in Domestic Animals 44 312–319. (https://doi.org/10.1111/j.1439-0531.2008.01073.x)
Ainsworth L & Ryan KJ 1966 Steroid hormone transformations by endocrine organs from pregnant mammals. I. Estrogen biosynthesis by mammalian placental preparations in vitro. Endocrinology 79 875–883. (https://doi.org/10.1210/endo-79-5-875)
Alzamil HA, Pawade J, Fortier MA & Bernal AL 2014 Expression of the prostaglandin F synthase AKR1B1 and the prostaglandin transporter SLCO2A1 in human fetal membranes in relation to spontaneous term and preterm labor. Frontiers in Physiology 5 272. (https://doi.org/10.3389/fphys.2014.00272)
Baquedano MS, Guercio G, Costanzo M, Marino R, Rivarola MA & Belgorosky A 2018 Mutation of HSD3B2 gene and fate of dehydroepiandrosterone. Vitamins and Hormones 108 75–123. (https://doi.org/10.1016/bs.vh.2018.05.002)
Berkane N, Liere P, Oudinet JP, Hertig A, Lefevre G, Pluchino N, Schumacher M & Chabbert-Buffet N 2017 From pregnancy to preeclampsia: a key role for estrogens. Endocrine Reviews 38 123–144. (https://doi.org/10.1210/er.2016-1065)
Bhutia YD, Babu E, Ramachandran S, Yang S, Thangaraju M & Ganapathy V 2016 SLC transporters as a novel class of tumour suppressors: identity, function and molecular mechanisms. Biochemical Journal 473 1113–1124. (https://doi.org/10.1042/BJ20150751)
Brown KA, Boerboom D, Bouchard N, Dore M, Lussier JG & Sirois J 2006 Human chorionic gonadotropin-dependent induction of an equine aldo-keto reductase (AKR1C23) with 20alpha-hydroxysteroid dehydrogenase activity during follicular luteinization in vivo. Journal of Molecular Endocrinology 36 449–461. (https://doi.org/10.1677/jme.1.01987)
Burns EN, Bordbari MH, Mienaltowski MJ, Affolter VK, Barro MV, Gianino F, Gianino G, Giulotto E, Kalbfleisch TS & Katzman SA et al. 2018 Generation of an equine biobank to be used for functional annotation of animal genomes project. Animal Genetics 49 564–570. (https://doi.org/10.1111/age.12717)
Byrns MC 2011 Role of aldo-keto reductase enzymes in mediating the timing of parturition. Frontiers in Pharmacology 2 92. (https://doi.org/10.3389/fphar.2011.00092)
Cantagrel V, Lefeber DJ, Ng BG, Guan Z, Silhavy JL, Bielas SL, Lehle L, Hombauer H, Adamowicz M & Swiezewska E et al. 2010 SRD5A3 is required for converting polyprenol to dolichol and is mutated in a congenital glycosylation disorder. Cell 142 203–217. (https://doi.org/10.1016/j.cell.2010.06.001)
Chavez B, Ramos L, Garcia-Becerra R & Vilchis F 2015 Hamster SRD5A3 lacks steroid 5alpha-reductase activity in vitro. Steroids 94 41–50. (https://doi.org/10.1016/j.steroids.2014.11.005)
Cole TJ, Short KAL & Hooper SB 2019 The science of steroids. Seminars in Fetal and Neonatal Medicine 24 170–175. (https://doi.org/10.1016/j.siny.2019.05.005)
Coleman SJ, Zeng Z, Hestand MS, Liu J & Macleod JN 2013 Analysis of unannotated equine transcripts identified by mRNA sequencing. PLoS ONE 8 e70125. (https://doi.org/10.1371/journal.pone.0070125)
Conley AJ 2016 Review of the reproductive endocrinology of the pregnant and parturient mare. Theriogenology 86 355–365. (https://doi.org/10.1016/j.theriogenology.2016.04.049)
Conley AJ & Ball BA 2019 Steroids in the establishment and maintenance of pregnancy and at parturition in the mare. Reproduction 158 R197–R208. (https://doi.org/10.1530/REP-19-0179)
Conley AJ, Scholtz EL, Legacki EL, Corbin CJ, Knych HK, Dujovne GD, Ball BA, Moeller BC & Stanley SD 2018 5alpha-dihydroprogesterone concentrations and synthesis in non-pregnant mares. Journal of Endocrinology 238 25–32. (https://doi.org/10.1530/JOE-18-0215)
Corado CR, Mckemie DS & Knych HK 2017 Pharmacokinetics of dextromethorphan and its metabolites in horses following a single oral administration. Drug Testing and Analysis 9 880–887. (https://doi.org/10.1002/dta.2060)
Corbin CJ, Legacki EL, Ball BA, Scoggin KE, Stanley SD & Conley AJ 2016 Equine 5alpha-reductase activity and expression in epididymis. Journal of Endocrinology 231 23–33. (https://doi.org/10.1530/JOE-16-0175)
Diczfalusy E 1969 Steroid metabolism in the human foeto-placental unit. Acta Endocrinologica 61 649–664. (https://doi.org/10.1530/acta.0.0610649)
El-Sheikh Ali H, Legacki EL, Loux SC, Esteller-Vico A, Dini P, Scoggin KE, Conley AJ, Stanley SD & Ball BA 2019 Equine placentitis is associated with a downregulation in myometrial progestin signalingdagger. Biology of Reproduction 101 162–176. (https://doi.org/10.1093/biolre/ioz059)
Fagerberg L, Hallstrom BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, Habuka M, Tahmasebpoor S, Danielsson A & Edlund K et al. 2014 Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Molecular and Cellular Proteomics 13 397–406. (https://doi.org/10.1074/mcp.M113.035600)
Falany CN, Krasnykh V & Falany JL 1995 Bacterial expression and characterization of a cDNA for human liver estrogen sulfotransferase. Journal of Steroid Biochemistry and Molecular Biology 52 529–539. (https://doi.org/10.1016/0960-0760(95)00015-r)
Fernandes CB, Loux SC, Scoggin KE, Squires EL, Troedsson MH, Esteller-Vico A & Ball BA 2017 Sex-steroid receptors, prostaglandin E2 receptors, and cyclooxygenase in the equine cervix during estrus, diestrus and pregnancy: Ggene expression and cellular localization. Animal Reproduction Science 187 141–151. (https://doi.org/10.1016/j.anireprosci.2017.10.018)
Fushan AA, Turanov AA, Lee SG, Kim EB, Lobanov AV, Yim SH, Buffenstein R, Lee SR, Chang KT & Rhee H et al. 2015 Gene expression defines natural changes in mammalian lifespan. Aging Cell 14 352–365. (https://doi.org/10.1111/acel.12283)
Garbacz WG, Jiang M & Xie W 2017 Sex-dependent role of estrogen sulfotransferase and steroid sulfatase in metabolic homeostasis. Advances in Experimental Medicine and Biology 1043 455–469. (https://doi.org/10.1007/978-3-319-70178-3_21)
Ginther OJ 1992 Reproductive Biology of the Mare: Basic and Applied Aspects. Cross Plains, Wis., USA: Equiservices.
Giton F, Sirab N, Franck G, Gervais M, Schmidlin F, Ali T, Allory Y, De La Taille A, Vacherot F & Loric S et al. 2015 Evidence of estrone-sulfate uptake modification in young and middle-aged rat prostate. Journal of Steroid Biochemistry and Molecular Biology 152 89–100. (https://doi.org/10.1016/j.jsbmb.2015.05.002)
Grube M, Reuther S, Meyer Zu Schwabedissen H, Kock K, Draber K, Ritter CA, Fusch C, Jedlitschky G & Kroemer HK 2007 Organic anion transporting polypeptide 2B1 and breast cancer resistance protein interact in the transepithelial transport of steroid sulfates in human placenta. Drug Metabolism and Disposition 35 30–35.
Guengerich FP 1997 Comparisons of catalytic selectivity of cytochrome P450 subfamily enzymes from different species. Chemico-Biological Interactions 106 161–182. (https://doi.org/10.1016/s0009-2797(97)00068-9)
Halwachs S, Kneuer C, Gohlsch K, Muller M, Ritz V & Honscha W 2016 The ABCG2 efflux transporter from rabbit placenta: cloning and functional characterization. Placenta 38 8–15. (https://doi.org/10.1016/j.placenta.2015.12.005)
Hamilton KJ, Hewitt SC, Arao Y & Korach KS 2017 Estrogen hormone biology. Current Topics in Developmental Biology 125 109–146. (https://doi.org/10.1016/bs.ctdb.2016.12.005)
Hankele AK, Bauersachs S & Ulbrich SE 2018 Conjugated estrogens in the endometrium during the estrous cycle in pigs. Reproductive Biology 18 336–343. (https://doi.org/10.1016/j.repbio.2018.11.001)
Heap RB, Hamon MH & Allen WR 1991 Oestrogen production by the preimplantation donkey conceptus compared with that of the horse and the effect of between-species embryo transfer. Journal of Reproduction and Fertility 93 141–147. (https://doi.org/10.1530/jrf.0.0930141)
Hilborn E, Stal O & Jansson A 2017 Estrogen and androgen-converting enzymes 17beta-hydroxysteroid dehydrogenase and their involvement in cancer: with a special focus on 17beta-hydroxysteroid dehydrogenase type 1, 2, and breast cancer. Oncotarget 8 30552–30562. (https://doi.org/10.18632/oncotarget.15547)
Hill M, Cibula D, Havlikova H, Kancheva L, Fait T, Kancheva R, Parizek A & Starka L 2007 Circulating levels of pregnanolone isomers during the third trimester of human pregnancy. Journal of Steroid Biochemistry and Molecular Biology 105 166–175. (https://doi.org/10.1016/j.jsbmb.2006.10.010)
Holtan DW, Nett TM & Estergreen VL 1975 Plasma progestins in pregnant, postpartum and cycling mares. Journal of Animal Science 40 251–260. (https://doi.org/10.2527/jas1975.402251x)
Huff RL & Eik-Nes KB 1966 Metabolism in vitro of acetate and certain steroids by six-day-old rabbit blastocysts. Reproduction 11 57–63. (https://doi.org/10.1530/jrf.0.0110057)
Inaoka Y, Yazawa T, Uesaka M, Mizutani T, Yamada K & Miyamoto K 2008 Regulation of NGFI-B/Nur77 gene expression in the rat ovary and in leydig tumor cells MA-10. Molecular Reproduction and Development 75 931–939. (https://doi.org/10.1002/mrd.20788)
Ing NH, Forrest DW, Riggs PK, Loux S, Love CC, Brinsko SP, Varner DD, Welsh TH, JR. 2014 Dexamethasone acutely down-regulates genes involved in steroidogenesis in stallion testes. Journal of Steroid Biochemistry and Molecular Biology 143 451–459. (https://doi.org/10.1016/j.jsbmb.2014.07.003)
Ito S, Honda G, Fujino Y, Ogata S, Hirayama-Kurogi M & Ohtsuki S 2019 Knockdown of orphan transporter SLC22A18 impairs lipid metabolism and increases invasiveness of HepG2 cells. Pharmaceutical Research 36 39. (https://doi.org/10.1007/s11095-018-2565-4)
Janecka JE, Davis BW, Ghosh S, Paria N, Das PJ, Orlando L, Schubert M, Nielsen MK, Stout TAE & Brashear W et al. 2018 Horse Y chromosome assembly displays unique evolutionary features and putative stallion fertility genes. Nature Communications 9 2945. (https://doi.org/10.1038/s41467-018-05290-6)
Kalbfleisch TS, Rice ES, DePriest MS, Walenz BP, Hestand MS, Vermeesch JR, O Connell BL, Fiddes IT, Vershinina AO & Saremi NF et al. 2018 Improved reference genome for the domestic horse increases assembly contiguity and composition. Communications Biology 1 197. (https://doi.org/10.1038/s42003-018-0199-z)
Kauffman FC 2004 Sulfonation in pharmacology and toxicology. Drug Metabolism Reviews 36 823–843. (https://doi.org/10.1081/dmr-200033496)
Kim SY, Yang CS, Lee HM, Kim JK, Kim YS, Kim YR, Kim JS, Kim TS, Yuk JM & Dufour CR et al. 2018 ESRRA (estrogen-related receptor alpha) is a key coordinator of transcriptional and post-translational activation of autophagy to promote innate host defense. Autophagy 14 152–168. (https://doi.org/10.1080/15548627.2017.1339001)
Komoto J, Yamada T, Watanabe K, Woodward DF & Takusagawa F 2006 Prostaglandin F2alpha formation from prostaglandin H2 by prostaglandin F synthase (PGFS): crystal structure of PGFS containing bimatoprost. Biochemistry 45 1987–1996. (https://doi.org/10.1021/bi051861t)
Kumchoo T & Mekchay S 2015 Association of NR4A1 and GNB2L1 genes with reproductive traits in commercial pig breeds. Genetics and Molecular Research 14 16276–16284. (https://doi.org/10.4238/2015.December.8.18)
Kuo KL, Zhu H, Mcnamara PJ & Leggas M 2012 Localization and functional characterization of the rat Oatp4c1 transporter in an in vitro cell system and rat tissues. PLoS ONE 7 e39641. (https://doi.org/10.1371/journal.pone.0039641)
Lacroix Pepin N, Chapdelaine P & Fortier MA 2013 Evaluation of the prostaglandin F synthase activity of human and bovine aldo-keto reductases: AKR1A1s complement AKR1B1s as potent PGF synthases. Prostaglandins and Other Lipid Mediators 106 124–132. (https://doi.org/10.1016/j.prostaglandins.2013.05.005)
Lambertini L, Marsit CJ, Sharma P, Maccani M, Ma Y, Hu J, Chen J, Lambertini L, Marsit CJ & Sharma P et al. 2012 Imprinted gene expression in fetal growth and development. Placenta 33 480–486. (https://doi.org/10.1016/j.placenta.2012.03.001)
Legacki EL, Corbin CJ, Ball BA, Wynn M, Loux S, Stanley SD & Conley AJ 2016a Progestin withdrawal at parturition in the mare. Reproduction 152 323–331. (https://doi.org/10.1530/REP-16-0227)
Legacki EL, Scholtz EL, Ball BA, Stanley SD, Berger T & Conley AJ 2016b The dynamic steroid landscape of equine pregnancy mapped by mass spectrometry. Reproduction 151 421–430. (https://doi.org/10.1530/REP-15-0547)
Legacki EL, Ball BA, Corbin CJ, Loux SC, Scoggin KE, Stanley SD & Conley AJ 2017 Equine fetal adrenal, gonadal and placental steroidogenesis. Reproduction 154 445–454. (https://doi.org/10.1530/REP-17-0239)
Legacki EL, Scholtz EL, Ball BA, Esteller-Vico A, Stanley SD & Conley AJ 2019 Concentrations of sulphated estrone, estradiol and dehydroepiandrosterone measured by mass spectrometry in pregnant mares. Equine Veterinary Journal 51 802–808. (https://doi.org/10.1111/evj.13109)
Lindstrom H, Mazari AMA, Musdal Y & Mannervik B 2019 Potent inhibitors of equine steroid isomerase EcaGST A3-3. PLoS ONE 14 e0214160. (https://doi.org/10.1371/journal.pone.0214160)
Liu J, Zhao R, Ye Z, Frey AJ, Schriver ER, Snyder NW & Hebbring SJ 2017 Relationship of SULT1A1 copy number variation with estrogen metabolism and human health. Journal of Steroid Biochemistry and Molecular Biology 174 169–175. (https://doi.org/10.1016/j.jsbmb.2017.08.017)
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25 402–408. (https://doi.org/10.1006/meth.2001.1262)
Loux SC, Dini P, El-Sheikh Ali H, Kalbfleisch T & Ball BA 2019 Characterization of the placental transcriptome through mid to late gestation in the mare. PLoS ONE 14 e0224497. (https://doi.org/10.1371/journal.pone.0224497)
Mansour TA, Scott EY, Finno CJ, Bellone RR, Mienaltowski MJ, Penedo MC, Ross PJ, Valberg SJ, Murray JD & Brown CT 2017 Tissue resolved, gene structure refined equine transcriptome. BMC Genomics 18 103. (https://doi.org/10.1186/s12864-016-3451-2)
Marth CD, Young ND, Glenton LY, Noden DM, Browning GF & Krekeler N 2015 Effect of ovarian hormones on the healthy equine uterus: a global gene expression analysis. Reproduction, Fertility, and Development 28 1810–1824. (https://doi.org/10.1071/RD14513)
Meinsohn MC, Smith OE, Bertolin K & Murphy BD 2019 The orphan nuclear receptors steroidogenic factor-1 and liver receptor homolog-1: structure, regulation, and essential roles in mammalian reproduction. Physiological Reviews 99 1249–1279. (https://doi.org/10.1152/physrev.00019.2018)
Meyer Zu Schwabedissen HE, Grube M, Heydrich B, Linnemann K, Fusch C, Kroemer HK & Jedlitschky G 2005 Expression, localization, and function of MRP5 (ABCC5), a transporter for cyclic nucleotides, in human placenta and cultured human trophoblasts: effects of gestational age and cellular differentiation. American Journal of Pathology 166 39–48. (https://doi.org/10.1016/S0002-9440(10)62230-4)
Morrison AC, Srinivas SK, Elovitz MA & Puschett JB 2010 Genetic variation in solute carrier genes is associated with preeclampsia. American Journal of Obstetrics and Gynecology 203 491.e1–491.e13. (https://doi.org/10.1016/j.ajog.2010.06.004)
Mueller JW, Idkowiak J, Gesteira TF, Vallet C, Hardman R, Van Den Boom J, Dhir V, Knauer SK, Rosta E & Arlt W 2018 Human DHEA sulfation requires direct interaction between PAPS synthase 2 and DHEA sulfotransferase SULT2A1. Journal of Biological Chemistry 293 9724–9735. (https://doi.org/10.1074/jbc.RA118.002248)
Nett TM, Holtan DW & Line Estergreen V 1973 Plasma estrogens in pregnant and postpartum mares. Journal of Animal Science 37 962–970. (https://doi.org/10.2527/jas1973.374962x)
Nishizawa M, Nakajima T, Yasuda K, Kanzaki H, Sasaguri Y, Watanabe K & Ito S 2000 Close kinship of human 20alpha-hydroxysteroid dehydrogenase gene with three aldo-keto reductase genes. Genes to Cells 5 111–125. (https://doi.org/10.1046/j.1365-2443.2000.00310.x)
Onteru SK, Fan B, Nikkila MT, Garrick DJ, Stalder KJ & Rothschild MF 2011 Whole-genome association analyses for lifetime reproductive traits in the pig. Journal of Animal Science 89 988–995. (https://doi.org/10.2527/jas.2010-3236)
Ousey JC, Forhead AJ, Rossdale PD, Grainger L, Houghton E & Fowden AL 2003 Ontogeny of uteroplacental progestagen production in pregnant mares during the second half of gestation. Biology of Reproduction 69 540–548. (https://doi.org/10.1095/biolreprod.102.013292)
Owen MPT, Mccarty KJ, Hart CG, Steadman CS & Lemley CO 2018 Endometrial blood perfusion as assessed using a novel laser Doppler technique in Angus cows. Animal Reproduction Science 190 119–126. (https://doi.org/10.1016/j.anireprosci.2018.01.015)
Pang Y, Dong J & Thomas P 2013 Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors delta and {epsilon} (mPRdelta and mPR{epsilon}) and mPRdelta involvement in neurosteroid inhibition of apoptosis. Endocrinology 154 283–295. (https://doi.org/10.1210/en.2012-1772)
Patel P, Weerasekera N, Hitchins M, Boyd CA, Johnston DG & Williamson C 2003 Semi quantitative expression analysis of MDR3, FIC1, BSEP, OATP-A, OATP-C,OATP-D, OATP-E and NTCP gene transcripts in 1st and 3rd trimester human placenta. Placenta 24 39–44. (https://doi.org/10.1053/plac.2002.0879)
Penning TM 2015 The aldo-keto reductases (AKRs): overview. Chemico-Biological Interactions 234 236–246. (https://doi.org/10.1016/j.cbi.2014.09.024)
Petersen SL, Intlekofer KA, Moura-Conlon PJ, Brewer DN, Del Pino Sans J & Lopez JA 2013 Nonclassical progesterone signalling molecules in the nervous system. Journal of Neuroendocrinology 25 991–1001. (https://doi.org/10.1111/jne.12060)
Petrovic V, Kojovic D, Cressman A & Piquette-Miller M 2015 Maternal bacterial infections impact expression of drug transporters in human placenta. International Immunopharmacology 26 349–356. (https://doi.org/10.1016/j.intimp.2015.04.020)
Qi L, Guo N, Wei Q, Jin P, Wang W & Mao D 2018 The involvement of NR4A1 and NR4A2 in the regulation of the luteal function in rats. Acta Histochemica 120 713–719. (https://doi.org/10.1016/j.acthis.2018.07.007)
Raeside JI 2017 A brief account of the discovery of the fetal/placental unit for estrogen production in equine and human pregnancies: relation to human medicine. Yale Journal of Biology and Medicine 90 449–461.
Raeside JI & Rosskopf EM 1979 Simulation of pregnancy levels of plasma estrone sulphate by infusion in the non-pregnant mare: a preliminary study. Animal Reproduction Science 3 101–106.
Raeside JI, Christie HL, Waelchli RO & Betteridge KJ 2009 Estrogen metabolism by the equine embryo proper during the fourth week of pregnancy. Reproduction 138 953–960. (https://doi.org/10.1530/REP-09-0235)
Raeside JI, Christie HL, Waelchli RO & Betteridge KJ 2012 Biosynthesis of oestrogen by the early equine embryo proper. Reproduction, Fertility, and Development 24 1071–1078. (https://doi.org/10.1071/RD11275)
Raeside JI, Christie HL & Betteridge KJ 2015 5alpha-Reduced steroids are major metabolites in the early equine embryo proper and its membranes. Biology of Reproduction 93 77. (https://doi.org/10.1095/biolreprod.115.131680)
Rambags BP, Van Tol HT, Van Den Eng MM, Colenbrander B & Stout TA 2008 Expression of progesterone and oestrogen receptors by early intrauterine equine conceptuses. Theriogenology 69 366–375. (https://doi.org/10.1016/j.theriogenology.2007.10.011)
Saengtienchai A, Ikenaka Y, Nakayama SM, Mizukawa H, Kakehi M, Bortey-Sam N, Darwish WS, Tsubota T, Terasaki M & Poapolathep A et al. 2014 Identification of interspecific differences in phase II reactions: determination of metabolites in the urine of 16 mammalian species exposed to environmental pyrene. Environmental Toxicology and Chemistry 33 2062–2069. (https://doi.org/10.1002/etc.2656)
Sanchez-Spitman AB, Dezentje VO, Swen JJ, Moes DJAR, Gelderblom H & Guchelaar HJ 2018 Genetic polymorphisms of 3′-untranslated region of SULT1A1 and their impact on tamoxifen metabolism and efficacy. Breast Cancer Research and Treatment 172 401–411. (https://doi.org/10.1007/s10549-018-4923-7)
Scholtz EL, Krishnan S, Ball BA, Corbin CJ, Moeller BC, Stanley SD, Mcdowell KJ, Hughes AL, Mcdonnell DP & Conley AJ 2014 Pregnancy without progesterone in horses defines a second endogenous biopotent progesterone receptor agonist, 5α-dihydroprogesterone. PNAS 111 3365–3370. (https://doi.org/10.1073/pnas.1318163111)
Schweigmann H, Sanchez-Guijo A, Ugele B, Hartmann K, Hartmann MF, Bergmann M, Pfarrer C, Doring B, Wudy SA & Petzinger E et al. 2014 Transport of the placental estriol precursor 16alpha-hydroxy-dehydroepiandrosterone sulfate (16alpha-OH-DHEAS) by stably transfected OAT4-, SOAT-, and NTCP-HEK293 cells. Journal of Steroid Biochemistry and Molecular Biology 143 259–265. (https://doi.org/10.1016/j.jsbmb.2014.03.013)
Silva ES, Scoggin KE, Canisso IF, Troedsson MH, Squires EL & Ball BA 2014 Expression of receptors for ovarian steroids and prostaglandin E2 in the endometrium and myometrium of mares during estrus, diestrus and early pregnancy. Animal Reproduction Science 151 169–181. (https://doi.org/10.1016/j.anireprosci.2014.11.001)
Song WC, Moore R, Mclachlan JA & Negishi M 1995 Molecular characterization of a testis-specific estrogen sulfotransferase and aberrant liver expression in obese and diabetogenic C57BL/KsJ-db/db mice. Endocrinology 136 2477–2484. (https://doi.org/10.1210/endo.136.6.7750469)
Song KH, Lee K & Choi HS 2002 Endocrine disrupter bisphenol A induces orphan nuclear receptor Nur77 gene expression and steroidogenesis in mouse testicular Leydig cells. Endocrinology 143 2208–2215. (https://doi.org/10.1210/endo.143.6.8847)
St-Pierre MV, Hagenbuch B, Ugele B, Meier PJ & Stallmach T 2002 Characterization of an organic anion-transporting polypeptide (OATP-B) in human placenta. Journal of Clinical Endocrinology and Metabolism 87 1856–1863. (https://doi.org/10.1210/jcem.87.4.8431)
Szilagyi JT, Vetrano AM, Laskin JD & Aleksunes LM 2017 Localization of the placental BCRP/ABCG2 transporter to lipid rafts: role for cholesterol in mediating efflux activity. Placenta 55 29–36. (https://doi.org/10.1016/j.placenta.2017.04.006)
Tamai I, Nezu J, Uchino H, Sai Y, Oku A, Shimane M & Tsuji A 2000 Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochemical and Biophysical Research Communications 273 251–260. (https://doi.org/10.1006/bbrc.2000.2922)
Uemura M, Tamura K, Chung S, Honma S, Okuyama A, Nakamura Y & Nakagawa H 2008 Novel 5 alpha-steroid reductase (SRD5A3, type-3) is overexpressed in hormone-refractory prostate cancer. Cancer Science 99 81–86. (https://doi.org/10.1111/j.1349-7006.2007.00656.x)
Ugele B, St-Pierre MV, Pihusch M, Bahn A & Hantschmann P 2003 Characterization and identification of steroid sulfate transporters of human placenta. American Journal of Physiology: Endocrinology and Metabolism 284 E390–E398. (https://doi.org/10.1152/ajpendo.00257.2002)
Ugele B, Bahn A & Rex-Haffner M 2008 Functional differences in steroid sulfate uptake of organic anion transporter 4 (OAT4) and organic anion transporting polypeptide 2B1 (OATP2B1) in human placenta. Journal of Steroid Biochemistry and Molecular Biology 111 1–6. (https://doi.org/10.1016/j.jsbmb.2008.04.001)
Walters KW, Corbin CJ, Anderson GB, Roser JF & Conley AJ 2000 Tissue-specific localization of cytochrome P450 aromatase in the equine embryo by in situ hybridization and immunocytochemistry. Biology of Reproduction 62 1141–1145. (https://doi.org/10.1095/biolreprod62.5.1141)
Wang L, Wang X, Li Z, Xia T, Zhu L, Liu B, Zhang Y, Xiao F, Pan Y & Liu Y et al. 2013 PAQR3 has modulatory roles in obesity, energy metabolism, and leptin signaling. Endocrinology 154 4525–4535. (https://doi.org/10.1210/en.2013-1633)
Watanabe K 2011 Recent reports about enzymes related to the synthesis of prostaglandin (PG) F(2) (PGF(2alpha) and 9alpha, 11beta-PGF(2)). Journal of Biochemistry 150 593–596. (https://doi.org/10.1093/jb/mvr116)
Wong JK, Chan GH, Leung DK, Tang FP & Wan TS 2016 Generation of phase II in vitro metabolites using homogenized horse liver. Drug Testing and Analysis 8 241–247. (https://doi.org/10.1002/dta.1850)
Wynn MAA, Ball BA, Legacki E, Conley A, Loux S, May J, Esteller-Vico A, Stanley S, Scoggin K & Squires E et al. 2018 Inhibition of 5alpha-reductase alters pregnane metabolism in the late pregnant mare. Reproduction 155 251–258. (https://doi.org/10.1530/REP-17-0380)
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S & Madden TL 2012 Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13 134. (https://doi.org/10.1186/1471-2105-13-134)
Yin H, Lo JH, Kim JY, Marsh EE, Kim JJ, Ghosh AK, Bulun S & Chakravarti D 2013 Expression profiling of nuclear receptors identifies key roles of NR4A subfamily in uterine fibroids. Molecular Endocrinology 27 726–740. (https://doi.org/10.1210/me.2012-1305)
Zavy JT, Mayer R, Vernon MW, Bazer FW & Sharp DC 1979 An investigation of the uterine luminal environment of non-pregnant and pregnant pony mares. Journal of Reproduction and Fertility: Supplement 27403–411.
Zavy MT, Vernon MW, Sharp DC 3rd & Bazer FW 1984 Endocrine aspects of early pregnancy in pony mares: a comparison of uterine luminal and peripheral plasma levels of steroids during the estrous cycle and early pregnancy. Endocrinology 115 214–219. (https://doi.org/10.1210/endo-115-1-214)
