Abstract
The survival and development of a semi-allogeneic fetus during pregnancy require the involvement of decidual stromal cells (DSCs), a series of cytokines and immune cells. Insulin-like growth factor 1 (IGF1) is a low molecular weight peptide hormone with similar metabolic activity and structural characteristics of proinsulin, which exerts its biological effects by binding with its receptor. Emerging evidence has shown that IGF1 is expressed at the maternal–fetal interface, but its special role in establishment and maintenance of pregnancy is largely unknown. Here, we found that the expression of IGF1 in the decidua was significantly higher than that in the endometrium. Additionally, decidua from women with normal pregnancy had high levels of IGF1 compared with that from women with unexplained recurrent spontaneous miscarriage. Estrogen and progesterone led to the increase of IGF1 in DSCs through upregulating the expression of WISP2. Recombinant IGF1 or DSCs-derived IGF1 increased the survival, reduced the apoptosis of DSCs, and downregulated the cytotoxicity of decidual NK cells (dNK) through interaction with IGF1R. These data suggest that estrogen and progesterone stimulate the growth of DSCs and impair the cytotoxicity of dNK possibly by the WISP2/IGF1 signaling pathway.
Introduction
For a pregnancy to be successful, the semi-allogenic fetus must not be rejected by the maternal immune system. Decidualization is a complex biological process, in which the endometrium undergoes extensive remodeling and completes the transformation from endometrial stromal cells (ESCs) to secretory decidual stromal cells (DSCs) (Kommagani et al. 2016, Senapati et al. 2018). Abnormal decidualization and functioning of DSCs may lead to adverse pregnancy outcomes, such as miscarriage, preeclampsia and so on.
In addition, the immune cells at the maternal–fetal interface are thought to play a critical role in pregnancy (Krieg & Westphal 2015). During the decidualization, the numbers of decidual immune cells (DICs) increase dramatically, and the composition of DICs is different from the leukocytes in the peripheral blood. DIC is composed of NK cells (~70%), macrophages (~15%), T cells (~15%) and a few other types of immune cells. Decidual NK cells (dNK) are mainly of the CD56brightCD16− phenotype, which form a unique natural killer (NK) subgroup with phenotypes and functions different from the peripheral blood NK cells (pNK) (Lee et al. 2019, Sojka et al. 2019). dNKs are essential for the maintenance of pregnancy having important roles in creating special immune microenvironment at the maternal–fetal interface, including angiogenesis, trophoblast invasion promotion and so on (Sojka et al. 2018, Lu et al. 2020). Besides, dNKs have lower cytotoxicity than peripheral NK cells, which contribute to the formation of maternal–fetal immune–tolerance microenvironment (Sojka et al. 2018, Toth et al. 2019).
The Insulin-like growth factor 1 (IGF1) is a single-chain polypeptide composing 70 amino acids, which is mainly synthesized and secreted by hepatocytes (Wang et al. 2016). Previous studies show that IGF1 can stimulate cell growth in nearly all systems (Jones & Clemmons 1995, Collett-Solberg & Cohen 2000). In addition, IGF1 is a key modulator of cell proliferation, differentiation, and apoptosis (Philippou et al. 2014, Costa-Silva et al. 2016). IGF1 and IGF1 receptor (IGF1R) were also present at the maternal–fetal interface (Han et al. 1996). Further report showed that IGF1 is expressed in the decidua and in almost all cell types of placenta (Luo et al. 2016). As one of the important growth factors, IGF1 plays a critical role in placental growth (Han et al. 1996). Additionally, IGF1 is one of the important regulators of trophoblast invasion (Niu et al. 2018). However, the specific role of IGF1 at the maternal–fetal interface in normal pregnancy is still unclear.
Therefore, the aim of the current study is to study the expression of IGF1 on decidua and explore whether IGF1 regulates the function of decidua NK cells and DSCs, which contribute to special immune-tolerance microenvironment at the maternal–fetal interface in vitro.
Materials and methods
Tissue collection
Tissue collection in this study was approved by the Ethical Committee of the Obstetrics and Gynecology Hospital, Fudan University. Every patient signed the written informed consent. Decidual tissues (n = 72) were collected from normal women in the first trimester of pregnancy for selective termination (age, 25–40 years old; gestational age, 7–9 weeks) or from patients (n =10) with unexplained spontaneous miscarriage caused by nongenetic or non-endocrine factors (age, 21–35 years old; gestational age, 7–9 weeks).
Endometrial tissues (n =10) were obtained from patients of reproductive ages with normal pregnancy history (25–40 years old), who underwent hysterectomy or diagnostic curettage for benign reasons unrelated to endometrial dysfunction. None of the patients had received hormonal medication in the 6 months before the surgical procedure. All samples were confirmed histologically according to the established criteria and obtained in the proliferative or secretory phase of the endometrial cycle.
The decidual tissues were collected under sterile conditions and transported to the laboratory within 30 min after surgery in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (HyClone; GE Healthcare Life Sciences) with 10% fetal bovine serum (FBS; Gibco) for further isolation of DSCs and dNK cells.
Cell isolation and culture
Collected decidual tissues were washed in Ca2+ Mg2+-free PBS (HyClone). The tissues were cut into 1 mm3 pieces and then digested with 5% DNA enzymes (3000IU; Sigma-Aldrich, Merck KGaA) and 20% type IV collagenase (0.1%; Sigma-Aldrich) at 37°C for 30 min with constant agitation. The enzymatic reaction was stopped by DMEM high-glucose medium (HyClone) containing 20% FBS (Gibco). The suspension of tissue was filtered through sieves (pore diameter sizes: 100, 200, and 400 mesh). The filtered suspension was collected and centrifuged at 443 g for 8 min, and the supernatant was discarded. The acquired cell pellet was suspended in PBS (HyClone) and centrifuged on a discontinuous gradient of 20, 40, and 60% Percoll bulk standard at 1367 g for 30 min. Percoll bulk standard consists of 90% Percoll (Amersham, GE Healthcare Life Sciences) and 10% 10 × PBS (HyClone). The cells from the 20%/40% interface were mainly DSCs and from the 40%/60% interface were mainly decidual immunocytes (DICs). DSCs and DICs were acquired and washed with PBS (HyClone).
Decidual stromal cells were cultured and purified with DMEM/F12 medium (HyClone) containing 10% fetal bovine serum (Gibco). Immunocytochemistry showed > 95% vimentin-positive and cytokeratin-negative DSCs.
DICs were cultured in RPMI-1640 medium (HyClone) containing 10% FBS (Gibco) overnight before NK cell isolation for DSC adhesion to increase isolation efficiency. Decidual NK cells from DICs were obtained through negative selection by a NK cell isolation kit according to the manufacturer’s instructions (MiltenyiBiotec, Bergisch Gladbach, Germany). And the purity of CD45+CD3−CD56+ NK cells was > 90% as determined by flow cytometry assays.
Cell treatment and co-culture
Isolated decidual stromal cells were cultured in six-well plate (5 × 105 cells/well) and treated with 17-β estradiol (E2; 0, 10−9, 10−8, 10−7 M; Sigma-Aldrich; Merck KGaA) and progesterone (P4; 0, 10−8, 10−7, 10−6 M; MedChem Express) respectively; control group was treated with 0.1% DMSO. DSCs in estrogen or progesterone-treated group or control group were cultured in DMEM/F-12 containing 10% fetal bovine serum and incubated in a humidified incubator with 5% CO2 at 37°C for 12, 24, or 48 h respectively. In addition, isolated decidual stromal cells were also cultured in six-well plate (5 × 105 cells/well) and treated with recombinant human IGF1 protein (ab9573, abcam) at the concentration of 0, 2, 20, or 200 ng/mL for 48 h. And then, the above cells were collected for extracting total RNA by RNAiso Plus reagent (TaKaRa Biotechnology).
Isolated decidual NKs were cultured in 24-well plate (2 × 105 cells/well) and treated with recombinant human IGF1 protein at the concentration of 0, 2, 20, or 200 ng/mL for 48 h.
After 24 h of culturing DSCs in 24-well plate (1 × 105 cells/well), dNK (1 × 105 cells/well) was placed in the upper compartment of the transwell chamber inserts (0.4 μm aperture, 12 mm diameter; Corning) in the noncontact transwell co-culture unit. After serum starvation for 8 h, the noncontact co-culture unit was incubated with the neutralizing IGF1 antibody (5 μg/mL; RB01, R&D Systems) or vehicle (1% PBS). The total volume of medium in each well was 1 mL. After 48-h co-culture, flow cytometry assays were carried out to analyze the levels of functional molecules in these NK cells.
Flow cytometry assays
Decidual immune cells were collected to detect the expression of IGF1R on decidual immune cells by Allophycocyanin (APC)-Cy7 anti-human CD45 antibody (304014; Biolegend), Brilliant Violet® 421 (BV421) anti-human CD56 antibody (562751; BD Pharmingen), FITC anti-human CD3 antibody (317306; Biolegend), BV421 anti-human CD14 (565283; BD Pharmingen) and Phycoerythrin (PE) anti-human IGF1R antibody (351806; Biolegend).
IGF1-treated decidual NKs or decidual NKs from co-culture system were collected from all wells and centrifuged immediately at 400 g for 8 min. The expression of CD56, NKp30, CD107a, CD16 and Ki67 was analyzed by flow cytometry. Specifically, decidual NKs were fixed, permeabilized, and stained with allophycocyanin (APC) anti-human Ki-67 antibody (350513; Biolegend), after labeling with BV421 anti-human CD56 antibody (562751; BD Pharmingen), PE anti-human Nkp30 antibody (325208; Biolegend), APC anti-human CD107a antibody (328620; Biolegend), Phycoerythrincyanin 7 (PE-Cy7) anti-human CD16 antibody (302016; Biolegend). Samples were analyzed with a Beckman CytoFLEX S flow cytometer (Beckman Coulter, Inc.) using Becton CytExpert software. The experiments were performed in triplicate.
Immunohistochemistry
The paraffin sections of human decidua (5 mm) and endometrium (5 mm) were dehydrated in graded ethanol, next the endogenous peroxidase was removed with 3% hydrogen peroxide and incubated with 5% BSA at room temperature for 1 h. And then, the samples were incubated with rabbit anti-IGF1 (1:100; Affinity Biosciences) or rabbit anti-IGF1 receptor antibody (1:500; abcam) or rabbit IgG isotypes at 4°C overnight. After washing with PBS for three times, the sections were incubated with HRP-labeled secondary antibody at room temperature for 30 min, reacted with 3,3-diaminobiphenylamine (DAB), and finally counterstained with hematoxylin.
RT-PCR
The transcription level of IGF1, WISP2 and MKI67 in the DSCs was verified by RT-PCR according to the standard protocols (RR036A and RR820A; Takara). The fold change in the gene expression was calculated using the change in cycle threshold value method (ΔΔCt). All values obtained were normalized to the values obtained for β-actin (ACTB). And the primer sequences were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China) indicated in Table 1.
Primer sequences of IGF1, WISP2, MKI67, and ACTB.
| Gene | Primer sequences 5′–3′ | |
|---|---|---|
| Forward | Reverse | |
| IGF1 | TGTCCTCCTCGCATCTCTTCTACC | CCTGTCTCCACACACGAACTGAAG |
| WISP2 | TTTCTGGCCTTGTCTCTTCC | GTGTGTGTAGGCAGGGAGTG |
| MKI67 | CCAAGCCACAGTCCAAGAGAAGTC | TGCTGATGGTGTTCGTTTCCTGAG |
| ACTB | GCCGACAGGATGCAGAAGGAGATCA | AAGCATTTGCGGTGGACGATGGA |
Hoechst staining
The DSCs were cultured in a 24-well plate (1 × 105/well) and exposed to recombinant human IGF1 protein at different concentrations (0, 2, 20, 200 ng/mL) for 48 h. Thereafter, the culture media was removed and washed with PBS. The cells were stained with a Hoechst Staining Kit (Solarbio Science&Technology Co., Ltb, Beijing, China), observed under an Olympus BX51 fluorescence microscope (Tokyo, Japan), and recorded with a high-resolution DP70 Olympus digital camera (×200). The percentage of apoptosis was determined by nuclear morphology using the software ImageJ. At least 1000 cells were counted in each group with the counter ‘blinded’ to identity sample in case of experimental bias.
Annexin V/PI apoptosis assay
Apoptotic cell death was detected via Annexin V-APC/propidium iodide (PI) staining using the apoptosis kit (APC Annexin V Apoptosis Detection Kit with PI, Biolegend, USA). DSCs (5 × 105 cells) from the various cultures were trypsinized using 0.25% Trypsin (1×, Phenol Red; no EDTA; Gibco) for 3 min at 37°C with 5% CO2 and collected, washed and resuspended in 100 µL binding buffer included in the apoptosis kit, followed by incubation with 5 µL Annexin V-APC and 10 µL PI at room temperature for 15 min in the dark. Then, 400 µL binding buffer was added and the cell samples were analyzed with a Beckman CytoFLEX S flow cytometer (Beckman Coulter, Inc.) using Becton CytExpert software. Annexin V+ PI− cells were in the early stage of apoptosis and Annexin V+ PI+ cells were late apoptotic cells. The experiments were performed in triplicate.
Transfection
Negative control (NM_CON335) and WISP2 gene overexpression (NM_003881) plasmid vectors were constructed by GeneChem (Shanghai, China). DSCs were plated in six-well plates (5 × 105/well) with DMEM/F-12 plus 10% FBS. When the cells had reached confluency, Lipofectamine™ 3000 (Invitrogen), OPTI-MEM™ (Gibco) and the WISP2 gene overexpression plasmid were mixed, incubated for 12 min and added to the cells according to the manufacturer’s protocol. The vector-only plasmid was used as the negative controls. And the cells were cultured for 48 h. RT-PCR analyses were performed to verify the efficiency of the overexpression of the plasmid vectors at the gene, and the successfully transfected cells were used for further analysis.
Statistical analysis
The results were representative of multiple experiments and were presented as mean ± s.e.m. The variables were analyzed by a Student’s t-test between two groups or a one-way ANOVA using Tukey’s post hoc test in multiple groups (SPSS, version 20.5). The differences were considered as statistically significant at P < 0.05.
Results
IGF1 promotes the survival and restricts the apoptosis of DSCs
We first observed the expression of IGF1 in endometrium in the proliferative and secretory phase of the endometrial cycle by immunohistochemistry. The results in Fig. 1A showed that the IGF1 is present in ESCs and the expression level of IGF1 in the secretory phase of the endometrial is higher compared with the proliferative endometrium. In addition, we observed the IGF1 expression in the decidua. The expression of IGF1 in the DSCs is higher than ESCs (Fig. 1A and B). IGF1 ligand plays a lot of roles through binding mainly to the IGF1R, which is a transmembrane tyrosine kinase receptor (Forbes et al. 2020). IGF1R was expressed in the DSCs at low levels (Fig. 1B).
The expression and role of IGF1 in the DSCs. (A) The expression of IGF1 in the proliferative (n = 6) and secretory phase (n = 4) of the endometrial cycle by immunohistochemistry. (B) The expression of IGF1 and IGF1R in the decidua of the normal pregnant women (n = 6). Magnification: ×200. (C) The effect of IGF1 protein on the expression of proliferation and cell survival related gene MKI67 in DSCs was analyzed by RT-PCR (n = 6). (D) The apoptosis of DSCs in control group, recombinant human IGF1 protein group was detected by the Hoechst staining (n = 6). The apoptotic cell was indicated by the red triangle. Magnification: ×200. (E) The apoptosis of DSCs in control group and recombinant human IGF1 protein group was detected by the flow cytometry assay (n = 6). The data were showed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The expression and role of IGF1 in the DSCs. (A) The expression of IGF1 in the proliferative (n = 6) and secretory phase (n = 4) of the endometrial cycle by immunohistochemistry. (B) The expression of IGF1 and IGF1R in the decidua of the normal pregnant women (n = 6). Magnification: ×200. (C) The effect of IGF1 protein on the expression of proliferation and cell survival related gene MKI67 in DSCs was analyzed by RT-PCR (n = 6). (D) The apoptosis of DSCs in control group, recombinant human IGF1 protein group was detected by the Hoechst staining (n = 6). The apoptotic cell was indicated by the red triangle. Magnification: ×200. (E) The apoptosis of DSCs in control group and recombinant human IGF1 protein group was detected by the flow cytometry assay (n = 6). The data were showed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The expression and role of IGF1 in the DSCs. (A) The expression of IGF1 in the proliferative (n = 6) and secretory phase (n = 4) of the endometrial cycle by immunohistochemistry. (B) The expression of IGF1 and IGF1R in the decidua of the normal pregnant women (n = 6). Magnification: ×200. (C) The effect of IGF1 protein on the expression of proliferation and cell survival related gene MKI67 in DSCs was analyzed by RT-PCR (n = 6). (D) The apoptosis of DSCs in control group, recombinant human IGF1 protein group was detected by the Hoechst staining (n = 6). The apoptotic cell was indicated by the red triangle. Magnification: ×200. (E) The apoptosis of DSCs in control group and recombinant human IGF1 protein group was detected by the flow cytometry assay (n = 6). The data were showed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
It has been reported that IGF1 has the ability of enhancing cell proliferation and survival (Huat et al. 2014, Majchrzak-Baczmańska & Malinowski 2016). We observed the expression of MKI67 of DSCs after the treatment of recombinant human IGF1 protein by RT-PCR. The result showed that IGF1 could upregulate the expression of MKI67, which is one of the cell proliferation and cell survival-related genes (Fig. 1C). However, there was no significant difference in efficiency among the different concentrations. In addition, we further explored the changes of apoptosis in DSCs after treating with recombinant human IGF1 protein by the Hoechst staining and Annexin V/PI apoptosis assay. As expected, the apoptosis of DSCs decreased after treatment with IGF1, but there was no significant difference in the efficiency among the different concentrations (Fig. 1D and E). The aforementioned results suggested that recombinant IGF1 protein could promote cell survival, and reduce the apoptosis of DSCs, but it does not appear a dose-dependent manner.
Decidual immune cells express IGF1R
During decidualization, the number of uterine leukocytes increase dramatically, and decidual immune cells (DICs) consist of NK cells (~70%), macrophages (~15%), T cells (~15%), and a very small number of other types of immune cells. As mentioned previously, IGFI plays a lot of roles through interacting mainly with IGF1R. Next, we tested the expression of IGF1R on the DICs. As shown in Fig. 2, we found the expression of IGF1R was present on the decidual natural killer cells (dNK), decidual macrophages and T cells. The expression of IGF1R was highest on decidual T cells, slightly lower on decidual NK cells and lowest on decidual macrophages. Considering that decidual NK cells are the most important component of decidual immune cells, we targeted decidual NK cells for the further study.
The expression of IGF1R on the decidual immune cells. The expression of IGF1R on the decidual immune cells (n = 6) was detected by flow cytometry. The data were showed as the mean ± s.e.m. dNK, decidual NK cells; Mφ, macrophage. ***P < 0.001.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The expression of IGF1R on the decidual immune cells. The expression of IGF1R on the decidual immune cells (n = 6) was detected by flow cytometry. The data were showed as the mean ± s.e.m. dNK, decidual NK cells; Mφ, macrophage. ***P < 0.001.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The expression of IGF1R on the decidual immune cells. The expression of IGF1R on the decidual immune cells (n = 6) was detected by flow cytometry. The data were showed as the mean ± s.e.m. dNK, decidual NK cells; Mφ, macrophage. ***P < 0.001.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
IGF1 regulates the proliferation and cytotoxicity-related molecules of dNK
Unlike the majority of NK cells in the peripheral blood (CD16+CD56dim), most of the resident NK cells in the decidua have a phenotype of CD16−CD56bright, lower cytotoxicity and a higher cytokine secretion (Fu et al. 2014, Lee et al. 2019). To investigate the effect of IGF1 on dNK cells, dNK cells were purified and treated with different concentrations of recombinant human IGF1 protein. Treatment with human recombinant IGF1 protein decreased the expression of NKp30, one of the natural cytotoxicity receptors, and the effect was most significant when the concentration was 2 ng/mL (Fig. 3A). Therefore, we treated decidual NK cells with concentration of 2 ng/mL to explore other molecules on dNK cells. We detected the expression of CD107a to define the cytotoxic potential of dNK. Obviously, recombinant human IGF1 protein reduced the expression of CD107a on dNKs (Fig. 3B). As mentioned previously, compared with pNKs, dNKs have lower expression of CD16, which may be related to the involvement of dNKs in the formation of maternal–fetal immune tolerance. As shown in Fig. 3C, when the dNKs were treated with IGF1, the expression of CD16 decreased. In addition, increased expression of proliferating cell-associated nuclear antigen Ki67 could be observed when IGF1 is used to stimulate the dNKs (Fig. 3D). In conclusion, recombinant human IGF1 reduces the cytotoxicity of dNK cells and increases dNK proliferation at the maternal–fetal interface, which may contribute to immune tolerance and successful pregnancy.
Recombinant human IGF1 protein regulates the function of decidual NK cells. (A) Sorted dNK (n = 6) was treated with recombinant human IGF1 in a different concentration gradient (2, 20, or 200 ng/mL), and NKp30, one of the natural cytotoxicity receptors, was analyzed by flow cytometry assays. (B, C and D). After treating dNKs (n = 6) with recombinant human IGF1 at the concentration of 2 ng/mL, the levels of cytotoxic molecules (CD107a and CD16) and proliferative molecule (Ki67) on dNKs were detected by flow cytometry. The data are expressed as the mean ± s.e.m. *P < 0.05; ***P < 0.001. IGF1, recombinant human IGF1.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Recombinant human IGF1 protein regulates the function of decidual NK cells. (A) Sorted dNK (n = 6) was treated with recombinant human IGF1 in a different concentration gradient (2, 20, or 200 ng/mL), and NKp30, one of the natural cytotoxicity receptors, was analyzed by flow cytometry assays. (B, C and D). After treating dNKs (n = 6) with recombinant human IGF1 at the concentration of 2 ng/mL, the levels of cytotoxic molecules (CD107a and CD16) and proliferative molecule (Ki67) on dNKs were detected by flow cytometry. The data are expressed as the mean ± s.e.m. *P < 0.05; ***P < 0.001. IGF1, recombinant human IGF1.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Recombinant human IGF1 protein regulates the function of decidual NK cells. (A) Sorted dNK (n = 6) was treated with recombinant human IGF1 in a different concentration gradient (2, 20, or 200 ng/mL), and NKp30, one of the natural cytotoxicity receptors, was analyzed by flow cytometry assays. (B, C and D). After treating dNKs (n = 6) with recombinant human IGF1 at the concentration of 2 ng/mL, the levels of cytotoxic molecules (CD107a and CD16) and proliferative molecule (Ki67) on dNKs were detected by flow cytometry. The data are expressed as the mean ± s.e.m. *P < 0.05; ***P < 0.001. IGF1, recombinant human IGF1.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
DSCs regulate the function of dNK in an IGF1-dependent manner
Subsequently, co-culture system of DSCs and dNKs was established to further investigate whether DSC-derived IGF1 could influence the function of dNKs. We observed that when DSCs were co-cultured with dNKs, the expression of CD16, CD107a, and NKp30 decreased but Ki67 increased (Fig. 4A, B, C and D). In addition, when IGF1 in the co-culture system was neutralized by human IGF1 antibody, the expression of a couple of surface makers and intracellular molecules was affected. The levels of CD16, CD107a, and NKp30 on dNK cells were upregulated significantly (Fig. 4A, B and C), whereas the percentage of Ki67, which is one of the proliferating cells-associated antigens, was decreased (Fig. 4D). These findings suggest that DSCs-derived IGF1 may induce more CD16−NKp30−CD107a− Ki67+ NK cells in decidua and be involved in the maintenance of dNK cells with low cytotoxic activity and high proliferation characteristics.
DSCs regulate the function of decidual NK cells in an IGF1-dependent manner. (A, B, C and D) The DSCs–dNK co-culture system (n = 6) was incubated with or without human IGF1 antibody for 48 h, and the expression of killer molecules (NKp30, CD107a, and CD16), proliferating cell-associated molecule (Ki67), was analyzed by flow cytometry assays. The data are expressed as the mean ± s.e.m. *P < 0.05.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
DSCs regulate the function of decidual NK cells in an IGF1-dependent manner. (A, B, C and D) The DSCs–dNK co-culture system (n = 6) was incubated with or without human IGF1 antibody for 48 h, and the expression of killer molecules (NKp30, CD107a, and CD16), proliferating cell-associated molecule (Ki67), was analyzed by flow cytometry assays. The data are expressed as the mean ± s.e.m. *P < 0.05.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
DSCs regulate the function of decidual NK cells in an IGF1-dependent manner. (A, B, C and D) The DSCs–dNK co-culture system (n = 6) was incubated with or without human IGF1 antibody for 48 h, and the expression of killer molecules (NKp30, CD107a, and CD16), proliferating cell-associated molecule (Ki67), was analyzed by flow cytometry assays. The data are expressed as the mean ± s.e.m. *P < 0.05.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Pregnancy-associated hormones upregulate the expression of IGF1 in DSCs
Recurrent miscarriage, also known as recurrent pregnancy loss, is defined as experiencing at least two or three consecutive fetal deaths or spontaneous abortions before the 24th gestational week. Although recurrent miscarriage has complex causes, including chromosome abnormalities, acquired infection and so on, the cause of recurrent miscarriage remains unexplained in almost half of the patients. Our results showed that the expression level of IGF1 was decreased in patients who had undergone unexplained spontaneous miscarriage compared with normal pregnant women (Fig. 5A). During early pregnancy, corpus luteum can synthesize a variety of hormones, including estrogen and progesterone, which play an important role in maintaining successful pregnancy (Muzzio et al. 2014). The insufficiency of progesterone and estrogen during the luteal phase of the menstrual cycle and during early pregnancy are thought to be may one of the many causes of miscarriage (Haas & Ramse 2013, Xu et al. 2017). So we further observed the possible roles of progesterone and estrogen on IGF1 expression. As shown, the expression of IGF1 was most upregulated by progesterone at the concentration of 10−8 M. The concentrations of estrogen that increased the IGF1 expression of DSCs were 10−9 and 10−8 M, and there was no significant difference between these two concentrations (Fig. 5B). In addition, we observed the time-dependent effect of progesterone and estrogen on DSCs. The results of RT-PCR showed that the expression of IGF1 in DSCs began to increase at 12 h, peaked at 24 h, and then began to decline after the treatment with progesterone (Fig. 5C). However, the expression of IGF1 in the experimental group was significantly higher than that in the control group only at 24 h when DSCs was treated with estrogen (Fig. 5D). These results suggest that pregnancy-associated hormones, including progesterone and estrogen, are able to promote the expression of IGF1 in DSCs in vitro.
Progesterone and estrogen upregulate the IGF1 expression in DSCs. (A) The expression of IGF1 in the decidua of the normal pregnant women (n = 6) and in patients who had undergone unexplained spontaneous miscarriage (n = 6) by immunohistochemistry. Magnification: ×200. (B) Progesterone and estrogen regulate the expression of IGF1 on DSCs (n = 6). (C) Time-dependent effect of progesterone on DSCs (n = 6). (D) Time-dependent effect of estrogen on DSCs (n = 6). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Progesterone and estrogen upregulate the IGF1 expression in DSCs. (A) The expression of IGF1 in the decidua of the normal pregnant women (n = 6) and in patients who had undergone unexplained spontaneous miscarriage (n = 6) by immunohistochemistry. Magnification: ×200. (B) Progesterone and estrogen regulate the expression of IGF1 on DSCs (n = 6). (C) Time-dependent effect of progesterone on DSCs (n = 6). (D) Time-dependent effect of estrogen on DSCs (n = 6). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Progesterone and estrogen upregulate the IGF1 expression in DSCs. (A) The expression of IGF1 in the decidua of the normal pregnant women (n = 6) and in patients who had undergone unexplained spontaneous miscarriage (n = 6) by immunohistochemistry. Magnification: ×200. (B) Progesterone and estrogen regulate the expression of IGF1 on DSCs (n = 6). (C) Time-dependent effect of progesterone on DSCs (n = 6). (D) Time-dependent effect of estrogen on DSCs (n = 6). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS: no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Progesterone and estrogen promote IGF1 expression through WISP2
To explore how progesterone and estrogen regulate the expression of IGF1 in DSCs, we performed prediction-related networks of differential genes and bioinformatics analysis. According to the predicted network among the estrogen receptor 1 (ESR1), estrogen receptor 2 (ESR2), progesterone receptor (PGR) and IGF1, WNT1-inducible signaling pathway protein 2 (WISP2) was predicted as an important regulatory gene (Fig. 6A). It has been reported that the expression of IGF1 is regulated by WNT signaling pathway, and WISP2 is one of the downstream target proteins of WNT signaling pathway (Brigstock et al. 2003, Repudi et al. 2013). Therefore, we first detected the expression of WISP2 in DSC of normal pregnant women and then in patients with unexplained spontaneous miscarriage. As shown previously, the expressions of IGF1 and WISP2 were significantly lower in DSCs of patients with unexplained spontaneous miscarriage compared with normal pregnancy (Fig. 6B). In addition, both progesterone and estrogen could enhance the expression of WISP2 (Fig. 6C). Therefore, we speculate that progesterone and estrogen may regulate the expression of IGF1 by increasing the expression of WISP2. To further verify this hypothesis, we transfected DSCs with WISP2 gene overexpression plasmid. And we analyzed the effect of plasmid transfection on WISP2 expression in the DSCs by RT-PCR. As expected, the expression of WISP2 increased in the group of WISP2 interface compared with the control group. Meanwhile, the expression of IGF1 in DSCs increased simultaneously after plasmid transfection (Fig. 6D). These results suggested that progesterone and estrogen could enhance the expression of IGF1 through increasing the WISP2 expression.
Progesterone and estrogen upregulate IGF1 expression in DSCs by upregulating the expression of WISP2. (A) The predicted networks of differential genes related to ESR1, ESR2, PGR and IGF1. (B) The expression of IGF1 and WISP2 in DSCs of the normal pregnant women (n = 6) and of patients who had undergone unexplained spontaneous miscarriage (n = 6) by RT-PCR. (C) Progesterone and estrogen regulate the expression of IGF1 and WISP2 in DSCs (n = 6). (D) RT-PCR showed that the relative level of WISP2 and IGF1 expression was significantly increased in the group transfected with WISP2 overexpression plasmid compared with that of the vehicle (n = 5). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen; Vector control, DSCs treated with vector-only plasmid; WISP2 interference, DSCs transfected with WISP2 overexpression plasmid. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS, no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Progesterone and estrogen upregulate IGF1 expression in DSCs by upregulating the expression of WISP2. (A) The predicted networks of differential genes related to ESR1, ESR2, PGR and IGF1. (B) The expression of IGF1 and WISP2 in DSCs of the normal pregnant women (n = 6) and of patients who had undergone unexplained spontaneous miscarriage (n = 6) by RT-PCR. (C) Progesterone and estrogen regulate the expression of IGF1 and WISP2 in DSCs (n = 6). (D) RT-PCR showed that the relative level of WISP2 and IGF1 expression was significantly increased in the group transfected with WISP2 overexpression plasmid compared with that of the vehicle (n = 5). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen; Vector control, DSCs treated with vector-only plasmid; WISP2 interference, DSCs transfected with WISP2 overexpression plasmid. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS, no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Progesterone and estrogen upregulate IGF1 expression in DSCs by upregulating the expression of WISP2. (A) The predicted networks of differential genes related to ESR1, ESR2, PGR and IGF1. (B) The expression of IGF1 and WISP2 in DSCs of the normal pregnant women (n = 6) and of patients who had undergone unexplained spontaneous miscarriage (n = 6) by RT-PCR. (C) Progesterone and estrogen regulate the expression of IGF1 and WISP2 in DSCs (n = 6). (D) RT-PCR showed that the relative level of WISP2 and IGF1 expression was significantly increased in the group transfected with WISP2 overexpression plasmid compared with that of the vehicle (n = 5). NP, normal pregnancy; SM, unexplained spontaneous miscarriage; DSCs, decidual stromal cells; P4, progesterone; E2, estrogen; Vector control, DSCs treated with vector-only plasmid; WISP2 interference, DSCs transfected with WISP2 overexpression plasmid. The data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; NS, no significance.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Discussion
Pregnancy is a complex and irreversible process, including implantation, decidualization, placenta and delivery (Kelleher et al. 2018, Paul et al. 2019). In the early stage of pregnancy, decidualization and the formation of maternal–fetal immune–tolerance microenvironment are essential to maintain a successful pregnancy. The formation and maintenance of immune tolerance microenvironment at the maternal–fetal interface are accompanied by special dNK cells function, T helper cell 2 bias and macrophage polarization (Yagel 2009, Piao et al. 2012, Xue et al. 2014, Meng et al. 2017). Here, the key findings of this study are that estrogen and progesterone upregulate the expression of IGF1 possibly by the WISP2, IGF1 enhances the survival of DSCs and impairs the cytotoxicity of dNK cell in vitro. However, the abnormal decrease of WISP2/IGF1 should contribute to the spontaneous abortion.
It has been reported that IGF1 is also presented in the endometrial basal lamina at the implantation phase in rat (Zhang et al. 2020). The accumulated evidence suggest that IGF1 plays a critical role in stimulating the proliferation, migration and invasion of trophoblast in a paracrine manner (Mayama et al. 2013, Tanaka et al. 2018, Yu et al. 2019b). Here, the results of immunohistochemistry showed that IGF1 was expressed in both ESCs and DSCs, and the expression level of IGF1 in DSCs was significantly higher than that in ESCs. Notably, the results also showed that the expression level of IGF1 was significantly decreased in patients with unexplained spontaneous miscarriage compared with normal pregnant women. These results suggest that the abnormal expression of IGF1 in DSCs may be related to the occurrence of recurrent spontaneous miscarriage.
Previous studies have revealed that IGF1, as an important growth factor, is a master regulator of cell proliferation, differentiation, and apoptosis (Yu & Rohan 2000, Philippou et al. 2014, Costa-Silva et al. 2016). Our data also showed that recombinant human IGF1 promoted cell survival and reduced the apoptosis of DSCs in a dose-independent manner. Of note, we observed that expression of IGF1R in DSCs was lower, possibly contributing to a dose-independent effect of IGF1 on DSCs. Emerging evidences have suggested that the combination of IGF1 and IGF1R can activate PI3K/AKT/MTOR signaling cascade to regulate the cell growth and apoptosis (Zhou et al. 2018, Ma et al. 2019) and the viability and apoptosis of DSCs are involved in the PI3K/AKT signaling pathway (Zhu et al. 2013). However, whether IGF1 affects the survival and apoptosis of DSCs in the way of activating PI3K/AKT needs further research.
During normal pregnancy, the number of uterine immune cells increased dramatically, and decidual NK cells accounted for the majority of DICs (King 2000). The function of decidual NK cells is abundant and complex, which not only promote placental angiogenesis but also play a critical role in the immune regulation of maternal–fetal interface (Siewiera et al. 2015, Lu et al. 2020). It has been reported that the cytotoxic activity of natural killer (NK) cell is depressed during pregnancy (Gregory et al. 1985, Yang et al. 2018) and the abnormal increase of decidual NK cells is related to miscarriage (Quenby et al. 2005, Vomstein et al. 2020). In addition, abnormalities of the NK function and activity were observed in most patients with unexplained spontaneous miscarriage (Toth et al. 2019). The killer receptors and the cytoplasmic granules including CD16, CD107a, NKp30, perforin, and granzyme B were also found to be increased on the decidual NK cells of recurrent miscarriage patients (Zhang et al. 2008, Li et al. 2019, Yang et al. 2021). DSCs play a necessary role in regulating the phenotype and biological function of decidual NK cells, although the specific mechanism is not clear enough now (Yang et al. 2019, Lu et al. 2020, James-Allan et al. 2020).
Previous studies have demonstrated that IGF1 plays a critical role in diverse functions of cells of the innate and acquired immune systems (Merchav et al. 1988, Ni et al. 2013). Human natural killer cells have the ability to produce IGF1 and that differential endogenous IGF1 expression leads to disparate cytotoxicity in human primary natural killer cells (Ni et al. 2013, Youness et al. 2016). In the current study, we observed that decidual immune cells, including dNK cells, decidual macrophage and decidual T cells expressed IGF1R. After stimulation with recombinant human IGF1 protein or co-culturing with DSCs, the expression of NK cell cytotoxicity-related receptors decreased, including CD107a, CD16 and NKp30, indicating that DSCs impair the cytotoxicity of decidual NK cells through IGF1, although the specific mechanism is still unclear. It has been reported that the STAT3 pathway is involved in the regulation of NK cell cytotoxicity by IGF1 (Ni et al. 2013). More notedly, the function of decidual NK cells is regulated by STAT signaling pathway (Fu et al. 2017). Therefore, we speculated that the IGF1 derived from DSC may modulate the function of decidual NK cells through STAT signaling pathway and contribute to the formation of maternal–fetal immune–tolerance microenvironment. In addition, our results also showed that IGF1 derived from DSCs can promote the proliferation of decidual NK cells. IGF1 binding to the IGF1R that are present on most cell types activates the Akt pathway and promotes cellular proliferation (Laron 2001, Waldron et al. 2018). Here, we observed that IGF1 could increase the proliferated ability of dNK cells, but whether this effect is dependent on the activation of Akt signaling pathway needs more researches. Owing to the expression of IGF1R on decidual T cells and macrophage, the possible role and mechanism of IGF1 on these cells should be further researched.
Progesterone and estrogen are both female sex hormones which are essential in the maintenance of pregnancy. Estradiol-17β (E2), which plays important roles in the regulation of reproductive functions, exerts the action by binding to the estrogen receptor (ESR). The classic ESRs are ESR1 and ESR2, which are encoded by two distinct genes. The activated ESRs regulate the transcription of E2-sensitive genes through directly binding to the estrogen responsive element (ERE) or by indirect interaction with other transcription factors, such as activating protein 1 (AP-1) and stimulating protein 1 (Sp-1) (Bjornstrom & Sjoberg 2005). Previous study has suggested that ESR1 promotes IGF1 transcription, whereas ESR2 appears to inhibit IGF1 gene transcription in mouse endometrial stromal cells and ovarian granulosa cells (Ogo et al. 2014). ESR1 and ESR2 are all expressed in the decidual stromal cells (DSC) (Lecce et al. 2001, Yu et al. 2019a). In addition, progesterone is able to induce ESR expression (Diep et al. 2016). In our research, the expression of IGF1 was significantly increased when DSCs were treated with estrogen and progesterone respectively. The predicted network of bioinformatics analysis showed that WISP2 was predicted as a critical regulatory gene among ESR1, ESR2, PGR and IGF1. WISP2, also known as CCN5, is a cysteine-rich protein, which belongs to the CCN protein family and is the downstream target protein of Wnt/β-Catenin. Previous study has suggested that WISP2 is involved in the regulation of IGF1 (Cai et al. 2017). Further analysis showed that both progesterone and estrogen upregulated the expression of WISP2, which was consistent with regulation of IGF1. Furthermore, we also confirmed that the expression of IGF1 increased after the transfection of WISP2 overexpression plasmid into the DSCs. Based on the aforementioned results, progesterone and estrogen increase the IGF1 expression by binding with the corresponding receptors, and WISP2 is involved in the regulation process. Notably, we also observed that the WISP2 expression in DSCs was significantly lower in patients with unexplained spontaneous miscarriage compared with normal pregnant women, which echoed the results of IGF1 expression. The inadequacy of estrogen and progesterone during early pregnancy is thought to be one of the important causes of miscarriage (Haas & Ramse 2013, Xu et al. 2017). Therefore, the deficiency of estrogen and progesterone might result in the decrease of WISP2 expression, possibly contributing to the abnormal decrease of IGF1 expression and dysfunction of dNKs during early pregnancy. Certainly, the possible mechanism of estrogen and progesterone on WISP2 expression still needs to be explored.
In conclusion, as shown in Fig. 7, IGF1 expressed and secreted on DSCs promotes cell survival and decreases the apoptosis of DSCs. In addition, the IGF1 derived from DSCs suppresses the cytotoxicity and promotes the proliferation of dNKs by binding to IGF1R. This effect is beneficial to induce the immune tolerance of dNKs at the maternal–fetal interface and thus contributes to successful pregnancy. Although the specific mechanism is still unclear, regulating the expression of IGF1 may be a potential target for clinical treatment of patients with abnormal pregnancy, and further studies are required to confirm this.
The role of DSCs-derived IGF1 at maternal–fetal interface during early pregnancy. Progesterone and estrogen regulate the expression of IGF1 in the DSCs through upregulation of the WISP2 expression. Under the positive regulation of progesterone and estrogen, IGF1 could enhance cell survival, and reduce the apoptosis of DSCs. In addition, IGF1 derived from DSCs can regulate decidual NK cell function possibly via decreasing cytotoxicity-related molecules CD16, CD107a, and NKp30, and also promote decidual NK cells proliferation by upregulating Ki67 at the maternal–fetal interface. IGF1 contributes to the formation of maternal–fetal interface immune tolerance by regulating the functioning of DSCs and decidual NK cells, thus contributing to successful pregnancy.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The role of DSCs-derived IGF1 at maternal–fetal interface during early pregnancy. Progesterone and estrogen regulate the expression of IGF1 in the DSCs through upregulation of the WISP2 expression. Under the positive regulation of progesterone and estrogen, IGF1 could enhance cell survival, and reduce the apoptosis of DSCs. In addition, IGF1 derived from DSCs can regulate decidual NK cell function possibly via decreasing cytotoxicity-related molecules CD16, CD107a, and NKp30, and also promote decidual NK cells proliferation by upregulating Ki67 at the maternal–fetal interface. IGF1 contributes to the formation of maternal–fetal interface immune tolerance by regulating the functioning of DSCs and decidual NK cells, thus contributing to successful pregnancy.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
The role of DSCs-derived IGF1 at maternal–fetal interface during early pregnancy. Progesterone and estrogen regulate the expression of IGF1 in the DSCs through upregulation of the WISP2 expression. Under the positive regulation of progesterone and estrogen, IGF1 could enhance cell survival, and reduce the apoptosis of DSCs. In addition, IGF1 derived from DSCs can regulate decidual NK cell function possibly via decreasing cytotoxicity-related molecules CD16, CD107a, and NKp30, and also promote decidual NK cells proliferation by upregulating Ki67 at the maternal–fetal interface. IGF1 contributes to the formation of maternal–fetal interface immune tolerance by regulating the functioning of DSCs and decidual NK cells, thus contributing to successful pregnancy.
Citation: Reproduction 161, 4; 10.1530/REP-20-0658
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by the National Natural Science Foundation of China (NSFC) (No. 31970798, 92057119 and 31671200), the Innovation-oriented Science and Technology Grant from NPFPC Key Laboratory of Reproduction Regulation (CX2017-2), the Program for Zhuoxue of Fudan University (JIF157602).
Author contribution statement
J W S conducted all the experiments and prepared the figures and the manuscript. H L Y, Z Z L, H H S, X Y Q, X M Q and Y W helped for the clinical samples collection. J N W helped for the data analysis. M Q L designed, initiated and supervised the project and edited the manuscript. All the authors were involved in writing the manuscript.
References
Bjornstrom L & Sjoberg M 2005 Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Molecular Endocrinology 19 833–842. (https://doi.org/10.1210/me.2004-0486)
Brigstock DR, Goldschmeding R, Katsube KI, Lam SC, Lau LF, Lyons K, Naus C, Perbal B, Riser B & Takigawa M et al.2003 Proposal for a unified CCN nomenclature. Molecular Pathology 56 127–128. (https://doi.org/10.1136/mp.56.2.127)
Cai X, Xie J, Yao Y, Cun X, Lin S, Tian T, Zhu B & Lin Y 2017 Angiogenesis in a 3D model containing adipose tissue stem cells and endothelial cells is mediated by canonical Wnt signaling. Bone Research 5 17048. (https://doi.org/10.1038/boneres.2017.48)
Collett-Solberg PF & Cohen P 2000 Genetics, chemistry, and function of the IGF/IGFBP system. Endocrine 12 121–136. (https://doi.org/10.1385/ENDO:12:2:121)
Costa-Silva DR, Barros-Oliveira MD, Borges RS, Tavares CB, Borges US, Alves-Ribeiro FA, Silva VC & Silva BB 2016 Insulin-like growth factor 1 gene polymorphism and breast cancer risk. Anais da Academia Brasileira de Ciências 88 2349–2356. (https://doi.org/10.1590/0001-3765201620160169)
Diep CH, Ahrendt H & Lange CA 2016 Progesterone induces progesterone receptor gene (PGR) expression via rapid activation of protein kinase pathways required for cooperative estrogen receptor alpha (ER) and progesterone receptor (PR) genomic action at ER/PR target genes. Steroids 114 48–58. (https://doi.org/10.1016/j.steroids.2016.09.004)
Forbes BE, Blyth AJ & Wit JM 2020 Disorders of IGFs and IGF-1R signaling pathways. Molecular and Cellular Endocrinology 518 111035. (https://doi.org/10.1016/j.mce.2020.111035)
Fu Q, Tao Y, Piao HL, Du MR & Li DJ 2014 Trophoblasts and decidual stromal cells regulate decidual NK cell functions via interaction between collagen and LAIR-1. American Journal of Reproductive Immunology 71 368–378. (https://doi.org/10.1111/aji.12211)
Fu Q, Sun YF, Tao Y, Piao HL, Wang XQ, Luan XY, Du MR & Li DJ 2017 Involvement of the JAK-STAT pathway in collagen regulation of decidual NK cells. American Journal of Reproductive Immunology 78 e12769. (https://doi.org/10.1111/aji.12769)
Gregory CD, Shan LP, Lee H, Scott IV & Golding PR 1985 Cytotoxic reactivity of human natural killer (NK) cells during normal pregnancy: a longitudinal study. Journal of Clinical and Laboratory Immunology 18 175–181.
Haas DM & Ramse PS 2013 Progestogen for preventing miscarriage. Cochrane Database of Systematic Reviews 10 Cd003511. (https://doi.org/10.1002/14651858.CD003511.pub3)
Han VK, Bassett N, Walton J & Challis JR 1996 The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. Journal of Clinical Endocrinology and Metabolism 81 2680–2693. (https://doi.org/10.1210/jcem.81.7.8675597)
Huat TJ, Khan AA, Pati S, Mustafa Z, Abdullah JM & Jaafar H 2014 IGF-1 enhances cell proliferation and survival during early differentiation of mesenchymal stem cells to neural progenitor-like cells. BMC Neuroscience 15 91. (https://doi.org/10.1186/1471-2202-15-91)
James-Allan LB, Buckley RJ, Whitley GS & Cartwright JE 2020 The phenotype of decidual CD56+ lymphocytes is influenced by secreted factors from decidual stromal cells but not macrophages in the first trimester of pregnancy. Journal of Reproductive Immunology 138 103082. (https://doi.org/10.1016/j.jri.2020.103082)
Jones JI & Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocrine Reviews 16 3–34. (https://doi.org/10.1210/edrv-16-1-3)
Kelleher AM, Milano-Foster J, Behura SK & Spencer TE 2018 Uterine glands coordinate on-time embryo implantation and impact endometrial decidualization for pregnancy success. Nature Communications 9 2435. (https://doi.org/10.1038/s41467-018-04848-8)
King A 2000 Uterine leukocytes and decidualization. Human Reproduction Update 6 28–36. (https://doi.org/10.1093/humupd/6.1.28)
Kommagani R, Szwarc MM, Vasquez YM, Peavey MC, Mazur EC, Gibbons WE, Lanz RB, Demayo FJ & Lydon JP 2016 The promyelocytic leukemia zinc finger transcription factor is critical for human endometrial stromal cell decidualization. PLoS Genetics 12 e1005937. (https://doi.org/10.1371/journal.pgen.1005937)
Krieg S & Westphal L 2015 Immune function and recurrent pregnancy loss. Seminars in Reproductive Medicine 33 305–312. (https://doi.org/10.1055/s-0035-1554917)
Laron Z 2001 Insulin-like growth factor 1 (IGF-1): a growth hormone. Molecular Pathology 54 311–316. (https://doi.org/10.1136/mp.54.5.311)
Lecce G, Meduri G, Ancelin M, Bergeron C & Perrot-Applanat M 2001 Presence of estrogen receptor beta in the human endometrium through the cycle: expression in glandular, stromal, and vascular cells. Journal of Clinical Endocrinology and Metabolism 86 1379–1386. (https://doi.org/10.1210/jcem.86.3.7322)
Lee CL, Vijayan M, Wang X, Lam KKW, Koistinen H, Seppala M, Li RHW, Ng EHY, Yeung WSB & Chiu PCN 2019 Glycodelin-A stimulates the conversion of human peripheral blood CD16-CD56bright NK cell to a decidual NK cell-like phenotype. Human Reproduction 34 689–701. (https://doi.org/10.1093/humrep/dey378)
Li H, Hou Y, Zhang S, Zhou Y, Wang D, Tao S & Ni F 2019 CD49a regulates the function of human decidual natural killer cells. American Journal of Reproductive Immunology 81 e13101. (https://doi.org/10.1111/aji.13101)
Lu H, Yang HL, Zhou WJ, Lai ZZ, Qiu XM, Fu Q, Zhao JY, Wang J, Li DJ & Li MQ 2020 Rapamycin prevents spontaneous abortion by triggering decidual stromal cell autophagy-mediated NK cell residence. Autophagy 1 1–17. (https://doi.org/10.1080/15548627.2020.1833515)
Luo L, Wang Q, Chen M, Yuan G, Wang Z & Zhou C 2016 IGF-1 and IGFBP-1 in peripheral blood and decidua of early miscarriages with euploid embryos: comparison between women with and without PCOS. Gynecological Endocrinology 32 538–542. (https://doi.org/10.3109/09513590.2016.1138459)
Ma RJ, Tan YQ & Zhou G 2019 Aberrant IGF1-PI3K/AKT/mTOR signaling pathway regulates the local immunity of oral lichen planus. Immunobiology 224 455–461. (https://doi.org/10.1016/j.imbio.2019.01.004)
Majchrzak-Baczmańska D & Malinowski A 2016 Does IGF-1 play a role in the biology of endometrial cancer? Ginekologia Polska 87 598–604. (https://doi.org/10.5603/GP.2016.0052)
Mayama R, Izawa T, Sakai K, Suciu N & Iwashita M 2013 Improvement of insulin sensitivity promotes extravillous trophoblast cell migration stimulated by insulin-like growth factor-I. Endocrine Journal 60 359–368. (https://doi.org/10.1507/endocrj.ej12-0241)
Meng YH, Zhou WJ, Jin LP, Liu LB, Chang KK, Mei J, Li H, Wang J, Li DJ & Li MQ 2017 RANKL-mediated harmonious dialogue between fetus and mother guarantees smooth gestation by inducing decidual M2 macrophage polarization. Cell Death and Disease 8 e3105. (https://doi.org/10.1038/cddis.2017.505)
Merchav S, Tatarsky I & Hochberg Z 1988 Enhancement of human granulopoiesis in vitro by biosynthetic insulin-like growth factor I/somatomedin C and human growth hormone. Journal of Clinical Investigation 81 791–797. (https://doi.org/10.1172/JCI113385)
Muzzio D, Zygmunt M & Jensen F 2014 The role of pregnancy-associated hormones in the development and function of regulatory B cells. Frontiers in Endocrinology 5 39. (https://doi.org/10.3389/fendo.2014.00039)
Ni F, Sun R, Fu B, Wang F, Guo C, Tian Z & Wei H 2013 IGF-1 promotes the development and cytotoxic activity of human NK cells. Nature Communications 4 1479. (https://doi.org/10.1038/ncomms2484)
Niu ZR, Han T, Sun XL, Luan LX, Guo WL & Zhu XM 2018 MicroRNA-30a-3p is overexpressed in the placentas of patients with preeclampsia and affects trophoblast invasion and apoptosis by its effects on IGF-1. American Journal of Obstetrics and Gynecology 218 249 . e1–249 . e12. (https://doi.org/10.1016/j.ajog.2017.11.568)
Ogo Y, Taniuchi S, Ojima F, Hayashi S, Murakami I, Saito Y, Takeuchi S, Kudo T & Takahashi S 2014 IGF-1 gene expression is differentially regulated by estrogen receptors α and β in mouse endometrial stromal cells and ovarian granulosa cells. Journal of Reproduction and Development 60 216–223. (https://doi.org/10.1262/jrd.2013-085)
Paul ABM, Sader ST & Mahesan AM 2019 The role of microRNAs in human embryo implantation: a review. Journal of Assisted Reproduction and Genetics 36 179–187. (https://doi.org/10.1007/s10815-018-1326-y)
Philippou A, Maridaki M, Pneumaticos S & Koutsilieris M 2014 The complexity of the IGF1 gene splicing, posttranslational modification and bioactivity. Molecular Medicine 20 202–214. (https://doi.org/10.2119/molmed.2014.00011)
Piao HL, Tao Y, Zhu R, Wang SC, Tang CL, Fu Q, Du MR & Li DJ 2012 The CXCL12/CXCR4 axis is involved in the maintenance of Th2 bias at the maternal/fetal interface in early human pregnancy. Cellular and Molecular Immunology 9 423–430. (https://doi.org/10.1038/cmi.2012.23)
Quenby S, Kalumbi C, Bates M, Farquharson R & Vince G 2005 Prednisolone reduces preconceptual endometrial natural killer cells in women with recurrent miscarriage. Fertility and Sterility 84 980–984. (https://doi.org/10.1016/j.fertnstert.2005.05.012)
Repudi SR, Patra M & Sen M 2013 WISP3-IGF1 interaction regulates chondrocyte hypertrophy. Journal of Cell Science 126 1650–1658. (https://doi.org/10.1242/jcs.119859)
Senapati S, Wang F, Ord T, Coutifaris C, Feng R & Mainigi M 2018 Superovulation alters the expression of endometrial genes critical to tissue remodeling and placentation. Journal of Assisted Reproduction and Genetics 35 1799–1808. (https://doi.org/10.1007/s10815-018-1244-z)
Siewiera J, Gouilly J, Hocine HR, Cartron G, Levy C, Al-Daccak R & Jabrane-Ferrat N 2015 Natural cytotoxicity receptor splice variants orchestrate the distinct functions of human natural killer cell subtypes. Nature Communications 6 10183. (https://doi.org/10.1038/ncomms10183)
Sojka DK, Yang L & Yokoyama WM 2018 Uterine natural killer cells: to protect and to nurture. Birth Defects Research 110 1531–1538. (https://doi.org/10.1002/bdr2.1419)
Sojka DK, Yang L & Yokoyama WM 2019 Uterine natural killer cells. Frontiers in Immunology 10 960. (https://doi.org/10.3389/fimmu.2019.00960)
Tanaka K, Watanabe M, Matsushima M, Matsuzawa Y, Izawa T, Nagashima T, Kobayashi Y & Iwashita M 2018 Synergistic effects of tumor necrosis factor-alpha and insulin-like growth factor-I on survival of human trophoblast-derived BeWo cell line. Growth Hormone and IGF Research 41 34–41. (https://doi.org/10.1016/j.ghir.2018.07.001)
Toth B, Vomstein K, Togawa R, Bottcher B, Hudalla H, Strowitzki T, Daniel V & Kuon RJ 2019 The impact of previous live births on peripheral and uterine natural killer cells in patients with recurrent miscarriage. Reproductive Biology and Endocrinology 17 72. (https://doi.org/10.1186/s12958-019-0514-7)
Vomstein K, Voss P, Molnar K, Ainsworth A, Daniel V, Strowitzki T, Toth B & Kuon RJ 2020 Two of a kind? Immunological and clinical risk factors differ between recurrent implantation failure and recurrent miscarriage. Journal of Reproductive Immunology 141 103166. (https://doi.org/10.1016/j.jri.2020.103166)
Waldron J, Raymond W, Ostli-Eilertsen G & Nossent J 2018 Insulin-like growth factor-1 (IGF1) in systemic lupus erythematosus: relation to disease activity, organ damage and immunological findings. Lupus 27 963–970. (https://doi.org/10.1177/0961203318756288)
Wang S, Wang G, Zhang M, Zhuang L, Wan X, Xu J, Wang L, Zhu X, Gao P & Xi Q et al.2016 The dipeptide Pro-Asp promotes IGF-1 secretion and expression in hepatocytes by enhancing JAK2/STAT5 signaling pathway. Molecular and Cellular Endocrinology 436 204–210. (https://doi.org/10.1016/j.mce.2016.07.028)
Xu Q, Chen J, Wei Z, Brandon TR, Zava DT, Shi YE & Cao Y 2017 Sex hormone metabolism and threatened abortion. Medical Science Monitor 23 5041–5048. (https://doi.org/10.12659/msm.904500)
Xue J, Schmidt SV, Sander J, Draffehn A, Krebs W, Quester I, Denardo D, Gohel TD, Emde M & Schmidleithner L et al.2014 Transcriptome-based network analysis reveals a spectrum model of human macrophage activation. Immunity 40 274–288. (https://doi.org/10.1016/j.immuni.2014.01.006)
Yagel S 2009 The developmental role of natural killer cells at the fetal-maternal interface. American Journal of Obstetrics and Gynecology 201 344–350. (https://doi.org/10.1016/j.ajog.2009.02.030)
Yang SL, Niu TT, Li XL, Li DJ, Li MQ & Wang HY 2018 Bu-Shen-Yi-Qi formula impairs cytotoxicity of NK cells by up-regulating IDO expression in trophoblasts. Gynecological Endocrinology 34 675–679. (https://doi.org/10.1080/09513590.2018.1425988)
Yang HL, Zhou WJ, Lu H, Lei ST, Ha SY, Lai ZZ, Zheng ZM, Ruan LY, He YY & Li DJ et al.2019 Decidual stromal cells promote the differentiation of CD56(bright) CD16(-) NK cells by secreting IL-24 in early pregnancy. American Journal of Reproductive Immunology 81 e13110. (https://doi.org/10.1111/aji.13110)
Yang SL, Tan HX, Niu TT, Li DJ, Wang HY & Li MQ 2021 Kynurenine promotes the cytotoxicity of NK cells through aryl hydrocarbon receptor in early pregnancy. Journal of Reproductive Immunology 143 103270. (https://doi.org/10.1016/j.jri.2020.103270)
Youness RA, Rahmoon MA, Assal RA, Gomaa AI, Hamza MT, Waked I, Eltayebi HM & Abdelaziz AI 2016 Contradicting interplay between insulin-like growth factor-1 and miR-486-5p in primary NK cells and hepatoma cell lines with a contemporary inhibitory impact on HCC tumor progression. Growth Factors 34 128–140. (https://doi.org/10.1080/08977194.2016.1200571)
Yu H & Rohan T 2000 Role of the insulin-like growth factor family in cancer development and progression. Journal of the National Cancer Institute 92 1472–1489. (https://doi.org/10.1093/jnci/92.18.1472)
Yu J, Berga SL, Zou W & Taylor RN 2019a Interleukin-1beta inhibits estrogen receptor-alpha, progesterone receptors A and B and biomarkers of human endometrial stromal cell differentiation: implications for endometriosis. Molecular Human Reproduction 25 625–637. (https://doi.org/10.1093/molehr/gaz045)
Yu M, Cui X, Wang H, Liu J, Qin H, Liu S & Yan Q 2019b FUT8 drives the proliferation and invasion of trophoblastic cells via IGF-1/IGF-1R signaling pathway. Placenta 75 45–53. (https://doi.org/10.1016/j.placenta.2018.11.005)
Zhang Y, Zhao A, Wang X, Shi G, Jin H & Lin Q 2008 Expressions of natural cytotoxicity receptors and NKG2D on decidual natural killer cells in patients having spontaneous abortions. Fertility and Sterility 90 1931–1937. (https://doi.org/10.1016/j.fertnstert.2007.08.009)
Zhang S, Wu Z, Heng J, Tian M, Chen J, Chen F & Guan W 2020 L-carnitine increases cell proliferation and amino acid transporter expression via the activation of insulin-like growth factor I signaling pathway in rat trophoblast cells. Food Science and Nutrition 8 3298–3307. (https://doi.org/10.1002/fsn3.1607)
Zhou W, Wang J, Qi Q, Feng Z, Huang B, Chen A, Zhang D, Li W, Zhang Q & Bjerkvig R et al.2018 Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway. Cancer Medicine 7 4729–4743. (https://doi.org/10.1002/cam4.1720)
Zhu R, Wang SC, Sun C, Tao Y, Piao HL, Wang XQ, Du MR & Li DJ 2013 Hyaluronan-CD44 interaction promotes growth of decidual stromal cells in human first-trimester pregnancy. PLoS ONE 8 e74812. (https://doi.org/10.1371/journal.pone.0074812)
