CXCL12 and its receptors regulate granulosa cell apoptosis in PCOS rats and human KGN tumor cells

in Reproduction
Authors:
Ling JinReproductive Medicine Center, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Hubei Clinical Research Center for Prenatal Diagnosis and Birth Health, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Ling Jin in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-4640-2895
,
Liang RenDepartment of Reproductive Center, First Affliated Hospital of Guangxi Medical University, Nanning, Guangxi, People’s Republic of China

Search for other papers by Liang Ren in
Current site
Google Scholar
PubMed
Close
,
Jing LuDepartment of Obstetrics and Gynecology, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Jing Lu in
Current site
Google Scholar
PubMed
Close
,
Xue WenReproductive Medicine Center, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Hubei Clinical Research Center for Prenatal Diagnosis and Birth Health, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Xue Wen in
Current site
Google Scholar
PubMed
Close
,
Siying ZhuangReproductive Medicine Center, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Hubei Clinical Research Center for Prenatal Diagnosis and Birth Health, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Siying Zhuang in
Current site
Google Scholar
PubMed
Close
,
Ting GengReproductive Medicine Center, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Hubei Clinical Research Center for Prenatal Diagnosis and Birth Health, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Ting Geng in
Current site
Google Scholar
PubMed
Close
, and
Yuanzhen ZhangReproductive Medicine Center, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Hubei Clinical Research Center for Prenatal Diagnosis and Birth Health, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China
Department of Obstetrics and Gynecology, Wuhan University Zhongnan Hospital, Wuhan, Hubei, People’s Republic of China

Search for other papers by Yuanzhen Zhang in
Current site
Google Scholar
PubMed
Close
View More View Less

Correspondence should be addressed to Y Zhang; Email: zhangyuanzhen@vip.sina.com

*(L Jin and L Ren contributed equally to this work)

Free access

Polycystic ovary syndrome (PCOS) is a common endocrine disorder accompanied by chronic low-grade inflammation; its etiology is still undefined. This study investigated the expression of CXCL12, CXCR4, and CXCR7 in PCOS rats and their role in regulation of apoptosis. To accomplish this, we established an in vivo PCOS rat model and studied KGN cells (human ovarian granulosa cell line) in vitro. In PCOS rats, the ovarian expression of CXCL12, CXCR4, and CXCR7 was reduced, and the apoptosis rate of granulosa cells was increased, accompanied by decreased expression of BCL2 and increased expression of BAX and cleaved CASPASE3 (CASP3). We further showed that recombinant human CXCL12 treatment upregulated BCL2, downregulated BAX, and cleaved CASP3 in KGN cells to inhibit their apoptosis in a concentration-dependent manner; moreover, the effect of CXCL12 was weakened by CXCR4 antagonist AMD3100 and anti-CXCR7 neutralizing antibody. In conclusion, PCOS rats showed decreased CXCL12, CXCR4, and CXCR7 expression and increased apoptosis rate of ovarian granulosa cells. Further, in human KGN cells, CXCL12 regulated the expression of BAX, BCL2, and cleaved CASP3 to inhibit apoptosis through CXCR4- and CXCR7-mediated signal transmission. These findings may provide a theoretical and practical basis for illuminating the role of proinflammatory cytokines in the pathogenesis of PCOS.

Abstract

Polycystic ovary syndrome (PCOS) is a common endocrine disorder accompanied by chronic low-grade inflammation; its etiology is still undefined. This study investigated the expression of CXCL12, CXCR4, and CXCR7 in PCOS rats and their role in regulation of apoptosis. To accomplish this, we established an in vivo PCOS rat model and studied KGN cells (human ovarian granulosa cell line) in vitro. In PCOS rats, the ovarian expression of CXCL12, CXCR4, and CXCR7 was reduced, and the apoptosis rate of granulosa cells was increased, accompanied by decreased expression of BCL2 and increased expression of BAX and cleaved CASPASE3 (CASP3). We further showed that recombinant human CXCL12 treatment upregulated BCL2, downregulated BAX, and cleaved CASP3 in KGN cells to inhibit their apoptosis in a concentration-dependent manner; moreover, the effect of CXCL12 was weakened by CXCR4 antagonist AMD3100 and anti-CXCR7 neutralizing antibody. In conclusion, PCOS rats showed decreased CXCL12, CXCR4, and CXCR7 expression and increased apoptosis rate of ovarian granulosa cells. Further, in human KGN cells, CXCL12 regulated the expression of BAX, BCL2, and cleaved CASP3 to inhibit apoptosis through CXCR4- and CXCR7-mediated signal transmission. These findings may provide a theoretical and practical basis for illuminating the role of proinflammatory cytokines in the pathogenesis of PCOS.

Introduction

Polycystic ovary syndrome (PCOS) is one of the most common complex endocrine diseases among women of childbearing age; its main pathological features are chronic anovulation or oligo-ovulation, hyperandrogenemia, and insulin resistance (Carmina & Lobo 1999). Major clinical manifestations of PCOS include anovulation, infertility, obesity, hirsutism in reproductive age and diabetes, cardiovascular disease, and mental disorders in middle age. Approximately 90–95% of patients diagnosed with PCOS have ovulation disorders, and during in vitro fertilization and embryo transfer (IVF-ET) treatment, the quality of oocytes and embryos is decreased (Ragni et al. 2005, Lainas et al. 2010). Granulosa cells, as the supporting cells of follicles, play a major role in the development and maturation of oocytes in vivo and in vitro, and apoptosis of granulosa cells is related to the decline of oocyte quality, embryonic rupture, and impaired blastocyst development (Meng et al. 2013). A previous study showed that apoptosis is easily induced in ovarian granulosa cells of PCOS patients (Lombardi et al. 2014); the imbalance between pro- and anti-apoptotic influences in ovarian granulosa cells may contribute to the progression of PCOS (Zhao et al. 2013).

PCOS is a highly heterogeneous disease that may be caused by a combination of factors such as changes in hormonal regulation, lifestyle, epigenetics, and exposure to environmental exogenous substances. However, the etiology of PCOS is complicated, and there are many unknowns and disputes. Recently, the relationship between inflammation and PCOS has gained more attention, and multiple studies have confirmed that patients with PCOS are in a state of chronic inflammation (Blair et al. 2013, Ojeda-Ojeda et al. 2013, Wang et al. 2017). Levels of proinflammatory cytokines including C-reactive protein (CRP), interleukin-6 (IL-6), IL-18, plasminogen activator inhibitor-1 (PAI-1), monocyte chemotactic factor-1 (MCP-1), and tumor necrosis factor-α (TNF-α) are significantly increased in serum and follicular fluid in PCOS patients which is related to the enhanced risk of insulin resistance and cardiovascular disease (Chen et al. 2014). Emerging evidence suggests that low-grade chronic inflammation plays an essential role in the pathogenesis of PCOS (Escobar-Morreale et al. 2011, Deligeoroglou et al. 2012, Shorakae et al. 2015).

If inflammatory factors affect the genesis and development of PCOS, then chemokines, as powerful chemotactic immunoregulatory cytokines, may also be involved. Chemokines, which are also proinflammatory chemoattractant cytokines, are small proteins controlling the migration of diverse cells. C-X-C motif chemokine ligand 12 (CXCL12), also termed stromal cell-derived factor 1 (SDF-1), is a typical bone marrow-derived chemokine that is expressed in many cell types (Dai et al. 2019). C-X-C motif chemokine receptor 4 (CXCR4) was long considered to be the only receptor for CXCL12 (Valentin et al. 2007). However, a member of the atypical chemokine receptor subgroup (ACKR), C-X-C motif chemokine receptor 7 (CXCR7), has been identified recently as the second receptor for CXCL12 and has a 10-fold higher affinity for CXCL12 than CXCR4 does (Balabanian et al. 2005). CXCL12, CXCR4, and CXCR7 have been demonstrated to play a crucial role in several biological processes, including cell proliferation, apoptosis, invasion, migration, angiogenesis, and embryonic development (Liu et al. 2016, Qiao et al. 2016, Chu et al. 2017, Reeves et al. 2017, Chang et al. 2020, Xie et al. 2020). Previously, our team conducted a broad screening of chemokines at the maternal–fetal interface and screened out CXCL12. And then we confirmed its expression and functional study of immune tolerance at the maternal–fetal interface in human early pregnancy. Subsequent studies found that human endometrial stromal cells also expressed CXCL12, CXCR4 and CXCR7 in mRNA levels, furthermore, the expression patterns of CXCL12, CXCR4, and CXCR7 in trophoblast cells (TCs) are associated with TC apoptosis, proliferation, and invasion (Zhou et al. 2008, Lu et al. 2016, 2020). In large monovulatory species such as sheep, horses, and cows, the CXCL12/CXCR4 axis has key functions in the interaction network between oocytes and granulosa cells that affect oocyte maturation, indicating that it is possible that CXCL12 may also play an important role in the microenvironment of follicular development (Sayasith & Sirois 2014, Zhang et al. 2018). However, little research has been focused on the relationship between CXCL12, CXCR4, and CXCR7 and the apoptosis of ovarian granulosa cells in PCOS.

In this study, we determined the expression patterns of CXCL12 and its receptors CXCR4 and CXCR7 in the ovaries from PCOS rat model, and their role in regulating the apoptosis of ovarian granulosa cells. First, we generated a PCOS rat model treated with a nonsteroidal aromatase inhibitor, letrozole. Its phenotype mirrors the reproductive and metabolic disorders of PCOS patients (Maliqueo et al. 2013, Noroozzadeh et al. 2017). We used this model to explore the expression of CXCL12, CXCR4, and CXCR7 and the apoptosis of granulosa cells. Secondly, recombinant human CXCL12 (rhCXCL12), CXCR4 antagonist AMD3100, and anti-CXCR7 neutralizing antibody were added to KGN cells (a human ovarian granulosa cell line) in vitro to investigate the role of CXCL12 and its receptors CXCR4 and CXCR7 in regulating the expression of apoptosis regulatory proteins and the apoptosis of ovarian granulosa cells. This research may help us better understand the role of CXCL12, CXCR4, and CXCR7 in the pathogenesis of PCOS, and thereby provide a new therapeutic target for PCOS.

Materials and methods

Animals

Thirty 6-week-old Sprague–Dawley female rats were purchased from Beijing Vital River Laboratory Animal Company. All rats were allowed to adapt to the environment for 1 week. All animals had free access to water and food in a breeding room maintained at a temperature of 25 ± 2°C on a alternating 12 h light:12 h darkness cycle. The study was approved by the Ethics Committee of Wuhan University (No. 2019071).

Experimental design

Rats were randomly assigned to two groups, a control group and a PCOS model group. The PCOS rat model was developed by orally administering 1 mg/kg letrozole (Sigma) in 0.4 mL 1% sodium carboxymethylcellulose (CMC-Na, Solarbio, China) at 08:00 h each day for 21 consecutive days. The control group was orally administered the same amount of 1% CMC-Na for 21 days. Body weight was monitored daily during the entire experimental procedure.

After the PCOS rat model was established, nine control and nine PCOS rats were deeply anesthetized by intraperitoneal injection of 2% sodium pentobarbital (40 mg/kg) for sample collection. Blood samples were collected from each heart into centrifuge tubes held at 37°C for 1 h, and then serum was separated by centrifugation at 906 g for 10 min. Both ovaries of all rats were taken out and weighed immediately; one was used for histological analysis, and the other was stored at −80°C until further analysis. Besides, six rats of each experimental group received an intraperitoneal injection of pregnant mare serum gonadotropin (PMSG, 50 IU; Solarbio). After 48 h, their ovaries were collected for isolation of granulosa cells. All rats were euthanized by cervical dislocation after sample collection.

Ovarian morphology and immunohistochemical staining

Ovaries were fixed in 4% paraformaldehyde in buffer (Beyotime, China) for at least 24 h, then dehydrated, embedded in paraffin, and sectioned at a thickness of 4 μm. To observe the morphological characteristics of ovaries, we stained the sections with hematoxylin and eosin (H&E, Solarbio). Ovarian morphology was observed and photographed with a light microscope (Olympus).

For immunohistochemical analysis, the sections were deparaffinized and rehydrated. Following the manual of the SP Kit (Rabbit, Solarbio), the sections were quenched in 3% H2O2 for 15 min, then put into microwave oven with citrate buffer (pH 6.0, Beyotime) to unmask antigens and blocked with 5% blocking serum (Yang et al. 2019). Sections were incubated in primary antibody for CXCL12, CXCR4, CXCR7, BAX, BCL2, and cleaved CASPASE3 (cleaved CASP3) overnight at 4°C (antibody details in Table1). Negative control was incubated with rabbit isotype IgG (Table1) instead of the primary antibody. After washing with PBS, the sections were incubated with a biotinylated secondary antibody (Table 1) and then with streptavidin-peroxidase solution according to the manufacturer’s directions. Finally, DAB solution was applied for the visualization of the reaction product. Sections were counterstained with hematoxylin, dehydrated, cleared in xylene, mounted, and observed with a microscope. The immunostaining intensity was determined by measuring the mean optical density using Image-Pro Plus 6.0. Six sections from different ovaries of each group were used for analysis; the mean optical density of every section was taken as the average of the mean optical density of ten random fields.

Table 1

Antibody used for immunohistochemistry, immunofluorescence and Western blotting.

Name Distributor Catalogue Number Species Dilution
IHC IF WB
Anti-CXCL12 antibody Abcam ab9797 Rabbit 1:1000
Anti-CXCR4 antibody Abcam ab197203 Rabbit 1:1000 1:1000

Anti-CXCR7 antibody Novus NBP2-24779 Rabbit 1:1000 1:100

Anti-Bax antibody Abcam ab32503 Rabbit 1:250 1:1000

Anti-Bcl-2 antibody Abcam ab196495 Rabbit 1:500 1:1000

Anti-caspase-3 antibody Abcam ab184787 Rabbit 1:100 1:5000

Anti-GAPDH antibody Abcam Ab9485 Rabbit 1:10,000
Rabbit IgG isotype control Abcam ab172730 Rabbit 1:100
Anti-FSHR antibody Proteintech Group 22665-1-AP Rabbit 1:50
Secondary antibody conjugated with CY3 Aspen AS1109 Goat 1:50
Biotinylated secondary antibody Solarbio SP0021 Goat 1:100
Horseradish peroxidase (HRP)-conjugated secondary antibody Aspen AS1107 Goat 1:5000

IHC, immunohistochemistry; IF, immunofluorescence; WB, Western blotting.

TUNEL assay

The TUNEL assay was carried out using the Colorimetric TUNEL Apoptosis Assay Kit (Beyotime). Slides were deparaffinized at room temperature, washed three times with PBS, incubated with proteinase K for 30 min at 37°C (Beyotime), rinsed three times with PBS, then quenched in 3% H2O2 in PBS for 20 min at room temperature. The sections were rinsed three times with PBS, then incubated in a solution composed of terminal deoxynucleotide transferase (TdT) and biotinylated (Bio-16) dUTP in TdT buffer in a humid chamber at 37°C for 1 h. The number of TUNEL positive cells was counted manually in six sections from different ovaries of each group (five random fields per section), and the apoptosis rate was calculated as the percentage of TUNEL-positive cells relative to the total cells.

Isolation of rat primary ovarian granulosa cells and cell culture

The ovaries were rinsed in PBS then transferred into DMEM and Ham’s F-12 medium (DMEM/F12, Gibco). The cells were harvested by puncturing the follicles with a 26-gauge needle and then incubating in 0.25% trypsin–EDTA solution (Beyotime) at 37°C for 45 min, during which time the cells were pipetted up and down to disperse the cells into a single-cell suspension; then DMEM/F12 medium with 10% fetal bovine serum (FBS, TIANHANG, China) was added to the suspension. Primary rat granulosa cells were separated from oocytes by filtering the oocyte/granulosa cell suspension through a 75-μm cell sieve (Falcon, USA) and centrifuged at 100 g for 5 min. The isolated granulosa cells were then cultured in DMEM/F12 medium with 10% FBS and 1% penicillin–streptomycin at 37°C in an atmosphere of 5% CO2 (Lovekamp & Davis 2001, Song & Tan 2019). The rat primary granulosa cells extracted from each rat were cultured independently. Culture supernatant was collected after 24, 48, and 72 h. The supernatant was then centrifuged at 1000 g for 20 min and collected. When the cell adherence rate was about 80%, after digesting and counting the cells, 5 × 104 cells from each sample were isolated and seeded into each well (with coverslip) of a 24-well plate for the identification of rat primary ovarian granulosa cells, and the remaining cells were collected for subsequent testing.

KGN cells were obtained from American Type Culture Collection (ATCC®). The cells were seeded into 55 cm2 dishes and cultured in DMEM/F12 medium including 10% FBS and 1% penicillin–streptomycin at 37°C in an atmosphere of 5% CO2. To detect the role of CXCL12, the cells were inoculated into a six-well plate; when the adherence rate was about 50–70%, the cells were starved using DMEM/F12 medium with 0.5% FBS for 12 h. After that, rhCXCL12 (0, 10, 50, and 100 ng/mL, Peprotech, USA) and rhCXCL12 (100 ng/mL) with CXCR4 antagonist AMD3100 (1 μg/mL; Sigma), anti-CXCR7 neutralizing antibody (10 μg/mL; R&D Systems), or isotype control antibody (10 μg/mL; R&D Systems) were added for 24 h incubation and cells were collected for subsequent testing.

Morphology and identification of rat primary ovarian granulosa cells

Because FSH receptor (FSHR) is expressed only in granulosa cells, immunofluorescence staining was conducted to assess cell purity; the requirement for subsequent trials is met if the positivity rate is >95%. Cells grown on coverslips were fixed with 4% paraformaldehyde at room temperature for 20 min. Next, cells were blocked with 5% BSA for 1 h and incubated with anti-FSHR (antibody details in Table1) overnight at 4°C. After washing, secondary antibody conjugated with Cy3 (Table1) was used at room temperature for 1 h. Nuclei were stained with DAPI for 5 min in darkness. Images were captured with a fluorescent microscope (Olympus).

Flow cytometry

KGN cells were detached with 0.25% trypsin (without EDTA; Beyotime) and collected in a centrifuge tube. The cell suspension was centrifuged at 1000 g for 5 min. After discarding the supernatant, the cells were gently resuspended in PBS and counted. Aliquots of 1 × 105 resuspended cells were centrifuged at 1000 g for 5 min. The cells were stained with the Annexin V-fluorescein isothiocyanate/propidium iodide apoptosis detection kit (Beyotime) according to the manufacturer’s protocol, then analyzed immediately using CytoFlex (Beckman, USA) equipped with CytExpert software (Beckman). These experiments were repeated three times.

Enzyme-linked immunosorbent assay (ELISA)

The levels of CXCL12 in serum and the supernatants of cultured cells, and the levels of reproductive hormone including follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), and total testosterone (T) in serum were quantified using ELISA kits (Elabscience, China) following the manufacturer’s instructions. Experiments were performed in triplicate and repeated three times. Intra-assay coefficients of variation were 4.9, 5.5, 5.3, 4.3, 7.2, and 6.4%, respectively, and inter-assay coefficients of variation were 5.2, 6.0, 5.8, 5.4, 7.8 and 7.4%, respectively.

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from rat ovarian tissue and KGN cells using the Easy-spin RNA Mini Kit (Aidlab, China) according to the manufacturer’s protocols. The concentration and purity of RNA were determined from OD260/280 using a Nanodrop spectrophotometer (Thermo Fisher Scientific), and the quality of RNA was checked by agarose gel electrophoresis.

Each reverse-transcribed PCR was performed in a 10 μL reaction system using a RT kit (Vazyme, China) and the quantity of RNA was 500 ng. According to the manufacturer’s instructions, RNA samples were treated with gDNA wiper Mix to avoid genomic DNA contamination, and the RT conditions included 15 min of cDNA synthesis at 50°C and 5 s of revertase inactivation at 85°C. The cDNA samples were stored at −20°C until use.

Real-time PCR was performed to analyze mRNA expression of Cxcr4, Cxcr7, Bax, Bcl2, and Gapdh in rat ovarian tissue and CXCR4, CXCR7, BAX, BCL2 and GAPDH in KGN cells, using the ChamQ SYBR qPCR Master Mix Kit (Vazyme). The primer sequences used (Tianyihuiyuan, China) are shown in Table 2. Primers and amplification products were verified by using Basic Local Alignment Search Tool (BLAST) to confirm gene specificity. Each PCR was performed in a total volume of 20 μL containing 2 μL cDNA, 10 μL 2× ChamQ SYBR qPCR Master Mix, 0.4 μL of each 10 μM forward/reverse primer, and 7.2 μL ddH2O on the CFX Connect™ Real-time PCR detection system (Bio-Rad), with these amplification conditions: pre-denaturation at 95°C for 30 s followed by 40 cycles of denaturation at 95°C for 10 s and annealing for 30 s. Negative DNA template controls were included in all assays. Product purity was checked by melting curves, and product size was analyzed by agarose gel electrophoresis. The relative mRNA expression of target genes was normalized to a steady amount of GAPHD mRNA as a reference gene and calculated using the 2-ΔΔCt formula (Bio-Rad CFX Maestro V4.0.2325.0418 software) (Song & Tan 2019). All the experiments were performed in triplicate and repeated three times.

Table 2

Oligonucleotide primers in real-time quantitative PCR.

Genes Forward primer Reverse primer Gene accession no. Amplicon size (bp) Annealing temperature (°C)
Cxcr4 (Rat) GCTGAGGAGCATGACAGACA GATGAAGGCCAGGATGAGAA NM_022205 187 56
Cxcr7 (Rat) GCACTACATCCCGTTCACCT AAGGCCTTCATCAGCTCGTA XM_006245479 150 57
Bcl2 (Rat) TGACTTCTCTCGTCGCTACCG GAAGAGTTCCTCCACCACCGT NM_016993 109 58
Bax (Rat) CAGGACGCATCCACCAAGAA CCTCTCGGGGGGAGTCTGTA NM_017059 118 59
Gapdh (Rat) CTCATGACCACAGTCCATGC TTCAGCTCTGGGATGACCTT NM_017008 155 57
BCL2 (Human) GGAGAGCGTCAACAGGGAGA CAGCCAGGAGAAATCAAACAGAG NM_000633 169 57
BAX (Human) TGACGGCAACTTCAACTGGG GGGACATCAGTCGCTTCAGT NM_001291428 212 57
GAPDH (Human) CATCATCCCTGCCTCTACTGG GTGGGTGTCGCTGTTGAAGTC NM_001256799 259 58

Western blotting (WB)

Total proteins were extracted with RIPA lysis buffer (Beyotime) plus 1:100 volume of phenylmethanesulfonyl fluoride (PMSF, Beyotime) and centrifuged at 13,800 g for 20 min at 4°C. The supernatant was collected to determine the protein concentration using a bicinchoninic acid protein assay kit (Beyotime). Total proteins (30 μg/group) were separated using 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Biosharp, China). Following blocking with QuickBlock™ Western blotting blocking reagent (Beyotime) for 1 h at room temperature, the membranes were incubated with antibodies against CXCR4, CXCR7, BAX, BCL2, cleaved CASP3 or GAPDH (antibody details in Table1) at 4°C overnight. The following day, the membranes were washed with TBST three times and further incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (Table1) at 37°C for 1 h. Finally, the protein bands were visualized using ECL plus Western blotting detection reagent (Vazyme), and the densities of the immunoblots were analyzed by ImageJ software. The experiments were repeated three times.

Statistical analysis

All data are expressed as mean ± s.d . Statistical analysis was performed using SPSS version 23.0 software. For comparison, differences between control and PCOS model groups were analyzed with Student’s t-test, and differences between control and different treatment groups were determined by one-way ANOVA. P < 0.05 was considered to indicate a significant difference.

Results

The establishment of the rat model

We treated rats with letrozole to create the PCOS model. The body weight of rats in the control and PCOS model groups were significantly different from the 5th day (Fig. 1A). Compared with the control group, ovarian weight in the PCOS model group was significantly increased (Fig. 1B). H&E staining of the control group showed follicles of different developmental stages, a few fresh corpora lutea, and an orderly arrangement of the granulosa cells. Meanwhile, H&E staining of the PCOS model group showed pathological changes. The number of small follicles and follicles with cystic dilatation increased, atretic follicles were observed, the number of corpora lutea was decreased, and the granulosa cells were arranged in 2–3 layers that were looser than in the control group (Fig. 1C). ELISA showed that serum levels of LH and FSH were increased in the PCOS model group, while LH/FSH ratios showed no statistical difference between groups; T was also significantly increased, whereas the E2 level was decreased in the PCOS model group compared to the control group (Table 3). These results are consistent with human PCOS characteristics, demonstrating that the PCOS rat model was successfully established.

Figure 1
Figure 1

The establishment of the rat model. (A) Body weight of the control group (n = 15) and PCOS model group (n = 15) during the administration process. (B) Ovarian weight of the control group (n = 18) and PCOS model group (n = 18). (C and D) H&E staining of rat ovarian tissues (magnification ×10 for C and magnification ×20 for D), normal follicles (arrows), corpus luteum (asterisk), cystic follicles (triangles). *P < 0.05, **P < 0.01, #P < 0.001.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

Table 3

Hormone levels between PCOS model and control group.

Group LH (ng/mL) FSH (ng/mL) E2 (pg/mL) T (ng/mL) LH/FSH
Control 4.13 ± 0.24 4.51 ± 0.51 9.20 ± 0.86 0.34 ± 0.16 0.94 ± 0.05
Model 6.24 ± 0.87* 5.74 ± 0.15* 5.77 ± 1.18* 1.74 ± 0.40* 1.08 ± 0.13
P-value 0.0473 0.0497 0.0472 0.0115 0.3306

*P < 0.05 between the PCOS and the control groups.

E2, estradiol; FSH, follicle-stimulating hormone; LH, luteinizing hormone; T, testosterone.

Expression of CXCL12, CXCR4, and CXCR7 in rats

ELISA was performed to detect the level of CXCL12 in serum, immunohistochemistry (IHC) analysis was performed to localize expression of CXCL12, CXCR4, and CXCR7 in ovary samples, and RT-qPCR and Western blotting (WB) were performed to quantitate the expression of CXCL12, CXCR4, and CXCR7 in ovary samples. The serum CXCL12 level was lower in the PCOS model group compared to the control group (Fig. 2G). RT-qPCR revealed that Cxcr4/Cxcr7 mRNA levels in ovaries of the PCOS model group were decreased relative to those of the control group (Fig. 2A). WB analysis showed that the protein expression of CXCR7 was significantly downregulated in ovaries of the PCOS model group relative to that of the control group, while there was no statistical difference in the protein expression of CXCR4 in ovaries between the two groups (Fig. 2B). With IHC, CXCL12 protein was localized to the cytoplasm of granulosa cells and also aggregated outside the cell. The mean density of CXCL12 on granulosa cells in the PCOS group was significantly decreased compared to that of the control group (Fig. 2C). CXCR4 and CXCR7 proteins were localized to the cytoplasm and cytomembrane of granulosa cells, and the mean density of CXCR4 and CXCR7 on granulosa cells in the PCOS model group was significantly decreased compared to the control group (Fig. 2D and E). Taken together, the above results demonstrate that there was lower expression of CXCL12, CXCR4, and CXCR7 in serum, ovarian tissue, and granulosa cells of PCOS rats than control rats.

Figure 2
Figure 2

Expression of CXCL12, CXCR4, and CXCR7 in the control group (n = 6) and PCOS model group (n = 6). (A) Relative mRNA expression of Cxcr4 and Cxcr7 in ovarian tissues. (B) The protein expression of CXCR4 and CXCR7 in ovarian tissues. (C, D and E) Immunohistochemistry analysis of CXCL12, CXCR4, and CXCR7 in ovarian tissues (magnification ×200), granulosa cell layer (GC). (F) Negative control of immunohistochemistry analysis in ovarian tissues (incubating with rabbit isotype IgG instead of the primary antibody). (G) The serum CXCL12 levels in two groups. *P < 0.05, **P < 0.01, ***P < 0.001, ns indicated non-significant.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

Apoptosis and expression of apoptosis regulatory proteins in ovarian granulosa cells

In order to investigate apoptosis and the expression of apoptosis regulatory proteins in ovarian granulosa cells, the rate of apoptosis of granulosa cells and the expression of BAX, BCL2, and cleaved CASP3 were detected by TUNEL staining and IHC analysis, respectively. According to the TUNEL results, the rate of apoptotic granulosa cells was significantly increased in the PCOS model group (Fig. 3A). IHC analysis revealed that expression of BAX and cleaved CASP3 in granulosa cells of the PCOS model group was higher than in those of the control group (Fig. 3B and D). In contrast, expression of BCL2 was decreased in the PCOS model group (Fig. 3C). Apoptosis of ovarian granulosa cells was increased in the PCOS model group, associated with upregulated expression of pro-apoptotic proteins and downregulated expression of anti-apoptotic proteins.

Figure 3
Figure 3

Apoptosis and expression of apoptosis regulatory proteins in ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (A) The apoptosis rate of ovarian granulosa cells. (B, C and D) IHC analysis of BAX, BCL2, and cleaved CASP3 in ovarian tissues (magnification ×200). (E) Negative control of immunohistochemistry analysis in ovarian tissues (incubating with rabbit isotype IgG instead of the primary antibody). *P < 0.05, **P < 0.01.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

Identification of rat primary ovarian granulosa cells

To determine the purity of rat primary ovarian granulosa cells, we used immunofluorescence (IF) staining to examine FSHR expression, which is limited to granulosa cells. FSHR staining was present mainly in the cytoplasm, with >95% of the cells being positive (Fig. 4A). Therefore, the isolated granulosa cells met the requirements for subsequent experiments.

Figure 4
Figure 4

Expression of CXCL12, Cxcr4, Cxcr7 and Bax, Bcl2 in rat primary ovarian granulosa cells. (A) Identification of rat primary ovarian granulosa cells (magnification ×200). (B) Secretion of CXCL12 by rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (C) The mRNA level of Cxcr4, Cxcr7 in rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (D) The mRNA level of Bax and Bcl2 in rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). *P < 0.05, **P < 0.01.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

Secretion of CXCL12 by rat primary ovarian granulosa cells

We carried out ELISA to examine CXCL12 secretion by primary ovarian granulosa cells. Supernatants of cultured cells were collected at 24, 48, and 72 h. There was no significant difference between the groups at 24 h; however, at 48 and 72 h, the level of CXCL12 in the PCOS model group became higher than that in the control group (Fig. 4B). This indicates that CXCL12 can be secreted by granulosa cells and that granulosa cells of the PCOS model group produced more CXCL12 than those of the control group after 48 and 72 h of culture.

Expression of Cxcr4, Cxcr7, Bax, and Bcl2 in rat primary ovarian granulosa cells

RT-qPCR was used to explore the expression of Cxcr4, Cxcr7, and apoptosis regulatory proteins in rat primary ovarian granulosa cells. The expression of Cxcr4 andCxcr7 mRNA was lower in primary ovarian granulosa cells from the PCOS model group than in those from the control group (Fig. 4C). The Bax mRNA expression level was increased, whereas the Bcl2 mRNA level was decreased in the PCOS model group (Fig. 4D). These results were in accord with the protein expression patterns of CXCR4, CXCR7, BAX, and BCL2 as determined with IHC.

The role of CXCL12 on apoptosis of KGN cells

To further investigate the relationship between CXCL12 and apoptosis of ovarian granulosa cells, rhCXCL12 was added to KGN cells at concentrations of 0, 10, 50, and 100 ng/mL, then the apoptosis rate was examined by flow cytometry and expression of BAX, BCL2, and cleaved CASP3 was detected by RT-qPCR and WB. There was a dose-dependent decrease in the apoptosis rate of KGN cells with increasing concentration of CXCL12 (Fig. 5A). BCL2 expression was significantly increased and BAX and cleaved CASP3 expression were decreased by CXCL12 treatment relative to control treatment (Fig. 5B, C, D, E, F and G). These results suggest that the role of CXCL12 on the KGN cells was anti-apoptotic.

Figure 5
Figure 5

The Role of 0 ng/mL (n = 6), 10 ng/mL (n = 6), 50 ng/mL (n = 6), and 100 ng/mL (n = 6) CXCL12 on Apoptosis of KGN cells. (A) The apoptosis rate of KGN cells after incubation with 0, 10, 50, and 100 ng/mL rhCXCL12 for 24 h. (B, C, D and E) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after rhCXCL12 incubation. (F and G) Relative mRNA expression of BAX and BCL2 in KGN cells after rhCXCL12 incubation. *P < 0.05, **P < 0.01, ***P < 0.001.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

The role of CXCL12 and its receptors CXCR4 and CXCR7 on apoptosis of KGN cells

To further explore the role of CXCL12 and its receptors CXCR4 and CXCR7 on apoptosis of KGN cells, 100 ng/mL rhCXCL12 (CXCL12), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + anti-CXCR7), or 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG) were added to the KGN cells, then flow cytometry was used to detect apoptosis rate. The apoptosis rate was significantly higher for the CXCL12 + AMD3100 group compared with the CXCL12 group and for the CXCL12 + anti-CXCR7 group compared with the CXCL12 + IgG group. Meanwhile, there were also statistically significant differences between the apoptosis rates of the CXCL12 + anti-CXCR7 group and the control group, while the value of CXCL12 + anti-CXCR7 group was between the control group and CXCL12 + IgG group (Fig. 6). These data demonstrate that CXCL12 inhibited apoptosis of KGN cells through CXCR4- and CXCR7-mediated signal transmission. Moreover, blocking CXCR4 with AMD3100 almost entirely reversed the effect of rhCXCL12 on apoptosis, whereas blocking CXCR7 with anti-CXCR7 only partially reversed it.

Figure 6
Figure 6

The role of CXCL12 and its receptors CXCR4, CXCR7 on Apoptosis of KGN cells. Apoptosis rate of KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype IgG (CXCL12 + IgG, n = 6) incubation for 24 h. *P < 0.05.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

The role of CXCL12 and its receptors CXCR4 and CXCR7 in regulating expression of apoptosis regulatory proteins BAX, BCL2, and cleaved CASP3 in KGN cells

We added 100 ng/mL rhCXCL12 (CXCL12), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + anti-CXCR7), or 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG) to the KGN cells to further investigate if CXCL12 and its receptors CXCR4 and CXCR7 were involved in regulating the expression of KGN cell apoptosis regulatory proteins BAX, BCL2, and cleaved CASP3. RT-qPCR and WB were used to detect expression of BAX, BCL2, and cleaved CASP3. Comparing the CXCL12 + AMD3100 group with the CXCL12 group and the CXCL12 + anti-CXCR7 group with the CXCL12 + IgG group, the expression of BCL2 was upregulated, and the expression of both BAX and cleaved CASP3 was downregulated (Fig. 7). These results show that CXCL12 downregulated expression of pro-apoptotic proteins and upregulated expression of anti-apoptotic protein through the CXCR4- and CXCR7-mediated signal transmission.

Figure 7
Figure 7

The role of CXCL12 and its receptors CXCR4, CXCR7 on regulating the expression of apoptosis regulatory proteins BAX, BCL2, cleaved CASP3 in KGN cells. (A) Relative mRNA expression of BAX/BCL2 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6) incubation for 24 h. (B) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6) incubation for 24 h. (C) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG, n = 6) incubation for 24 h. (D and E) Relative mRNA expression of BAX/BCL2 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL antiCXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG, n = 6) incubation for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001.

Citation: Reproduction 161, 2; 10.1530/REP-20-0451

Discussion

A variety of methods have been used to induce PCOS models in rodents, including exposure to androgens, aromatase activity blockers that prevent the transformation of androgens to estrogens, anti-progestin drugs, and genetic modification (Manneras et al. 2007, van Houten et al. 2012). In this study, rats were treated with letrozole (an aromatase activity blocker) at a daily dose of 1 mg/kg by oral gavage for 21 days to generate the PCOS model. After 21 days, the rats showed expected key features including obesity, increased ovarian weight, ovarian cysts with increased diameter, atretic follicles, hyperandrogenism, and oligo-ovulation, all similar to the PCOS phenotype in women and thus indicating the successful establishment of the rat model. This is in agreement with previous studies (Maharjan et al. 2010, Patel & Shah 2018).

The chemokine CXCL12 and its receptors CXCR4 and CXCR7 are widely expressed in a variety of organs and cells, including heart, liver, spleen, lung, kidney, bone marrow, brain, and various immune cells (Wurth et al. 2014). In the present study, the level of CXCL12 in serum from PCOS rats was significantly lower than control rats. WB analysis of ovaries showed that the expression of CXCR7 was significantly decreased in PCOS rats, whereas CXCR4 showed no significant difference between the two groups. Because the whole rat ovary includes a number of different cell types, such as granulosa, theca, and interstitial cells, the expression of CXCR4 and CXCR7 in the ovary is the integrated expression of a mixture of cell types. To further explore how CXCR4 and CXCR7 exert their biological functions, it is necessary to detect the protein expression in ovarian granulosa cells exclusively. Consequently, we isolated relatively pure rat primary granulosa cells from the ovary, then demonstrated that there was significantly decreased expression of CXCR4 and CXCR7 in granulosa cells of PCOS rats. Previous studies demonstrated ovarian expression of CXCL12 and CXCR4 in rats and swine (Basini et al. 2020, Zhang et al. 2020b). Additionally, the expression of CXCL12, CXCR4, and CXCR7 in human epithelial ovarian cancer has been examined (Jaszczynska-Nowinka et al. 2014). Meanwhile, the joint expression of CXCL12 and its receptors CXCR4 and CXCR7 in the ovary of PCOS rat is shown for the first time in the present study. Taken together, these findings suggest that decreased expression of CXCL12 and its receptors CXCR4 and CXCR7 may be involved in the pathogenesis of PCOS. However, it cannot be excluded that other inflammatory factors could be involved in the pathogenesis of PCOS.

Our previous study confirmed that CXCL12 can be secreted by human trophoblasts and may play an important role in autocrine stimulation of cell proliferation (Zhou et al. 2008, Ren et al. 2012). Similarly, we observed in this study that primary ovarian granulosa cells of rats can spontaneously secrete CXCL12 in vitro. Unexpectedly, we found that granulosa cells from PCOS rats produced more CXCL12 after 72 h culture than granulosa cells from control rats, which is opposite to the results regarding serum CXCL12 level in rats. There is a difference between the growth environment and culture condition of ovarian granulosa cells in vitro and in vivo. In vivo, there is interaction between granulosa cells and other cells, but in vitro, there are only granulosa cells. For example, CXCL12 in sheep follicles is produced in both granulosa cells and oocytes and works in a paracrine or autocrine manner (Zhang et al. 2018). Moreover, rats were injected with PMSG before collecting ovaries for granulosa cell isolation, which differs from the treatment before collecting serum for ELISA and ovaries for IHC. During controlled ovarian stimulation, an important part of in vitro fertilization, it was found that using exogenous gonadotropins changed the circulating Th1/Th2 cytokine ratio (Liang et al. 2015). Similarly, the expression of CXCL12 might have been affected by PMSG injection. These considerations may explain why the results are different. Apparently, the expression of CXCL12 in vivo (serum and granulosa cells) may be more representative of the environment affecting the pathogenesis of PCOS than the environment in vitro.

Cell apoptosis is of vital importance during the entirety of follicular development in the ovary. Some studies suggest that the dysfunction of granulosa cells may be the primary cause of numerous symptoms in PCOS patients (Shalev et al. 2001). In this study, we discovered with TUNEL staining that the apoptosis rate of ovarian granulosa cells was increased in the PCOS rat model induced by letrozole. Previous studies found that the apoptosis rate of ovarian granulosa cells in PCOS patients and in the PCOS rat model induced by mifepristone was relatively increased, perhaps inducing follicular premature atresia in PCOS (Cataldo et al. 2000, Ding et al. 2016, Zheng et al. 2017). Therefore, the results suggest a close correlation of increased ovarian granulosa cell apoptosis rate with PCOS.

Members of the BCL2 protein family are involved in the regulation of apoptosis, the most prominent members being the anti-apoptotic regulator BCL2 and pro-apoptotic activator BAX. An imbalance between BCL2 and BAX interactions can cause apoptosis. We found that BAX expression increased and BCL2 expression decreased in the PCOS group relative to the control group, which is in accordance with previous research in rat PCOS induced by insulin (Chi et al. 2018). The CASPASE family also plays a key role in the molecular mechanism of apoptosis induction, is the convergence point of multiple apoptosis pathways, the final route to carry out apoptosis, and is also considered to be an irreversible core point in the execution of apoptosis. Among them, CASP3 is usually expressed as an inactive precursor. After being activated by pro-apoptotic signals, CASP3 is proteolytically cleaved into its active form, cleaved CASP3, then apoptotic degradation is initiated and executed, which is one of the most famous signs of apoptosis (Bernard et al. 2019). Our study found for the first time that the expression of cleaved CASP3 in ovarian granulosa cells of PCOS rats increased. Similarly, previous studies found that CASP3 is involved in the regulation of ovarian granulosa cell apoptosis; moreover, CASP3 activity has been confirmed to be increased in ovarian tissue of PCOS rats (Salehi et al. 2017, Mao et al. 2018).

Previous reports suggest a role of CXCL12 in apoptosis, although the function of CXCL12 in granulosa cells remains largely unknown (Hattermann et al. 2012). We found that rhCXCL12 down-regulated BAX, cleaved CASP3 and upregulated BCL2 in KGN cells to inhibit apoptosis in a concentration-dependent manner, with 100 ng/mL rhCXCL12 showing the most significant effect. It has been confirmed that CXCL12 reduces the early apoptosis of human granulosa cells accompanied by the altered expression of BCL2 and BAX (Kryczek et al. 2005). In the present study, it was also observed that the effect of CXCL12 was weakened by AMD3100 and anti-CXCR7 neutralizing antibody. It has been shown that CXCL12 can protect cardiomyocytes from apoptosis through its receptor CXCR4 (Liu et al. 2011). Besides, inhibiting the function of CXCR4 in sheep decreased the cumulus expansion growth rate and the maturity of the oocyte, while supplementing recombinant CXCL12 promoted oocyte maturation by targeting granulosa cells (Zhang et al. 2018). In addition, activation of CXCR7 plays an important protective role for ischemic cells in hypoxic endothelial cells and acute myocardial infarction model mice by reducing apoptosis (Zhang et al. 2020a). Notably, we found that blocking CXCR4 with AMD3100 almost completely reversed the effect of rhCXCL12 on apoptosis, whereas blocking CXCR7 reversed only part of it. Although both CXCR4 and CXCR7 are receptors for CXCL12, their different expression and signal transduction mechanisms may underlie their different effects. CXCR4 is located on the cell membrane and belongs to the seven-pass transmembrane G-protein-coupled receptor (GPCR) family. The classic signal-mediated pathway is to receive external signals and change its conformation, which causes intracellular G protein dissociation and second messenger cascade signal amplification before finally yielding a response; this plays an important role in various physiological or pathological processes including cell proliferation and apoptosis. Unlike CXCR4, CXCR7 does not activate G protein after properly binding to its ligand (Bachelerie et al. 2014). CXCR7 could form heterodimers with CXCR4 to induce conformational changes of CXCR4/G protein and prevent signal transduction (Decaillot et al. 2011). Furthermore, CXCR7 could also activate intracellular signal transduction pathways through β-arrestin-dependent pathways, including the elimination of CXCL12 (Wang et al. 2011, Singh et al. 2013). Therefore, we propose that CXCR7 involvement in apoptosis of granulosa cells, which is complicated, may involve forming heterodimers with some amount of CXCR4, thereby blocking signal transduction (Levoye et al. 2009). Further studies still need to be undertaken to elucidate the interaction of CXCR4 and CXCR7 in granulosa cells apoptosis and the underlying mechanisms. In tumor cells, CXCR4 regulates cell survival through activating G protein-dependent JNK, p38 MAPK and CXCR7 regulates through β-arrestin-mediated ERK1/2 phosphorylation (Rajagopal et al. 2010). Regrettably, the downstream signal molecules activated by CXCL12, CXCR4, and CXCR7 were not involved in our design of experiments.

Taken together, the results of the current study showed that the apoptosis rate of ovarian granulosa cells was increased and the CXCL12, CXCR4 and CXCR7 expression of ovarian granulosa cells was decreased in PCOS rats. Further, it was found that CXCL12 regulated the expression of BAX, BCL2, and cleaved CASP3 to inhibit apoptosis of KGN cells through the CXCR4-mediated and CXCR7-mediated signal transmission. This study provides a theoretical and practical basis for illuminating the role of proinflammatory cytokines in the pathogenesis of PCOS, and CXCL12 may be utilized as a therapeutic target for PCOS, providing new insights into the diagnosis and treatment of PCOS.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by Health and Family Planning Commission of Hubei Province (grant number: WJ2017Q013); National Natural Science Foundation of China (grant number: 81370707).

Author contribution statement

R L and L J designed the study. L J and S Y Z performed experiments of animals. L J and T G performed experiments of cells. L J and X W analyzed the data. L J drafted the manuscript, which was edited by R L and J L. Y Z Z had a leading role in manuscript preparation and its revision. All authors have approved the final manuscript

References

  • Bachelerie F, Graham GJ, Locati M, Mantovani A, Murphy PM, Nibbs R, Rot A, Sozzani S & Thelen M 2014 New nomenclature for atypical chemokine receptors. Nature Immunology 15 20720 8. (https://doi.org/10.1038/ni.2812)

    • Search Google Scholar
    • Export Citation
  • Balabanian K, Lagane B, Infantino S, Chow KY, Harriague J, Moepps B, Arenzana-Seisdedos F, Thelen M & Bachelerie F 2005 The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. Journal of Biological Chemistry 280 357603576 6. (https://doi.org/10.1074/jbc.M508234200)

    • Search Google Scholar
    • Export Citation
  • Basini G, Ragionieri L, Bussolati S, Di Lecce R, Cacchioli A, Dettin M, Cantoni AM, Grolli S, La Bella O & Zamuner A et al.2020 Expression and function of the stromal cell-derived factor-1 (SDF-1) and CXC chemokine receptor 4 (CXCR4) in the swine ovarian follicle. Domestic Animal Endocrinology 71 106404. (https://doi.org/10.1016/j.domaniend.2019.106404)

    • Search Google Scholar
    • Export Citation
  • Bernard A, Chevrier S, Beltjens F, Dosset M, Viltard E, Lagrange A, Derangere V, Oudot A, Ghiringhelli F & Collin B et al.2019 Cleaved caspase-3 transcriptionally regulates angiogenesis-promoting chemotherapy resistance. Cancer Research 79 59585970. (https://doi.org/10.1158/0008-5472.CAN-19-0840)

    • Search Google Scholar
    • Export Citation
  • Blair SA, Kyaw-Tun T, Young IS, Phelan NA, Gibney J & McEneny J 2013 Oxidative stress and inflammation in lean and obese subjects with polycystic ovary syndrome. Journal of Reproductive Medicine 58 1071 1 4.

    • Search Google Scholar
    • Export Citation
  • Carmina E & Lobo RA 1999 Polycystic ovary syndrome (PCOS): arguably the most common endocrinopathy is associated with significant morbidity in women. Journal of Clinical Endocrinology and Metabolism 84 1897189 9. (https://doi.org/10.1210/jcem.84.6.5803)

    • Search Google Scholar
    • Export Citation
  • Cataldo NA, Dumesic DA, Goldsmith PC & Jaffe RB 2000 Immunolocalization of Fas and Fas ligand in the ovaries of women with polycystic ovary syndrome: relationship to apoptosis. Human Reproduction 15 188918 97. (https://doi.org/10.1093/humrep/15.9.1889)

    • Search Google Scholar
    • Export Citation
  • Chang GQ, Collier AD, Karatayev O, Gulati G, Boorgu DSSK & Leibowitz SF 2020 Moderate prenatal ethanol exposure stimulates CXCL12/CXCR4 chemokine system in radial glia progenitor cells in hypothalamic neuroepithelium and peptide neurons in lateral hypothalamus of the embryo and postnatal offspring. Alcoholism, Clinical and Experimental Research 44 866879. (https://doi.org/10.1111/acer.14296)

    • Search Google Scholar
    • Export Citation
  • Chen L, Xu WM & Zhang D 2014 Association of abdominal obesity, insulin resistance, and oxidative stress in adipose tissue in women with polycystic ovary syndrome. Fertility and Sterility 102 1167 .e41174.e4. (https://doi.org/10.1016/j.fertnstert.2014.06.027)

    • Search Google Scholar
    • Export Citation
  • Chi XX, Zhang T, Chu XL, Zhen JL & Zhang DJ 2018 The regulatory effect of genistein on granulosa cell in ovary of rat with PCOS through Bcl-2 and Bax signaling pathways. Journal of Veterinary Medical Science 80 13481355. (https://doi.org/10.1292/jvms.17-0001)

    • Search Google Scholar
    • Export Citation
  • Chu T, Shields LBE, Zhang YP, Feng SQ, Shields CB & Cai J 2017 CXCL12/CXCR4/CXCR7 chemokine axis in the central nervous system: therapeutic targets for remyelination in demyelinating diseases. Neuroscientist 23 627648. (https://doi.org/10.1177/1073858416685690)

    • Search Google Scholar
    • Export Citation
  • Dai Y, Liu S, Xie X, Ding M, Zhou Q & Zhou X 2019 MicroRNA31 promotes chondrocyte proliferation by targeting CXC motif chemokine ligand 12. Molecular Medicine Reports 19 22312237. (https://doi.org/10.3892/mmr.2019.9859)

    • Search Google Scholar
    • Export Citation
  • Decaillot FM, Kazmi MA, Lin Y, Ray-Saha S, Sakmar TP & Sachdev P 2011 CXCR7/CXCR4 heterodimer constitutively recruits beta-arrestin to enhance cell migration. Journal of Biological Chemistry 286 32188321 97. (https://doi.org/10.1074/jbc.M111.277038)

    • Search Google Scholar
    • Export Citation
  • Deligeoroglou E, Vrachnis N, Athanasopoulos N, Iliodromiti Z, Sifakis S, Iliodromiti S, Siristatidis C & Creatsas G 2012 Mediators of chronic inflammation in polycystic ovarian syndrome. Gynecological Endocrinology 28 97497 8. (https://doi.org/10.3109/09513590.2012.683082)

    • Search Google Scholar
    • Export Citation
  • Ding L, Gao F, Zhang M, Yan W, Tang R, Zhang C & Chen ZJ 2016 Higher PDCD4 expression is associated with obesity, insulin resistance, lipid metabolism disorders, and granulosa cell apoptosis in polycystic ovary syndrome. Fertility and Sterility 105 13301337.e3. (https://doi.org/10.1016/j.fertnstert.2016.01.020)

    • Search Google Scholar
    • Export Citation
  • Escobar-Morreale HF, Luque-Ramirez M & Gonzalez F 2011 Circulating inflammatory markers in polycystic ovary syndrome: a systematic review and metaanalysis. Fertility and Sterility 95 1048.e1 –2105 8.e1 –2. (https://doi.org/10.1016/j.fertnstert.2010.11.036)

    • Search Google Scholar
    • Export Citation
  • Hattermann K, Mentlein R & Held-Feindt J 2012 CXCL12 mediates apoptosis resistance in rat C6 glioma cells. Oncology Reports 27 134813 52. (https://doi.org/10.3892/or.2012.1674)

    • Search Google Scholar
    • Export Citation
  • Jaszczynska-Nowinka K, Rucinski M, Ziolkowska A, Markowska A & Malendowicz LK 2014 Expression of SDF-1 and CXCR4 transcript variants and CXCR7 in epithelial ovarian cancer. Oncology Letters 7 16181624. (https://doi.org/10.3892/ol.2014.1897)

    • Search Google Scholar
    • Export Citation
  • Kryczek I, Frydman N, Gaudin F, Krzysiek R, Fanchin R, Emilie D, Chouaib S, Zou W & Machelon V 2005 The chemokine SDF-1/CXCL12 contributes to T lymphocyte recruitment in human pre-ovulatory follicles and coordinates with lymphocytes to increase granulosa cell survival and embryo quality. American Journal of Reproductive Immunology 54 2702 83. (https://doi.org/10.1111/j.1600-0897.2005.00307.x)

    • Search Google Scholar
    • Export Citation
  • Lainas TG, Sfontouris IA, Zorzovilis IZ, Petsas GK, Lainas GT, Alexopoulou E & Kolibianakis EM 2010 Flexible GnRH antagonist protocol versus GnRH agonist long protocol in patients with polycystic ovary syndrome treated for IVF: a prospective randomised controlled trial (RCT). Human Reproduction 25 68368 9. (https://doi.org/10.1093/humrep/dep436)

    • Search Google Scholar
    • Export Citation
  • Levoye A, Balabanian K, Baleux F, Bachelerie F & Lagane B 2009 CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113 608560 93. (https://doi.org/10.1182/blood-2008-12-196618)

    • Search Google Scholar
    • Export Citation
  • Liang PY, Yin B, Cai J, Hu XD, Song C, Wu TH, Zhao J, Li GG & Zeng Y 2015 Increased circulating Th1/Th2 ratios but not other lymphocyte subsets during controlled ovarian stimulation are linked to subsequent implantation failure after transfer of in vitro fertilized embryos. American Journal of Reproductive Immunology 73 1221. (https://doi.org/10.1111/aji.12320)

    • Search Google Scholar
    • Export Citation
  • Liu X, Duan B, Cheng Z, Jia X, Mao L, Fu H, Che Y, Ou L, Liu L & Kong D 2011 SDF-1/CXCR4 axis modulates bone marrow mesenchymal stem cell apoptosis, migration and cytokine secretion. Protein and Cell 2 8458 54. (https://doi.org/10.1007/s13238-011-1097-z)

    • Search Google Scholar
    • Export Citation
  • Liu P, Long P, Huang Y, Sun F & Wang Z 2016 CXCL12/CXCR4 axis induces proliferation and invasion in human endometrial cancer. American Journal of Translational Research 8 171917 29.

    • Search Google Scholar
    • Export Citation
  • Lombardi LA, Simoes RS, Maganhin CC, Baracat MC, Silva-Sasso GR, Florencio-Silva R, Soares JM Jr & Baracat EC 2014 Immunohistochemical evaluation of proliferation, apoptosis and steroidogenic enzymes in the ovary of rats with polycystic ovary. Revista da Associação Médica Brasileira 60 3493 56. (https://doi.org/10.1590/1806-9282.60.04.0014)

    • Search Google Scholar
    • Export Citation
  • Lovekamp TN & Davis BJ 2001 Mono-(2-ethylhexyl) phthalate suppresses aromatase transcript levels and estradiol production in cultured rat granulosa cells. Toxicology and Applied Pharmacology 172 2172 2 4. (https://doi.org/10.1006/taap.2001.9156)

    • Search Google Scholar
    • Export Citation
  • Lu J, Zhou WH, Ren L & Zhang YZ 2016 CXCR4, CXCR7, and CXCL12 are associated with trophoblastic cells apoptosis and linked to pathophysiology of severe preeclampsia. Experimental and Molecular Pathology 100 1841 91. (https://doi.org/10.1016/j.yexmp.2015.12.013)

    • Search Google Scholar
    • Export Citation
  • Lu J, Wang Z, Ren L, Sun Y, Cao Y, Xiong Y & Zhang Y 2020 Expression and functional analysis of CXCL12 and its receptors in human term trophoblast cells. Reproductive Sciences 27 4654. (https://doi.org/10.1007/s43032-019-00134-0)

    • Search Google Scholar
    • Export Citation
  • Maharjan R, Nagar PS & Nampoothiri L 2010 Effect of Aloe barbadensis Mill. formulation on letrozole induced polycystic ovarian syndrome rat model. Journal of Ayurveda and Integrative Medicine 1 27327 9. (https://doi.org/10.4103/0975-9476.74090)

    • Search Google Scholar
    • Export Citation
  • Maliqueo M, Sun M, Johansson J, Benrick A, Labrie F, Svensson H, Lonn M, Duleba AJ & Stener-Victorin E 2013 Continuous administration of a P450 aromatase inhibitor induces polycystic ovary syndrome with a metabolic and endocrine phenotype in female rats at adult age. Endocrinology 154 4344 4 5. (https://doi.org/10.1210/en.2012-1693)

    • Search Google Scholar
    • Export Citation
  • Manneras L, Cajander S, Holmang A, Seleskovic Z, Lystig T, Lonn M & Stener-Victorin E 2007 A new rat model exhibiting both ovarian and metabolic characteristics of polycystic ovary syndrome. Endocrinology 148 378137 91. (https://doi.org/10.1210/en.2007-0168)

    • Search Google Scholar
    • Export Citation
  • Mao Z, Fan L, Yu Q, Luo S, Wu X, Tang J, Kang G & Tang L 2018 Abnormality of klotho signaling is involved in polycystic ovary syndrome. Reproductive Sciences 25 372383. (https://doi.org/10.1177/1933719117715129)

    • Search Google Scholar
    • Export Citation
  • Meng Y, Qian Y, Gao L, Cai LB, Cui YG & Liu JY 2013 Downregulated expression of peroxiredoxin 4 in granulosa cells from polycystic ovary syndrome. PLoS ONE 8 e76460. (https://doi.org/10.1371/journal.pone.0076460)

    • Search Google Scholar
    • Export Citation
  • Noroozzadeh M, Behboudi-Gandevani S, Zadeh-Vakili A & Ramezani Tehrani F 2017 Hormone-induced rat model of polycystic ovary syndrome: a systematic review. Life Sciences 191 259272. (https://doi.org/10.1016/j.lfs.2017.10.020)

    • Search Google Scholar
    • Export Citation
  • Ojeda-Ojeda M, Murri M, Insenser M & Escobar-Morreale HF 2013 Mediators of low-grade chronic inflammation in polycystic ovary syndrome (PCOS). Current Pharmaceutical Design 19 577557 91. (https://doi.org/10.2174/1381612811319320012)

    • Search Google Scholar
    • Export Citation
  • Patel R & Shah G 2018 High-fat diet exposure from pre-pubertal age induces polycystic ovary syndrome (PCOS) in rats. Reproduction 155 141151. (https://doi.org/10.1530/REP-17-0584)

    • Search Google Scholar
    • Export Citation
  • Qiao N, Wang L, Wang T & Li H 2016 Inflammatory CXCL12-CXCR4/CXCR7 axis mediates G-protein signaling pathway to influence the invasion and migration of nasopharyngeal carcinoma cells. Tumour Biology 37 816981 79. (https://doi.org/10.1007/s13277-015-4686-2)

    • Search Google Scholar
    • Export Citation
  • Ragni G, Vegetti W, Riccaboni A, Engl B, Brigante C & Crosignani PG 2005 Comparison of GnRH agonists and antagonists in assisted reproduction cycles of patients at high risk of ovarian hyperstimulation syndrome. Human Reproduction 20 2421242 5. (https://doi.org/10.1093/humrep/dei074)

    • Search Google Scholar
    • Export Citation
  • Rajagopal S, Kim J, Ahn S, Craig S, Lam CM, Gerard NP, Gerard C & Lefkowitz RJ 2010 beta-Arrestin- but not G protein-mediated signaling by the ‘decoy’ receptor CXCR7. PNAS 107 6286 32. (https://doi.org/10.1073/pnas.0912852107)

    • Search Google Scholar
    • Export Citation
  • Reeves PM, Abbaslou MA, Kools FRW & Poznansky MC 2017 CXCR4 blockade with AMD3100 enhances Taxol chemotherapy to limit ovarian cancer cell growth. Anti-Cancer Drugs 28 935942. (https://doi.org/10.1097/CAD.0000000000000518)

    • Search Google Scholar
    • Export Citation
  • Ren L, Liu YQ, Zhou WH & Zhang YZ 2012 Trophoblast-derived chemokine CXCL12 promotes CXCR4 expression and invasion of human first-trimester decidual stromal cells. Human Reproduction 27 3663 74. (https://doi.org/10.1093/humrep/der395)

    • Search Google Scholar
    • Export Citation
  • Salehi E, Aflatoonian R, Moeini A, Yamini N, Asadi E, Khosravizadeh Z, Tarzjani MD, Harat ZN & Abolhassani F 2017 Apoptotic biomarkers in cumulus cells in relation to embryo quality in polycystic ovary syndrome. Archives of Gynecology and Obstetrics 296 12191227. (https://doi.org/10.1007/s00404-017-4523-5)

    • Search Google Scholar
    • Export Citation
  • Sayasith K & Sirois J 2014 Expression and regulation of stromal cell-derived factor-1 (SDF1) and chemokine CXC motif receptor 4 (CXCR4) in equine and bovine preovulatory follicles. Molecular and Cellular Endocrinology 391 1021. (https://doi.org/10.1016/j.mce.2014.04.009)

    • Search Google Scholar
    • Export Citation
  • Shalev E, Goldman S & Ben-Shlomo I 2001 The balance between MMP-9 and MMP-2 and their tissue inhibitor (TIMP)-1 in luteinized granulosa cells: comparison between women with PCOS and normal ovulatory women. Molecular Human Reproduction 7 3253 3 1. (https://doi.org/10.1093/molehr/7.4.325)

    • Search Google Scholar
    • Export Citation
  • Shorakae S, Teede H, de Courten B, Lambert G, Boyle J & Moran LJ 2015 The emerging role of chronic low-grade inflammation in the pathophysiology of polycystic ovary syndrome. Seminars in Reproductive Medicine 33 2572 69. (https://doi.org/10.1055/s-0035-1556568)

    • Search Google Scholar
    • Export Citation
  • Singh AK, Arya RK, Trivedi AK, Sanyal S, Baral R, Dormond O, Briscoe DM & Datta D 2013 Chemokine receptor trio: CXCR3, CXCR4 and CXCR7 crosstalk via CXCL11 and CXCL12. Cytokine and Growth Factor Reviews 24 414 9. (https://doi.org/10.1016/j.cytogfr.2012.08.007)

    • Search Google Scholar
    • Export Citation
  • Song S & Tan Y 2019 Expression of FKBP52 in the ovaries of PCOS rats. International Journal of Molecular Medicine 43 868878. (https://doi.org/10.3892/ijmm.2018.3998)

    • Search Google Scholar
    • Export Citation
  • Valentin G, Haas P & Gilmour D 2007 The chemokine SDF1a coordinates tissue migration through the spatially restricted activation of Cxcr7 and Cxcr4b. Current Biology 17 102610 31. (https://doi.org/10.1016/j.cub.2007.05.020)

    • Search Google Scholar
    • Export Citation
  • van Houten EL, Kramer P, McLuskey A, Karels B, Themmen AP & Visser JA 2012 Reproductive and metabolic phenotype of a mouse model of PCOS. Endocrinology 153 2861286 9. (https://doi.org/10.1210/en.2011-1754)

    • Search Google Scholar
    • Export Citation
  • Wang Y, Li G, Stanco A, Long JE, Crawford D, Potter GB, Pleasure SJ, Behrens T & Rubenstein JL 2011 CXCR4 and CXCR7 have distinct functions in regulating interneuron migration. Neuron 69 6176. (https://doi.org/10.1016/j.neuron.2010.12.005)

    • Search Google Scholar
    • Export Citation
  • Wang L, Qi H, Baker PN, Zhen Q, Zeng Q, Shi R, Tong C & Ge Q 2017 Altered circulating inflammatory cytokines are associated with anovulatory polycystic ovary syndrome (PCOS) women resistant to clomiphene citrate treatment. Medical Science Monitor 23 10831089. (https://doi.org/10.12659/msm.901194)

    • Search Google Scholar
    • Export Citation
  • Wurth R, Bajetto A, Harrison JK, Barbieri F & Florio T 2014 CXCL12 modulation of CXCR4 and CXCR7 activity in human glioblastoma stem-like cells and regulation of the tumor microenvironment. Frontiers in Cellular Neuroscience 8 144. (https://doi.org/10.3389/fncel.2014.00144)

    • Search Google Scholar
    • Export Citation
  • Xie K, Cai Y, Yang P, Du F & Wu K 2020 Upregulating microRNA-874-3p inhibits CXCL12 expression to promote angiogenesis and suppress inflammatory response in ischemic stroke. American Journal of Physiology: Cell Physiology 319 C579C588. (https://doi.org/10.1152/ajpcell.00001.2020)

    • Search Google Scholar
    • Export Citation
  • Yang J, Zhang L, Jiang Z, Ge C, Zhao F, Jiang J, Tian H, Chen T, Xie H & Cui Y et al.2019 TCF12 promotes the tumorigenesis and metastasis of hepatocellular carcinoma via upregulation of CXCR4 expression. Theranostics 9 58105827. (https://doi.org/10.7150/thno.34973)

    • Search Google Scholar
    • Export Citation
  • Zhang RN, Pang B, Xu SR, Wan PC, Guo SC, Ji HZ, Jia GX, Hu LY, Zhao XQ & Yang QE 2018 The CXCL12-CXCR4 signaling promotes oocyte maturation by regulating cumulus expansion in sheep. Theriogenology 107 8594. (https://doi.org/10.1016/j.theriogenology.2017.10.039)

    • Search Google Scholar
    • Export Citation
  • Zhang S, Yue J, Ge Z, Xie Y, Zhang M & Jiang L 2020a Activation of CXCR7 alleviates cardiac insufficiency after myocardial infarction by promoting angiogenesis and reducing apoptosis. Biomedicine and Pharmacotherapy 127 110168. (https://doi.org/10.1016/j.biopha.2020.110168)

    • Search Google Scholar
    • Export Citation
  • Zhang T, Chi XX, Kong FX & Chu XL 2020b Effect of genistein on the gene and protein expressions of CXCL-12 and EGR-1 in the rat ovary. Journal of Animal Physiology and Animal Nutrition In Press. (https://doi.org/10.1111/jpn.13448)

    • Search Google Scholar
    • Export Citation
  • Zhao KK, Cui YG, Jiang YQ, Wang J, Li M, Zhang Y, Ma X, Diao FY & Liu JY 2013 Effect of HSP10 on apoptosis induced by testosterone in cultured mouse ovarian granulosa cells. European Journal of Obstetrics, Gynecology, and Reproductive Biology 171 30130 6. (https://doi.org/10.1016/j.ejogrb.2013.09.026)

    • Search Google Scholar
    • Export Citation
  • Zheng Q, Li Y, Zhang D, Cui X, Dai K, Yang Y, Liu S, Tan J & Yan Q 2017 ANP promotes proliferation and inhibits apoptosis of ovarian granulosa cells by NPRA/PGRMC1/EGFR complex and improves ovary functions of PCOS rats. Cell Death and Disease 8 e3145. (https://doi.org/10.1038/cddis.2017.494)

    • Search Google Scholar
    • Export Citation
  • Zhou WH, Du MR, Dong L, Yu J & Li DJ 2008 Chemokine CXCL12 promotes the cross-talk between trophoblasts and decidual stromal cells in human first-trimester pregnancy. Human Reproduction 23 266926 79. (https://doi.org/10.1093/humrep/den308)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • View in gallery
    Figure 1

    The establishment of the rat model. (A) Body weight of the control group (n = 15) and PCOS model group (n = 15) during the administration process. (B) Ovarian weight of the control group (n = 18) and PCOS model group (n = 18). (C and D) H&E staining of rat ovarian tissues (magnification ×10 for C and magnification ×20 for D), normal follicles (arrows), corpus luteum (asterisk), cystic follicles (triangles). *P < 0.05, **P < 0.01, #P < 0.001.

  • View in gallery
    Figure 2

    Expression of CXCL12, CXCR4, and CXCR7 in the control group (n = 6) and PCOS model group (n = 6). (A) Relative mRNA expression of Cxcr4 and Cxcr7 in ovarian tissues. (B) The protein expression of CXCR4 and CXCR7 in ovarian tissues. (C, D and E) Immunohistochemistry analysis of CXCL12, CXCR4, and CXCR7 in ovarian tissues (magnification ×200), granulosa cell layer (GC). (F) Negative control of immunohistochemistry analysis in ovarian tissues (incubating with rabbit isotype IgG instead of the primary antibody). (G) The serum CXCL12 levels in two groups. *P < 0.05, **P < 0.01, ***P < 0.001, ns indicated non-significant.

  • View in gallery
    Figure 3

    Apoptosis and expression of apoptosis regulatory proteins in ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (A) The apoptosis rate of ovarian granulosa cells. (B, C and D) IHC analysis of BAX, BCL2, and cleaved CASP3 in ovarian tissues (magnification ×200). (E) Negative control of immunohistochemistry analysis in ovarian tissues (incubating with rabbit isotype IgG instead of the primary antibody). *P < 0.05, **P < 0.01.

  • View in gallery
    Figure 4

    Expression of CXCL12, Cxcr4, Cxcr7 and Bax, Bcl2 in rat primary ovarian granulosa cells. (A) Identification of rat primary ovarian granulosa cells (magnification ×200). (B) Secretion of CXCL12 by rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (C) The mRNA level of Cxcr4, Cxcr7 in rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). (D) The mRNA level of Bax and Bcl2 in rat primary ovarian granulosa cells of the control group (n = 6) and PCOS model group (n = 6). *P < 0.05, **P < 0.01.

  • View in gallery
    Figure 5

    The Role of 0 ng/mL (n = 6), 10 ng/mL (n = 6), 50 ng/mL (n = 6), and 100 ng/mL (n = 6) CXCL12 on Apoptosis of KGN cells. (A) The apoptosis rate of KGN cells after incubation with 0, 10, 50, and 100 ng/mL rhCXCL12 for 24 h. (B, C, D and E) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after rhCXCL12 incubation. (F and G) Relative mRNA expression of BAX and BCL2 in KGN cells after rhCXCL12 incubation. *P < 0.05, **P < 0.01, ***P < 0.001.

  • View in gallery
    Figure 6

    The role of CXCL12 and its receptors CXCR4, CXCR7 on Apoptosis of KGN cells. Apoptosis rate of KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype IgG (CXCL12 + IgG, n = 6) incubation for 24 h. *P < 0.05.

  • View in gallery
    Figure 7

    The role of CXCL12 and its receptors CXCR4, CXCR7 on regulating the expression of apoptosis regulatory proteins BAX, BCL2, cleaved CASP3 in KGN cells. (A) Relative mRNA expression of BAX/BCL2 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6) incubation for 24 h. (B) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 1 μg/mL CXCR4 antagonist AMD3100 (CXCL12 + AMD3100, n = 6) incubation for 24 h. (C) The protein expression of BAX/BCL2/cleaved CASP3 in KGN cells after after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL anti-CXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG, n = 6) incubation for 24 h. (D and E) Relative mRNA expression of BAX/BCL2 in KGN cells after 100 ng/mL rhCXCL12 (CXCL12, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL antiCXCR7 neutralizing antibody (CXCL12 + Anti-CXCR7, n = 6), 100 ng/mL rhCXCL12 with 10 μg/mL isotype control antibody (CXCL12 + IgG, n = 6) incubation for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001.

  • Bachelerie F, Graham GJ, Locati M, Mantovani A, Murphy PM, Nibbs R, Rot A, Sozzani S & Thelen M 2014 New nomenclature for atypical chemokine receptors. Nature Immunology 15 20720 8. (https://doi.org/10.1038/ni.2812)

    • Search Google Scholar
    • Export Citation
  • Balabanian K, Lagane B, Infantino S, Chow KY, Harriague J, Moepps B, Arenzana-Seisdedos F, Thelen M & Bachelerie F 2005 The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. Journal of Biological Chemistry 280 357603576 6. (https://doi.org/10.1074/jbc.M508234200)

    • Search Google Scholar
    • Export Citation
  • Basini G, Ragionieri L, Bussolati S, Di Lecce R, Cacchioli A, Dettin M, Cantoni AM, Grolli S, La Bella O & Zamuner A et al.2020 Expression and function of the stromal cell-derived factor-1 (SDF-1) and CXC chemokine receptor 4 (CXCR4) in the swine ovarian follicle. Domestic Animal Endocrinology 71 106404. (https://doi.org/10.1016/j.domaniend.2019.106404)

    • Search Google Scholar
    • Export Citation
  • Bernard A, Chevrier S, Beltjens F, Dosset M, Viltard E, Lagrange A, Derangere V, Oudot A, Ghiringhelli F & Collin B et al.2019 Cleaved caspase-3 transcriptionally regulates angiogenesis-promoting chemotherapy resistance. Cancer Research 79 59585970. (https://doi.org/10.1158/0008-5472.CAN-19-0840)

    • Search Google Scholar
    • Export Citation
  • Blair SA, Kyaw-Tun T, Young IS, Phelan NA, Gibney J & McEneny J 2013 Oxidative stress and inflammation in lean and obese subjects with polycystic ovary syndrome. Journal of Reproductive Medicine 58 1071 1 4.

    • Search Google Scholar
    • Export Citation
  • Carmina E & Lobo RA 1999 Polycystic ovary syndrome (PCOS): arguably the most common endocrinopathy is associated with significant morbidity in women. Journal of Clinical Endocrinology and Metabolism 84 1897189 9. (https://doi.org/10.1210/jcem.84.6.5803)

    • Search Google Scholar
    • Export Citation
  • Cataldo NA, Dumesic DA, Goldsmith PC & Jaffe RB 2000 Immunolocalization of Fas and Fas ligand in the ovaries of women with polycystic ovary syndrome: relationship to apoptosis. Human Reproduction 15 188918 97. (https://doi.org/10.1093/humrep/15.9.1889)

    • Search Google Scholar
    • Export Citation
  • Chang GQ, Collier AD, Karatayev O, Gulati G, Boorgu DSSK & Leibowitz SF 2020 Moderate prenatal ethanol exposure stimulates CXCL12/CXCR4 chemokine system in radial glia progenitor cells in hypothalamic neuroepithelium and peptide neurons in lateral hypothalamus of the embryo and postnatal offspring. Alcoholism, Clinical and Experimental Research 44 866879. (https://doi.org/10.1111/acer.14296)

    • Search Google Scholar
    • Export Citation
  • Chen L, Xu WM & Zhang D 2014 Association of abdominal obesity, insulin resistance, and oxidative stress in adipose tissue in women with polycystic ovary syndrome. Fertility and Sterility 102 1167 .e41174.e4. (https://doi.org/10.1016/j.fertnstert.2014.06.027)

    • Search Google Scholar
    • Export Citation
  • Chi XX, Zhang T, Chu XL, Zhen JL & Zhang DJ 2018 The regulatory effect of genistein on granulosa cell in ovary of rat with PCOS through Bcl-2 and Bax signaling pathways. Journal of Veterinary Medical Science 80 13481355. (https://doi.org/10.1292/jvms.17-0001)

    • Search Google Scholar
    • Export Citation
  • Chu T, Shields LBE, Zhang YP, Feng SQ, Shields CB & Cai J 2017 CXCL12/CXCR4/CXCR7 chemokine axis in the central nervous system: therapeutic targets for remyelination in demyelinating diseases. Neuroscientist 23 627648. (https://doi.org/10.1177/1073858416685690)

    • Search Google Scholar
    • Export Citation
  • Dai Y, Liu S, Xie X, Ding M, Zhou Q & Zhou X 2019 MicroRNA31 promotes chondrocyte proliferation by targeting CXC motif chemokine ligand 12. Molecular Medicine Reports 19 22312237. (https://doi.org/10.3892/mmr.2019.9859)

    • Search Google Scholar
    • Export Citation
  • Decaillot FM, Kazmi MA, Lin Y, Ray-Saha S, Sakmar TP & Sachdev P 2011 CXCR7/CXCR4 heterodimer constitutively recruits beta-arrestin to enhance cell migration. Journal of Biological Chemistry 286 32188321 97. (https://doi.org/10.1074/jbc.M111.277038)

    • Search Google Scholar
    • Export Citation
  • Deligeoroglou E, Vrachnis N, Athanasopoulos N, Iliodromiti Z, Sifakis S, Iliodromiti S, Siristatidis C & Creatsas G 2012 Mediators of chronic inflammation in polycystic ovarian syndrome. Gynecological Endocrinology 28 97497 8. (https://doi.org/10.3109/09513590.2012.683082)

    • Search Google Scholar
    • Export Citation
  • Ding L, Gao F, Zhang M, Yan W, Tang R, Zhang C & Chen ZJ 2016 Higher PDCD4 expression is associated with obesity, insulin resistance, lipid metabolism disorders, and granulosa cell apoptosis in polycystic ovary syndrome. Fertility and Sterility 105 13301337.e3. (https://doi.org/10.1016/j.fertnstert.2016.01.020)

    • Search Google Scholar
    • Export Citation
  • Escobar-Morreale HF, Luque-Ramirez M & Gonzalez F 2011 Circulating inflammatory markers in polycystic ovary syndrome: a systematic review and metaanalysis. Fertility and Sterility 95 1048.e1 –2105 8.e1 –2. (https://doi.org/10.1016/j.fertnstert.2010.11.036)

    • Search Google Scholar
    • Export Citation
  • Hattermann K, Mentlein R & Held-Feindt J 2012 CXCL12 mediates apoptosis resistance in rat C6 glioma cells. Oncology Reports 27 134813 52. (https://doi.org/10.3892/or.2012.1674)

    • Search Google Scholar
    • Export Citation
  • Jaszczynska-Nowinka K, Rucinski M, Ziolkowska A, Markowska A & Malendowicz LK 2014 Expression of SDF-1 and CXCR4 transcript variants and CXCR7 in epithelial ovarian cancer. Oncology Letters 7 16181624. (https://doi.org/10.3892/ol.2014.1897)

    • Search Google Scholar
    • Export Citation
  • Kryczek I, Frydman N, Gaudin F, Krzysiek R, Fanchin R, Emilie D, Chouaib S, Zou W & Machelon V 2005 The chemokine SDF-1/CXCL12 contributes to T lymphocyte recruitment in human pre-ovulatory follicles and coordinates with lymphocytes to increase granulosa cell survival and embryo quality. American Journal of Reproductive Immunology 54 2702 83. (https://doi.org/10.1111/j.1600-0897.2005.00307.x)

    • Search Google Scholar
    • Export Citation
  • Lainas TG, Sfontouris IA, Zorzovilis IZ, Petsas GK, Lainas GT, Alexopoulou E & Kolibianakis EM 2010 Flexible GnRH antagonist protocol versus GnRH agonist long protocol in patients with polycystic ovary syndrome treated for IVF: a prospective randomised controlled trial (RCT). Human Reproduction 25 68368 9. (https://doi.org/10.1093/humrep/dep436)

    • Search Google Scholar
    • Export Citation
  • Levoye A, Balabanian K, Baleux F, Bachelerie F & Lagane B 2009 CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113 608560 93. (https://doi.org/10.1182/blood-2008-12-196618)

    • Search Google Scholar
    • Export Citation
  • Liang PY, Yin B, Cai J, Hu XD, Song C, Wu TH, Zhao J, Li GG & Zeng Y 2015 Increased circulating Th1/Th2 ratios but not other lymphocyte subsets during controlled ovarian stimulation are linked to subsequent implantation failure after transfer of in vitro fertilized embryos. American Journal of Reproductive Immunology 73 1221. (https://doi.org/10.1111/aji.12320)

    • Search Google Scholar
    • Export Citation
  • Liu X, Duan B, Cheng Z, Jia X, Mao L, Fu H, Che Y, Ou L, Liu L & Kong D 2011 SDF-1/CXCR4 axis modulates bone marrow mesenchymal stem cell apoptosis, migration and cytokine secretion. Protein and Cell 2 8458 54. (https://doi.org/10.1007/s13238-011-1097-z)

    • Search Google Scholar
    • Export Citation
  • Liu P, Long P, Huang Y, Sun F & Wang Z 2016 CXCL12/CXCR4 axis induces proliferation and invasion in human endometrial cancer. American Journal of Translational Research 8 171917 29.

    • Search Google Scholar
    • Export Citation
  • Lombardi LA, Simoes RS, Maganhin CC, Baracat MC, Silva-Sasso GR, Florencio-Silva R, Soares JM Jr & Baracat EC 2014 Immunohistochemical evaluation of proliferation, apoptosis and steroidogenic enzymes in the ovary of rats with polycystic ovary. Revista da Associação Médica Brasileira 60 3493 56. (https://doi.org/10.1590/1806-9282.60.04.0014)

    • Search Google Scholar
    • Export Citation
  • Lovekamp TN & Davis BJ 2001 Mono-(2-ethylhexyl) phthalate suppresses aromatase transcript levels and estradiol production in cultured rat granulosa cells. Toxicology and Applied Pharmacology 172 2172 2 4. (https://doi.org/10.1006/taap.2001.9156)

    • Search Google Scholar
    • Export Citation
  • Lu J, Zhou WH, Ren L & Zhang YZ 2016 CXCR4, CXCR7, and CXCL12 are associated with trophoblastic cells apoptosis and linked to pathophysiology of severe preeclampsia. Experimental and Molecular Pathology 100 1841 91. (https://doi.org/10.1016/j.yexmp.2015.12.013)

    • Search Google Scholar
    • Export Citation
  • Lu J, Wang Z, Ren L, Sun Y, Cao Y, Xiong Y & Zhang Y 2020 Expression and functional analysis of CXCL12 and its receptors in human term trophoblast cells. Reproductive Sciences 27 4654. (https://doi.org/10.1007/s43032-019-00134-0)

    • Search Google Scholar
    • Export Citation
  • Maharjan R, Nagar PS & Nampoothiri L 2010 Effect of Aloe barbadensis Mill. formulation on letrozole induced polycystic ovarian syndrome rat model. Journal of Ayurveda and Integrative Medicine 1 27327 9. (https://doi.org/10.4103/0975-9476.74090)

    • Search Google Scholar
    • Export Citation
  • Maliqueo M, Sun M, Johansson J, Benrick A, Labrie F, Svensson H, Lonn M, Duleba AJ & Stener-Victorin E 2013 Continuous administration of a P450 aromatase inhibitor induces polycystic ovary syndrome with a metabolic and endocrine phenotype in female rats at adult age. Endocrinology 154 4344 4 5. (https://doi.org/10.1210/en.2012-1693)

    • Search Google Scholar
    • Export Citation
  • Manneras L, Cajander S, Holmang A, Seleskovic Z, Lystig T, Lonn M & Stener-Victorin E 2007 A new rat model exhibiting both ovarian and metabolic characteristics of polycystic ovary syndrome. Endocrinology 148 378137 91. (https://doi.org/10.1210/en.2007-0168)

    • Search Google Scholar
    • Export Citation
  • Mao Z, Fan L, Yu Q, Luo S, Wu X, Tang J, Kang G & Tang L 2018 Abnormality of klotho signaling is involved in polycystic ovary syndrome. Reproductive Sciences 25 372383. (https://doi.org/10.1177/1933719117715129)

    • Search Google Scholar
    • Export Citation
  • Meng Y, Qian Y, Gao L, Cai LB, Cui YG & Liu JY 2013 Downregulated expression of peroxiredoxin 4 in granulosa cells from polycystic ovary syndrome. PLoS ONE 8 e76460. (https://doi.org/10.1371/journal.pone.0076460)

    • Search Google Scholar
    • Export Citation
  • Noroozzadeh M, Behboudi-Gandevani S, Zadeh-Vakili A & Ramezani Tehrani F 2017 Hormone-induced rat model of polycystic ovary syndrome: a systematic review. Life Sciences 191 259272. (https://doi.org/10.1016/j.lfs.2017.10.020)

    • Search Google Scholar
    • Export Citation
  • Ojeda-Ojeda M, Murri M, Insenser M & Escobar-Morreale HF 2013 Mediators of low-grade chronic inflammation in polycystic ovary syndrome (PCOS). Current Pharmaceutical Design 19 577557 91. (https://doi.org/10.2174/1381612811319320012)

    • Search Google Scholar
    • Export Citation
  • Patel R & Shah G 2018 High-fat diet exposure from pre-pubertal age induces polycystic ovary syndrome (PCOS) in rats. Reproduction 155 141151. (https://doi.org/10.1530/REP-17-0584)

    • Search Google Scholar
    • Export Citation
  • Qiao N, Wang L, Wang T & Li H 2016 Inflammatory CXCL12-CXCR4/CXCR7 axis mediates G-protein signaling pathway to influence the invasion and migration of nasopharyngeal carcinoma cells. Tumour Biology 37 816981 79. (https://doi.org/10.1007/s13277-015-4686-2)

    • Search Google Scholar
    • Export Citation
  • Ragni G, Vegetti W, Riccaboni A, Engl B, Brigante C & Crosignani PG 2005 Comparison of GnRH agonists and antagonists in assisted reproduction cycles of patients at high risk of ovarian hyperstimulation syndrome. Human Reproduction 20 2421242 5. (https://doi.org/10.1093/humrep/dei074)

    • Search Google Scholar
    • Export Citation
  • Rajagopal S, Kim J, Ahn S, Craig S, Lam CM, Gerard NP, Gerard C & Lefkowitz RJ 2010 beta-Arrestin- but not G protein-mediated signaling by the ‘decoy’ receptor CXCR7. PNAS 107 6286 32. (https://doi.org/10.1073/pnas.0912852107)

    • Search Google Scholar
    • Export Citation
  • Reeves PM, Abbaslou MA, Kools FRW & Poznansky MC 2017 CXCR4 blockade with AMD3100 enhances Taxol chemotherapy to limit ovarian cancer cell growth. Anti-Cancer Drugs 28 935942. (https://doi.org/10.1097/CAD.0000000000000518)

    • Search Google Scholar
    • Export Citation
  • Ren L, Liu YQ, Zhou WH & Zhang YZ 2012 Trophoblast-derived chemokine CXCL12 promotes CXCR4 expression and invasion of human first-trimester decidual stromal cells. Human Reproduction 27 3663 74. (https://doi.org/10.1093/humrep/der395)

    • Search Google Scholar
    • Export Citation
  • Salehi E, Aflatoonian R, Moeini A, Yamini N, Asadi E, Khosravizadeh Z, Tarzjani MD, Harat ZN & Abolhassani F 2017 Apoptotic biomarkers in cumulus cells in relation to embryo quality in polycystic ovary syndrome. Archives of Gynecology and Obstetrics 296 12191227. (https://doi.org/10.1007/s00404-017-4523-5)

    • Search Google Scholar
    • Export Citation
  • Sayasith K & Sirois J 2014 Expression and regulation of stromal cell-derived factor-1 (SDF1) and chemokine CXC motif receptor 4 (CXCR4) in equine and bovine preovulatory follicles. Molecular and Cellular Endocrinology 391 1021. (https://doi.org/10.1016/j.mce.2014.04.009)

    • Search Google Scholar
    • Export Citation
  • Shalev E, Goldman S & Ben-Shlomo I 2001 The balance between MMP-9 and MMP-2 and their tissue inhibitor (TIMP)-1 in luteinized granulosa cells: comparison between women with PCOS and normal ovulatory women. Molecular Human Reproduction 7 3253 3 1. (https://doi.org/10.1093/molehr/7.4.325)

    • Search Google Scholar
    • Export Citation
  • Shorakae S, Teede H, de Courten B, Lambert G, Boyle J & Moran LJ 2015 The emerging role of chronic low-grade inflammation in the pathophysiology of polycystic ovary syndrome. Seminars in Reproductive Medicine 33 2572 69. (https://doi.org/10.1055/s-0035-1556568)

    • Search Google Scholar
    • Export Citation
  • Singh AK, Arya RK, Trivedi AK, Sanyal S, Baral R, Dormond O, Briscoe DM & Datta D 2013 Chemokine receptor trio: CXCR3, CXCR4 and CXCR7 crosstalk via CXCL11 and CXCL12. Cytokine and Growth Factor Reviews 24 414 9. (https://doi.org/10.1016/j.cytogfr.2012.08.007)

    • Search Google Scholar
    • Export Citation
  • Song S & Tan Y 2019 Expression of FKBP52 in the ovaries of PCOS rats. International Journal of Molecular Medicine 43 868878. (https://doi.org/10.3892/ijmm.2018.3998)

    • Search Google Scholar
    • Export Citation
  • Valentin G, Haas P & Gilmour D 2007 The chemokine SDF1a coordinates tissue migration through the spatially restricted activation of Cxcr7 and Cxcr4b. Current Biology 17 102610 31. (https://doi.org/10.1016/j.cub.2007.05.020)

    • Search Google Scholar
    • Export Citation
  • van Houten EL, Kramer P, McLuskey A, Karels B, Themmen AP & Visser JA 2012 Reproductive and metabolic phenotype of a mouse model of PCOS. Endocrinology 153 2861286 9. (https://doi.org/10.1210/en.2011-1754)

    • Search Google Scholar
    • Export Citation
  • Wang Y, Li G, Stanco A, Long JE, Crawford D, Potter GB, Pleasure SJ, Behrens T & Rubenstein JL 2011 CXCR4 and CXCR7 have distinct functions in regulating interneuron migration. Neuron 69 6176. (https://doi.org/10.1016/j.neuron.2010.12.005)

    • Search Google Scholar
    • Export Citation
  • Wang L, Qi H, Baker PN, Zhen Q, Zeng Q, Shi R, Tong C & Ge Q 2017 Altered circulating inflammatory cytokines are associated with anovulatory polycystic ovary syndrome (PCOS) women resistant to clomiphene citrate treatment. Medical Science Monitor 23 10831089. (https://doi.org/10.12659/msm.901194)

    • Search Google Scholar
    • Export Citation
  • Wurth R, Bajetto A, Harrison JK, Barbieri F & Florio T 2014 CXCL12 modulation of CXCR4 and CXCR7 activity in human glioblastoma stem-like cells and regulation of the tumor microenvironment. Frontiers in Cellular Neuroscience 8 144. (https://doi.org/10.3389/fncel.2014.00144)

    • Search Google Scholar
    • Export Citation
  • Xie K, Cai Y, Yang P, Du F & Wu K 2020 Upregulating microRNA-874-3p inhibits CXCL12 expression to promote angiogenesis and suppress inflammatory response in ischemic stroke. American Journal of Physiology: Cell Physiology 319 C579C588. (https://doi.org/10.1152/ajpcell.00001.2020)

    • Search Google Scholar
    • Export Citation
  • Yang J, Zhang L, Jiang Z, Ge C, Zhao F, Jiang J, Tian H, Chen T, Xie H & Cui Y et al.2019 TCF12 promotes the tumorigenesis and metastasis of hepatocellular carcinoma via upregulation of CXCR4 expression. Theranostics 9 58105827. (https://doi.org/10.7150/thno.34973)

    • Search Google Scholar
    • Export Citation
  • Zhang RN, Pang B, Xu SR, Wan PC, Guo SC, Ji HZ, Jia GX, Hu LY, Zhao XQ & Yang QE 2018 The CXCL12-CXCR4 signaling promotes oocyte maturation by regulating cumulus expansion in sheep. Theriogenology 107 8594. (https://doi.org/10.1016/j.theriogenology.2017.10.039)

    • Search Google Scholar
    • Export Citation
  • Zhang S, Yue J, Ge Z, Xie Y, Zhang M & Jiang L 2020a Activation of CXCR7 alleviates cardiac insufficiency after myocardial infarction by promoting angiogenesis and reducing apoptosis. Biomedicine and Pharmacotherapy 127 110168. (https://doi.org/10.1016/j.biopha.2020.110168)

    • Search Google Scholar
    • Export Citation
  • Zhang T, Chi XX, Kong FX & Chu XL 2020b Effect of genistein on the gene and protein expressions of CXCL-12 and EGR-1 in the rat ovary. Journal of Animal Physiology and Animal Nutrition In Press. (https://doi.org/10.1111/jpn.13448)

    • Search Google Scholar
    • Export Citation
  • Zhao KK, Cui YG, Jiang YQ, Wang J, Li M, Zhang Y, Ma X, Diao FY & Liu JY 2013 Effect of HSP10 on apoptosis induced by testosterone in cultured mouse ovarian granulosa cells. European Journal of Obstetrics, Gynecology, and Reproductive Biology 171 30130 6. (https://doi.org/10.1016/j.ejogrb.2013.09.026)

    • Search Google Scholar
    • Export Citation
  • Zheng Q, Li Y, Zhang D, Cui X, Dai K, Yang Y, Liu S, Tan J & Yan Q 2017 ANP promotes proliferation and inhibits apoptosis of ovarian granulosa cells by NPRA/PGRMC1/EGFR complex and improves ovary functions of PCOS rats. Cell Death and Disease 8 e3145. (https://doi.org/10.1038/cddis.2017.494)

    • Search Google Scholar
    • Export Citation
  • Zhou WH, Du MR, Dong L, Yu J & Li DJ 2008 Chemokine CXCL12 promotes the cross-talk between trophoblasts and decidual stromal cells in human first-trimester pregnancy. Human Reproduction 23 266926 79. (https://doi.org/10.1093/humrep/den308)

    • Search Google Scholar
    • Export Citation