Abstract
Nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain-containing proteins (NRLPs) are central components of the inflammasome. Accumulating evidence has shown that a reproductive clade of NRLPs is predominantly expressed in oocyte to cleavage stage embryos and participates in mammalian preimplantation development as a component of a multiprotein complex known as the subcortical maternal complex (SCMC). Nlrp9s belong to the reproductive class of NLRPs; Nlrp9b is unique in acting as an inflammasome against rotavirus in intestines. Here we generated mice carrying mutations in all three members of the Nlrp9a/b/c gene (Nlrp9 triple mutant (TMut) mice). When crossed with WT males, the Nlrp9 TMut females were fertile, but deliveries with fewer pups were increased in the mutants. Consistent with this, blastocyst development was retarded and lethality to the preimplantation embryos increased in the Nlrp9 TMut females in vivo. Under in vitro culture conditions, the fertilized eggs from the Nlrp9 TMut females exhibited developmental arrest at the two-cell stage, accompanied by asymmetric cell division. By contrast, double-mutant (DMut) oocytes (any genetic combination) did not exhibit the two-cell block in vitro, showing the functional redundancy of Nlrp9a/b/c. Finally, Nlrp9 could bind to components of the SCMC. These results show that Nlrp9 functions as an immune or reproductive NLRP in a cell-type-dependent manner.
Introduction
Maternal-to-zygotic transition (MZT), also referred to as oocyte-to-embryo transition (OET), transforms highly differentiated cell types, such as oocytes, into undifferentiated blastomeres of cleavage-stage embryos. Maternal factors and zygotic genome activation (ZGA) play central roles in MZT (Lu et al. 2017, Schultz et al. 2018). While maternal products such as mRNAs and proteins are degraded rapidly after fertilization, a number of maternal factors are prerequisites for the progression of preimplantation development. Furthermore, ZGA is a major contributor to the creation of transcriptomes of cleavage-stage embryos. Thus, in mammals, preimplantation embryos sequentially acquire totipotency and pluripotency during MZT (Dang-Nguyen & Torres-Padilla 2015, Leung & Zernicka-Goetz 2015).
Nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain-containing proteins (NLRPs; sometimes called NALPs) share a conserved tripartite domain containing an N-terminal pyrin domain, a central nucleotide-binding oligomerization (NACHT) domain, and a C-terminal leucine-rich repeat (LRR) domain, and are classified into two families: the immune and reproductive NLRP families (Tian et al. 2009). While immune NLRPs are expressed mainly in the cells responsible for innate immune responses (Pétrilli et al. 2007, Rathinam and Fitzgerald 2016), reproductive NLRPs are expressed predominantly in oocytes and preimplantation embryos. The immune NLRP family proteins are central components of a multiprotein complex inflammasome that is responsible for inflammatory responses. Pathogenic microorganisms and sterile stressors trigger the oligomerization of NLRPs and assembly of other inflammasome components, such as caspases, which ultimately leads to maturation and secretion of the pro-inflammatory cytokines interleukin–1β (IL–1β) and IL–18, as well as induction of a form of programmed cell death, termed pyroptosis.
Nlrp5, a member of the reproductive NLRP family also known as MATER, is a maternal factor essential for the progression of preimplantation development in mice. Female mice lacking Nlrp5 are infertile; when the oocytes of the Nlrp5-mutant females are fertilized with the sperm of WT males, the zygotes never develop beyond the two-cell stage, according to a phenomenon known as ‘two-cell block’ (Tong et al. 2000). Nlrp5 is localized in the subcortical region of oocytes and preimplantation embryos and forms the subcortical maternal complex (SCMC), which is a large protein complex containing Floped (Ooep), Tle6, Filia (Khdc3) and Padi6 (Li et al. 2008). Similar to the Nlrp5-mutant females, female mice deficient in Floped, Tle6 and Padi6 are sterile due to developmental arrest of the zygotes at the two-cell stage (Esposito et al. 2007, Li et al. 2008, Tashiro et al. 2010, Yu et al. 2014), thus demonstrating the crucial roles of the SCMC in mouse preimplantation development. Meanwhile, mutations and single-nucleotide variants of human NLRP5 were found in mothers with molar pregnancy who gave birth to offspring with multi-locus imprinting disorders (Docherty et al. 2015). Additionally, mutations and variants of human KHDC3L are also associated with familial recurrent hydatidiform moles (Parry et al. 2011, Reddy et al. 2013, Rezaei et al. 2016). Thus, the components of the SCMC are pivotal factors in embryonic development in mice and humans.
Nlrp9 is classified as a reproductive NLRP, based on its expression pattern and homology to the reproductive NLRPs (Tong et al. 2000). Nonetheless, it was recently demonstrated that mouse Nlrp9b and human NLRP9 are highly expressed in intestinal epithelium and that the Nlrp9b-containing inflammasome restricts rotavirus infection in mouse intestines (Zhu et al. 2017). In this study, we generated mice carrying mutations in all three Nlrp9 genes to explore their function as reproductive NLRPs. The preimplantation embryos developed in the mutant female mice in vivo exhibited increased lethality and a delay in reaching the blastocyst stage. Furthermore, the fertilized eggs isolated from the mutant female mice displayed two-cell block in in vitro culture conditions. Our finding clearly shows that Nlrp9 functions not only as an immune NLRP but also as a reproductive NLRP, depending on the cell types.
Materials and methods
Animals
ICR mice were purchased from Japan SLC (Shizuoka, Japan). ICR females were injected with pregnant mare serum gonadotropin (PMSG; ASKA Pharmaceutical, Tokyo, Japan) and human chorionic gonadotropin (hCG; ASKA Pharmaceutical) at 46–48 h intervals and were crossed with ICR males to collect fertilized eggs. ICR females were crossed with vasectomized ICR males to prepare pseudopregnant mice. All animal care and experimental procedures were carried out in accordance with the Guidelines of Animal Experiments of Kitasato University and were approved by the Institutional Animal Care and Use Committee of Kitasato University.
Generation of Nlrp9-mutant mice
Two guide RNAs (gRNAs), gRNAa/c and gRNAb/c, which target the Nlrp9a/c and Nlrp9b/c genes, respectively, were designed using CRISPRdirect (https://crispr.dbcls.jp/). The target sequences of gRNAa/c and gRNAb/c are 5ʹ-CTCAACCATGGCTCAGACAG-3ʹ and 5ʹ-GCAATGTTGGATTGGGCATC-3ʹ, respectively, and are unique in the mouse genome except for Nlrp9/a/b/c. The gRNAs were synthesized using the MEGAshortscriptTMT7 in vitro transcription system (Thermo Fisher Scientific) and dissolved in Opti-MEM (Thermo Fisher Scientific).
The gRNA and Cas9 protein (Medical & Biological Laboratories, Aichi, Japan) were introduced into one-cell embryos as described, with modifications (Hashimoto & Takemoto 2015, Sakai et al. 2019, Kosugi et al. 2020). Briefly, one-cell embryos were isolated by removing cumulus cells by treatment with 30 µg/mL hyaluronidase (Sigma-Aldrich) in M2 medium and were then washed and cultured in KSOM (ARK Resource, Kumamoto, Japan) at 37°C and 5% CO2 until electroporation. KSOM was replaced with Opti-MEM immediately before electroporation. Approximately 20 fertilized eggs were suspended in Opti-MEM containing 200 ng/µl gRNA(s) and 200 ng/µL Cas9 protein, placed between two platinum block electrodes connected to a pulse generator (CUY21Vivo-SQ; BEX, Tokyo, Japan) and maintained on ice until electroporation. Electroporation was carried out at room temperature. The condition for electroporation was 30 V (3 ms ON + 97 ms OFF) × 7. The fertilized eggs were washed several times and cultured in KSOM overnight at 37°C and 5% CO2. On the following day, two-cell embryos were transferred into the fimbriae tubae of the pseudopregnant mice. The pups were obtained by Caesarean dissection.
Genotyping
The following forward and reverse primer pairs were utilized to amplify the target sequences of individual Nlrp9 genes (Fig. 1A); 5ʹ-TCATCTGGGTATGGCTTGCT-3ʹ and 5ʹ-AAATGGAGGAGCAGTGGATG-3ʹ for exon 2 of Nlrp9a (a target of gRNAa/c); 5ʹ-TGGCTTGCTGCAGTATTTTCA-3ʹ and 5ʹ-ACTGCCTTAGTGGGGAAGGA-3ʹ for exon 2 of Nlrp9c (a target of gRNAa/c); 5ʹ- TGGACATTGGAGACCAACAC -3ʹ and 5ʹ-CGGCTAAGCTTAACTCTGTGG-3ʹ for exon 3 of Nlrp9b (a target of gRNAb/c); 5ʹ-TGGACATCTGAGACCAACACTT-3ʹ and 5ʹ-TGTCTCAGAACACTCAGGCAAT-3ʹ for exon 3 of Nlrp9c a target of (gRNAb/c). The forward primers were used for Sanger sequencing.
Generation of the Nlrp9 mutant mice and expression of mouse Nlrp9a/b/c. (A) The structure of the Nlrp9a/b/c genes and the positions of the gRNAs. gRNAa/c and gRNAb/c correspond to exon 2, encoding the pyrin domain and exon 3, encoding the NACHT domain, respectively. The target sequences are enclosed with lines, and the PAM sequences are underlined. Arrows show the cleavage sites of Cas9. (B) Expression of mouse Nlrp9a/b/c in oocytes and preimplantation embryos. The expression pattern of mouse Nlrp9a/b/c was analyzed using the expressed sequence tag (EST) database. TPM, transcripts per million. (C) Expression of mouse Nlrp9a/b/c in various adult organs and reproductive organs (insert). The expression pattern of mouse Nlrp9a/b/c was analyzed using RNA sequencing data of the ENCODE transcriptome project. RPKM, reads per kilobase per million reads. (D) Protein products expressed from Nlrp9b mutant cDNAs. Upper panel shows the structure of N-terminally, FLAG-tagged and C-terminally, Myc-tagged Nlrp9b carrying representative mutations. The M1 and M2 mutants carry 13 and 7 nucleotides deletions in NACHT domains, respectively, and presumably produce N-terminal truncated proteins. Calculated molecular weights are shown. The plasmids encoding wild-type (WT) and mutant Nlrp9b (M1, M2) were transfected into HEK293T cells. Expression of proteins were analyzed by immunoblot assay using anti-FLAG and anti-Myc antibodies (bottom panels).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Generation of the Nlrp9 mutant mice and expression of mouse Nlrp9a/b/c. (A) The structure of the Nlrp9a/b/c genes and the positions of the gRNAs. gRNAa/c and gRNAb/c correspond to exon 2, encoding the pyrin domain and exon 3, encoding the NACHT domain, respectively. The target sequences are enclosed with lines, and the PAM sequences are underlined. Arrows show the cleavage sites of Cas9. (B) Expression of mouse Nlrp9a/b/c in oocytes and preimplantation embryos. The expression pattern of mouse Nlrp9a/b/c was analyzed using the expressed sequence tag (EST) database. TPM, transcripts per million. (C) Expression of mouse Nlrp9a/b/c in various adult organs and reproductive organs (insert). The expression pattern of mouse Nlrp9a/b/c was analyzed using RNA sequencing data of the ENCODE transcriptome project. RPKM, reads per kilobase per million reads. (D) Protein products expressed from Nlrp9b mutant cDNAs. Upper panel shows the structure of N-terminally, FLAG-tagged and C-terminally, Myc-tagged Nlrp9b carrying representative mutations. The M1 and M2 mutants carry 13 and 7 nucleotides deletions in NACHT domains, respectively, and presumably produce N-terminal truncated proteins. Calculated molecular weights are shown. The plasmids encoding wild-type (WT) and mutant Nlrp9b (M1, M2) were transfected into HEK293T cells. Expression of proteins were analyzed by immunoblot assay using anti-FLAG and anti-Myc antibodies (bottom panels).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Generation of the Nlrp9 mutant mice and expression of mouse Nlrp9a/b/c. (A) The structure of the Nlrp9a/b/c genes and the positions of the gRNAs. gRNAa/c and gRNAb/c correspond to exon 2, encoding the pyrin domain and exon 3, encoding the NACHT domain, respectively. The target sequences are enclosed with lines, and the PAM sequences are underlined. Arrows show the cleavage sites of Cas9. (B) Expression of mouse Nlrp9a/b/c in oocytes and preimplantation embryos. The expression pattern of mouse Nlrp9a/b/c was analyzed using the expressed sequence tag (EST) database. TPM, transcripts per million. (C) Expression of mouse Nlrp9a/b/c in various adult organs and reproductive organs (insert). The expression pattern of mouse Nlrp9a/b/c was analyzed using RNA sequencing data of the ENCODE transcriptome project. RPKM, reads per kilobase per million reads. (D) Protein products expressed from Nlrp9b mutant cDNAs. Upper panel shows the structure of N-terminally, FLAG-tagged and C-terminally, Myc-tagged Nlrp9b carrying representative mutations. The M1 and M2 mutants carry 13 and 7 nucleotides deletions in NACHT domains, respectively, and presumably produce N-terminal truncated proteins. Calculated molecular weights are shown. The plasmids encoding wild-type (WT) and mutant Nlrp9b (M1, M2) were transfected into HEK293T cells. Expression of proteins were analyzed by immunoblot assay using anti-FLAG and anti-Myc antibodies (bottom panels).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Fertility test
Female mice aged over 6 weeks were crossed with WT males for 3 months. The litter size was examined immediately after delivery, following which the pups were sacrificed.
In vitro development
Female mice were injected with PMSG and hCG and crossed with WT males to collect the fertilized eggs as described above. The following morning (at d0.5 after mating), the oocytes and fertilized eggs were isolated from the ampulla of the oviduct. The fertilized eggs were selected according to the presence of pronuclei and the secondary polar body. The zygotes from each female were placed in individual KSOM drops and cultured at 37°C and 5% CO2 for 4 days. Alternatively, the embryos were isolated from the uterus at d3.5 and cultured at 37°C and 5% CO2 for 1 day. Photos of all of the embryos were taken each day using an IX70-SBF2 microscope (Olympus) and a DP73 digital charge-coupled device (CCD) camera (Olympus).
Quantification of the sizes of blastocysts and blastomeres
The images taken of the blastocysts and two-cell embryos were analyzed by ImageJ software (National Institutes of Health). All of the blastocysts were measured at d3.5 and d4.5 (Fig. 3C). Ten two-cell embryos were randomly selected for individual females, and the size of each blastomere was measured (Fig. 4E). When the number of two-cell embryos was fewer than ten, all embryos were analyzed.
Co-immunoprecipitation assay
HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal calf serum and antibiotics. The plasmids encoding the FLAG-tagged Nlrp9b and Myc-tagged SCMC components were transfected using polyethyleneimine. Cell lysates were prepared in a solution of 150 mM NaCl, 1% Nonidet P-40, 10 mM Tris–HCl (pH 8.0) containing an EDTA-free protease inhibitor cocktail (Nacalai) and 10 mM MgCl2. The Nlrp9b protein complexes were immunoprecipitated with anti-FLAG antibody-conjugated agarose beads (Sigma-Aldrich) and eluted with FLAG peptide (Sigma-Aldrich). Reciprocal coimmunoprecipitation was carried out using anti-Myc antibody (9E10 (sc-40), Santa Cruz Biotechnology). The precipitated proteins were resolved on an SDS 5–20% polyacrylamide gel (Nacalai) and transferred onto a polyvinylidene difluoride membrane (Merck Millipore). The filters were blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween 20 (TBST), and incubated sequentially with primary and secondary antibodies. The blots were developed by Chemi-Lumi One Super (Nacalai) and signals were detected using the ImageQuant LAS 4000 instrument (GE Healthcare). The antibodies used for Western blot analysis were as follows: rabbit anti-FLAG antibody (1:1,000 dilution; MBL, Aichi, Japan), rabbit anti-Myc antibody (1:500 dilution; MBL), and HRP-conjugated donkey anti-rabbit IgG F(ab’)2 fragment (1:3,000 dilution; GE Healthcare).
Immunostaining
Oocytes were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 30 min, and permeabilized in 0.5% Triton X-100 in PBS for 15 min at room temperature. After blocking with 3% BSA in PBS for 30 min, the oocytes were incubated with primary antibodies overnight at 4°C and secondary antibody for 2 h at room temperature. The antibodies used were as follows: rabbit anti-Nlrp5 antibody (1:100 dilution), rabbit anti-Filia antibody (1:500 dilution) (Ohsugi et al. 2008) and CF488-conjugated goat anti-rabbit IgG (H+L) antibody (1:500 dilution; Biotium, Fremont, CA, USA). Immunofluorescence was observed using a LSM510 confocal laser scanning microscope (Carl Zeiss).
Nlrp9 antibodies
We utilized a commercially available Nlrp9 antibody (NBP2-24661, Novus Biologicals), which was used previously (Peng et al. 2015). We also generated antibodies using the peptides whose sequences are completely conserved among three Nlrp9 members. The peptide (KTLKLGNNNIQDT or DYLKFDLELRTNL) were immunized individually into rabbits. The antibodies were affinity-purified using peptide columns. The ovary lysates were prepared in RIPA buffer (50 mM HEPES (pH 7.9), 150 mM NaCl, 1% Nonidet P-40, 0.5% DOC, 0.1% SDS, 5 mM EDTA, protease inhibitor cocktail) as described (Qin et al. 2019). Western blot analyses were performed as described.
Expression of mutant proteins
The plasmids encoding WT and mutant Nlrp9b, all of which were N-terminally, FLAG-tagged and C-terminally, Myc-tagged, were transfected into a human embryonic kidney-derived cell line, HEK293T cell. Cell lysates were prepared 48 h after transfection as described above. The protein expression was analyzed by Western blot analyses using anti-FLAG and anti-Myc antibodies as described.
Results
Generation of the Nlrp9a/b/c triple mutant (TMut) mice
The human genome contains one NLRP9 gene, whereas the mouse genome encodes three copies of the Nlrp9 gene: Nlrp9a, Nlrp9b, and Nlrp9c. Nlrp9a/b/c proteins are composed of a pyrin domain, a NACHT domain, and an LRR domain (Fig. 1A) that are almost identical; 64% of amino acids are identical among Nlrp9a/b/c. The mouse expressed sequence tag (EST) data sets showed that Nlrp9a/b/c expression was detected from oocytes to cleavage stage embryos, but was undetectable in blastocysts, implanted embryos and the fetus (Fig. 1B). The Nlrp9 protein was also reported to be expressed in oocytes and preimplantation embryos of mice (Peng et al. 2015). The RNA sequencing results of various adult organs in the mouse ENCODE transcriptome data sets showed that all three Nlrp9 genes were expressed in ovaries (Fig. 1C) (Yue et al. 2014). In addition, Nlrp9b, but neither Nlrp9a nor Nlrp9c, was expressed strongly in digestive organs and weakly in testes. The expression of Nlrp9a/b/c was not detected in other adult organs. The expression pattern in adult organs was validated by quantitative RT–PCR and immunological analyses in previous studies (Peng et al. 2015, Zhu et al. 2017).
To investigate the function of Nlrp9a/b/c in mouse female reproduction, mutations were introduced into the Nlrp9a/b/c locus using the CSRIPSR/Cas9 system. Two gRNAs were designed to target exon 2 encoding the pyrin domain of the Nlrp9a and Nlrp9c genes (gRNAa/c), and exon 3 encoding the NACHT domain of the Nlrp9b and Nlrp9c genes (gRNAb/c) (Fig. 1A). Fertilized eggs of WT mice were electroporated with gRNAa/c and/or gRNAb/c together with Cas9 protein and transferred to pseudopregnant females (Table 1). Additionally, the fertilized eggs collected from the intercrosses of the mice carrying the heterozygous mutations in both Nlrp9a and Nlrp9c were treated with gRNAb/c. Finally, the Nlrp9-mutant mice containing all genetic combinations, including single mutant (SMut; Nlrp9a SMut, Nlrp9b SMut, Nlrp9c SMut), double mutant (DMut; Nlrp9a/b DMut, Nlrp9a/c DMut, Nlrp9b/c DMut) and triple mutant (TMut; Nlrp9a/b/c TMut) mice, were generated (Table 1). All of the mutations resulted in premature translational termination.
Generation of the Nlrp9 mutant mice.
| Mutants | Fertilized eggs* | gRNA | Mutations*** | |||
|---|---|---|---|---|---|---|
| Nlrp9a (Pyrin) | Nlrp9b (NACHT) | Nlrp9c (Pyrin) | Nlrp9c (NACHT) | |||
| Nlrp9a SMut | WT × WT | gRNAa/c | + 2nt | |||
| Nlrp9b SMut | WT × WT | gRNAb/c | Δ 2nt | |||
| Nlrp9c SMut | WT × WT | gRNAb/c | Δ 8nt | |||
| Nlrp9a/b DMut | WT × WT | gRNAa/c + gRNAb/c | + 1nt | Δ 7nt | ||
| Nlrp9a/c DMut | WT × WT | gRNAa/c | Δ 25nt | +1 nt | ||
| Nlrp9b/c DMut | Nlrp9a/c hetero × Nlrp9a/c hetero | gRNAb/c | Δ 13nt | Δ 8nt | ||
| Nlrp9a/b/c TMut-1 | Nlrp9a/c hetero × Nlrp9a/c hetero | gRNAb/c | Δ 25nt | Δ 13nt | +1 nt | |
| Nlrp9a/b/c TMut-2 | Nlrp9a/c hetero × Nlrp9a/c hetero | gRNAb/c | Δ 25nt | Δ 13nt | +1 nt ** | Δ 1nt |
*The fertilized eggs from the WT (WT) females that were crossed with WT males or from the Nlrp9a/c heterozygous mutant females that were crossed with the Nlrp9a/c heterozygous mutant males were treated with gRNAa/c and/or gRNAb/c. **The insertion of 1 nucleotide in Pyrin domain resulted in premature translational termination before the position of the 1 nucleotide deletion in NACHT domain. Therefore, the same truncated Nlrp9c proteins are produced both in the Nlrp9a/b/c TMut-1 and the Nlrp9a/b/c TMut -2 mice. ***All the mutations resulted in premature translational termination immediately after in/del mutation sites.
To validate the absence of protein expression in ovaries of Nlrp9 TMut females, we conducted immunoblot assays. Although three antibodies were tested, endogenous Nlrp9 was not detected by any antibodies (data not shown; see Materials and Methods for details). As an alternative approach, we examined the expression of protein products by using N-terminally, FLAG-tagged and C-terminally, Myc-tagged Nlrp9b cDNAs carrying representative mutations (Fig. 1D). Following the expression vectors were transfected into HEK293T cells, the protein expression was evaluated by Western blot analyses using anti-FLAG and anti-Myc antibodies. Immunoblot analyses showed that N-terminal truncated products were barely detectable and C-terminal truncated products were undetectable. Additionally, mutations were introduced into pyrin or NACHT domains. Thus, it is plausible that functional proteins are not produced from the mutated alleles. However, as these results do not exclude the possibility that the alleles are hypomorphic, we designated these mice as mutant mice, but not knockout mice, in this study.
Although Nlrp9 functions as inflammasome (Zhu et al. 2017), body weight of Nlrp9 TMut mice was comparable to that of WT and heterozygous mice at 6–7 weeks (P = 0.34 by Student’s t-test; WT, 27.9 ± 2.9 g, n = 11; TMut, 27.9 ± 4.3 g, n = 11) and at 6–7 months after birth (P = 0.35 by Student’s t-test; heterozygous, 48.0 ± 8.7 g, n = 21; TMut, 45.9 ± 4.6 g, n = 14). The Nlrp9 TMut mice did not show any abnormalities and were healthy at least for 1 year under specific pathogen-free condition.
Fertility of the Nlrp9 TMut female mice
To examine reproductive ability, the Nlrp9 mutant females were crossed with WT male mice for 3 months. The number of deliveries was comparable between the WT and Nlrp9 mutant females (Fig. 2A). In addition, litter size was not significantly different between the WT and Nlrp9 mutant mice (Fig. 2B). However, the number of litters with seven or fewer pups was significantly increased in the Nlrp9 TMut females compared to females with other genotypes (P < 0.05 by χ2 test). Moreover, the litter size from Nlrp9 TMut females significantly decreased compared those from all other females (P < 0.05 by Student’s t-test; Nlrp9 TMut, 8.75 ± 3.62, n = 12; Others, 11.24 ± 2.70, n = 63). We also examined when the Nrlp9 TMut females gave birth to pups after observation of copulatory plug. The gestation period of the Nrlp9 TMut females was slightly longer than that of WT mice (P = 0.006 by Student’s t-test; WT, 19.3 ± 0.4 days, n = 6; TMut, 20.0 ± 0.4 days, n = 7).
Reproductive ability of the Nlrp9 mutant female mice. The number of deliveries per three months (A) and the number of pups per delivery (B). The wild-type (WT) females and the Nlrp9 mutant females carrying single-, double-, and triple- mutations (SMut, DMut, and TMut, respectively) were crossed with wild-type males. The number of deliveries and litter size were not significantly changed in any of the Nlrp9 mutant mice (Student’s t-test). The mean ± standard deviation is shown. The numbers of mice examined were as follows; wild-type, n = 3; Nlrp9a SMut n = 4; Nlrp9b SMut n = 4; Nlrp9c SMut n = 2; Nlrp9a/b DMut n = 3; Nlrp9a/c DMut n = 4; Nlrp9b/c DMut n = 3; Nlrp9a/b/c TMut n = 5.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Reproductive ability of the Nlrp9 mutant female mice. The number of deliveries per three months (A) and the number of pups per delivery (B). The wild-type (WT) females and the Nlrp9 mutant females carrying single-, double-, and triple- mutations (SMut, DMut, and TMut, respectively) were crossed with wild-type males. The number of deliveries and litter size were not significantly changed in any of the Nlrp9 mutant mice (Student’s t-test). The mean ± standard deviation is shown. The numbers of mice examined were as follows; wild-type, n = 3; Nlrp9a SMut n = 4; Nlrp9b SMut n = 4; Nlrp9c SMut n = 2; Nlrp9a/b DMut n = 3; Nlrp9a/c DMut n = 4; Nlrp9b/c DMut n = 3; Nlrp9a/b/c TMut n = 5.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Reproductive ability of the Nlrp9 mutant female mice. The number of deliveries per three months (A) and the number of pups per delivery (B). The wild-type (WT) females and the Nlrp9 mutant females carrying single-, double-, and triple- mutations (SMut, DMut, and TMut, respectively) were crossed with wild-type males. The number of deliveries and litter size were not significantly changed in any of the Nlrp9 mutant mice (Student’s t-test). The mean ± standard deviation is shown. The numbers of mice examined were as follows; wild-type, n = 3; Nlrp9a SMut n = 4; Nlrp9b SMut n = 4; Nlrp9c SMut n = 2; Nlrp9a/b DMut n = 3; Nlrp9a/c DMut n = 4; Nlrp9b/c DMut n = 3; Nlrp9a/b/c TMut n = 5.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
The above observation prompted further examination of preimplantation development in the Nlrp9 TMut females. The WT and Nlrp9 TMut females were super-ovulated and crossed with WT males. At embryonic day 3.5 (d3.5), the embryos were isolated from the uterus of the females and cultured for 1 day in vitro. At d3.5, more than 90% of the embryos isolated from WT females developed into blastocysts (Fig. 3A and B). In contrast, the embryos isolated from the Nlrp9 TMut females at d3.5 showed a significant decrease in the percentage of blastocysts (65%, P < 0.0005 by χ2 test), as well as a significant increase in the percentages of morulae (16%, P < 0.05 by χ2 test) and degenerated embryos (19%, P < 0.005 by χ2 test). After 1 day of culture in vitro, similar trends were observed (Fig. 3A and B). Furthermore, the blastocysts were significantly smaller in the embryos from the Nlrp9 TMut females at d3.5 and d4.5 (Fig. 3C). These results demonstrate that the blastocyst stage of development was delayed, and preimplantation embryonic death was increased in the zygotes from the Nlrp9 TMut females in vivo.
Development of preimplantation embryos in the Nlrp9 TMut females in vivo. (A) Representative photos of the embryos at embryonic day 3.5 (d3.5) and d4.5. The embryos were isolated from the uterus of wild-type and Nlrp9 TMut females at d3.5 after mating with wild-type males (d3.5, left), and cultured for 1 day in vitro (d4.5, right). Note that the blastocysts from the Nlrp9 TMut females were smaller in size. Morulae and the degenerated embryos were also observed in the embryos from the Nlrp9 TMut females. Bars: 50 µm. (B) The percentages of blastocysts, morulae, and degenerated embryos. The number of blastocysts at d3.5 was significantly lower in the embryos isolated from Nlrp9 TMut females (P < 0.0005 by χ2 test). The number of morulae and degenerated embryos at d3.5 significantly increased in the embryos of Nlrp9 TMut females (P < 0.05, P < 0.005 by χ2 test, respectively). The number of blastocysts decreased, and the number of degenerated embryos increased, in the Nlrp9 TMut females at d4.5 (P < 0.001 by χ2 test). Wild-type, 57 embryos from 4 females; Nlrp9 TMut, 86 embryos from 5 females. (C) Relative sizes of blastocysts. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from the Nlrp9 TMut females were significantly smaller (Student’s t-test; *P < 10−7, **P < 0.05). Wild-type, 53, and 56 blastocysts at d3.5 and d4.5, respectively; Nlrp9 TMut, 56, and 68 blastocysts at d3.5 and d4.5, respectively.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of preimplantation embryos in the Nlrp9 TMut females in vivo. (A) Representative photos of the embryos at embryonic day 3.5 (d3.5) and d4.5. The embryos were isolated from the uterus of wild-type and Nlrp9 TMut females at d3.5 after mating with wild-type males (d3.5, left), and cultured for 1 day in vitro (d4.5, right). Note that the blastocysts from the Nlrp9 TMut females were smaller in size. Morulae and the degenerated embryos were also observed in the embryos from the Nlrp9 TMut females. Bars: 50 µm. (B) The percentages of blastocysts, morulae, and degenerated embryos. The number of blastocysts at d3.5 was significantly lower in the embryos isolated from Nlrp9 TMut females (P < 0.0005 by χ2 test). The number of morulae and degenerated embryos at d3.5 significantly increased in the embryos of Nlrp9 TMut females (P < 0.05, P < 0.005 by χ2 test, respectively). The number of blastocysts decreased, and the number of degenerated embryos increased, in the Nlrp9 TMut females at d4.5 (P < 0.001 by χ2 test). Wild-type, 57 embryos from 4 females; Nlrp9 TMut, 86 embryos from 5 females. (C) Relative sizes of blastocysts. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from the Nlrp9 TMut females were significantly smaller (Student’s t-test; *P < 10−7, **P < 0.05). Wild-type, 53, and 56 blastocysts at d3.5 and d4.5, respectively; Nlrp9 TMut, 56, and 68 blastocysts at d3.5 and d4.5, respectively.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of preimplantation embryos in the Nlrp9 TMut females in vivo. (A) Representative photos of the embryos at embryonic day 3.5 (d3.5) and d4.5. The embryos were isolated from the uterus of wild-type and Nlrp9 TMut females at d3.5 after mating with wild-type males (d3.5, left), and cultured for 1 day in vitro (d4.5, right). Note that the blastocysts from the Nlrp9 TMut females were smaller in size. Morulae and the degenerated embryos were also observed in the embryos from the Nlrp9 TMut females. Bars: 50 µm. (B) The percentages of blastocysts, morulae, and degenerated embryos. The number of blastocysts at d3.5 was significantly lower in the embryos isolated from Nlrp9 TMut females (P < 0.0005 by χ2 test). The number of morulae and degenerated embryos at d3.5 significantly increased in the embryos of Nlrp9 TMut females (P < 0.05, P < 0.005 by χ2 test, respectively). The number of blastocysts decreased, and the number of degenerated embryos increased, in the Nlrp9 TMut females at d4.5 (P < 0.001 by χ2 test). Wild-type, 57 embryos from 4 females; Nlrp9 TMut, 86 embryos from 5 females. (C) Relative sizes of blastocysts. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from the Nlrp9 TMut females were significantly smaller (Student’s t-test; *P < 10−7, **P < 0.05). Wild-type, 53, and 56 blastocysts at d3.5 and d4.5, respectively; Nlrp9 TMut, 56, and 68 blastocysts at d3.5 and d4.5, respectively.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of zygotes from the Nlrp9 TMut female mice in vitro
To further explore the roles of Nlrp9a/b/c in preimplantation development, fertilized eggs isolated from oviducts of Nlrp9 TMut females were analyzed in vitro. Wild-type, Nlrp9a/b/c heterozygous, and Nlrp9 TMut females were super-ovulated and crossed with WT males. The fertilized eggs were isolated from the oviducts at d0.5. The number of ovulated eggs was comparable between the control (wild-type and Nlrp9a/b/c heterozygous) females and Nlrp9 TMut females (P = 0.40 by Student’s t-test; control, 20.3 ± 13.9, n = 9; Nlrp9 TMut, 27.2 ± 15.1, n = 6). Additionally, the fertilization rate was not significantly altered between the control and the Nlrp9 TMut females (P = 0.07 by Student’s t-test; control, 74.9% ± 15.8%, n = 9; Nlrp9 TMut, 92.9% ± 17.4%, n = 6).
The fertilized eggs were then cultured for 4 days in vitro. The zygotes isolated from control females developed progressively into blastocysts over the 4 days (Fig. 4A and B). Approximately 70% of the embryos from control females developed into blastocysts at d4.5 (Fig. 4C). In contrast, in the zygotes from the Nlrp9 TMut females, although ~60% of the zygotes developed into two-cell embryos at d1.5, the remaining zygotes did not proceed to the two-cell stage and underwent degeneration. Furthermore, the majority of the two-cell embryos were arrested at this stage, and no embryos reached the blastocyst stage until d4.5 (Fig. 4A, B and C).
Development of zygotes from the Nlrp9 TMut females in vitro. (A) Representative photos of the embryos developed in vitro. The fertilized eggs were isolated at d0.5 from control (wild-type and the Nlrp9a/b/c heterozygous) females and Nlrp9 TMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Note that the degenerated embryos emerged at d1.5, and the majority of the embryos were arrested at the 2-cell stage in the Nlrp9 TMut females. Bar: 50 µm. (B) Development from 1-cell embryos to blastocysts in vitro. Control, 86 embryos from 4 females; Nlrp9 TMut, 148 embryos from 6 females. (C) Percentages of zygotes developed into blastocysts in vitro. The fertilized eggs were isolated from control and Nlrp9 TMut females (n = 4 and n = 6, respectively), and the percentage of the blastocysts at d4.5 for each mouse is plotted. No zygotes developed into blastocysts in the Nlrp9 TMut females (Student’s t-test; *P < 10−4). The mean ± s.d. is shown. (D) Representative photos of the two-cell embryos with asymmetric cell division from Nlrp9 TMut females. Bars: 20 µm. (E) The percentage of the two-cell embryos with asymmetric cell division. The embryos were classified as undergoing asymmetric division when the sizes of two blastomeres differed by more than 10%. The percentage of embryos with asymmetric cell division was significantly higher in the zygotes from Nlrp9 TMut females (Student’s t-test; *P < 10−3).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of zygotes from the Nlrp9 TMut females in vitro. (A) Representative photos of the embryos developed in vitro. The fertilized eggs were isolated at d0.5 from control (wild-type and the Nlrp9a/b/c heterozygous) females and Nlrp9 TMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Note that the degenerated embryos emerged at d1.5, and the majority of the embryos were arrested at the 2-cell stage in the Nlrp9 TMut females. Bar: 50 µm. (B) Development from 1-cell embryos to blastocysts in vitro. Control, 86 embryos from 4 females; Nlrp9 TMut, 148 embryos from 6 females. (C) Percentages of zygotes developed into blastocysts in vitro. The fertilized eggs were isolated from control and Nlrp9 TMut females (n = 4 and n = 6, respectively), and the percentage of the blastocysts at d4.5 for each mouse is plotted. No zygotes developed into blastocysts in the Nlrp9 TMut females (Student’s t-test; *P < 10−4). The mean ± s.d. is shown. (D) Representative photos of the two-cell embryos with asymmetric cell division from Nlrp9 TMut females. Bars: 20 µm. (E) The percentage of the two-cell embryos with asymmetric cell division. The embryos were classified as undergoing asymmetric division when the sizes of two blastomeres differed by more than 10%. The percentage of embryos with asymmetric cell division was significantly higher in the zygotes from Nlrp9 TMut females (Student’s t-test; *P < 10−3).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of zygotes from the Nlrp9 TMut females in vitro. (A) Representative photos of the embryos developed in vitro. The fertilized eggs were isolated at d0.5 from control (wild-type and the Nlrp9a/b/c heterozygous) females and Nlrp9 TMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Note that the degenerated embryos emerged at d1.5, and the majority of the embryos were arrested at the 2-cell stage in the Nlrp9 TMut females. Bar: 50 µm. (B) Development from 1-cell embryos to blastocysts in vitro. Control, 86 embryos from 4 females; Nlrp9 TMut, 148 embryos from 6 females. (C) Percentages of zygotes developed into blastocysts in vitro. The fertilized eggs were isolated from control and Nlrp9 TMut females (n = 4 and n = 6, respectively), and the percentage of the blastocysts at d4.5 for each mouse is plotted. No zygotes developed into blastocysts in the Nlrp9 TMut females (Student’s t-test; *P < 10−4). The mean ± s.d. is shown. (D) Representative photos of the two-cell embryos with asymmetric cell division from Nlrp9 TMut females. Bars: 20 µm. (E) The percentage of the two-cell embryos with asymmetric cell division. The embryos were classified as undergoing asymmetric division when the sizes of two blastomeres differed by more than 10%. The percentage of embryos with asymmetric cell division was significantly higher in the zygotes from Nlrp9 TMut females (Student’s t-test; *P < 10−3).
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Asymmetric cell division, as well as the two-cell block, are commonly observed in zygotes from females lacking SCMC components (Yu et al. 2014, Gao et al. 2018). We analyzed the sizes of two blastomeres in the two-cell embryos at d1.5 (Fig. 4D). The two-cell embryos were classified as those with asymmetric cell division when the sizes of two blastomeres differed by more than 10%. The percentage of two-cell embryos with asymmetric cell division was significantly elevated in embryos from the Nlrp9 TMut females (Fig. 4E).
Development of the zygotes from the Nlrp9 DMut female mice in vitro
To examine the contribution of each Nlrp9 family member to the two-cell block observed in the zygotes from the Nlrp9 TMut females in vitro, the fertilized eggs isolated from the Nlrp9 DMut females were cultured for four days in vitro. The zygotes isolated from Nlrp9a/b DMut, Nlrp9a/c DMut and Nlrp9b/c DMut females did not exhibit two-cell block (Fig. 5). However, the embryos from these DMut mice displayed developmental delay and arrest. For example, the zygotes from Nlrp9a/b DMut and Nlrp9a/c DMut females showed delayed development to blastocysts at d3.5, although the majority developed to blastocysts at d4.5 (Fig. 5A and B). In the zygotes from Nlrp9b/c DMut females, more than half of the embryos remained at the 4–8-cell stages, ~40% were morulae, and no blastocysts were observed at d3.5 (Fig. 5A and B). Moreover, at d4.5, only 40% of embryos developed to blastocysts, whereas ~40% of embryos were degenerated. Furthermore, the blastocysts were significantly smaller in the embryos from the Nlrp9a/b DMut, Nlrp9a/b DMut and Nlrp9a/b DMut females at d4.5 (Fig. 5C). These results demonstrated that maternal Nlrp9a/b/c are redundantly required for development beyond the two-cell stage in vitro.
Development of zygotes from the Nlrp9 DMut females in vitro. (A) Representative photos of the embryos developed in vitro. Fertilized eggs were isolated at d0.5 from control and Nlrp9 DMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Bar: 50 µm. (B) Development from one-cell embryos into blastocysts in vitro. Blastocyst development was significantly delayed at d3.5 in the embryos from Nlrp9a/b DMut and Nlrp9a/c DMut females (P < 10−8 and P < 10−9 by χ2 test, respectively). Development into blastocysts significantly decreased, and the incidence of degeneration increased, at d4.5 in Nlrp9b/c DMut females (P < 10−13 and P < 10−8, respectively, by χ2 test). Wild-type, 128 embryos from 9 females; Nlrp9a/b DMut, 86 embryos from 5 females; Nlrp9a/c DMut, 103 embryos from 5 females; Nlrp9b/c DMut, 131 embryos from 5 females. (C) Relative sizes of blastocysts at d4.5. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from three types of Nlrp9 DMut females were significantly smaller (Student’s t-test; *P < 10−11, **P < 10−12, ***P < 10−18). Wild-type, n = 73; Nlrp9a/b DMut, n = 74; Nlrp9a/c DMut, n = 78; Nlrp9b/c DMut, n = 56.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of zygotes from the Nlrp9 DMut females in vitro. (A) Representative photos of the embryos developed in vitro. Fertilized eggs were isolated at d0.5 from control and Nlrp9 DMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Bar: 50 µm. (B) Development from one-cell embryos into blastocysts in vitro. Blastocyst development was significantly delayed at d3.5 in the embryos from Nlrp9a/b DMut and Nlrp9a/c DMut females (P < 10−8 and P < 10−9 by χ2 test, respectively). Development into blastocysts significantly decreased, and the incidence of degeneration increased, at d4.5 in Nlrp9b/c DMut females (P < 10−13 and P < 10−8, respectively, by χ2 test). Wild-type, 128 embryos from 9 females; Nlrp9a/b DMut, 86 embryos from 5 females; Nlrp9a/c DMut, 103 embryos from 5 females; Nlrp9b/c DMut, 131 embryos from 5 females. (C) Relative sizes of blastocysts at d4.5. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from three types of Nlrp9 DMut females were significantly smaller (Student’s t-test; *P < 10−11, **P < 10−12, ***P < 10−18). Wild-type, n = 73; Nlrp9a/b DMut, n = 74; Nlrp9a/c DMut, n = 78; Nlrp9b/c DMut, n = 56.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Development of zygotes from the Nlrp9 DMut females in vitro. (A) Representative photos of the embryos developed in vitro. Fertilized eggs were isolated at d0.5 from control and Nlrp9 DMut females that were crossed with wild-type male mice, and cultured from d0.5 to d4.5 in vitro. Bar: 50 µm. (B) Development from one-cell embryos into blastocysts in vitro. Blastocyst development was significantly delayed at d3.5 in the embryos from Nlrp9a/b DMut and Nlrp9a/c DMut females (P < 10−8 and P < 10−9 by χ2 test, respectively). Development into blastocysts significantly decreased, and the incidence of degeneration increased, at d4.5 in Nlrp9b/c DMut females (P < 10−13 and P < 10−8, respectively, by χ2 test). Wild-type, 128 embryos from 9 females; Nlrp9a/b DMut, 86 embryos from 5 females; Nlrp9a/c DMut, 103 embryos from 5 females; Nlrp9b/c DMut, 131 embryos from 5 females. (C) Relative sizes of blastocysts at d4.5. The box plots show the 25th, 50th, and 75th percentiles of blastocyst size and the whiskers show the minimum and maximum values. The blastocysts isolated from three types of Nlrp9 DMut females were significantly smaller (Student’s t-test; *P < 10−11, **P < 10−12, ***P < 10−18). Wild-type, n = 73; Nlrp9a/b DMut, n = 74; Nlrp9a/c DMut, n = 78; Nlrp9b/c DMut, n = 56.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Physical associations between Nlrp9 and the SCMC components
Because two-cell block and asymmetric cell division are characteristic of females lacking the SCMC components, Nlrp9 may participate in the formation of the SCMC. We examined whether Nlrp9 can bind to major SCMC components. After the expression vector for FLAG-tagged Nlrp9b was transfected into HEK293T cells with plasmids encoding Myc-tagged SCMC components, including Nlrp5 (MATER), Filia or Floped (Ooep), FLAG-Nlrp9b was pulled down with anti-FLAG antibody-agarose. As shown in Fig. 6A, all these SCMC components were coimmunoprecipitated with Nlrp9b. In addition, reciprocal coimmunoprecipitation analyses showed that Nlrp9b was coprecipitated with all these SCMC components (Fig. 6B). These results suggest the possibility that Nlrp9 is a novel component of the SCMC.
Physical association between Nlrp9 and the SCMC components. (A) The FLAG-Nlrp9b-associated proteins were isolated with anti-FLAG antibody-conjugated agarose from the HEK293T cell lysates that were transfected with the indicated plasmids, and then analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies (left panel). The right panel shows the input cell lysates analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies. FLAG-Nlrp9b could bind to all the Myc-tagged SCMC components, including Filia, Ooep, and Nlrp5. (B) Reciprocal coimmunoprecipitation analyses using anti-Myc antibody. (C) Subcortical distribution of the SCMC components, Nlrp5 and Filia, in oocytes from the Nlrp9 TMut females. Oocytes were analyzed using a confocal laser scanning microscope with 1-µm-thick optical sections.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Physical association between Nlrp9 and the SCMC components. (A) The FLAG-Nlrp9b-associated proteins were isolated with anti-FLAG antibody-conjugated agarose from the HEK293T cell lysates that were transfected with the indicated plasmids, and then analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies (left panel). The right panel shows the input cell lysates analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies. FLAG-Nlrp9b could bind to all the Myc-tagged SCMC components, including Filia, Ooep, and Nlrp5. (B) Reciprocal coimmunoprecipitation analyses using anti-Myc antibody. (C) Subcortical distribution of the SCMC components, Nlrp5 and Filia, in oocytes from the Nlrp9 TMut females. Oocytes were analyzed using a confocal laser scanning microscope with 1-µm-thick optical sections.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
Physical association between Nlrp9 and the SCMC components. (A) The FLAG-Nlrp9b-associated proteins were isolated with anti-FLAG antibody-conjugated agarose from the HEK293T cell lysates that were transfected with the indicated plasmids, and then analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies (left panel). The right panel shows the input cell lysates analyzed by immunoblot assay with anti-Myc and anti-FLAG antibodies. FLAG-Nlrp9b could bind to all the Myc-tagged SCMC components, including Filia, Ooep, and Nlrp5. (B) Reciprocal coimmunoprecipitation analyses using anti-Myc antibody. (C) Subcortical distribution of the SCMC components, Nlrp5 and Filia, in oocytes from the Nlrp9 TMut females. Oocytes were analyzed using a confocal laser scanning microscope with 1-µm-thick optical sections.
Citation: Reproduction 160, 2; 10.1530/REP-19-0516
The subcortical distribution of SCMS components are disturbed in the oocytes lacking the core components of SCMC, including Nlrp5 and Ooep (Li et al. 2008, Yu et al. 2014, Mahadevan et al. 2017). Therefore, we investigated whether the subcellular localization of Nlrp5 and Filia was altered by the mutations of Nlrp9a/b/c. Similar to control mice, Nlrp5 and Filia was localized in subcortical regions in oocytes of Nlrp9 TMut mice (Fig. 6C), suggesting that Nlrp9a/b/c is not required for subcortical localization of SCMC.
Discussion
In this study, we analyzed the developmental potential of oocytes lacking maternal Nlrp9a/b/c in mice. The zygotes developed in the Nlrp9 TMut females in vivo exhibited increased lethality and a delay in reaching the blastocyst stage (Fig. 3). Furthermore, the fertilized eggs isolated from the Nlrp9 TMut females displayed two-cell block in an in vitro culture, which was accompanied by asymmetric cell division (Fig. 4). These results demonstrated that Nlrp9a/b/c contribute to optimal progression of preimplantation development. On the other hand, zygotes from three types of Nlrp9 DMut females did not show two-cell block, although the development of these zygotes was delayed or arrested around the 4–8-cell stages in vitro (Fig. 5). Our results showed that the presence of any one of Nlrp9a/b/c could rescue the two-cell block in Nlrp9 TMut mice, indicating that Nlrp9a/b/c are functionally redundant in preimplantation development.
The two-cell block and asymmetric cell division observed in the zygotes of the Nlrp9 TMut females are reminiscent of the zygotes of the female mice lacking the components of the SCMC (Yu et al. 2014, Gao et al. 2018). It was shown previously that the SCMC is a multiprotein complex composed of Nlrp5, Floped, Filia, and Tle6 (Li et al. 2008). However, considering that the estimated molecular weight of the SCMC ranged from 669 KDa to 2 MDa (Li et al. 2008), it is likely that the SCMC contains additional components. Recent reports have revealed that Nlrp2 and Nlrp4f, other members of the reproductive NLRPs, and Zbed3, are components of the SCMC (Mahadevan et al. 2017, Gao et al. 2018, Qin et al. 2019). Our study has also shown that Nlrp9b was able to bind to the SCMC components (Fig. 6A and B). Taken together, while Nlrp9b forms an inflammasome composed of adaptor protein PYCARD (ASC), which recruits caspase-1, and RNA helicase Dhx9, which binds to rotavirus RNA in the intestinal epithelium (Zhu et al. 2017), Nlrp9a/b/c may participate in the SCMC as novel components in oocytes and preimplantation embryos. On the other hand, while subcortical localization of SCMC components was compromised by the absence of ‘core’ components of SCMC such as Nlrp5, Ooep and Tle6 (Li et al. 2008, Yu et al. 2014, Mahadevan et al. 2017), the distribution of the SCMC components was not altered in the oocytes lacking Filia, Zbed3 and Nlrp4f (Zheng & Dean 2009, Gao et al. 2018, Qin et al. 2019). Normal distribution of Nlrp5 and Filia in Nlrp9 TMut oocytes suggests that Nlrp9a/b/c are not the core component (Fig. 6C).
It is well-known that under in vitro culture conditions, fertilized eggs from permissive mouse strains can develop into blastocysts, whereas those from non-permissive strains are arrested at the two-cell stage (Biggers 1998). As females of non-permissive strains give birth to offspring during natural mating, the suboptimal conditions in culture induce the two-cell block, which is dependent on the genetic background of mice. Similar to the permissive mouse strains, the Nrlp9 TMut females in this study gave birth to a relatively normal number of pups, but the zygotes from the Nrlp9 TMut females exhibited two-cell block in culture. Likewise, the zygotes from the Nlrp2 mutant females also resulted in two-cell block in culture, although the number of implanted embryos in the mutant females in vivo was comparable to those of the control females (Mahadevan et al. 2017). Additionally, the zygotes form Nlrp4f KO females did not exhibit two-cell arrest, but showed delayed development to blastocysts in vitro (Qin et al. 2019). It has been shown that the formation of the F-actin meshwork around the subcortical region was impaired in the absence of the SCMC components, which may have given rise to the asymmetric cell division seen in the SCMC mutant embryos (Yu et al. 2014). Thus, the molecular processes in which reproductive NLRPs are involved, including the dynamics of cytoskeletal organization, may be affected by the culture conditions.
Female mice deficient in Nlrp5 are sterile due to the two-cell block in vivo (Tong et al. 2000). The Nlrp2 mutant female mice frequently give birth to stillborn offspring with aberrant DNA methylation in the imprinted genes (Mahadevan et al. 2017). In this study, we showed that the Nlrp9 TMut female mice had relatively normal litter sizes, but preimplantation development was impaired both in vitro and in vivo. As they lacked one member of the reproductive NLRPs, this resulted in specific phenotypes, suggesting that reproductive NLRPs might be functionally diverse. Each immune NLRP forms an independent inflammasome that responds to distinct pathogens and stressors. Similarly, reproductive NLRPs might also be involved in the formation of diverse SCMCs. As an alternative, the milder phenotypes of the Nlrp2 KO, Nlrp4f KO and Nlrp9 mutant mice might be explained by compensation by Nlrp5. In conclusion, taken together with a precious study (Zhu et al. 2017), our results demonstrated that Nlrp9 functions as both an immune and reproductive NLRP, depending on the cell types involved.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work is financially supported by the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan, and Kitasato University School of Science.
Author contribution statement
Sa K, S T, T I, M W and Y S performed the experiments. All the authors analyzed the data. Sa K, S T, Y S and T K designed the research and wrote the paper. All the authors approved the manuscript.
Acknowledgements
The authors thank Dr S Zhu (University of Science and Technology in China) and Dr RA Flavell (Yale School of Medicine) for kindly providing the expression plasmid for mouse FLAG-Nlrp9b, Dr J Dean (NIDDK, NIH) for kindly providing the antibodies against Nlrp5 and Filia, all the members of Kimura Laboratory and staffs of animal facility, especially Ms A Ogura and the deceased Mr A Ohtani.
References
Biggers JD 1998 Reflections on the culture of the preimplantation embryo. International Journal of Developmental Biology 42 879–884.
Dang-Nguyen TQ & Torres-Padilla ME 2015 How cells build totipotency and pluripotency: nuclear, chromatin and transcriptional architecture. Current Opinion in Cell Biology 34 9–15. (https://doi.org/10.1016/j.ceb.2015.04.006)
Docherty LE, Rezwan FI, Poole RL, Turner CLS, Kivuva E, Maher ER, Smithson SF, Hamilton-Shield JP, Patalan M & Gizewska M et al.2015 Mutations in NLRP5 are associated with reproductive wastage and multilocus imprinting disorders in humans. Nature Communications 6 8086. (https://doi.org/10.1038/ncomms9086)
Esposito G, Vitale AM, Leijten FPJ, Strik AM, Koonen-Reemst AMCB, Yurttas P, Robben TJAA, Coonrod S & Gossen JA 2007 Peptidylarginine deiminase (PAD) 6 is essential for oocyte cytoskeletal sheet formation and female fertility. Molecular and Cellular Endocrinology 273 25–31. (https://doi.org/10.1016/j.mce.2007.05.005)
Gao Z, Zhang X, Yu X, Qin D, Xiao Y, Yu Y, Xiang Y, Nie X, Lu X & Liu W et al.2018 Zbed3 participates in the subcortical maternal complex and regulates the distribution of organelles. Journal of Molecular Cell Biology 10 74–88. (https://doi.org/10.1093/jmcb/mjx035)
Hashimoto M & Takemoto T 2015 Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports 5 11315. (https://doi.org/10.1038/srep11315)
Kosugi M, Otani M, Kikkawa Y, Itakura Y, Sakai K, Ito T, Toyoda M, Sekita Y & Kimura T 2020 Mutations of histone demethylase genes encoded by X and Y chromosomes, Kdm5c and Kdm5d, lead to noncompaction cardiomyopathy in mice. Biochemical and Biophysical Research Communications. (https://doi.org/10.1016/j.bbrc.2020.02.043)
Leung CY & Zernicka-Goetz M 2015 Mapping the journey from totipotency to lineage specification in the mouse embryo. Current Opinion in Genetics and Development 34 71–76. (https://doi.org/10.1016/j.gde.2015.08.002)
Li L, Baibakov B & Dean J 2008 A subcortical maternal complex essential for preimplantation mouse embryogenesis. Developmental Cell 15 416–425. (https://doi.org/10.1016/j.devcel.2008.07.010)
Lu X, Gao Z, Qin D & Li L 2017 A maternal functional module in the mammalian oocyte-to-embryo transition. Trends in Molecular Medicine 23 1014–1023. (https://doi.org/10.1016/j.molmed.2017.09.004)
Mahadevan S, Sathappan V, Utama B, Lorenzo I, Kaskar K & Van Den Veyver IB 2017 Maternally expressed NLRP2 links the subcortical maternal complex (SCMC) to fertility, embryogenesis and epigenetic reprogramming. Scientific Reports 7 44667. (https://doi.org/10.1038/srep44667)
Ohsugi M, Zheng P, Baibakov B, Li L & Dean J 2008 Maternally derived FILIA-MATER complex localizes asymmetrically in cleavage-stage mouse embryos. Development 135 259–269. (https://doi.org/10.1242/dev.011445)
Parry DA, Logan CV, Hayward BE, Shires M, Landolsi H, Diggle C, Carr I, Rittore C, Touitou I & Philibert L et al.2011 Mutations causing familial biparental hydatidiform mole implicate C6orf221 as a possible regulator of genomic imprinting in the human oocyte. American Journal of Human Genetics 89 451–458. (https://doi.org/10.1016/j.ajhg.2011.08.002)
Peng H, Lin X, Liu F, Wang C & Zhang W 2015 NLRP9B protein is dispensable for oocyte maturation and early embryonic development in the mouse. Journal of Reproduction and Development 61 559–564. (https://doi.org/10.1262/jrd.2015-050)
Pétrilli V, Dostert C, Muruve DA & Tschopp J 2007 The inflammasome: a danger sensing complex triggering innate immunity. Current Opinion in Immunology 19 615–622. (https://doi.org/10.1016/j.coi.2007.09.002)
Qin D, Gao Z, Xiao Y, Zhang X, Ma H, Yu X, Nie X, Fan N, Wang X & Ouyang Y et al.2019 The subcortical maternal complex protein Nlrp4f is involved in cytoplasmic lattice formation and organelle distribution. Development 146. (https://doi.org/10.1242/dev.183616)
Rathinam VAK & Fitzgerald KA 2016 Inflammasome complexes: emerging mechanisms and effector functions. Cell 165 792–800. (https://doi.org/10.1016/j.cell.2016.03.046)
Reddy R, Akoury E, Phuong Nguyen NM, Abdul-Rahman OA, Dery C, Gupta N, Daley WP, Ao A, Landolsi H & Ann Fisher R et al.2013 Report of four new patients with protein-truncating mutations in C6orf221/KHDC3L and colocalization with NLRP7. European Journal of Human Genetics 21 957–964. (https://doi.org/10.1038/ejhg.2012.274)
Rezaei M, Nguyen NMP, Foroughinia L, Dash P, Ahmadpour F, Verma IC, Slim R & Fardaei M 2016 Two novel mutations in the KHDC3L gene in Asian patients with recurrent hydatidiform mole. Human Genome Variation 3 16027. (https://doi.org/10.1038/hgv.2016.27)
Sakai K, Ito C, Wakabayashi M, Kanzaki S, Ito T, Takada S, Toshimori K, Sekita Y & Kimura T 2019 Usp26 mutation in mice leads to defective spermatogenesis depending on genetic background. Scientific Reports 9 13757. (https://doi.org/10.1038/s41598-019-50318-6)
Schultz RM, Stein P & Svoboda P 2018 The oocyte-to-embryo transition in mouse: past, present, and future. Biology of Reproduction 99 160–174. (https://doi.org/10.1093/biolre/ioy013)
Tashiro F, Kanai-Azuma M, Miyazaki S, Kato M, Tanaka T, Toyoda S, Yamato E, Kawakami H, Miyazaki T & Miyazaki JI 2010 Maternal-effect gene Ces5/Ooep/Moep19/Floped is essential for oocyte cytoplasmic lattice formation and embryonic development at the maternal-zygotic stage transition. Genes to Cells 15 813–828. (https://doi.org/10.1111/j.1365-2443.2010.01420.x)
Tian X, Pascal G & Monget P 2009 Evolution and functional divergence of NLRP genes in mammalian reproductive systems. BMC Evolutionary Biology 9 202. (https://doi.org/10.1186/1471-2148-9-202)
Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J & Nelson LM 2000 Mater, a maternal effect gene required for early embryonic development in mice. Nature Genetics 26 267–268. (https://doi.org/10.1038/81547)
Yu XJ, Yi Z, Gao Z, Qin D, Zhai Y, Chen X, Ou-Yang Y, Wang ZB, Zheng P & Zhu MS et al.2014 The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics. Nature Communications 5 4887. (https://doi.org/10.1038/ncomms5887)
Yue F, Cheng Y, Breschi A, Vierstra J, Wu W, Ryba T, Sandstrom R, Ma Z, Davis C & Pope BD et al.2014 A comparative encyclopedia of DNA elements in the mouse genome. Nature 515 355–364. (https://doi.org/10.1038/nature13992)
Zheng P & Dean J 2009 Role of Filia, a maternal effect gene, in maintaining euploidy during cleavage-stage mouse embryogenesis. PNAS 106 7473–7478. (https://doi.org/10.1073/pnas.0900519106)
Zhu S, Ding S, Wang P, Wei Z, Pan W, Palm NW, Yang Y, Yu H, Li HB & Wang G et al.2017 Nlrp9b inflammasome restricts rotavirus infection in intestinal epithelial cells. Nature 546 667–670. (https://doi.org/10.1038/nature22967)
