Nucleolar stress regulates stromal–epithelial transition via NPM1 during decidualization

in Reproduction
Authors:
Yu-Xiang LiangShanxi Key Laboratory of Birth Defect and Cell Regeneration, Shanxi Medical University, Taiyuan, China
College of Veterinary Medicine, South China Agricultural University

Search for other papers by Yu-Xiang Liang in
Current site
Google Scholar
PubMed
Close
,
Wei HuCollege of Veterinary Medicine, South China Agricultural University
College of Life Science and Resources and Environment, Yichun University, Yichun, China

Search for other papers by Wei Hu in
Current site
Google Scholar
PubMed
Close
,
Zhi-Yong JinCollege of Veterinary Medicine, South China Agricultural University

Search for other papers by Zhi-Yong Jin in
Current site
Google Scholar
PubMed
Close
,
Hong-Lu DiaoReproductive Medicine Center, Renmin Hospital, Hubei University of Medicine, Shiyan, Hubei, China

Search for other papers by Hong-Lu Diao in
Current site
Google Scholar
PubMed
Close
,
Li LiuCollege of Veterinary Medicine, South China Agricultural University

Search for other papers by Li Liu in
Current site
Google Scholar
PubMed
Close
,
Yan YangCollege of Veterinary Medicine, South China Agricultural University

Search for other papers by Yan Yang in
Current site
Google Scholar
PubMed
Close
,
Tao FuCollege of Veterinary Medicine, South China Agricultural University

Search for other papers by Tao Fu in
Current site
Google Scholar
PubMed
Close
, and
Zeng-Ming YangCollege of Veterinary Medicine, South China Agricultural University

Search for other papers by Zeng-Ming Yang in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed and reprint requests to Z-M Yang; Email: zmyang@scau.edu.cn
Free access

Embryo implantation and decidualization are crucial steps during early pregnancy. We recently showed that nucleolar stress is involved in embryo implantation. This study was to explore whether nucleolar stress participates in mouse and human decidualization. Our data demonstrated that a low dose of actinomycin D (ActD) could induce nucleolar stress in stroma cells. Nucleolar stress promotes the stromal-epithelial transition during mouse in vitro decidualization through nucleophosmin1 (NPM1). Under nucleolar stress, Wnt family member 4 (Wnt4), a decidualization marker, is significantly increased, but decidua/trophoblast prolactin-related protein (Dtprp/Prl8a2) expression remains unchanged. For translational significance, we also examined the effects of nucleolar stress on human decidualization. Nucleolar stress stimulated by a low dose of ActD enhances human stromal–epithelial transition during human decidualization, but has no effects on the expression of insulin-like growth factor-binding protein 1 (IGFBP1). Our study indicates that nucleolar stress may promote only the mesenchymal–epithelial transition (MET), but not for all the molecular changes during decidualization.

Abstract

Embryo implantation and decidualization are crucial steps during early pregnancy. We recently showed that nucleolar stress is involved in embryo implantation. This study was to explore whether nucleolar stress participates in mouse and human decidualization. Our data demonstrated that a low dose of actinomycin D (ActD) could induce nucleolar stress in stroma cells. Nucleolar stress promotes the stromal-epithelial transition during mouse in vitro decidualization through nucleophosmin1 (NPM1). Under nucleolar stress, Wnt family member 4 (Wnt4), a decidualization marker, is significantly increased, but decidua/trophoblast prolactin-related protein (Dtprp/Prl8a2) expression remains unchanged. For translational significance, we also examined the effects of nucleolar stress on human decidualization. Nucleolar stress stimulated by a low dose of ActD enhances human stromal–epithelial transition during human decidualization, but has no effects on the expression of insulin-like growth factor-binding protein 1 (IGFBP1). Our study indicates that nucleolar stress may promote only the mesenchymal–epithelial transition (MET), but not for all the molecular changes during decidualization.

Introduction

Although a great progress has been made in in vitro fertilization (IVF) techniques for the treatment of female infertility, implantation failure is still the main cause for pregnancy loss (Cakmak & Taylor 2011). The molecular mechanisms underlying uterine receptivity and decidualization are poorly defined.

The major function of the nucleolus is ribosome biosynthesis. The ribosome biosynthesis events within the nucleolus consist of pre-rRNA transcription, processing, and ribosomal ribonucleoprotein assembly, and is tightly orchestrated by different types of cellular stress (Carotenuto et al. 2019). Actinomycin D (ActD) is an inhibitor of protein synthesis and a chemotherapeutic agent (Brodská et al. 2016). When cells are under stress condition, such as a low dose of ActD, RNA polymerase I is typically inhibited, leading to the decrease of pre-rRNA transcription, reorganization of nuclear architecture, and activation of specific stress repair responses (e.g. DNA repair) (James et al. 2014). Once the severity of the insult is beyond the ability of the cell to recover, the stress signaling ultimately results in either cell cycle arrest or apoptosis (Boulon et al. 2010, Nishimura et al. 2015, Lewinska et al. 2017). Nucleolar stress, also known as ribosomal stress or ribotoxic stress, is now used to describe various stressor-induced impairments in nucleolar morphology and function (James et al. 2014, Yang et al. 2016, 2018). Under nucleolar stress, nucleolar protein NPM1 translocates from nucleolus to nucleoplasm, where it interacts with Mdm2 to prevent P53 from ubiquitin-mediated degradation (Zhang & Lu 2009, Golstein 2017). The typical characteristics of nucleolar stress include reduced rRNA synthesis, P53 stabilization and translocation of NPM1 from the nucleolus to the nucleoplasm. Nucleolar stress can be induced by ActD, 5-FU, CX5461, nutrient deprivation or ultraviolet radiation (Bywater et al. 2012, Suzuki et al. 2012). Indeed, failure of a cell to properly regulate P53 activity following disruption of ribosome biogenesis has been linked to human disorders, such as Diamond–Blackfan anaemia, TCOF1 (Treacher Collins–Franceschetti syndrome 1), Alzheimer’s disease and Parkinson’s disease (Parlato & Liss 2014). However, the potential physiological functions of nucleolar stress need to be elucidated.

In rodents and primates, blastocyst will penetrate luminal epithelium to initiate decidualization (Dey et al. 2004). During decidualization, stromal cells undergo extensive proliferation and differentiation and ultimately transform into decidual cells. Both DNA damage and endoplasmic reticulum stress response are detected during decidualization (Lei et al. 2012). Moreover, cAMP enhances the production of endogenous reactive oxygen species (ROS), which coincides with a dramatic increase in decidual PRL and IGFBP1 expression (Al-Sabbagh et al. 2011). Recently, it has been demonstrated that nucleolar oxidation is a general response to various cellular stresses, including nucleolar stress (Yang et al. 2016). It is shown that delayed implantation in mice and rats can be activated by intraperitoneal injections of ActD (Finn & Downie 1975, Camus et al. 1979). Our recent study showed that nucleolar stress is present during early pregnancy and can induce embryo implantation in both mice and humans (Hu et al. 2019). Because there is a translocation of NPM1 from the nucleolus to the nucleoplasm in the subepithelial stromal cells at implantation site on day 5 (Hu et al. 2019), we hypothesized that nucleolar stress might play a role during decidualization. The aim of this study was to examine the effects of ActD-induced nucleolar stress on mouse and human decidualization. Our data showed that nucleolar stress stimulates the stromal–epithelial transition during mouse and human decidualization.

Materials and methods

Animal treatments

Mature CD1 mice were obtained from Hunan Slack Laboratory Animal Co., Ltd and were maintained under a specific pathogen-free environment (12 h light:12 h darkness cycle). All animal procedures were approved by the Animal Care and Use Committee of South China Agricultural University. Pregnant or pseudopregnant female mice (8–10 weeks) were obtained by mating with fertile or vasectomized males of the same strain (day 1 is the day of the vaginal plug).

Artificial decidualization was performed as previously described (Liang et al. 2018). Briefly, pseudopregnant mice were intraluminally infused with 25 μL of sesame oil (Sigma) into one uterine horn on day 4, whereas the contralateral uninjected horn served as a control. The uteri were collected on day 8 of pseudopregnancy.

To examine the effects of NPM1 on weight of mouse implantation sites on day 8, pregnant mice were intraperitoneally injected with the NPM1-specific antagonist NSC348884 (80 μg/mouse and 160 μg/mouse in saline; 31.85 mg/mL dissolved in DMSO and diluted in saline, 100 μL per mouse, Selleckchem) daily from days 5 to 7 of pregnancy. The injection of an equal solvent served as a control. Mice were sacrificed at 0900 h on day 8 to collect uteri for weighing implantation sites. There were no less than nine mice in each group of this assay.

To exclude possibility that NSC348884 may inhibit decidual weight via preclude the embryonic development, pseudopregnant mice induced for artificial decidualization were treated with a daily intraperitoneally injection of 80 μg/mouse and 160 μg/mouse NSC-348884 (31.85 mg/mL dissolved in DMSO and diluted in saline, 100 μL per mouse, Selleckchem) on days 5, 6 and 7 of pseudopregnancy. The injection of an equal solvent served as a control. Uteri were collected and weighed on day 8 of pseudopregnancy. There were no less than nine mice in each group of this assay.

Isolation and treatment of mouse uterine stromal cells

The stromal cells were isolated as previously described (De Clercq et al. 2017). Briefly, the uterine horns on day 4 of pregnancy were split longitudinally and washed with sterile HBSS (Sigma-Aldrich) three times. All the uteri were digested with HBSS containing 1% (w/v) trypsin (Amresco, Cleveland, USA) and 6 mg/mL dispase (Roche Applied Science) for 1 h at 4°C, followed by 1 h at room temperature and 10 min at 37°C. The luminal epithelial cells were removed by shaking gently to dislodge sheets of luminal epithelial cells from digested uteri after HBSS washing. The remaining tissues were incubated in 2 mL of HBSS containing 0.15 mg/mL collagenase I (Invitrogen) at 37°C for 30 min to collect the stromal cells. The stromal cells were cultured in DMEM/F12 medium (Sigma-Aldrich) containing 10% (v/v) heat-inactivated fetal bovine serum (FBS, Biological Industries, Cromwell, Israel). In vitro decidualization of mouse stromal cells was induced by treatment of 10 nM estradiol-17β plus 1 μM progesterone. Under the condition of decidualization and non-decidualization, stromal cells were treated with 7.5 nM and 12.5 nM ActD to study the effect of nucleolar stress on decidualization in vitro.

Cell culture and in vitro decidualization of human endometrial stromal cells

Immortalized human endometrial stromal cells (hESC) were purchased from the American Type Culture Collection (ATCC, CRL-4003TM) and cultured according to the manufacturer’s instructions. Briefly, stromal cells were cultured in DMEM/F12 (Sigma-Aldrich) supplemented with 10% charcoal-stripped FBS (cFBS, Biological Industries, Invitrogen) at 37°C in a humidified chamber with 5% CO2. Decidualization in vitro was induced as previously described (Liang et al. 2018). Stromal cells were treated with 1 μM medroxyprogesterone 17-acetate (Sigma-Aldrich) and 0.5 mM dibutyryl cAMP (db-cAMP, Sigma-Aldrich) in DMEM/F12 with 2% (v/v) cFBS (Biological Industries) for 6 days. The medium was changed every 48 h. Under the condition of decidualization and non-decidualization, stromal cells were treated with 3.5 nM ActD (ab141058, Abcam) for further analyzing the effects of nucleolar stress on in vitro decidualization.

Transfection of Npm1 siRNA

The stromal cells were transfected with Npm1 siRNA (Guangzhou Ribo Co., Ltd., Guangzhou, China) according to the instructions of Lipofectamine 2000 kit (Invitrogen). After transfection with Npm1 siRNA for 6 h, the stromal cells were induced for in vitro decidualization with estradiol-17β (10 nM) and progesterone (1 μM) in DMEM/F12 medium containing 2% (v/v) cFBS for 24 h. Hi GC siRNA was used as a negative control. The sequences used for RNA interference were provided in Table 1.

Table 1

Primers used in this study.

Gene Primers (5ʹ–3ʹ) ID Products (bp) Application
Rpl7 GCAGATGTACCGCACTGAGATTC

ACCTTTGGGCTTACTCCATTGATA
NM_29016 129 RT-PCR
Dtprp AGCCAGAAATCACTGCCACT

TGATCCATGCACCCATAAAA
NM_010088 119 RT-PCR
Its1 TCCGTGTCTACGAGGGGCGG

GGGTGCCGGGAGAGCAAAGC
XR_877120.2 95 RT-PCR
p21 TGAGCGGCCTGAAGATTCC

ATAGAAATCTGTCAGGCTGGTCTGC
NM_007669.5 82 RT-PCR
Mdm2 AATTTAGTGGCTGTAAGTCAGCAAGA

ATCCTTCAGATCACTCCCACCTT
NM_010786.4 87 RT-PCR
Lif AAAAGCTATGTGCGCCTAACA

GTATGCGACCATCCGATACAG
NM_008501 98 RT-PCR
Wnt4 CCTCGTCTTCGCCGTGTT

TCCTCTTCGGAGATGCTGC
NM_009523.2 87 RT-PCR
Bhlha15 GAGAGCAATGAGCGAGAG

TAAGTATGGTGGCGGTCA
NM_010800.4 163 RT-PCR
IGFBP1 CCAAACTGCAACAAGAATG

GTAGACGCACCAGCAGAG
NM_001013029 87 RT-PCR
GAPDH GAAGGTGAAGGTCGGAGT

GATGGCAACAATATCCACTT
BC023632 94 RT-PCR
siNpm1 CTATGAAGGCAGTCCAATT siRNA
siNC CTCCGAACGTGTCACGT siRNA

Real-time PCR

Real-time PCR was performed as previously described (Ding et al. 2018). Briefly, total RNAs from each sample were isolated using TRIzol reagent kit (Invitrogen), digested with RQ1 deoxyribonuclease I (Promega) and reverse-transcribed into cDNA with PrimeScript reverse transcriptase reagent kit (TaKaRa). For real-time PCR, cDNA was amplified using a SYBR Premix Ex Taq kit (TaKaRa) on the CFX96 Touch™ Real-Time System (Bio-Rad). Data from real-time PCR were analyzed using the 2−ΔΔCt method and normalized to Rpl7 (mouse) or GAPDH (human) expression. Primer sequences used in this study were listed in Table 1.

Western blot analysis

Western blot was performed as previously described (Zuo et al. 2015). Briefly, protein lysates were separated by SDS–polyacrylamide gel electrophoresis and transferred onto a PVDF membrane. Membranes were incubated overnight at 4°C with each primary antibody, including anti-P53 (#1050, Cell Signaling Technology), anti-Snail (#3294, Cell Signaling Technology), anti-E-cadherin (#ab48187, Cell Signaling Technology) and anti-Tubulin (#2144, Cell Signaling Technology). Then the membrane was incubated in 5% non-fat milk containing HRP-conjugated secondary antibody (1:5000) for 1 h. Signals were detected by ECL Chemiluminescent kit (Millipore).

Immunofluorescence

Immunofluorescence was performed as previously described (Yang et al. 2016). Mouse uteri were fixed overnight in neutral formalin and embedded in paraffin. Paraffin sections (5 μm) were deparaffinized in xylene, rehydrated with a graded series of ethanol, and washed in water. Endogenous peroxidase activity was inhibited with 3% (v/v) H2O2 for 15 min. Antigen retrieval was achieved by boiling the slides in 10 mM citrate pH 6.0 for 12–15 min. Slides were washed several times with distilled water and blocked by 10% (v/v) horse serum at 37°C for 1 h. Primary antibodies (anti-NPM1, 1:200, #10306-1-AP, ProteinTech, USA) were applied overnight at 4°C in 10% (v/v) horse serum. Sections were washed in PBS for three times and incubated with fluorescent-labelled secondary antibodies at room temperature in darkness for 2 h. The nuclei were counterstained with DAPI.

Cultured cells grown on coverslips were fixed in 4% (w/v) paraformaldehyde for 10 min before permeabilization with 0.3% (v/v) Triton X-100, washed with PBS and incubated with 2% (w/v) BSA containing anti-NPM1 antibody at 4°C overnight. The monolayers were then washed with PBS and incubated with goat anti-rabbit Alexa Fluor 488 (Invitrogen, 1:200) in PBS at 37°C for 2 h. Cells were washed again with PBS, counterstained with DAPI ion (Invitrogen). Confocal images were acquired using a Leica TCS confocal laser-scanning microscope (Leica).

Statistical analysis

Statistical analysis was performed with GraphPad Prism 8.0 software. All the experiments were repeated independently at least three times. For mouse studies, n = 3 means at least three mice were included in each group. For cell culture assay, n = 3 means three replicates using stromal cells from at least three individual mice. Data were presented as mean ± s.e.m. One-way ANOVA test was conducted to assess the differences between groups. P-value < 0.05 was considered statistically significant.

Results

Nucleolar stress is induced in mouse stromal cells by a low dose of ActD

Pre-rRNA (Its1) reduction, P53 stabilization and NPM1 translocation are the hallmark of nucleolar stress (Holmberg Olausson et al. 2012). p21 and Mdm2 are typical target genes of P53 (Avitabile et al. 2011). ActD in a low concentration of 10 nM was previously used to induce nucleolar stress (Bhat et al. 2004, Suzuki et al. 2012). When stromal cells were treated with 7.5 or 12.5 nM ActD, there were a decrease in the Its1 mRNA level and an increase in p21 and Mdm2 mRNA levels (Fig. 1A). Western blot analysis showed that P53 was also upregulated in ActD-treated cells (Fig. 1B). After stromal cells were treated with 7.5 or 12.5 nM ActD for 3 days, NPM1 translocated from the nucleolus to the nucleoplasm (Fig. 1C). These results indicated that ActD can induce nucleolar stress in stromal cells.

Figure 1
Figure 1

Nucleolar stress is induced in mouse stromal cells by low-dose ActD. (A) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (B) Western blot analysis of P53 protein in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Tubulin was used as a loading control. (C) Confocal images of NPM1 fluorescence in stromal cells treated with DMSO or 7.5 nM ActD for 3 days. Bar = 20 μm. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P  < 0.05.

Citation: Reproduction 160, 4; 10.1530/REP-20-0051

ActD-induced nucleolar stress regulates MET in mouse stromal cells

Since nucleolar stress could be induced by a low-dose ActD in mouse uterine stromal cells, we wondered whether nucleolar stress has any effects on mouse stromal cell in vitro decidualization. When stromal cells were treated with ActD for 2 or 3 days, Prl8a2, a widely used marker for mouse stromal cell in vitro decidualization (Kimura et al. 2001), was significantly decreased (Fig. 2A). Wnt4 and Lif are essential for mouse implantation and decidualization (Stewart et al. 1992, Franco et al. 2011, Li et al. 2013). ActD treatment significantly stimulated the increase of both the Lif and Wnt4 mRNA levels (Fig. 2B). Snail, a marker of mesenchymal to epithelial transition (MET) during decidualization (Cano et al. 2000), was also reduced by ActD treatment (Fig. 2C). Meanwhile, Bhlha15 (Mist1), a marker for MET (Li et al. 2018), was increased by ActD treatment (Fig. 2D). Additionally, the morphology of the stromal cells changed from fibroblastic to epithelial phenotype (Fig. 2E). These findings indicated that nucleolar stress could upregulate Lif and Wnt4 and promote MET in mouse stromal cells.

Figure 2
Figure 2

ActD-induced nucleolar stress promotes stromal–epithelial transition in mouse in vitro decidualization. (A) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 2 and 3 days. (B) Real-time PCR analysis of Lif and Wnt4 mRNA levels in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (C) Western blot analysis of the Snail protein in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Tubulin was used as a loading control. (D) Real-time PCR analysis of Bhlha15 mRNA level in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (E) The morphology of stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Bar = 100 μm. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

Citation: Reproduction 160, 4; 10.1530/REP-20-0051

Nucleolar protein NPM1 is indispensable for mouse decidualization

Because Npm1, a marker of nucleolar stress, is highly detected at implantation sites on day 5 of pregnancy (Hu et al. 2019), we speculated that NPM1 might play an important role in the process of decidualization in mice. In order to analyze the role of NPM1 during mouse decidualization, pregnant mice were treated from days 4 to 7 with different doses of NSC348884, a specific inhibitor of NPM1 (Qi et al. 2008). On day 8, mouse decidualization was dramatically inhibited or blocked by NSC34884 (Fig. 3A). To exclude the effects of NSC348884 on embryo development, pseudopregnant mice induced for artificial decidualization was treated with NSC348884. Artificial decidualization was also suppressed by NSC348884 (Fig. 3B), suggesting that the inhibition of NSC348884 on decidualization mainly acts on uterine function, not on embryos. Compared to control, Prl8a2 expression was compromised by Npm1 siRNA under in vitro decidualization (Fig. 3C). Under in vitro decidualization, Prl8a2 expression was also inhibited by NSC348884 (Fig. 3D). These results suggest that NPM1 is important for mouse decidualization.

Figure 3
Figure 3

NPM1 is indispensable during mouse decidualization. (A) The morphology of implantation sites on day 8 following NSC348884 treatment from days 4 to 7 of pregnancy. (B) The morphology of deciduoma on day 8 following NSC348884 treatment from days 4 to 7 of pseudopregnancy. (C) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with Npm1 siRNA under in vitro decidualization for 24 h. (D) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with NSC348884 (2 μM) under in vitro decidualization for 3 days. The real-time values are normalized to Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

Citation: Reproduction 160, 4; 10.1530/REP-20-0051

DNA damage and oxidative stress induce nucleolar stress in stromal cells

DNA damage is detected during mouse decidualization (Lei et al. 2012). We then analyzed the effects of DNA damage on nucleolar stress. After the stromal cells were treated with 10 μM CPT for 12 h, an inducer of DNA damage (Morris & Geller 1996), NPM1 translocated from the nucleolus to the nucleoplasm (Fig. 4A). Accordingly, there were a decrease of Its1 mRNA level and an increase for both p21 and Mdm2 mRNA levels in CPT-treated cells (Fig. 4B). In CPT-treated cells, p-H2AX, a DNA damage marker (Bonner et al. 2008), was significantly upregulated and P53 level was also sharply increased (Fig. 4C). These results indicate that nucleolar stress could be induced by DNA damage.

Figure 4
Figure 4

Nucleolar stress in stromal cells is stimulated by DNA damage and oxidative stress. (A) NPM1 immunofluorescence after stromal cells were treated with 10 μM CPT for 12 h. Bar = 25 μm. (B) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in CPT-treated stromal cells. (C) Western blot analysis of P53 and p-H2AX proteins in CPT-treated stromal cells. β-Actin was used as a loading control. (D) NPM1 immunofluorescence after stromal cells were treated with 250 μM H2O2 for 2 h. Bar = 25 μm. (E) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in H2O2-treated stromal cells. (F) Western blot analysis of P53 protein in H2O2-treated stromal cells. Tubulin was used as a loading control. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

Citation: Reproduction 160, 4; 10.1530/REP-20-0051

Additionally, ROS production increases in decidualized stromal cells during mouse early pregnancy. ROS can effectively induce oxidative stress and DNA damage (Agarwal et al. 2005, Zhang et al. 2018). After stromal cells were treated with 250 μM H2O2 for 2 h, NPM1 partially translocated from the nucleolus to the nucleoplasm (Fig. 4D). In the H2O2-treated cells, there were a decrease of Its1 mRNA and an increase for p21 and Mdm2 mRNA levels (Fig. 4E). Western blot analysis showed that P53 was also upregulated in H2O2-treated cells (Fig. 4F). These results showed that oxidative stress may induce nucleolar stress in the stromal cells.

Nucleolar stress promotes stromal–epithelial transition in human decidualization

Given that nucleolar stress is involved in mouse decidualization, we would like to translate these results in humans. Under human in vitro decidualization, treatment with 3.5 nM ActD caused a significant decrease of IGFBP1 (Fig. 5A), which is a marker for human decidualization (Rutanen et al. 1985). However, after stromal cells were treated by 3.5 nM ActD, the epithelial phenotype was induced in comparison to control (Fig. 5B). Upregulation of E-cadherin and downregulation of snail are recognized as MET marker (Cano et al. 2000). Accordingly, E-cadherin was upregulated, while Snail was downregulated by treatment with 3.5 nM ActD (Fig. 5C). When stromal cells were treated with 3.5 nM ActD, P53 protein level was significantly increased (Fig. 5C). NPM1 translocation was significantly induced by 3.5 nM ActD (Fig. 5D). Our data suggested that nucleolar stress in human endometrial stromal cells could be induced by low-dose ActD and promote stromal–epithelial transition.

Figure 5
Figure 5

Nucleolar stress promotes stromal–epithelial transition in human decidualization. (A) The mRNA expression of IGFBP1 in human stromal cells treated with DMSO (control) or 3.5 nM ActD during the condition of in vitro decidualization for 6 days. (B) The morphological changes after stromal cells were treated with DMSO (control) or 3.5 nM ActD. Bar = 50 μm. (C) The protein expression of P53, Snail and E-Cadherin in human stromal cells treated with DMSO (control) or 3.5 nM ActD for 48 h. (D) NPM1 immunofluorescence in human stromal cells treated with DMSO (control) or 3.5 nM ActD for 48 h. Bar = 5 μm; n = 3; *P < 0.05.

Citation: Reproduction 160, 4; 10.1530/REP-20-0051

Discussion

Nucleolar stress is involved in mouse embryo implantation (Hu et al. 2019). Delayed implantation in mice and rats can be activated by low-dose ActD (Finn & Downie 1975, Camus et al. 1979). In this study, nucleolar stress is induced by a low dose of ActD. In these ActD-treated stromal cells, the morphology of stromal cells also changes from stromal to epithelial cells. MET is a reliable marker for mouse and human decidualization (Zhang et al. 2013). The overexpression of Mist1 can reverse the epithelial–mesenchymal transition of pancreatic cancer cells by downregulating Snail (Li et al. 2018). In our study, ActD treatment also stimulates an increase of Mist1 and a decrease of Snail. Furthermore, WNT4 overexpression is involved in the transformation of human endometrial stromal cells from mesenchymal to epithelioid phenotype (Owusu-Akyaw et al. 2019), which is in accordance with our data showing a significant upregulation of Wnt4 in ActD-treated mouse stromal cells. These results indicate that nucleolar stress induced by ActD can promote MET in stromal cells. NPM1, a nucleolar phosphoprotein, localizes in the granular regions of the nucleolus and acts as a key effector protein of nucleolar stress (Qi et al. 2008). Npm1 mutation is associated with hematopoietic malignant tumor in mice (Loberg et al. 2019). However, it is unclear how Npm1 acts during mouse decidualization. In our study, mouse in vitro decidualization is suppressed by Npm1 blockade, and treatment of NPM1 inhibitor compromises mouse in vivo decidualization independent of embryo. These evidences indicate that nucleolar stress should play a role during decidualization. While nucleolar stress is implicated to play a role in mouse decidualization, the mechanism by which this could be accomplished, is unknown. To this end, we examine whether DNA damage could be an inducer of nucleolar stress in decidualization. DNA damage is involved in mouse decidualization (Lei et al. 2012). We found that nucleolar stress is indeed induced by CPT-induced DNA damage. Additionally, DNA damage also upregulates P53 (Ou & Schumacher 2018). What is more, the presence of ROS in the female reproductive tract has been demonstrated in both animal and human studies (Agarwal et al. 2005). ROS can effectively induce oxidative stress and DNA damage (Zhang et al. 2018). Our results confirm that the nucleolar stress is induced by H2O2 in the stromal cells. It is possible that DNA damage or oxidative stress-induced nucleolar stress may be important for mouse decidualization.

IGFBP1 is a marker for human in vitro decidualization. In our study, IGFBP1 is not upregulated significantly by ActD treatment, whereas ActD treatment promotes the transformation of human stromal cells from a fibroblastic to an epithelioid phenotype. Concomitantly, E-cadherin is upregulated and Snail is downregulated by low-dose ActD treatment, also suggesting a transformation from fibroblastic to an epithelioid phenotype. However, during mouse in vitro decidualization, ActD treatment also causes a decrease of Prl8a2 expression, a marker for mouse in vitro decidualization. However, Bhlha15, a MET marker, is upregulated concurrently with a sharp downregulation of snail, a well-defined EMT marker, by ActD treatment. In our study, ActD-induced nucleolar stress could only promote MET and cell morphological change, but not IGFBP1/Prl8a2 level. Based on our data, we speculate that upregulation of IGFBP1/Prl8a2 and MET should be two independent physiological processes during decidualization. This may indicate that nucleolar stress does not influence all the respects of decidualization positively, but merely promotes the MET process and certain molecular events during decidualization.

There are certain immune adaptation and inflammatory reactions in the process of embryo implantation and decidualization. Stress response may exist in the normal physiological process and play essential roles in embryo implantation and decidualization if these stress responses are fine-tuned. The replication stress and DNA damage-induced ribonucleotide reductase 2 are necessary for mouse decidualization (Lei et al. 2012). We also showed that endoplasmic reticulum stress is essential for mouse decidualization. Excessive or deficient endoplasmic reticulum stress may give rise to serious defects in decidualization (Gu et al. 2016). Developmentally arrested embryos initiate anomalous endoplasmic stress response in human decidual cells (Brosens et al. 2014). Based on current evidences, it seems that physiological stress should play an indispensable role in normal embryo implantation and decidualization. However, any stress deficiency or abnormality in decidualization may involve in endometriosis-associated infertility (Kim et al. 2019). NPM1, a key effector of nucleolar stress, is strongly expressed in mouse decidual cells and human endometrial cells. Inhibition of NPM1 can compromise mouse decidualization. These data suggested that physiological nucleolar stress response may play positive roles during mouse and human decidualization. However, ActD is a chemotherapeutic reagent used in clinical cancer treatment with multiple side effects, such as myelosuppression and gastrointestinal reactions (Peng et al. 2015). Therefore, it is optimal to seek some analogues for possible treatments in infertility clinics. Aspirin can elicit an anti-tumor effect by inducing a NF-κB dependent nucleolar stress (Chen & Stark 2018). Low-dose aspirin reduces the risk of preterm preeclampsia in high risk women and may increase fecundability in certain women with a recent early pregnancy loss (Schisterman et al. 2015). It is possible that low-dose aspirin-induced nucleolar stress may contribute to improving human pregnancy.

Our study demonstrated that nucleolar stress, a novel cell stress pattern, plays a positive role during mouse and human decidualization through NPM1, mainly for promoting stromal–epithelial transition.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by National Key Research and Development Program of China (2018YFC1004403), National Natural Science Foundation of China (31871511 and 31671563) and Science Research Start-up Fund for Doctor of Shanxi Medical University (XD1828).

Author contribution statement

Y-X L designed and performed experiments, including major experiments, analyzed the data and wrote the manuscript. H-L D performed immunofluorescence. W H and Z-Y J performed mouse treatments and real-time RT-PCR. Y Y and T F performed Western blot, RNA analysis. L L contributed to data interpretation and analysis. Z-M Y designed, supervised the study, and wrote the manuscript. All authors commented on the manuscript.

References

  • Agarwal A, Gupta S & Sharma RK 2005 Role of oxidative stress in female reproduction. Reproductive Biology and Endocrinology 3 28. (https://doi.org/10.1186/1477-7827-3-28)

    • Search Google Scholar
    • Export Citation
  • Al-Sabbagh M, Fusi L, Higham J, Lee Y, Lei K, Hanyaloglu AC, Lam EW, Christian M & Brosens JJ 2011 NADPH oxidase-derived reactive oxygen species mediate decidualization of human endometrial stromal cells in response to cyclic AMP signaling. Endocrinology 152 730740. (https://doi.org/10.1210/en.2010-0899)

    • Search Google Scholar
    • Export Citation
  • Avitabile D, Bailey B, Cottage CT, Sundararaman B, Joyo A, Mcgregor M, Gude N, Truffa S, Zarrabi A & Konstandin M et al.2011 Nucleolar stress is an early response to myocardial damage involving nucleolar proteins nucleostemin and nucleophosmin. PNAS 108 61456150. (https://doi.org/10.1073/pnas.1017935108)

    • Search Google Scholar
    • Export Citation
  • Bhat KP, Itahana K, Jin A & Zhang Y 2004 Essential role of ribosomal protein L11 in mediating growth inhibition-induced p53 activation. The EMBO Journal 23 24022412. (https://doi.org/10.1038/sj.emboj.7600247)

    • Search Google Scholar
    • Export Citation
  • Bonner WM, Redon CE, Dickey JS, Nakamura AJ, Sedelnikova OA, Solier S & Pommier Y 2008 GammaH2AX and cancer. Nature Reviews: Cancer 8 957967. (https://doi.org/10.1038/nrc2523)

    • Search Google Scholar
    • Export Citation
  • Boulon S, Westman BJ, Hutten S, Boisvert FM & Lamond AI 2010 The nucleolus under stress. Molecular Cell 40 216227. (https://doi.org/10.1016/j.molcel.2010.09.024)

    • Search Google Scholar
    • Export Citation
  • Brodská B, Holoubek A, Otevřelová P & Kuželová K 2016 Low-dose actinomycin-D induces redistribution of wild-type and mutated nucleophosmin followed by cell death in leukemic cells. Journal of Cellular Biochemistry 117 13191329. (https://doi.org/10.1002/jcb.25420)

    • Search Google Scholar
    • Export Citation
  • Brosens JJ, Salker MS, Teklenburg G, Nautiyal J, Salter S, Lucas ES, Steel JH, Christian M, Chan YW & Boomsma CM et al.2014 Uterine selection of human embryos at implantation. Scientific Reports 4 3894. (https://doi.org/10.1038/srep03894)

    • Search Google Scholar
    • Export Citation
  • Bywater MJ, Poortinga G, Sanij E, Hein N, Peck A, Cullinane C, Wall M, Cluse L, Drygin D & Anderes K et al.2012 Inhibition of RNA polymerase I as a therapeutic strategy to promote cancer-specific activation of p53. Cancer Cell 22 5165. (https://doi.org/10.1016/j.ccr.2012.05.019)

    • Search Google Scholar
    • Export Citation
  • Cakmak H & Taylor HS 2011 Implantation failure: molecular mechanisms and clinical treatment. Human Reproduction Update 17 242253. (https://doi.org/10.1093/humupd/dmq037)

    • Search Google Scholar
    • Export Citation
  • Camus M, Lejeune B & Leroy F 1979 Induction of implantation in the rat by intraparametrial injection of lo D. Biology of Reproduction 20 11151118. (https://doi.org/10.1095/biolreprod20.5.1115)

    • Search Google Scholar
    • Export Citation
  • Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, Del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Search Google Scholar
    • Export Citation
  • Carotenuto P, Pecoraro A, Palma G, Russo G & Russo A 2019 Therapeutic approaches targeting nucleolus in cancer. Cells 8 1090. (https://doi.org/10.3390/cells8091090)

    • Search Google Scholar
    • Export Citation
  • Chen J & Stark LA 2018 Crosstalk between NF-kappaB and nucleoli in the regulation of cellular homeostasis. Cells 7 E157. (https://doi.org/10.3390/cells7100157)

    • Search Google Scholar
    • Export Citation
  • De Clercq K, Hennes A & Vriens J 2017 Isolation of mouse endometrial epithelial and stromal cells for in vitro decidualization. Journal of Visualized Experiments 121 55168. (https://doi.org/10.3791/55168)

    • Search Google Scholar
    • Export Citation
  • Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T & Wang H 2004 Molecular cues to implantation. Endocrine Reviews 25 341373. (https://doi.org/10.1210/er.2003-0020)

    • Search Google Scholar
    • Export Citation
  • Ding NZ, Qi QR, Gu XW, Zuo RJ, Liu J & Yang ZM 2018 De novo synthesis of sphingolipids is essential for decidualization in mice. Theriogenology 106 227236. (https://doi.org/10.1016/j.theriogenology.2017.09.036)

    • Search Google Scholar
    • Export Citation
  • Finn CA & Downie JM 1975 Changes in the endometrium of mice after the induction of implantation by actinomycin D. The Journal of Endocrinology 65 259264. (https://doi.org/10.1677/joe.0.0650259)

    • Search Google Scholar
    • Export Citation
  • Franco HL, Dai D, Lee KY, Rubel CA, Roop D, Boerboom D, Jeong JW, Lydon JP, Bagchi IC & Bagchi MK et al.2011 WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB Journal 25 11761187. (https://doi.org/10.1096/fj.10-175349)

    • Search Google Scholar
    • Export Citation
  • Golstein P 2017 Conserved nucleolar stress at the onset of cell death. FEBS Journal 284 37913800. (https://doi.org/10.1111/febs.14095)

    • Search Google Scholar
    • Export Citation
  • Gu XW, Yan JQ, Dou HT, Liu J, Liu L, Zhao ML, Liang XH & Yang ZM 2016 Endoplasmic reticulum stress in mouse decidua during early pregnancy. Molecular and Cellular Endocrinology 434 4856. (https://doi.org/10.1016/j.mce.2016.06.012)

    • Search Google Scholar
    • Export Citation
  • Holmberg Olausson K, Nister M & Lindstrom MS 2012 p53-Dependent and -independent nucleolar stress responses. Cells 1 774798. (https://doi.org/10.3390/cells1040774)

    • Search Google Scholar
    • Export Citation
  • Hu W, Liang YX, Luo JM, Gu XW, Chen ZC, Fu T, Zhu YY, Lin S, Diao HL & Jia B et al.2019 Nucleolar stress regulation of endometrial receptivity in mouse models and human cell lines. Cell Death & Disease 10 831. (https://doi.org/10.1038/s41419-019-2071-6)

    • Search Google Scholar
    • Export Citation
  • James A, Wang Y, Raje H, Rosby R & Dimario P 2014 Nucleolar stress with and without p53. Nucleus 5 402426. (https://doi.org/10.4161/nucl.32235)

    • Search Google Scholar
    • Export Citation
  • Kim TH, Yoo JY, Choi KC, Shin JH, Leach RE, Fazleabas AT, Young SL, Lessey BA, Yoon HG & Jeong JW 2019 Loss of HDAC3 results in nonreceptive endometrium and female infertility. Science Translational Medicine 11 eaaf7533. (https://doi.org/10.1126/scitranslmed.aaf7533)

    • Search Google Scholar
    • Export Citation
  • Kimura F, Takakura K, Takebayashi K, Ishikawa H, Kasahara K, Goto S & Noda Y 2001 Messenger ribonucleic acid for the mouse decidual prolactin is present and induced during in vitro decidualization of endometrial stromal cells. Gynecological Endocrinology 15 426432. (https://doi.org/10.1080/gye.15.6.426.432)

    • Search Google Scholar
    • Export Citation
  • Lei W, Feng XH, Deng WB, Ni H, Zhang ZR, Jia B, Yang XL, Wang TS, Liu JL & Su RW et al.2012 Progesterone and DNA damage encourage uterine cell proliferation and decidualization through up-regulating ribonucleotide reductase 2 expression during early pregnancy in mice. Journal of Biological Chemistry 287 1517415192. (https://doi.org/10.1074/jbc.M111.308023)

    • Search Google Scholar
    • Export Citation
  • Lewinska A, Bednarz D, Adamczyk-Grochala J & Wnuk M 2017 Phytochemical-induced nucleolar stress results in the inhibition of breast cancer cell proliferation. Redox Biology 12 469482. (https://doi.org/10.1016/j.redox.2017.03.014)

    • Search Google Scholar
    • Export Citation
  • Li Q, Kannan A, Das A, Demayo FJ, Hornsby PJ, Young SL, Taylor RN, Bagchi MK & Bagchi IC 2013 WNT4 acts downstream of BMP2 and functions via beta-catenin signaling pathway to regulate human endometrial stromal cell differentiation. Endocrinology 154 446457. (https://doi.org/10.1210/en.2012-1585)

    • Search Google Scholar
    • Export Citation
  • Li X, Chen H, Liu Z, Ye Z, Gou S & Wang C 2018 Overexpression of MIST1 reverses the epithelial-mesenchymal transition and reduces the tumorigenicity of pancreatic cancer cells via the Snail/E-cadherin pathway. Cancer Letters 431 96104. (https://doi.org/10.1016/j.canlet.2018.05.043)

    • Search Google Scholar
    • Export Citation
  • Liang YX, Liu L, Jin ZY, Liang XH, Fu YS, Gu XW & Yang ZM 2018 The high concentration of progesterone is harmful for endometrial receptivity and decidualization. Scientific Reports 8 712. (https://doi.org/10.1038/s41598-017-18643-w)

    • Search Google Scholar
    • Export Citation
  • Loberg MA, Bell RK, Goodwin LO, Eudy E, Miles LA, Sanmiguel JM, Young K, Bergstrom DE, Levine RL & Schneider RK et al.2019 Sequentially inducible mouse models reveal that Npm1 mutation causes malignant transformation of Dnmt3a-mutant clonal hematopoiesis. Leukemia 33 16351649. (https://doi.org/10.1038/s41375-018-0368-6)

    • Search Google Scholar
    • Export Citation
  • Morris EJ & Geller HM 1996 Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity. The Journal of Cell Biology 134 757770. (https://doi.org/10.1083/jcb.134.3.757)

    • Search Google Scholar
    • Export Citation
  • Nishimura K, Kumazawa T, Kuroda T, Katagiri N, Tsuchiya M, Goto N, Furumai R, Murayama A, Yanagisawa J & Kimura K 2015 Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation. Cell Reports 10 13101323. (https://doi.org/10.1016/j.celrep.2015.01.055)

    • Search Google Scholar
    • Export Citation
  • Ou HL & Schumacher B 2018 DNA damage responses and p53 in the aging process. Blood 131 488495. (https://doi.org/10.1182/blood-2017-07-746396)

    • Search Google Scholar
    • Export Citation
  • Owusu-Akyaw A, Krishnamoorthy K, Goldsmith LT & Morelli SS 2019 The role of mesenchymal-epithelial transition in endometrial function. Human Reproduction Update 25 114133. (https://doi.org/10.1093/humupd/dmy035)

    • Search Google Scholar
    • Export Citation
  • Parlato R & Liss B 2014 How Parkinson’s disease meets nucleolar stress. Biochimica et Biophysica Acta 1842 791797. (https://doi.org/10.1016/j.bbadis.2013.12.014)

    • Search Google Scholar
    • Export Citation
  • Peng M, Ding Y, Yu L, Deng Y, Lai W, Hu Y, Zhang H, Wu X, Fan H & Ding H et al.2015 Tegafur substitution for 5-fu in combination with actinomycin D to treat gestational trophoblastic neoplasm. PLoS One 10 e0143531. (https://doi.org/10.1371/journal.pone.0143531)

    • Search Google Scholar
    • Export Citation
  • Qi W, Shakalya K, Stejskal A, Goldman A, Beeck S, Cooke L & Mahadevan D 2008 NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and induces apoptosis in human cancer cells. Oncogene 27 42104220. (https://doi.org/10.1038/onc.2008.54)

    • Search Google Scholar
    • Export Citation
  • Rutanen EM, Koistinen R, Wahlström T, Bohn H, Ranta T & Seppälä M 1985 Synthesis of placental protein 12 by human decidua. Endocrinology 116 13041309. (https://doi.org/10.1210/endo-116-4-1304)

    • Search Google Scholar
    • Export Citation
  • Schisterman EF, Mumford SL, Schliep KC, Sjaarda LA, Stanford JB, Lesher LL, Wactawski-Wende J, Lynch AM, Townsend JM & Perkins NJ et al.2015 Preconception low dose aspirin and time to pregnancy: findings from the effects of aspirin in gestation and reproduction randomized trial. The Journal of Clinical Endocrinology & Metabolism 100 17851791. (https://doi.org/10.1210/jc.2014-4179)

    • Search Google Scholar
    • Export Citation
  • Stewart CL, Kaspar P, Brunet LJ, Bhatt H, Gadi I, Kontgen F & Abbondanzo SJ 1992 Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359 7679. (https://doi.org/10.1038/359076a0)

    • Search Google Scholar
    • Export Citation
  • Suzuki A, Kogo R, Kawahara K, Sasaki M, Nishio M, Maehama T, Sasaki T, Mimori K & Mori M 2012 A new PICTure of nucleolar stress. Cancer Science 103 632637. (https://doi.org/10.1111/j.1349-7006.2012.02219.x)

    • Search Google Scholar
    • Export Citation
  • Yang K, Wang M, Zhao Y, Sun X, Yang Y, Li X, Zhou A, Chu H, Zhou H & Xu J et al.2016 A redox mechanism underlying nucleolar stress sensing by nucleophosmin. Nature Communications 7 13599. (https://doi.org/10.1038/ncomms13599)

    • Search Google Scholar
    • Export Citation
  • Yang K, Yang J & Yi J 2018 Nucleolar stress: hallmarks, sensing mechanism and diseases. Cell Stress 2 125140. (https://doi.org/10.15698/cst2018.06.139)

    • Search Google Scholar
    • Export Citation
  • Zhang XH, Liang X, Liang XH, Wang TS, Qi QR, Deng WB, Sha AG & Yang ZM 2013 The mesenchymal-epithelial transition during in vitro decidualization. Reproductive Sciences 20 354360. (https://doi.org/10.1177/1933719112472738)

    • Search Google Scholar
    • Export Citation
  • Zhang Y & Lu H 2009 Signaling to p53: ribosomal proteins find their way. Cancer Cell 16 369377. (https://doi.org/10.1016/j.ccr.2009.09.024)

    • Search Google Scholar
    • Export Citation
  • Zhang Z, Ren Z, Chen S, Guo X, Liu F, Guo L & Mei N 2018 ROS generation and JNK activation contribute to 4-methoxy-TEMPO-induced cytotoxicity, autophagy, and DNA damage in HepG2 cells. Archives of Toxicology 92 717728. (https://doi.org/10.1007/s00204-017-2084-9)

    • Search Google Scholar
    • Export Citation
  • Zuo RJ, Gu XW, Qi QR, Wang TS, Zhao XY, Liu JL & Yang ZM 2015 Warburg-like glycolysis and lactate shuttle in mouse decidua during early pregnancy. Journal of Biological Chemistry 290 2128021291. (https://doi.org/10.1074/jbc.M115.656629)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    Nucleolar stress is induced in mouse stromal cells by low-dose ActD. (A) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (B) Western blot analysis of P53 protein in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Tubulin was used as a loading control. (C) Confocal images of NPM1 fluorescence in stromal cells treated with DMSO or 7.5 nM ActD for 3 days. Bar = 20 μm. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P  < 0.05.

  • View in gallery
    Figure 2

    ActD-induced nucleolar stress promotes stromal–epithelial transition in mouse in vitro decidualization. (A) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 2 and 3 days. (B) Real-time PCR analysis of Lif and Wnt4 mRNA levels in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (C) Western blot analysis of the Snail protein in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Tubulin was used as a loading control. (D) Real-time PCR analysis of Bhlha15 mRNA level in stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. (E) The morphology of stromal cells treated with DMSO (control), 7.5 or 12.5 nM ActD for 3 days. Bar = 100 μm. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

  • View in gallery
    Figure 3

    NPM1 is indispensable during mouse decidualization. (A) The morphology of implantation sites on day 8 following NSC348884 treatment from days 4 to 7 of pregnancy. (B) The morphology of deciduoma on day 8 following NSC348884 treatment from days 4 to 7 of pseudopregnancy. (C) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with Npm1 siRNA under in vitro decidualization for 24 h. (D) Real-time PCR analysis of Prl8a2 mRNA level in stromal cells treated with NSC348884 (2 μM) under in vitro decidualization for 3 days. The real-time values are normalized to Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

  • View in gallery
    Figure 4

    Nucleolar stress in stromal cells is stimulated by DNA damage and oxidative stress. (A) NPM1 immunofluorescence after stromal cells were treated with 10 μM CPT for 12 h. Bar = 25 μm. (B) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in CPT-treated stromal cells. (C) Western blot analysis of P53 and p-H2AX proteins in CPT-treated stromal cells. β-Actin was used as a loading control. (D) NPM1 immunofluorescence after stromal cells were treated with 250 μM H2O2 for 2 h. Bar = 25 μm. (E) Real-time PCR analysis of Its1, p21 and Mdm2 mRNA levels in H2O2-treated stromal cells. (F) Western blot analysis of P53 protein in H2O2-treated stromal cells. Tubulin was used as a loading control. The real-time values are normalized to the Rpl7 expression level and indicated as the mean ± s.e.m. n = 3. *P < 0.05.

  • View in gallery
    Figure 5

    Nucleolar stress promotes stromal–epithelial transition in human decidualization. (A) The mRNA expression of IGFBP1 in human stromal cells treated with DMSO (control) or 3.5 nM ActD during the condition of in vitro decidualization for 6 days. (B) The morphological changes after stromal cells were treated with DMSO (control) or 3.5 nM ActD. Bar = 50 μm. (C) The protein expression of P53, Snail and E-Cadherin in human stromal cells treated with DMSO (control) or 3.5 nM ActD for 48 h. (D) NPM1 immunofluorescence in human stromal cells treated with DMSO (control) or 3.5 nM ActD for 48 h. Bar = 5 μm; n = 3; *P < 0.05.

  • Agarwal A, Gupta S & Sharma RK 2005 Role of oxidative stress in female reproduction. Reproductive Biology and Endocrinology 3 28. (https://doi.org/10.1186/1477-7827-3-28)

    • Search Google Scholar
    • Export Citation
  • Al-Sabbagh M, Fusi L, Higham J, Lee Y, Lei K, Hanyaloglu AC, Lam EW, Christian M & Brosens JJ 2011 NADPH oxidase-derived reactive oxygen species mediate decidualization of human endometrial stromal cells in response to cyclic AMP signaling. Endocrinology 152 730740. (https://doi.org/10.1210/en.2010-0899)

    • Search Google Scholar
    • Export Citation
  • Avitabile D, Bailey B, Cottage CT, Sundararaman B, Joyo A, Mcgregor M, Gude N, Truffa S, Zarrabi A & Konstandin M et al.2011 Nucleolar stress is an early response to myocardial damage involving nucleolar proteins nucleostemin and nucleophosmin. PNAS 108 61456150. (https://doi.org/10.1073/pnas.1017935108)

    • Search Google Scholar
    • Export Citation
  • Bhat KP, Itahana K, Jin A & Zhang Y 2004 Essential role of ribosomal protein L11 in mediating growth inhibition-induced p53 activation. The EMBO Journal 23 24022412. (https://doi.org/10.1038/sj.emboj.7600247)

    • Search Google Scholar
    • Export Citation
  • Bonner WM, Redon CE, Dickey JS, Nakamura AJ, Sedelnikova OA, Solier S & Pommier Y 2008 GammaH2AX and cancer. Nature Reviews: Cancer 8 957967. (https://doi.org/10.1038/nrc2523)

    • Search Google Scholar
    • Export Citation
  • Boulon S, Westman BJ, Hutten S, Boisvert FM & Lamond AI 2010 The nucleolus under stress. Molecular Cell 40 216227. (https://doi.org/10.1016/j.molcel.2010.09.024)

    • Search Google Scholar
    • Export Citation
  • Brodská B, Holoubek A, Otevřelová P & Kuželová K 2016 Low-dose actinomycin-D induces redistribution of wild-type and mutated nucleophosmin followed by cell death in leukemic cells. Journal of Cellular Biochemistry 117 13191329. (https://doi.org/10.1002/jcb.25420)

    • Search Google Scholar
    • Export Citation
  • Brosens JJ, Salker MS, Teklenburg G, Nautiyal J, Salter S, Lucas ES, Steel JH, Christian M, Chan YW & Boomsma CM et al.2014 Uterine selection of human embryos at implantation. Scientific Reports 4 3894. (https://doi.org/10.1038/srep03894)

    • Search Google Scholar
    • Export Citation
  • Bywater MJ, Poortinga G, Sanij E, Hein N, Peck A, Cullinane C, Wall M, Cluse L, Drygin D & Anderes K et al.2012 Inhibition of RNA polymerase I as a therapeutic strategy to promote cancer-specific activation of p53. Cancer Cell 22 5165. (https://doi.org/10.1016/j.ccr.2012.05.019)

    • Search Google Scholar
    • Export Citation
  • Cakmak H & Taylor HS 2011 Implantation failure: molecular mechanisms and clinical treatment. Human Reproduction Update 17 242253. (https://doi.org/10.1093/humupd/dmq037)

    • Search Google Scholar
    • Export Citation
  • Camus M, Lejeune B & Leroy F 1979 Induction of implantation in the rat by intraparametrial injection of lo D. Biology of Reproduction 20 11151118. (https://doi.org/10.1095/biolreprod20.5.1115)

    • Search Google Scholar
    • Export Citation
  • Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, Del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Search Google Scholar
    • Export Citation
  • Carotenuto P, Pecoraro A, Palma G, Russo G & Russo A 2019 Therapeutic approaches targeting nucleolus in cancer. Cells 8 1090. (https://doi.org/10.3390/cells8091090)

    • Search Google Scholar
    • Export Citation
  • Chen J & Stark LA 2018 Crosstalk between NF-kappaB and nucleoli in the regulation of cellular homeostasis. Cells 7 E157. (https://doi.org/10.3390/cells7100157)

    • Search Google Scholar
    • Export Citation
  • De Clercq K, Hennes A & Vriens J 2017 Isolation of mouse endometrial epithelial and stromal cells for in vitro decidualization. Journal of Visualized Experiments 121 55168. (https://doi.org/10.3791/55168)

    • Search Google Scholar
    • Export Citation
  • Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T & Wang H 2004 Molecular cues to implantation. Endocrine Reviews 25 341373. (https://doi.org/10.1210/er.2003-0020)

    • Search Google Scholar
    • Export Citation
  • Ding NZ, Qi QR, Gu XW, Zuo RJ, Liu J & Yang ZM 2018 De novo synthesis of sphingolipids is essential for decidualization in mice. Theriogenology 106 227236. (https://doi.org/10.1016/j.theriogenology.2017.09.036)

    • Search Google Scholar
    • Export Citation
  • Finn CA & Downie JM 1975 Changes in the endometrium of mice after the induction of implantation by actinomycin D. The Journal of Endocrinology 65 259264. (https://doi.org/10.1677/joe.0.0650259)

    • Search Google Scholar
    • Export Citation
  • Franco HL, Dai D, Lee KY, Rubel CA, Roop D, Boerboom D, Jeong JW, Lydon JP, Bagchi IC & Bagchi MK et al.2011 WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB Journal 25 11761187. (https://doi.org/10.1096/fj.10-175349)

    • Search Google Scholar
    • Export Citation
  • Golstein P 2017 Conserved nucleolar stress at the onset of cell death. FEBS Journal 284 37913800. (https://doi.org/10.1111/febs.14095)

    • Search Google Scholar
    • Export Citation
  • Gu XW, Yan JQ, Dou HT, Liu J, Liu L, Zhao ML, Liang XH & Yang ZM 2016 Endoplasmic reticulum stress in mouse decidua during early pregnancy. Molecular and Cellular Endocrinology 434 4856. (https://doi.org/10.1016/j.mce.2016.06.012)

    • Search Google Scholar
    • Export Citation
  • Holmberg Olausson K, Nister M & Lindstrom MS 2012 p53-Dependent and -independent nucleolar stress responses. Cells 1 774798. (https://doi.org/10.3390/cells1040774)

    • Search Google Scholar
    • Export Citation
  • Hu W, Liang YX, Luo JM, Gu XW, Chen ZC, Fu T, Zhu YY, Lin S, Diao HL & Jia B et al.2019 Nucleolar stress regulation of endometrial receptivity in mouse models and human cell lines. Cell Death & Disease 10 831. (https://doi.org/10.1038/s41419-019-2071-6)

    • Search Google Scholar
    • Export Citation
  • James A, Wang Y, Raje H, Rosby R & Dimario P 2014 Nucleolar stress with and without p53. Nucleus 5 402426. (https://doi.org/10.4161/nucl.32235)

    • Search Google Scholar
    • Export Citation
  • Kim TH, Yoo JY, Choi KC, Shin JH, Leach RE, Fazleabas AT, Young SL, Lessey BA, Yoon HG & Jeong JW 2019 Loss of HDAC3 results in nonreceptive endometrium and female infertility. Science Translational Medicine 11 eaaf7533. (https://doi.org/10.1126/scitranslmed.aaf7533)

    • Search Google Scholar
    • Export Citation
  • Kimura F, Takakura K, Takebayashi K, Ishikawa H, Kasahara K, Goto S & Noda Y 2001 Messenger ribonucleic acid for the mouse decidual prolactin is present and induced during in vitro decidualization of endometrial stromal cells. Gynecological Endocrinology 15 426432. (https://doi.org/10.1080/gye.15.6.426.432)

    • Search Google Scholar
    • Export Citation
  • Lei W, Feng XH, Deng WB, Ni H, Zhang ZR, Jia B, Yang XL, Wang TS, Liu JL & Su RW et al.2012 Progesterone and DNA damage encourage uterine cell proliferation and decidualization through up-regulating ribonucleotide reductase 2 expression during early pregnancy in mice. Journal of Biological Chemistry 287 1517415192. (https://doi.org/10.1074/jbc.M111.308023)

    • Search Google Scholar
    • Export Citation
  • Lewinska A, Bednarz D, Adamczyk-Grochala J & Wnuk M 2017 Phytochemical-induced nucleolar stress results in the inhibition of breast cancer cell proliferation. Redox Biology 12 469482. (https://doi.org/10.1016/j.redox.2017.03.014)

    • Search Google Scholar
    • Export Citation
  • Li Q, Kannan A, Das A, Demayo FJ, Hornsby PJ, Young SL, Taylor RN, Bagchi MK & Bagchi IC 2013 WNT4 acts downstream of BMP2 and functions via beta-catenin signaling pathway to regulate human endometrial stromal cell differentiation. Endocrinology 154 446457. (https://doi.org/10.1210/en.2012-1585)

    • Search Google Scholar
    • Export Citation
  • Li X, Chen H, Liu Z, Ye Z, Gou S & Wang C 2018 Overexpression of MIST1 reverses the epithelial-mesenchymal transition and reduces the tumorigenicity of pancreatic cancer cells via the Snail/E-cadherin pathway. Cancer Letters 431 96104. (https://doi.org/10.1016/j.canlet.2018.05.043)

    • Search Google Scholar
    • Export Citation
  • Liang YX, Liu L, Jin ZY, Liang XH, Fu YS, Gu XW & Yang ZM 2018 The high concentration of progesterone is harmful for endometrial receptivity and decidualization. Scientific Reports 8 712. (https://doi.org/10.1038/s41598-017-18643-w)

    • Search Google Scholar
    • Export Citation
  • Loberg MA, Bell RK, Goodwin LO, Eudy E, Miles LA, Sanmiguel JM, Young K, Bergstrom DE, Levine RL & Schneider RK et al.2019 Sequentially inducible mouse models reveal that Npm1 mutation causes malignant transformation of Dnmt3a-mutant clonal hematopoiesis. Leukemia 33 16351649. (https://doi.org/10.1038/s41375-018-0368-6)

    • Search Google Scholar
    • Export Citation
  • Morris EJ & Geller HM 1996 Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity. The Journal of Cell Biology 134 757770. (https://doi.org/10.1083/jcb.134.3.757)

    • Search Google Scholar
    • Export Citation
  • Nishimura K, Kumazawa T, Kuroda T, Katagiri N, Tsuchiya M, Goto N, Furumai R, Murayama A, Yanagisawa J & Kimura K 2015 Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation. Cell Reports 10 13101323. (https://doi.org/10.1016/j.celrep.2015.01.055)

    • Search Google Scholar
    • Export Citation
  • Ou HL & Schumacher B 2018 DNA damage responses and p53 in the aging process. Blood 131 488495. (https://doi.org/10.1182/blood-2017-07-746396)

    • Search Google Scholar
    • Export Citation
  • Owusu-Akyaw A, Krishnamoorthy K, Goldsmith LT & Morelli SS 2019 The role of mesenchymal-epithelial transition in endometrial function. Human Reproduction Update 25 114133. (https://doi.org/10.1093/humupd/dmy035)

    • Search Google Scholar
    • Export Citation
  • Parlato R & Liss B 2014 How Parkinson’s disease meets nucleolar stress. Biochimica et Biophysica Acta 1842 791797. (https://doi.org/10.1016/j.bbadis.2013.12.014)

    • Search Google Scholar
    • Export Citation
  • Peng M, Ding Y, Yu L, Deng Y, Lai W, Hu Y, Zhang H, Wu X, Fan H & Ding H et al.2015 Tegafur substitution for 5-fu in combination with actinomycin D to treat gestational trophoblastic neoplasm. PLoS One 10 e0143531. (https://doi.org/10.1371/journal.pone.0143531)

    • Search Google Scholar
    • Export Citation
  • Qi W, Shakalya K, Stejskal A, Goldman A, Beeck S, Cooke L & Mahadevan D 2008 NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and induces apoptosis in human cancer cells. Oncogene 27 42104220. (https://doi.org/10.1038/onc.2008.54)

    • Search Google Scholar
    • Export Citation
  • Rutanen EM, Koistinen R, Wahlström T, Bohn H, Ranta T & Seppälä M 1985 Synthesis of placental protein 12 by human decidua. Endocrinology 116 13041309. (https://doi.org/10.1210/endo-116-4-1304)

    • Search Google Scholar
    • Export Citation
  • Schisterman EF, Mumford SL, Schliep KC, Sjaarda LA, Stanford JB, Lesher LL, Wactawski-Wende J, Lynch AM, Townsend JM & Perkins NJ et al.2015 Preconception low dose aspirin and time to pregnancy: findings from the effects of aspirin in gestation and reproduction randomized trial. The Journal of Clinical Endocrinology & Metabolism 100 17851791. (https://doi.org/10.1210/jc.2014-4179)

    • Search Google Scholar
    • Export Citation
  • Stewart CL, Kaspar P, Brunet LJ, Bhatt H, Gadi I, Kontgen F & Abbondanzo SJ 1992 Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359 7679. (https://doi.org/10.1038/359076a0)

    • Search Google Scholar
    • Export Citation
  • Suzuki A, Kogo R, Kawahara K, Sasaki M, Nishio M, Maehama T, Sasaki T, Mimori K & Mori M 2012 A new PICTure of nucleolar stress. Cancer Science 103 632637. (https://doi.org/10.1111/j.1349-7006.2012.02219.x)

    • Search Google Scholar
    • Export Citation
  • Yang K, Wang M, Zhao Y, Sun X, Yang Y, Li X, Zhou A, Chu H, Zhou H & Xu J et al.2016 A redox mechanism underlying nucleolar stress sensing by nucleophosmin. Nature Communications 7 13599. (https://doi.org/10.1038/ncomms13599)

    • Search Google Scholar
    • Export Citation
  • Yang K, Yang J & Yi J 2018 Nucleolar stress: hallmarks, sensing mechanism and diseases. Cell Stress 2 125140. (https://doi.org/10.15698/cst2018.06.139)

    • Search Google Scholar
    • Export Citation
  • Zhang XH, Liang X, Liang XH, Wang TS, Qi QR, Deng WB, Sha AG & Yang ZM 2013 The mesenchymal-epithelial transition during in vitro decidualization. Reproductive Sciences 20 354360. (https://doi.org/10.1177/1933719112472738)

    • Search Google Scholar
    • Export Citation
  • Zhang Y & Lu H 2009 Signaling to p53: ribosomal proteins find their way. Cancer Cell 16 369377. (https://doi.org/10.1016/j.ccr.2009.09.024)

    • Search Google Scholar
    • Export Citation
  • Zhang Z, Ren Z, Chen S, Guo X, Liu F, Guo L & Mei N 2018 ROS generation and JNK activation contribute to 4-methoxy-TEMPO-induced cytotoxicity, autophagy, and DNA damage in HepG2 cells. Archives of Toxicology 92 717728. (https://doi.org/10.1007/s00204-017-2084-9)

    • Search Google Scholar
    • Export Citation
  • Zuo RJ, Gu XW, Qi QR, Wang TS, Zhao XY, Liu JL & Yang ZM 2015 Warburg-like glycolysis and lactate shuttle in mouse decidua during early pregnancy. Journal of Biological Chemistry 290 2128021291. (https://doi.org/10.1074/jbc.M115.656629)

    • Search Google Scholar
    • Export Citation