FGF2/FGFR signaling promotes cumulus–oocyte complex maturation in vitro

in Reproduction
Authors:
Chao DuKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Chao Du in
Current site
Google Scholar
PubMed
Close
,
John S DavisOlson Center for Women’s Health, Department of Obstetrics and Gynecology, University of Nebraska Medical Center, Omaha, Nebraska, USA
Omaha Veterans Affairs Medical Center, Omaha, Nebraska, USA

Search for other papers by John S Davis in
Current site
Google Scholar
PubMed
Close
,
Chao ChenKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Chao Chen in
Current site
Google Scholar
PubMed
Close
,
Zan LiKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Zan Li in
Current site
Google Scholar
PubMed
Close
,
Ye CaoKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Ye Cao in
Current site
Google Scholar
PubMed
Close
,
Hui SunKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Hui Sun in
Current site
Google Scholar
PubMed
Close
,
Bao-Shun ShaoKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Bao-Shun Shao in
Current site
Google Scholar
PubMed
Close
,
Yu-Xin LinKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Yu-Xin Lin in
Current site
Google Scholar
PubMed
Close
,
Yong-Sheng WangKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Yong-Sheng Wang in
Current site
Google Scholar
PubMed
Close
,
Li-Guo YangKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Li-Guo Yang in
Current site
Google Scholar
PubMed
Close
, and
Guo-Hua HuaKey Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan, China
College of Animal Science and Technology of Huazhong Agricultural University, Wuhan, China

Search for other papers by Guo-Hua Hua in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to G-H Hua; Email: huaguohua09@gmail.com
Free access

Fibroblast growth factor 2 (FGF2), a member of FGF family, binds with FGF receptors (FGFR) to initiate biological functions in various somatic cells. However, little is known regarding the role of FGF2/FGFR on oocyte meiosis. In this study, we investigated expression patterns and functions of FGF2/FGFR during in vitro maturation (IVM) of mouse cumulus-oocyte complexes (COCs). Among four FGFRs, Ffgr1 was the most abundant in COCs. The transcripts for Fgf2 and Ffgr1 in COCs increased during IVM. Ffgr1 was present in oocytes and cumulus cells, while Fgf2 was present in only cumulus cells. Treatment of COCs with the selective FGFR inhibitor SU5402 blocked oocyte meiotic progression and downregulated expression of Bmp15 and Gdf9. In contrast, supplement of FGF2 promoted oocyte meiotic progression and upregulated Bmp15 and Gdf9 expression. Inhibition of FGFR with SU5402 reduced cumulus expansion and expressions of Ptx3, Has2 and Tnfaip6. Treatment with FGF2 increased Ptx3 and Has2 expression. Inhibition of FGFR had no effect on meiotic progression of denuded oocytes (DOs). However, co-culture of DOs with COCs or supplementation with FGF2 promoted meiotic progression of DOs. Inhibition of FGF2/FGFR signaling also downregulated Ffgr1 expression, while supplemental FGF2 upregulated Fgfr1 expression. Furthermore, inhibition of FGFR in COCs interrupted the c-Mos/MAPK pathway and maturation-promoting factor (MPF), as indicated by downregulation of oocyte c-mos and Ccnb1 transcripts, respectively. Overall, this study suggests that FGF2 produced by cumulus cells, activates a FGF2/FGFR autocrine/paracrine loop within COCs to regulate cumulus expansion and oocyte meiosis. These findings reveal a novel role for FGF2/FGFR signaling during in vitro maturation of COCs.

Abstract

Fibroblast growth factor 2 (FGF2), a member of FGF family, binds with FGF receptors (FGFR) to initiate biological functions in various somatic cells. However, little is known regarding the role of FGF2/FGFR on oocyte meiosis. In this study, we investigated expression patterns and functions of FGF2/FGFR during in vitro maturation (IVM) of mouse cumulus-oocyte complexes (COCs). Among four FGFRs, Ffgr1 was the most abundant in COCs. The transcripts for Fgf2 and Ffgr1 in COCs increased during IVM. Ffgr1 was present in oocytes and cumulus cells, while Fgf2 was present in only cumulus cells. Treatment of COCs with the selective FGFR inhibitor SU5402 blocked oocyte meiotic progression and downregulated expression of Bmp15 and Gdf9. In contrast, supplement of FGF2 promoted oocyte meiotic progression and upregulated Bmp15 and Gdf9 expression. Inhibition of FGFR with SU5402 reduced cumulus expansion and expressions of Ptx3, Has2 and Tnfaip6. Treatment with FGF2 increased Ptx3 and Has2 expression. Inhibition of FGFR had no effect on meiotic progression of denuded oocytes (DOs). However, co-culture of DOs with COCs or supplementation with FGF2 promoted meiotic progression of DOs. Inhibition of FGF2/FGFR signaling also downregulated Ffgr1 expression, while supplemental FGF2 upregulated Fgfr1 expression. Furthermore, inhibition of FGFR in COCs interrupted the c-Mos/MAPK pathway and maturation-promoting factor (MPF), as indicated by downregulation of oocyte c-mos and Ccnb1 transcripts, respectively. Overall, this study suggests that FGF2 produced by cumulus cells, activates a FGF2/FGFR autocrine/paracrine loop within COCs to regulate cumulus expansion and oocyte meiosis. These findings reveal a novel role for FGF2/FGFR signaling during in vitro maturation of COCs.

Introduction

Fibroblast growth factor 2 (FGF2), also known as a basic fibroblast growth factor (bFGF), is a canonical member of FGF family (Ornitz & Itoh 2015). FGF2 promotes follicular development in multiple species including the goat (Almeida et al. 2012), sheep (Santos et al. 2014), and macaque (Lu et al. 2015). Additionally, Mondal et al (2015) reported that supplementation of maturation medium with FGF2 significantly increased the maturation rate of ovine COCs. Barros et al. (2019) suggested that the addition of FGF2 to IVM medium increased the percentage of oocytes reaching GVBD. The addition of FGF2 improved the efficiency of producing matured oocytes of pig (Yuan et al. 2017). Abouzaripour et al (2018) indicated that the addition of FGF2 to the medium had beneficial effects on the IVM of mouse oocyte. Moreover, FGF2 could also improve early embryonic development (Zhang & Ealy 2012a, Abouzaripour et al. 2018). Collectively, these studies show that FGF2 can promote oocyte maturation; however, the cell types and underlying mechanisms of FGF/FGFR regulation of oocyte meiosis remain unclear.

The biological functions of canonical FGFs are mediated by interactions with transmembrane receptors known as FGF receptors (FGFRs) (Zhang & Ealy 2012b). The FGFRs are tyrosine kinase receptors (TRKs) that are derived from four genes, namely Ffgr1, Fgfr2, Fgfr3, and Fgfr4 (Price 2016). FGF2 is expressed in caprine follicles (Almeida et al. 2012), in bovine cumulus cells (Barros et al. 2019), and in ovine oocytes and embryos (Santos et al. 2014, Mor et al. 2018). FGFR1, FGFR2, and FGFR3 are expressed in mouse oocytes and embryos (Lu et al. 2010). Previous studies demonstrate that FGF2 binds to and activates FGFR1 to carry out its diverse physiological functions in target tissues. For example, FGF2 promotes the proliferation of ovarian granulosa cells and germ cells through the activation of FGFR1 (He et al. 2012, Lin et al. 2012). Collectively, these findings implicate FGF2 and FGFR in follicular development and oocyte maturation in mammals. However, the expression patterns of the ligand (FGF2) and receptors (FGFRs) in murine cumulus-oocyte complexes (COCs) have not been established. Furthermore, the role of paracrine trafficking of FGF2 between cumulus cells (CCs) and oocytes on oocyte meiosis has not been examined.

In the present study, mouse COCs, and isolated oocytes and cumulus cells, were employed to further explore the functions of FGF2/FGFR signaling on COCs during in vitro maturation (IVM). Specific objectives were to: 1) illuminate the expression patterns of FGF2 and FGFRs in COCs, 2) determine the effects of FGF2/FGFR signaling on oocyte meiosis and cumulus expansion, and 3) explore the possible mechanisms by which FGF2/FGFR signaling regulates oocyte in vitro maturation.

Materials and methods

Chemicals

The chemicals used in this study included FGF2 (Peprotech, USA), α-MEM (Gibco), M2 medium (Sigma), SU5402 (MCE, USA), penicillin–streptomycin (P/S) (Gibco), BSA (Genview, USA), PMSG (Sansheng, China), HCG (Sansheng, China), EGF (Peprotech, USA), sodium pyruvate (Sigma), and mineral oil (embryo-tested) (Sigma).

Animals

Female Kunming white mice (3 weeks old) were purchased from local Central Animal Laboratory (Wuhan, China). All mice were maintained under 12 h darkness:12 h light cycle with food and water supplied ad libitum at Huazhong Agricultural University animal facility. The animal handling procedures and all experimental protocols were approved by the Huazhong Agricultural University Animal Care and Use Committee (HZAUMO-2017-025).

Cumulus-oocyte complexes (COCs) collection

Female mice at 3 weeks of age were given an intraperitoneal injection of 10IU PMSG in sterile saline. After 46–48 h mice were euthanized by cervical dislocation. COCs were retrieved from ovaries by puncturing the follicles with needles in M2 medium. Only COCs containing compact cumulus cells were used for experiments. For experiments using denuded oocytes (DOs), the COCs were denuded of their cumulus cells mechanically by repeated pipetting using a fine-bore glass pipette in 0.1% hyaluronidase.

In vitro maturation (IVM)

The COCs were washed three times in maturation medium containing α-MEM supplemented with 1 IU/mL PMSG, 2 IU/mL HCG, 20 ng/mL EGF, 75 μg/mL penicillin, 50 μg/mL streptomycin, 0.2 mM sodium pyruvate and 3 mg/mL BSA. Then, 30–50 COCs were randomly allocated to each drop containing 80 μL of the appropriate culture medium covered with mineral oil and maintained at 37°C in 5% CO2 for 4 h or 14 h in vitro (Fig. 1A). The extent of meiosis in the oocytes was determined based on the ratio of germinal vesicle breakdown (GVBD) and the first polar body extrusion (PBE) (Liu et al. 2018, Rong et al. 2019). The maturation rate was calculated as the number of oocytes extruding the first polar body divided by the total number of oocytes cultured.

Figure 1
Figure 1

(A) Experimental design. (B) Identification of different stages of oocyte during in vitro maturation. Left panel: GV stage, with visible nucleus. Middle panel: GVBD stage, with disappearance of nucleus. Right panel: MII/maturation stage, with visible the first polar body.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

Treatment with FGF2 or the selective FGFR inhibitor SU5402

FGF2 was dissolved in ddH2O to prepare a 100 μg/mL stock solution and stored at −20°C before use. At the beginning of each culture, the stock solution was diluted with maturation medium to achieve a final concentration of 0, 1, 10, and 100 ng/mL FGF2. SU5402, a selective FGFR inhibitor, was dissolved in dimethyl sulfoxide (DMSO) and stored at 4°C. At the beginning of each culture, the stock solution was diluted with maturation medium to achieve a final working concentration of 0, 5, 10, and 20 μM SU5402. The final DMSO concentration was less than 0.2%, which was determined to have no effect on the COCs in vitro maturation (Soto-Heras et al. 2019).

Assessment of the cumulus expansion and oocyte nuclear stage

After IVM, COCs were photographed with an inverted microscope, and the area of cumulus expansion was measured using Image J software. Subsequently, COCs were denuded of their cumulus cells using the method as mentioned previously, and then oocyte were classified as germinal vesicle (GV), germinal vesicle breakdown (GVBD) and metaphase II (MII). GVBD was determined visually by the disappearance of the oocyte nucleus, and the oocyte with visible the first polar body extrusion (PBE) was considered as a matured oocyte (metaphase II) (Fig. 1B).

Total RNA extraction and cDNA synthesis

Total RNA was extracted from mouse COCs (n = 120), DOs (n = 120), and cumulus cells (CCs, harvested from 120 COCs). Before or after IVM, COCs were collected, washed three times in PBS, and then transferred to a tube containing lysis buffer for RNA extraction. For experiments of extracting RNA from DOs and CCs separately, oocytes were denuded from cumulus cells using the method as mentioned previously, and then the resultant DOs and CCs were separately transferred into lysis buffer. All samples were stored at −80°C until RNA extraction. Total RNA was extracted using RNAprep Pure Micro Kit (Qiagen) in accordance with the manufacture’s instructions. First-strand cDNA was generated using the cDNA synthesis kit (Thermo) following the manufacturer’s guidelines.

Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)

To quantify RNA expression, sequence-specific primers were designed and synthesized by TSINGKE Biological Technology (Wuhan, China). Primer sequences were summarized in Table 1. Actb was selected as a reference gene (Acuna-Hernández et al. 2018). Real-time qPCR was performed using the CFX96 detection system (Bio-Rad) with SYBR Green (Qiagen) with the following program steps: 95°C for 2 min followed by 40 cycles of 95°C for 10 s, and 58°C for 30 s. The temperature was then gradually increased (0.5°C/s) to 95°C to generate the melting curve. For each group, qRT-PCR was performed in triplicate. Relative gene expression was calculated by the 2−ΔΔCt method.

Table 1

Primer sequences of genes used for quantitative RT-PCR.

Primers Primer sequences (5’ → 3’) Annealing temperature (°C) Fragment length (bp)
Forward Reverse
Fgf2 GAGAAGAGCGACCCACACG CACACTTAGAAGCCAGCAGC 58 130
Fgfr1 GGAGAAAGAGACGGACAACAC GTCAGAAGGCACCACAGAATC 58 256
Fgfr2 GCCTCTCGAACAGTATTCTCCT ACAGGGTTCATAAGGCATGGG 58 103
Fgfr3 GGAGGACGTGGCTGAAGAC GGAGCTTGATGCCCCCAAT 58 197
Fgfr4 TCCATGACCGTCGTACACAAT ATTTGACAGTATTCCCGGCAG 58 193
Bmp15 GAAAATGGTGAGGCTGGTAAAG AGATGAAGTTGATGGCGGTAAA 58 153
Gdf9 TGGAACACTTGCTCAAATCGG GACATGGCCTCCTTTACCACA 58 106
Ptx3 TTTGGAAGCGTGCATCCTGT GTTCTCCTTTCCACCCACCA 58 186
Tnfaip6 GCTCAACAGGAGTGAGCGAT CTGACCGTACTTGAGCCGAA 58 166
Has2 GACGACAGGCACCTTACCAA TGCTGGTTCAGCCATCTCAG 58 116
Ccnb1 GGAAATTCTTGACAACGGTG TGCCTTTGTCACGGCCTTAG 58 222
c-mos GCGTGTACGTGCCCCCTATGTGGT CACGCGCACGCCCGAAGACT 58 334
Actb CACGATGGAGGGGCCGGACTCATC TAAAGACCTCTATGCCAACACAGT 58 240

Statistical analysis

Data sets were presented as the mean ± s.e.m. of at least three independent experiments. Data were analyzed using t-tests between two groups, and comparisons between three or more groups were made using one-way ANOVA followed by Tukey’s multiple comparison tests. P < 0.05 was considered statistically significant.

Results

The expression patterns of FGF2 and FGFRs during COCs in vitro maturation

The expression levels of the four FGFRs in COCs were determined using qRT-PCR. Fgfr1 expression level was the most abundant among the four FGF receptors. The Fgfr1 expression level was 6500-, 150-, and 18,000-fold higher than Fgfr2, Fgfr3, and Fgfr4, respectively (Fig. 2A). To detect the expression profile of Fgfr1 in COCs during IVM, we examined the expression of Fgfr1 mRNA at three different time points, including 0, 4, and 14 h. The relative expression level of Fgfr1 mRNA in COCs increased approximately four-fold at 4 and 14 h, compared with 0 h (Fig. 2B). Fgf2 mRNA showed a similar pattern of expression as Fgfr1 in COCs during IVM (Fig. 2C). To determine which cell express Fgf2 and Fgfr1, cumulus cells and oocytes were harvested from pool of COCs, RNA was extracted, and Fgf2 and Fgfr1 expression was examined in each cell type. The results showed that Fgfr1 mRNA was expressed in both oocytes and cumulus cells, while Fgf2 mRNA was only present in cumulus cells (Fig. 2D).

Figure 2
Figure 2

The expression patterns of FGF2 and FGFRs during COCs in vitro maturation. (A) qRT-PCR analysis of four Fgfrs expression levels in COCs in GV stage. Data are presented as means ± s.e.m. relative to Actb. (B and C) The relative expression levels of Fgfr1 and Fgf2 mRNA in COCs at 0, 4, and 14 h of IVM. Bars with different letters are significantly different (P < 0.05). (D) RT-PCR analysis of Fgf2 and Fgfr1 expression in oocyte and cumulus cells from GV stage. Actb was used as reference gene.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

FGF2/FGFR signaling regulates oocyte meiotic progression

To study whether FGF2 and FGFR interaction affect oocyte meiotic progression, we employed SU5402, a well-studied FGFR tyrosine kinase inhibitor (Fields et al. 2011, Zhang & Ealy 2012b). COCs were cultured in maturation medium supplemented with different concentrations of SU5402 (0, 5, 10, and 20 μM), and in vitro maturation of COCs were assessed by GVBD and the first polar body extrusion (PBE) rates. Supplementation of maturation medium with 20 μM SU5402 significantly decreased the GVBD rate compared with the control group (12.24 ± 14.44% vs 66.54 ± 9.40%, respectively) (Fig. 3A). In parallel, the maturation rate was significantly decreased in 20 μM SU5402 (5.26 ± 3.12%) compared with the control (78.59 ± 4.89%) and 10 μM SU5402 (61.07 ± 5.81%) (Fig. 3B). The reduction in GVBD and PBE induced by SU5402 was associated with significantly decreased expression of the oocyte maturation related genes Bmp15 and Gdf9 after 14 h of treatment (Fig. 3C).

Figure 3
Figure 3

Effect of FGF2/FGFR signaling on oocyte meiosis. (A and B) COCs were cultured with increasing concentrations of the FGFR inhibitor SU5402 for 4 h to assess the rate of GVBD (A), and for 14 h to assess the rate of maturation (B). Thirty to 50 COCs were cultured in each group of one independent experiment. Data were expressed as average percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (C) Effect of 20 μM SU5402 on the expression of oocyte maturation related genes Bmp15 and Gdf9 in oocyte at 14 h. (D and E) COCs were cultured with different concentration of FGF2 for 4 h to assess the rate of GVBD (D), and for 14 h to assess the rate of maturation (E). Data are expressed as percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (F) Effect of 100 ng/mL FGF2 on the expression of oocyte maturation related genes Bmp15 and Gdf9 in oocyte at 14 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05; **P < 0.01.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

These findings indicate that inhibition of FGFR suppresses oocyte meiotic progression in COCs. To further confirm the role of FGF2/FGFR signaling on oocyte meiosis, we tested whether exogenous FGF2 could promote oocyte meiotic progression. COCs were cultured for 4 h or 14 h with 0, 1, 10, and 100 ng/mL FGF2, and then GVBD and PBE rates were recorded. The result showed that addition of FGF2 to the maturation medium did not affect the percentage of oocytes reaching GVBD (Fig. 3D). However, significant improvement of maturation rate was observed in 100 ng/mL FGF2 treatment group (91.54 ± 7.71%) compared to the control (72.07 ± 0.49%) (Fig. 3E). FGF2 treatment (100 ng/mL) also significantly increased the expression of oocyte maturation related genes Gdf9 and Bmp15 at 14 h (Fig. 3F).

FGF2/FGFR signaling regulates cumulus expansion

To examine the effect of FGF2/FGFR signaling on cumulus expansion, mouse COCs were cultured in maturation medium supplemented with vehicle (Ctrl), SU5402 (20 μM) or FGF2 (100 ng/mL) and the area of cumulus expansion was assessed after 14 h. Cumulus cells (CCs) in the control group were completely expanded after culturing for 14 h (Fig. 4A, Ctrl). However, CCs remained compact in the SU5402 treatment group (Fig. 4A, SU5402). Quantification of the expansion area indicated that SU5402 treatment significantly prevented cumulus expansion (Fig. 4B). The morphological changes were further confirmed at mRNA levels through assessment of the relative expression of cumulus expansion related genes Ptx3, Has2, and Tnfaip6 (Matsuno et al. 2017). Consistently, the results showed that SU5402 treatment significantly decreased the expression levels of these three genes (Fig. 4C).

Figure 4
Figure 4

Effect of FGF2/FGFR signaling on cumulus expansion. (A and D) The morphology of cumulus expansion in control group, 20 μM SU5402 treatment group, and 100 ng/mL FGF2 treatment group at 14 h. (B and E) Effect of 20 μM SU5402 (B) and 100 ng/mL FGF2 (E) on the area of cumulus expansion. The area of cumulus expansion was calculated using Image J software. Data are expressed as mean ± s.e.m. from at least three independent experiments. ***P < 0.001. (C and F) Effect of 20 μM SU5402 (C) and 100 ng/mL FGF2 (F) on the expression of cumulus expansion related genes Ptx3, Has2, and Tnfaip6 in cumulus cells at 14 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

Addition of exogenous FGF2 had no visible effect on the morphology of COCs compared to the control group, which was understandable that cumulus cells were completely expanded in control group (Fig. 4D). Statistical analysis confirmed that additional of FGF2 only slightly promoted cumulus expansion area (Fig. 4E). However, FGF2 treatment significantly stimulated the expression levels of cumulus expansion related genes Ptx3 and Has2 (Fig. 4F).

FGF2/FGFR forms an autocrine/paracrine loop within COCs to stimulate oocyte maturation

Our current data show that FGF2/FGFR signaling promotes IVM of COCs. Considering that FGFR1 was expressed in both cumulus cells and oocytes, we hypothesized that FGF2/FGFR signaling may also improve IVM of denuded oocytes (DOs). First, DOs were cultured in maturation medium supplemented with vehicle (Ctrl) or SU5402 (20 μM), then the rates of GVBD and the first polar body extrusion (PBE) were evaluated after 4 and 14 h, respectively. The rate of GVBD at 4 h and the rate of the first polar body extrusion (PBE) at 14 h were not statistically different between control and SU5402 treatment groups (Fig. 5A and B). Next, DOs were cultured in maturation medium with vehicle or 100 ng/mL FGF2. Exogenous FGF2 significantly improved the percentage of oocytes reaching GVBD at 4 h (66.70 ± 5.79% vs 75.60 ± 4.35%, Fig. 5C), but did not affect percentage of oocytes reaching MII at 14 h (54.68 ± 4.07% vs 55.85 ± 6.28% , Fig. 5D).

Figure 5
Figure 5

FGF2/FGFR forms an autocrine or paracrine loop within COCs. (A and B) Denuded oocytes (DOs) were cultured with the FGFR inhibitor SU5402 (20 μM) for 4 h to assess GVBD (A) and for 14 h to assess PBE (B). (C and D) Effect of exogenous FGF2 on GVBD of DOs at 4 h (C) and maturation at 14 h (D). Thirty to 50 DOs were cultured in each group of one independent experiment. Data were expressed as average percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (E) Model of the co-culture system using denuded oocytes and COCs. (F) Co-culturing DOs with COCs significantly improved the oocyte maturation rate, and treatment with SU5402 abrogated COC-induced maturation of DOs. (G) FGF2 stimulated the expression of Fgfr1 in COCs. (H and I) The expression of Fgfr1 mRNA (H) and protein (I) in COCs was significantly decreased after FGFR inhibition with SU5402.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

Considering that FGF2 is expressed by cumulus cells, a co-culture system employing denuded oocytes and COCs was developed (Emori et al. 2013) (Fig. 5E) to mimic the exogenous supplement of FGF2. We investigated whether co-culture DOs with COCs could improve the maturation of DOs. The result showed that the first polar body extrusion (PBE) rate of DOs in the co-culture group was significantly higher than that in the control group (55.25 ± 3.54% vs 79.52 ± 2.90%, Fig. 5F). Then, SU5402 was added into the denuded oocyte and COCs co-culture system to evaluate the maturation rate of DOs after 14 h. Treatment with SU5402 abrogated the ability of COCs to improve the maturation of DOs in the co-culture system (Fig. 5F).

To support the idea of the FGF2/FGFR autocrine/paracrine loop, we determined whether treatment COCs with exogenous FGF2 could stimulate the expression of the FGFR in COCs. FGF2 treatment provoked a nine-fold increase in Fgfr1 expression (Fig. 5G). Consistently, inhibition of the FGFR signaling by SU5402 in COCs significantly decreased (75% reduction) Fgfr1 mRNA expression (Fig. 5H). Furthermore, FGFR1 protein level was also significantly downregulated in COCs treated with the FGFR inhibitor (Fig. 5I). These data indicate that the FGF2/FGFR forms an autocrine/paracrine loop within COCs, which may facilitate oocyte maturation.

FGF2/FGFR signaling regulates MPF and MAPK activities

To explore the possible mechanism by which FGF2/FGFR signaling regulates oocyte meiotic progression, we determined the relative expression of transcripts for Ccnb1, a regulatory subunit of maturation/M-phase-promoting factor (MPF) and c- mos, a protein kinase that activates mitogen-activated protein kinase (MAPK), both of which contribute to oocyte meiotic progression (Kubiak 2013). Mouse COCs were cultured in maturation medium with vehicle or 20 μM SU5402. After 4 h of IVM, oocytes were denuded from cumulus cells, and the resultant oocytes were collected and used for detection of Ccnb1 and c-mos expression. Treatment with SU5402 significantly decreased the expression of these two transcripts compared with the control group at 4 h (Fig. 6A and B), indicating that inhibition of FGFR regulates MPF and MAPK activities, required for oocyte meiosis.

Figure 6
Figure 6

Inhibition of FGFR affects MPF and MAPK activities. Mouse COCs were cultured in maturation medium with vehicle or 20 μM SU5402. After 4 h of IVM, oocytes were denuded from cumulus cells, and the resultant oocytes were collected and used for detection of Ccnb1 and c-mos expression. Inhibition of FGFR with SU5402 significantly decreased the relative expression of Ccnb1 (A) and c-mos (B) at 4 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05; ***P < 0.001.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

Discussion

At least 23 fibroblast growth factors (FGFs) exist in mammals. FGF2 has received some recent attention because of its ability to regulate follicular development and oocyte maturation. Previous studies indicated that FGF2 could improve oocyte maturation rate in the sheep (Mondal et al. 2015), pig (Yuan et al. 2017), mouse (Abouzaripour et al. 2018), and blastocyst formation in the cow (Fields et al. 2011). Despite FGF2 function in IVM is widely reported, however, the FGFs function was achieved by binding to and activating a group of transmembrane-spanning tyrosine kinase receptors known as FGF receptors (FGFRs) (Fields et al. 2011, Zhang & Ealy 2012b). The FGF/FGFR signaling, and their relative expressions during IVM need to be addressed. Our present data showed that Fgfr1 expression was the most abundant among the four FGF receptors (FGFR1-4) in mouse COCs. The transcripts for both Fgf2 and Fgfr1 increased during IVM of mouse COCs. Consistent with previous studies, the present study also showed that addition of FGF2 significantly facilitated the IVM of mouse COCs. In addition, exogenous FGF2 stimulated the expression of Fgfr1 in COCs. The importance of FGF signaling was revealed by the use of a selective inhibitor FGFR, which significantly decreased the oocyte maturation rate and cumulus expansion. Inhibition of FGFR did not change the maturation rate of DOs, however, co-culture of DOs with COCs or exogenous FGF2 promoted the maturation of DOs, providing evidence that cumulus cells derived FGF2 can promote oocyte maturation. These results suggest that FGF2/FGFR signaling contributes to maturation of murine COCs in vitro.

Two approaches were taken to explore the role of FGF2/FGFR signaling on in vitro maturation of COCs. First, the maturation medium was supplemented with exogenous FGF2 to investigate the effects of FGF2 on meiosis in cumulus-enclosed oocytes. Our results show that FGF2 significantly accelerated oocyte meiotic progression, indicated by the improved rates of both GVBD and the first PBE. However, FGF2 did not increase total GVBD/PBE, which spontaneously reach a maximum with increasing time in culture (Rong et al. 2019). Besides, exogenous FGF2 induced transcripts for important oocyte-secreted factors, Gdf9 and Bmp15, which serve as reliable predictors of oocyte maturation (Tian et al. 2017, Belli & Shimasaki 2018). High levels of GDF9 in the follicular fluid are significantly correlated with oocyte maturation (Gode et al. 2011). To further test the function of FGF2/FGFR signaling on the oocyte meiosis, we employed SU5402, a selective inhibitor of FGFR. Although SU5402 has been described as a dual purpose inhibitor for vascular endothelial growth factor receptor (VEGFR) and FGFR, previous work showed that concentrations of SU5402 below 60 μM have no inhibitory activity on VEGFR, platelet-derived growth factor (PDGF), EGF or insulin signaling (Sugiura et al. 2007). Our results showed that SU5402 (20 μM) significantly suppressed oocyte meiotic progression and reduced Gdf9 and Bmp15 transcripts. These findings implicate FGF2/FGFR signaling in COCs IVM. Second, we evaluated the role of FGF2/FGFR signaling on cumulus expansion, which is considered as a critical indicator of oocyte maturation (Tian et al. 2017). In the present study, supplementation of the maturation medium with the FGFR inhibitor SU5402 significantly blocked cumulus expansion. Treatment with SU5402 also inhibited the expression of transcripts for cumulus expansion related genes, Has2, Tnfaip6 and Ptx3, indicating that FGFR receptor tyrosine kinase activity is required for cumulus expansion. Furthermore, treatment with exogenous FGF2 significantly increased the expression levels of cumulus expansion related genes Ptx3 and Has2. However, treatment with exogenous FGF2 had no visible change on cumulus expansion. It is well established that cumulus expansion proceeds spontaneously under IVM culture conditions. Because both cumulus cells and oocytes express FGFR1 and the cumulus cells express FGF2, it is reasonable to predict that exogenous FGF2 would have little additive effect on cumulus expansion. Taken together, our findings using two complimentary approaches (oocyte meiosis and cumulus expansion), we propose that FGF2/FGFR signaling plays a functional role in in vitro maturation of mouse COCs.

In the present study, we provide evidence for a FGF2 regulated autocrine or paracrine regulatory loop in mouse COCs maturation. Under standard IVM culture conditions, which do not include exogenous FGF2, inhibition of FGFR activity with SU5402 suppressed oocyte meiotic progression and cumulus expansion. Additionally, suppression of FGFR activity reduced the expression of Fgfr1 mRNA in COCs. Given that the IVM medium was fully defined (devoid of serum, containing 3 mg/mL BSA), it seems likely that endogenous FGF2 derived from cumulus cells contributes to COCs maturation. This idea is supported by observations that oocytes did not express Fgf2 mRNA and SU5402 did not impact oocyte meiotic progression of denuded oocytes (DOs). Previous studies showed that mouse oocytes could secrete FGF8, whose positive effect on oocyte maturation could be also inhibited by SU5402 (Sugiura et al. 2007, 2009). Therefore, the suppressive effect of SU5402 on IVM of mouse COCs in the present study may also involve inhibition of FGF8. Because FGFR1 is also expressed in oocytes, it is reasonable to suggest that exogenous FGF2 improved the rate of GVBD of denuded oocytes (DOs). Indeed, co-culture of DOs with intact COCs increases the rate of the first polar body extrusion (PBE), which was consistent with a previous report demonstrating that a DOs/COCs co-culture system is beneficial to the maturation of DOs (Emori et al. 2013). This evidence indicates that a factor from COCs contributes to DOs maturation. Furthermore, FGF2 directly stimulates GVBD in DOs, and SU5402 diminished the maturation of DOs in this co-culture system. Based on these data, we postulate that FGF2 produced by cumulus cells, activates FGFR in oocytes and cumulus cells, forming a FGF2/FGFR1 autocrine/paracrine loop within mouse COCs to regulate oocyte meiosis in vitro. However, it is worth noting that FGF2 derived from granulose cells could also contribute to the maturation of COCs in vivo (von Otte et al. 2006). Therefore, a FGF2/FGFR positive feedback loop may also promote follicle development in vivo. Studies in other FGF target tissues provide evidence for FGFs/FGFRs autocrine or paracrine regulatory loops (Buratini & Caixeta 2012, Hua et al. 2016). A previous study demonstrated that FGF10 derived from oocytes, binds to FGFRs in cumulus cells and oocytes to promote bovine oocyte maturation, cumulus expansion, and embryo development (Zhang et al. 2010).

Treatment of COCs with exogenous FGF2 increased the proportion of oocytes reaching metaphase II. However, FGF2 had no effect on the maturation rate of denuded oocytes (DOs). These indicate that the FGF2 effect on oocyte meiosis is likely mediated by cumulus cells and interactions with other FGFR/SU5402 sensitive signaling molecules produced via cumulus cells. It is also possible that other FGFs, such as FGF10 produced by cumulus cells, have positive effects on the maturation of oocytes (Zhang & Ealy 2012b). Besides, previous studies illuminated the critical role of the EGF signaling in integrating the interactions between cumulus cells and oocytes (Downs 1989, Kawashima et al. 2012, Sugimura et al. 2015, Yang et al. 2016). Cumulus cells express EGFR, which are activated by EGF that enables oocyte maturation in COCs (Shimada et al. 2016). Besides, FGF and EGF signaling cooperate with oocyte-derived members such as GDF9 and BMP15, which are involved in the maturation of oocyte (Sugiura et al. 2009). Additionally, Fgfr2 expression is significantly increased in cumulus cells after eCG treatment (Furukawa et al. 2014), which could promote the actions of endogenous FGF2 as reported in the present study. Therefore, it is likely that FGF signaling crosstalk with EGF and/or eCG signaling cooperate to facilitate oocyte maturation.

Oocyte maturation requires various signaling pathways. MPF (M-phase Promoting Factor) and MAPK (Mitogen-activated protein kinase) are two major kinases driving oocyte maturation (Kubiak 2013). The c-mos proto-oncogene product, a serine/threonine kinase, is a strong activator of MAPK pathway, and the cyclin B1 protein is an essential regulatory subunit of MPF. It is reported that oocyte meiosis progression requires cyclin B1 synthesis (Gao et al. 2014, Pereira et al. 2019). In the present study, we showed that FGFR inhibition with SU5402 significantly decreased the transcripts for Ccnb1 and c-mos. These findings support the idea that disruption of FGFR affects oocyte meiotic progression by interfering with key meiotic maturation signals.

In conclusion, the present study reveals that FGF2/FGFR forms an autocrine or paracrine loop within COCs to promote mouse COCs in vitro maturation,that is, cumulus expansion and oocyte meiosis. FGF2 produced by cumulus cells binds with FGFR expressed in cumulus cells to stimulate the expansion of cumulus cells. Additionally, FGF2, as well as other FGF ligands (such as FGF8, FGF10, etc.) can bind with FGFR expressed in the oocyte to promote oocyte meiosis by affecting MPF and c-Mos/MAPK activities (Fig. 7).

Figure 7
Figure 7

The role of FGF2/FGFR signaling on cumulus-oocyte complexes (COCs) during in vitro maturation. FGF2 which is produced by cumulus cells, bind with FGFR in oocyte and cumulus cells, and thus FGF2/FGFR forms an autocrine or paracrine loop within COCs to regulate cumulus expansion and oocyte meiosis by affecting MPF and MAPK activities.

Citation: Reproduction 161, 2; 10.1530/REP-20-0264

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Science Foundation of China (31872352), Fundamental Research Funds for the Central Universities (2662018PY037), Natural Science Foundation of Hubei Province (2018CFA015), and Modern Agro-industry Technology Research System (CARS-36). This work was supported in part by the Olson Center for Women’s Health, and the VA NWIHCS, Omaha, NE, USA.

Author contribution statement

C Du participated in the experimental design, performance of experiments, data analysis, figure preparation and the manuscript draft. J-S Davis, L-G Yang participated in the experimental design and manuscript revision. C Chen, Z Li, Y Cao, H Sun performed experiments. B-S Shao, Y-X Lin, Y-S Wang helped to analyze data. G-H Hua conceived, designed and coordinated the study and revised the manuscript. All authors read and approved the final version of the manuscript

References

  • Abouzaripour M, Fathi F, Daneshi E, Mortezaee K, Rezaie MJ & Abdi M 2018 Combined effect of retinoic acid and basic fibroblast growth factor on maturation of mouse oocyte and subsequent fertilization and development. International Journal of Fertility and Sterility 12 6871. (https://doi.org/10.22074/ijfs.2018.5293)

    • Search Google Scholar
    • Export Citation
  • Acuna-Hernández DG, Arreola-Mendoza L, Santacruz-Márquez R, García-Zepeda SP, Parra-Forero LY, Olivares-Reyes JA & Hernández-Ochoa I 2018 Bisphenol A alters oocyte maturation by prematurely closing gap junctions in the cumulus cell-oocyte complex. Toxicology and Applied Pharmacology 344 1322. (https://doi.org/10.1016/j.taap.2018.02.011)

    • Search Google Scholar
    • Export Citation
  • Almeida AP, Saraiva MV, Alves Filho JG, Silva GM, Gonçalves RF, Brito IR, Silva AW, Lima AK, Cunha RM & Silva JR et al. 2012 Gene expression and immunolocalization of fibroblast growth factor 2 in the ovary and its effect on the in vitro culture of caprine preantral ovarian follicles. Reproduction in Domestic Animals 47 2025. (https://doi.org/10.1111/j.1439-0531.2011.01793.x)

    • Search Google Scholar
    • Export Citation
  • Barros RG, Lima PF, Soares ACS, Sanches L, Price CA & Buratini J 2019 Fibroblast growth factor 2 regulates cumulus differentiation under the control of the oocyte. Journal of Assisted Reproduction and Genetics 36 905913. (https://doi.org/10.1007/s10815-019-01436-7)

    • Search Google Scholar
    • Export Citation
  • Belli M & Shimasaki S 2018 Molecular aspects and clinical relevance of gdf9 and bmp15 in ovarian function. Vitamins and Hormones 107 317348. (https://doi.org/10.1016/bs.vh.2017.12.003)

    • Search Google Scholar
    • Export Citation
  • Buratini J & Caixeta ES 2012 Paracrine and autocrine factors in the differentiation of the cumulus-oocyte complex. Animal Reproduction 9 414419.

    • Search Google Scholar
    • Export Citation
  • Downs SM 1989 Specificity of epidermal growth factor action on maturation of the murine oocyte and cumulus oophorus in vitro. Biology of Reproduction 41 371379. (https://doi.org/10.1095/biolreprod41.2.371)

    • Search Google Scholar
    • Export Citation
  • Emori C, Wigglesworth K, Fujii W, Naito K, Eppig JJ & Sugiura K 2013 Cooperative effects of 17β-estradiol and oocyte-derived paracrine factors on the transcriptome of mouse cumulus cells. Endocrinology 154 48594872. (https://doi.org/10.1210/en.2013-1536)

    • Search Google Scholar
    • Export Citation
  • Fields SD, Hansen PJ & Ealy AD 2011 Fibroblast growth factor requirements for in vitro development of bovine embryos. Theriogenology 75 14661475. (https://doi.org/10.1016/j.theriogenology.2010.12.007)

    • Search Google Scholar
    • Export Citation
  • Furukawa S, Matsuno Y, Emori C, Fujii W, Naito K & Sugiura K 2014 Expression and regulation of FGF receptors in mouse granulosa cells. Journal of Mammalian Ova Research 31 8692. (https://doi.org/10.1274/jmor.31.86)

    • Search Google Scholar
    • Export Citation
  • Gao Y, Ren J, Zhang L, Zhang Y, Wu X, Jiang H, Xu F, Yuan B, Yu X & Zhang J 2014 The effects of demecolcine, alone or in combination with sucrose on bovine oocyteprotrusion rate, MAPK1 protein level and c-mos gene expression level. Cellular Physiology and Biochemistry 34 19741982. (https://doi.org/10.1159/000366393)

    • Search Google Scholar
    • Export Citation
  • Gode F, Gulekli B, Dogan E, Korhan P, Dogan S, Bige O, Cimrin D & Atabey N 2011 Influence of follicular fluid GDF9 and BMP15 on embryo quality. Fertility and Sterility 95 22742278. (https://doi.org/10.1016/j.fertnstert.2011.03.045)

    • Search Google Scholar
    • Export Citation
  • He B, Lin J, Li J, Mi Y, Zeng W & Zhang C 2012 Basic fibroblast growth factor suppresses meiosis and promotes mitosis of ovarian germ cells in embryonic chickens. General and Comparative Endocrinology 176 173181. (https://doi.org/10.1016/j.ygcen.2012.01.012)

    • Search Google Scholar
    • Export Citation
  • Hua G, Lv X, He C, Remmenga SW, Rodabough KJ, Dong J, Yang L, Lele SM, Yang P & Zhou J et al. 2016 YAP induces high-grade serous carcinoma in Fallopian tube secretory epithelial cells. Oncogene 35 22472265. (https://doi.org/10.1038/onc.2015.288)

    • Search Google Scholar
    • Export Citation
  • Kawashima I, Liu Z, Mullany LK, Mihara T, Richards JS & Shimada M 2012 EGF-like factors induce expansion of the cumulus cell-oocyte complexes by activating calpain-mediated cell movement. Endocrinology 153 39493959. (https://doi.org/10.1210/en.2012-1059)

    • Search Google Scholar
    • Export Citation
  • Kubiak JZ 2013 Protein kinase assays for measuring MPF and MAPK activities in mouse and rat oocytes and early embryos. Methods in Molecular Biology 957 7789. (https://doi.org/10.1007/978-1-62703-191-2_5)

    • Search Google Scholar
    • Export Citation
  • Lin J, Jia Y, Zeng W, Mi Y & Zhang C 2012 Basic FGF promotes proliferation of ovarian granulosa cells in the laying chickens via FGFR1 and PKC pathway. Reproduction in Domestic Animals 47 135142. (https://doi.org/10.1111/j.1439-0531.2011.01813.x)

    • Search Google Scholar
    • Export Citation
  • Liu XM, Yan MQ, Ji SY, Sha QQ, Huang T, Zhao H, Liu HB, Fan HY & Chen ZJ 2018 Loss of oocyte Rps26 in mice arrests oocyte growth and causes premature ovarian failure. Cell Death and Disease 9 1144. (https://doi.org/10.1038/s41419-018-1196-3)

    • Search Google Scholar
    • Export Citation
  • Lu J, Zhang W, Lin C, Xie M, Wang J, Wang Z & Wang S 2010 Expression and distribution of fibroblast growth factor receptor 1, 2 and 3 in Kunming mouse oocyte and preimplantation embryos. Chinese Journal of Anatomy 33 296298, 332. (https://doi.org/10.3969/j.issn.1001-1633.2010.03.005)

    • Search Google Scholar
    • Export Citation
  • Lu CL, Yan J, Zhi X, Xia X, Wang TR, Yan LY, Yu Y, Ding T, Gao JM & Li R et al. 2015 Basic fibroblast growth factor promotes macaque follicle development in vitro. Reproduction 149 425433. (https://doi.org/10.1530/REP-14-0557)

    • Search Google Scholar
    • Export Citation
  • Matsuno Y, Onuma A, Fujioka YA, Yasuhara K, Fujii W, Naito K & Sugiura K 2017 Effects of exosome-like vesicles on cumulus expansion in pigs in vitro. Journal of Reproduction and Development 63 5158. (https://doi.org/10.1262/jrd.2016-124)

    • Search Google Scholar
    • Export Citation
  • Mondal S, Mor A, Reddy IJ, Nandi S & Parameswaragupta P 2015 Effect of fibroblast growth factor 2 (FGF2) and insulin transferrin selenium (ITS) on in vitro maturation, fertilization and embryo development in sheep. Brazilian Archives of Biology and Technology 58 521525. (https://doi.org/10.1590/S1516-8913201500059)

    • Search Google Scholar
    • Export Citation
  • Mor A, Mondal S, Reddy IJ, Nandi S & Gupta P 2018 Molecular cloning and expression of FGF2 gene in pre-implantation developmental stages of in vitro-produced sheep embryos. Reproduction in Domestic Animals 53 895903. (https://doi.org/10.1111/rda.13182)

    • Search Google Scholar
    • Export Citation
  • Ornitz DM & Itoh N 2015 The fibroblast growth factor signaling pathway. Wiley Interdisciplinary Reviews: Developmental Biology 4 215266. (https://doi.org/10.1002/wdev.176)

    • Search Google Scholar
    • Export Citation
  • Pereira LMC, Bersano PRO, Rocha DD & Lopes MD 2019 Effect of EGF on expression and localization of maturation‐promoting factor, mitogen‐activated protein kinase, p34cdc2 and cyclin B during different culture periods on in vitro maturation of canine oocytes. Reproduction in Domestic Animals 54 325341. (https://doi.org/10.1111/rda.13365)

    • Search Google Scholar
    • Export Citation
  • Price CA 2016 Mechanisms of fibroblast growth factor signaling in the ovarian follicle. Journal of Endocrinology 228 R31R 43. (https://doi.org/10.1530/JOE-15-0414)

    • Search Google Scholar
    • Export Citation
  • Rong Y, Ji SY, Zhu YZ, Wu YW, Shen L & Fan HY 2019 ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation. Nucleic Acids Research 47 1138711402. (https://doi.org/10.1093/nar/gkz863)

    • Search Google Scholar
    • Export Citation
  • Santos JM, Menezes VG, Barberino RS, Macedo TJ, Lins TL, Gouveia BB, Barros VR, Santos LP, Gonçalves RJ & Matos MH 2014 Immunohistochemical localization of fibroblast growth factor-2 in the sheep ovary and its effects on pre-antral follicle apoptosis and development in vitro. Reproduction in Domestic Animals 49 522528. (https://doi.org/10.1111/rda.12322)

    • Search Google Scholar
    • Export Citation
  • Shimada M, Umehara T & Hoshino Y 2016 Roles of epidermal growth factor (EGF)-like factor in the ovulation process. Reproductive Medicine and Biology 15 201216. (https://doi.org/10.1007/s12522-016-0236-x)

    • Search Google Scholar
    • Export Citation
  • Soto-Heras S, Catalá MG, Roura M, Menéndez-Blanco I, Piras AR, Izquierdo D & Paramio MT 2019 Effects of melatonin on oocyte developmental competence and the role of melatonin receptor 1 in juvenile goats. Reproduction in Domestic Animals 54 381390. (https://doi.org/10.1111/rda.13378)

    • Search Google Scholar
    • Export Citation
  • Sugimura S, Ritter LJ, Rose RD, Thompson JG, Smitz J, Mottershead DG & Gilchrist RB 2015 Promotion of EGF receptor signaling improves the quality of low developmental competence oocytes. Developmental Biology 403 139149. (https://doi.org/10.1016/j.ydbio.2015.05.008)

    • Search Google Scholar
    • Export Citation
  • Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O'Brien MJ, Matzuk MM, Shimasaki S & Eppig JJ 2007 Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 134 25932603. (https://doi.org/10.1242/dev.006882)

    • Search Google Scholar
    • Export Citation
  • Sugiura K, Su YQ, Li Q, Wigglesworth K, Matzuk MM & Eppig JJ 2009 Fibroblast growth factors and epidermal growth factor cooperate with oocyte-derived members of the TGFbeta superfamily to regulate Spry2 mRNA levels in mouse cumulus cells. Biology of Reproduction 81 833841. (https://doi.org/10.1095/biolreprod.109.078485)

    • Search Google Scholar
    • Export Citation
  • Tian X, Wang F, Zhang L, He C, Ji P, Wang J, Zhang Z, Lv D, Abulizi W & Wang X et al. 2017 Beneficial effects of melatonin on the in vitro maturation of sheep oocytes and its relation to melatonin receptors. International Journal of Molecular Sciences 18 834. (https://doi.org/10.3390/ijms18040834)

    • Search Google Scholar
    • Export Citation
  • von Otte S, Paletta JR, Becker S, König S, Fobker M, Greb RR, Kiesel L, Assmann G, Diedrich K & Nofer JR 2006 Follicular fluid high density lipoprotein-associated sphingosine 1-phosphate is a novel mediator of ovarian angiogenesis. Journal of Biological Chemistry 281 53985405. (https://doi.org/10.1074/jbc.M508759200)

    • Search Google Scholar
    • Export Citation
  • Yang CR, Lowther KM, Lalioti MD & Seli E 2016 Embryonic poly(A)-binding protein (EPAB) is required for granulosa cell EGF signaling and cumulus expansion in female mice. Endocrinology 157 405416. (https://doi.org/10.1210/en.2015-1135)

    • Search Google Scholar
    • Export Citation
  • Yuan Y, Spate LD, Redel BK, Tian Y, Zhou J, Prather RS & Roberts RM 2017 Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. PNAS 114 E5796E5804. (https://doi.org/10.1073/pnas.1703998114)

    • Search Google Scholar
    • Export Citation
  • Zhang K & Ealy AD 2012a Supplementing fibroblast growth factor 2 during bovine oocyte in vitro maturation promotes subsequent embryonic development. Open Journal of Animal Sciences 2 119126. (https://doi.org/10.4236/ojas.2012.22017)

    • Search Google Scholar
    • Export Citation
  • Zhang K & Ealy AD 2012b Disruption of fibroblast growth factor receptor signaling in bovine cumulus-oocyte complexes during in vitro maturation reduces subsequent embryonic development. Domestic Animal Endocrinology 42 230238. (https://doi.org/10.1016/j.domaniend.2011.12.006)

    • Search Google Scholar
    • Export Citation
  • Zhang K, Hansen PJ & Ealy AD 2010 Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 140 815826. (https://doi.org/10.1530/REP-10-0190)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    (A) Experimental design. (B) Identification of different stages of oocyte during in vitro maturation. Left panel: GV stage, with visible nucleus. Middle panel: GVBD stage, with disappearance of nucleus. Right panel: MII/maturation stage, with visible the first polar body.

  • View in gallery
    Figure 2

    The expression patterns of FGF2 and FGFRs during COCs in vitro maturation. (A) qRT-PCR analysis of four Fgfrs expression levels in COCs in GV stage. Data are presented as means ± s.e.m. relative to Actb. (B and C) The relative expression levels of Fgfr1 and Fgf2 mRNA in COCs at 0, 4, and 14 h of IVM. Bars with different letters are significantly different (P < 0.05). (D) RT-PCR analysis of Fgf2 and Fgfr1 expression in oocyte and cumulus cells from GV stage. Actb was used as reference gene.

  • View in gallery
    Figure 3

    Effect of FGF2/FGFR signaling on oocyte meiosis. (A and B) COCs were cultured with increasing concentrations of the FGFR inhibitor SU5402 for 4 h to assess the rate of GVBD (A), and for 14 h to assess the rate of maturation (B). Thirty to 50 COCs were cultured in each group of one independent experiment. Data were expressed as average percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (C) Effect of 20 μM SU5402 on the expression of oocyte maturation related genes Bmp15 and Gdf9 in oocyte at 14 h. (D and E) COCs were cultured with different concentration of FGF2 for 4 h to assess the rate of GVBD (D), and for 14 h to assess the rate of maturation (E). Data are expressed as percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (F) Effect of 100 ng/mL FGF2 on the expression of oocyte maturation related genes Bmp15 and Gdf9 in oocyte at 14 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05; **P < 0.01.

  • View in gallery
    Figure 4

    Effect of FGF2/FGFR signaling on cumulus expansion. (A and D) The morphology of cumulus expansion in control group, 20 μM SU5402 treatment group, and 100 ng/mL FGF2 treatment group at 14 h. (B and E) Effect of 20 μM SU5402 (B) and 100 ng/mL FGF2 (E) on the area of cumulus expansion. The area of cumulus expansion was calculated using Image J software. Data are expressed as mean ± s.e.m. from at least three independent experiments. ***P < 0.001. (C and F) Effect of 20 μM SU5402 (C) and 100 ng/mL FGF2 (F) on the expression of cumulus expansion related genes Ptx3, Has2, and Tnfaip6 in cumulus cells at 14 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05.

  • View in gallery
    Figure 5

    FGF2/FGFR forms an autocrine or paracrine loop within COCs. (A and B) Denuded oocytes (DOs) were cultured with the FGFR inhibitor SU5402 (20 μM) for 4 h to assess GVBD (A) and for 14 h to assess PBE (B). (C and D) Effect of exogenous FGF2 on GVBD of DOs at 4 h (C) and maturation at 14 h (D). Thirty to 50 DOs were cultured in each group of one independent experiment. Data were expressed as average percentage ± s.e.m. of at least three independent experiments. Bars with different letters are significantly different (P < 0.05). (E) Model of the co-culture system using denuded oocytes and COCs. (F) Co-culturing DOs with COCs significantly improved the oocyte maturation rate, and treatment with SU5402 abrogated COC-induced maturation of DOs. (G) FGF2 stimulated the expression of Fgfr1 in COCs. (H and I) The expression of Fgfr1 mRNA (H) and protein (I) in COCs was significantly decreased after FGFR inhibition with SU5402.

  • View in gallery
    Figure 6

    Inhibition of FGFR affects MPF and MAPK activities. Mouse COCs were cultured in maturation medium with vehicle or 20 μM SU5402. After 4 h of IVM, oocytes were denuded from cumulus cells, and the resultant oocytes were collected and used for detection of Ccnb1 and c-mos expression. Inhibition of FGFR with SU5402 significantly decreased the relative expression of Ccnb1 (A) and c-mos (B) at 4 h. Data are presented as means ± s.e.m. relative to Actb. *P < 0.05; ***P < 0.001.

  • View in gallery
    Figure 7

    The role of FGF2/FGFR signaling on cumulus-oocyte complexes (COCs) during in vitro maturation. FGF2 which is produced by cumulus cells, bind with FGFR in oocyte and cumulus cells, and thus FGF2/FGFR forms an autocrine or paracrine loop within COCs to regulate cumulus expansion and oocyte meiosis by affecting MPF and MAPK activities.

  • Abouzaripour M, Fathi F, Daneshi E, Mortezaee K, Rezaie MJ & Abdi M 2018 Combined effect of retinoic acid and basic fibroblast growth factor on maturation of mouse oocyte and subsequent fertilization and development. International Journal of Fertility and Sterility 12 6871. (https://doi.org/10.22074/ijfs.2018.5293)

    • Search Google Scholar
    • Export Citation
  • Acuna-Hernández DG, Arreola-Mendoza L, Santacruz-Márquez R, García-Zepeda SP, Parra-Forero LY, Olivares-Reyes JA & Hernández-Ochoa I 2018 Bisphenol A alters oocyte maturation by prematurely closing gap junctions in the cumulus cell-oocyte complex. Toxicology and Applied Pharmacology 344 1322. (https://doi.org/10.1016/j.taap.2018.02.011)

    • Search Google Scholar
    • Export Citation
  • Almeida AP, Saraiva MV, Alves Filho JG, Silva GM, Gonçalves RF, Brito IR, Silva AW, Lima AK, Cunha RM & Silva JR et al. 2012 Gene expression and immunolocalization of fibroblast growth factor 2 in the ovary and its effect on the in vitro culture of caprine preantral ovarian follicles. Reproduction in Domestic Animals 47 2025. (https://doi.org/10.1111/j.1439-0531.2011.01793.x)

    • Search Google Scholar
    • Export Citation
  • Barros RG, Lima PF, Soares ACS, Sanches L, Price CA & Buratini J 2019 Fibroblast growth factor 2 regulates cumulus differentiation under the control of the oocyte. Journal of Assisted Reproduction and Genetics 36 905913. (https://doi.org/10.1007/s10815-019-01436-7)

    • Search Google Scholar
    • Export Citation
  • Belli M & Shimasaki S 2018 Molecular aspects and clinical relevance of gdf9 and bmp15 in ovarian function. Vitamins and Hormones 107 317348. (https://doi.org/10.1016/bs.vh.2017.12.003)

    • Search Google Scholar
    • Export Citation
  • Buratini J & Caixeta ES 2012 Paracrine and autocrine factors in the differentiation of the cumulus-oocyte complex. Animal Reproduction 9 414419.

    • Search Google Scholar
    • Export Citation
  • Downs SM 1989 Specificity of epidermal growth factor action on maturation of the murine oocyte and cumulus oophorus in vitro. Biology of Reproduction 41 371379. (https://doi.org/10.1095/biolreprod41.2.371)

    • Search Google Scholar
    • Export Citation
  • Emori C, Wigglesworth K, Fujii W, Naito K, Eppig JJ & Sugiura K 2013 Cooperative effects of 17β-estradiol and oocyte-derived paracrine factors on the transcriptome of mouse cumulus cells. Endocrinology 154 48594872. (https://doi.org/10.1210/en.2013-1536)

    • Search Google Scholar
    • Export Citation
  • Fields SD, Hansen PJ & Ealy AD 2011 Fibroblast growth factor requirements for in vitro development of bovine embryos. Theriogenology 75 14661475. (https://doi.org/10.1016/j.theriogenology.2010.12.007)

    • Search Google Scholar
    • Export Citation
  • Furukawa S, Matsuno Y, Emori C, Fujii W, Naito K & Sugiura K 2014 Expression and regulation of FGF receptors in mouse granulosa cells. Journal of Mammalian Ova Research 31 8692. (https://doi.org/10.1274/jmor.31.86)

    • Search Google Scholar
    • Export Citation
  • Gao Y, Ren J, Zhang L, Zhang Y, Wu X, Jiang H, Xu F, Yuan B, Yu X & Zhang J 2014 The effects of demecolcine, alone or in combination with sucrose on bovine oocyteprotrusion rate, MAPK1 protein level and c-mos gene expression level. Cellular Physiology and Biochemistry 34 19741982. (https://doi.org/10.1159/000366393)

    • Search Google Scholar
    • Export Citation
  • Gode F, Gulekli B, Dogan E, Korhan P, Dogan S, Bige O, Cimrin D & Atabey N 2011 Influence of follicular fluid GDF9 and BMP15 on embryo quality. Fertility and Sterility 95 22742278. (https://doi.org/10.1016/j.fertnstert.2011.03.045)

    • Search Google Scholar
    • Export Citation
  • He B, Lin J, Li J, Mi Y, Zeng W & Zhang C 2012 Basic fibroblast growth factor suppresses meiosis and promotes mitosis of ovarian germ cells in embryonic chickens. General and Comparative Endocrinology 176 173181. (https://doi.org/10.1016/j.ygcen.2012.01.012)

    • Search Google Scholar
    • Export Citation
  • Hua G, Lv X, He C, Remmenga SW, Rodabough KJ, Dong J, Yang L, Lele SM, Yang P & Zhou J et al. 2016 YAP induces high-grade serous carcinoma in Fallopian tube secretory epithelial cells. Oncogene 35 22472265. (https://doi.org/10.1038/onc.2015.288)

    • Search Google Scholar
    • Export Citation
  • Kawashima I, Liu Z, Mullany LK, Mihara T, Richards JS & Shimada M 2012 EGF-like factors induce expansion of the cumulus cell-oocyte complexes by activating calpain-mediated cell movement. Endocrinology 153 39493959. (https://doi.org/10.1210/en.2012-1059)

    • Search Google Scholar
    • Export Citation
  • Kubiak JZ 2013 Protein kinase assays for measuring MPF and MAPK activities in mouse and rat oocytes and early embryos. Methods in Molecular Biology 957 7789. (https://doi.org/10.1007/978-1-62703-191-2_5)

    • Search Google Scholar
    • Export Citation
  • Lin J, Jia Y, Zeng W, Mi Y & Zhang C 2012 Basic FGF promotes proliferation of ovarian granulosa cells in the laying chickens via FGFR1 and PKC pathway. Reproduction in Domestic Animals 47 135142. (https://doi.org/10.1111/j.1439-0531.2011.01813.x)

    • Search Google Scholar
    • Export Citation
  • Liu XM, Yan MQ, Ji SY, Sha QQ, Huang T, Zhao H, Liu HB, Fan HY & Chen ZJ 2018 Loss of oocyte Rps26 in mice arrests oocyte growth and causes premature ovarian failure. Cell Death and Disease 9 1144. (https://doi.org/10.1038/s41419-018-1196-3)

    • Search Google Scholar
    • Export Citation
  • Lu J, Zhang W, Lin C, Xie M, Wang J, Wang Z & Wang S 2010 Expression and distribution of fibroblast growth factor receptor 1, 2 and 3 in Kunming mouse oocyte and preimplantation embryos. Chinese Journal of Anatomy 33 296298, 332. (https://doi.org/10.3969/j.issn.1001-1633.2010.03.005)

    • Search Google Scholar
    • Export Citation
  • Lu CL, Yan J, Zhi X, Xia X, Wang TR, Yan LY, Yu Y, Ding T, Gao JM & Li R et al. 2015 Basic fibroblast growth factor promotes macaque follicle development in vitro. Reproduction 149 425433. (https://doi.org/10.1530/REP-14-0557)

    • Search Google Scholar
    • Export Citation
  • Matsuno Y, Onuma A, Fujioka YA, Yasuhara K, Fujii W, Naito K & Sugiura K 2017 Effects of exosome-like vesicles on cumulus expansion in pigs in vitro. Journal of Reproduction and Development 63 5158. (https://doi.org/10.1262/jrd.2016-124)

    • Search Google Scholar
    • Export Citation
  • Mondal S, Mor A, Reddy IJ, Nandi S & Parameswaragupta P 2015 Effect of fibroblast growth factor 2 (FGF2) and insulin transferrin selenium (ITS) on in vitro maturation, fertilization and embryo development in sheep. Brazilian Archives of Biology and Technology 58 521525. (https://doi.org/10.1590/S1516-8913201500059)

    • Search Google Scholar
    • Export Citation
  • Mor A, Mondal S, Reddy IJ, Nandi S & Gupta P 2018 Molecular cloning and expression of FGF2 gene in pre-implantation developmental stages of in vitro-produced sheep embryos. Reproduction in Domestic Animals 53 895903. (https://doi.org/10.1111/rda.13182)

    • Search Google Scholar
    • Export Citation
  • Ornitz DM & Itoh N 2015 The fibroblast growth factor signaling pathway. Wiley Interdisciplinary Reviews: Developmental Biology 4 215266. (https://doi.org/10.1002/wdev.176)

    • Search Google Scholar
    • Export Citation
  • Pereira LMC, Bersano PRO, Rocha DD & Lopes MD 2019 Effect of EGF on expression and localization of maturation‐promoting factor, mitogen‐activated protein kinase, p34cdc2 and cyclin B during different culture periods on in vitro maturation of canine oocytes. Reproduction in Domestic Animals 54 325341. (https://doi.org/10.1111/rda.13365)

    • Search Google Scholar
    • Export Citation
  • Price CA 2016 Mechanisms of fibroblast growth factor signaling in the ovarian follicle. Journal of Endocrinology 228 R31R 43. (https://doi.org/10.1530/JOE-15-0414)

    • Search Google Scholar
    • Export Citation
  • Rong Y, Ji SY, Zhu YZ, Wu YW, Shen L & Fan HY 2019 ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation. Nucleic Acids Research 47 1138711402. (https://doi.org/10.1093/nar/gkz863)

    • Search Google Scholar
    • Export Citation
  • Santos JM, Menezes VG, Barberino RS, Macedo TJ, Lins TL, Gouveia BB, Barros VR, Santos LP, Gonçalves RJ & Matos MH 2014 Immunohistochemical localization of fibroblast growth factor-2 in the sheep ovary and its effects on pre-antral follicle apoptosis and development in vitro. Reproduction in Domestic Animals 49 522528. (https://doi.org/10.1111/rda.12322)

    • Search Google Scholar
    • Export Citation
  • Shimada M, Umehara T & Hoshino Y 2016 Roles of epidermal growth factor (EGF)-like factor in the ovulation process. Reproductive Medicine and Biology 15 201216. (https://doi.org/10.1007/s12522-016-0236-x)

    • Search Google Scholar
    • Export Citation
  • Soto-Heras S, Catalá MG, Roura M, Menéndez-Blanco I, Piras AR, Izquierdo D & Paramio MT 2019 Effects of melatonin on oocyte developmental competence and the role of melatonin receptor 1 in juvenile goats. Reproduction in Domestic Animals 54 381390. (https://doi.org/10.1111/rda.13378)

    • Search Google Scholar
    • Export Citation
  • Sugimura S, Ritter LJ, Rose RD, Thompson JG, Smitz J, Mottershead DG & Gilchrist RB 2015 Promotion of EGF receptor signaling improves the quality of low developmental competence oocytes. Developmental Biology 403 139149. (https://doi.org/10.1016/j.ydbio.2015.05.008)

    • Search Google Scholar
    • Export Citation
  • Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O'Brien MJ, Matzuk MM, Shimasaki S & Eppig JJ 2007 Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 134 25932603. (https://doi.org/10.1242/dev.006882)

    • Search Google Scholar
    • Export Citation
  • Sugiura K, Su YQ, Li Q, Wigglesworth K, Matzuk MM & Eppig JJ 2009 Fibroblast growth factors and epidermal growth factor cooperate with oocyte-derived members of the TGFbeta superfamily to regulate Spry2 mRNA levels in mouse cumulus cells. Biology of Reproduction 81 833841. (https://doi.org/10.1095/biolreprod.109.078485)

    • Search Google Scholar
    • Export Citation
  • Tian X, Wang F, Zhang L, He C, Ji P, Wang J, Zhang Z, Lv D, Abulizi W & Wang X et al. 2017 Beneficial effects of melatonin on the in vitro maturation of sheep oocytes and its relation to melatonin receptors. International Journal of Molecular Sciences 18 834. (https://doi.org/10.3390/ijms18040834)

    • Search Google Scholar
    • Export Citation
  • von Otte S, Paletta JR, Becker S, König S, Fobker M, Greb RR, Kiesel L, Assmann G, Diedrich K & Nofer JR 2006 Follicular fluid high density lipoprotein-associated sphingosine 1-phosphate is a novel mediator of ovarian angiogenesis. Journal of Biological Chemistry 281 53985405. (https://doi.org/10.1074/jbc.M508759200)

    • Search Google Scholar
    • Export Citation
  • Yang CR, Lowther KM, Lalioti MD & Seli E 2016 Embryonic poly(A)-binding protein (EPAB) is required for granulosa cell EGF signaling and cumulus expansion in female mice. Endocrinology 157 405416. (https://doi.org/10.1210/en.2015-1135)

    • Search Google Scholar
    • Export Citation
  • Yuan Y, Spate LD, Redel BK, Tian Y, Zhou J, Prather RS & Roberts RM 2017 Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. PNAS 114 E5796E5804. (https://doi.org/10.1073/pnas.1703998114)

    • Search Google Scholar
    • Export Citation
  • Zhang K & Ealy AD 2012a Supplementing fibroblast growth factor 2 during bovine oocyte in vitro maturation promotes subsequent embryonic development. Open Journal of Animal Sciences 2 119126. (https://doi.org/10.4236/ojas.2012.22017)

    • Search Google Scholar
    • Export Citation
  • Zhang K & Ealy AD 2012b Disruption of fibroblast growth factor receptor signaling in bovine cumulus-oocyte complexes during in vitro maturation reduces subsequent embryonic development. Domestic Animal Endocrinology 42 230238. (https://doi.org/10.1016/j.domaniend.2011.12.006)

    • Search Google Scholar
    • Export Citation
  • Zhang K, Hansen PJ & Ealy AD 2010 Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 140 815826. (https://doi.org/10.1530/REP-10-0190)

    • Search Google Scholar
    • Export Citation