Abstract
Long ncRNAs regulate a complex array of fundamental biological processes, while its molecular regulatory mechanism in Leydig cells (LCs) remains unclear. In the present study, we established the lncRNA LOC102176306/miR-1197-3p/peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PPARGC1A) regulatory network by bioinformatic prediction, and investigated its roles in goat LCs. We found that lncRNA LOC102176306 could efficiently bind to miR-1197-3p and regulate PPARGC1A expression in goat LCs. Downregulation of lncRNA LOC102176306 significantly supressed testosterone (T) synthesis and ATP production, decreased the activities of antioxidant enzymes and mitochondrial complex I and complex III, caused the loss of mitochondrial membrane potential, and inhibited the proliferation of goat LCs by decreasing PPARGC1A expression, while these effects could be restored by miR-1197-3p inhibitor treatment. In addition, miR-1197-3p mimics treatment significantly alleviated the positive effects of lncRNA LOC102176306 overexpression on T and ATP production, antioxidant capacity and proliferation of goat LCs. Taken together, lncRNA LOC102176306 functioned as a sponge for miR-1197-3p to maintain PPARGC1A expression, thereby affecting the steroidogenesis, cell proliferation and oxidative stress of goat LCs. These findings extend our understanding of the molecular mechanisms of T synthesis, cell proliferation and oxidative stress of LCs.
Introduction
Leydig cells (LCs), located in the interstitial tissue of the testis, as the main site of androgen (mainly testosterone (T)) synthesis and secretion, play pivotal roles in regulating secondary male-specific sexual maturation and male reproduction (Zirkin & Papadopoulos 2018). Steroidogenesis in LCs is a complex process involving in a series of cholesterol transporters, steroidogenic enzymes and transcription factors (Andric & Kostic 2019). These key enzymes related to steroidogenesis are mainly localized in the mitochondria, which is a key control point for steroid biosynthesis and regulation (Haider 2007, Miller 2013). As a master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PPARGC1A) has been identified to be involved in T production in LCs (An et al. 2019, Radovic et al. 2019). Moreover, several studies have shown that PPARGC1A participated in the regulation of cell proliferation, apoptosis, oxidative stress and energy metabolism in the LCs (Gak et al. 2015, Roy et al. 2017, Medar et al. 2020), which improved testis development and reproductive health. Despite numerous studies, the precise mechanisms of PPARGC1A to mediate cell proliferation, oxidative stress and steroidogenesis of goat LCs are still not fully understood.
Accumulating evidence suggests that noncoding ribonucleic acids (ncRNAs), including miRNA and long ncRNAs, modulate a variety of biological processes, including cell growth, differentiation, apoptosis, metastasis, and mitochondrial function (Guil & Esteller 2015, Li et al. 2016). miRNA can specifically bind to the 3’-untranslated regions (3’UTR) of mRNA to induce mRNA degradation or repress mRNA translation of the target genes (Ambros 2004). Additionally, lncRNAs could function as competing endogenous RNAs (ceRNAs) by sponging miRNAs to regulate their target genes (Salmena et al. 2011). In recent years, using extensive microarray profiling of testis tissues or male germ cells, a number of studies have demonstrated the expression profiles of lncRNA, miRNA and mRNA during spermatogenesis, steroidogenesis and testis development (Wichman et al. 2017, Qiannan et al. 2020). In addition, a number of lncRNAs and miRNAs were implicated in the regulation of LC function (Chen et al. 2019, Cui et al. 2020). Our previous research also showed that lncRNA LOC105611671 and miR-26a regulated T production of sheep LCs by ceRNA regulation network (Gao et al. 2020). Despite extensive researches, most of the detected lncRNAs have unknown or poorly understood functions, and the molecular mechanisms of ceRNA regulatory network responsible for mediating cell proliferation, oxidative stress and steroidogenesis of goat LCs remain to be explored.
LncRNAs and miRNAs are involved in the regulation of mitochondrial biogenesis (Su et al. 2019, Tian et al. 2019), some of which participate in the functional regulation via mediating PPARGC1A expression (Long et al. 2016, Zhang et al. 2020). Recent research showed that the regulatory network of lncRNA histocompatibility leukocyte antigen complex P5 (HCP5)/miR-3619-5p/PPARGC1A was involved in fatty acid oxidation of gastric cancer cells (Wu et al. 2020). Our previous study demonstrated that miR-1197-3p regulated T secretion in goat LCs via targeting PPARGC1A (An et al. 2019). In the current study, we tested the hypothesis that the highly expressed lncRNAs in goat LCs could act as ceRNA for miR-1197-3p to regulate LC function by targeting PPARGC1A. To test the hypothesis, bioinformatics analysis, dual-luciferase reporter assay and gain- and loss-of-function experiments were conducted, and the functions of candidate lncRNA/miR-1197-3p/PPARGC1A regulatory network in T production, cell proliferation and oxidative stress in cultured goat LCs were evaluated.
Materials and methods
All protocols involved in the use of animals were performed in accordance with the approved Guidelines for Animal Experiments of Nanjing Agricultural University and were approved by Animal Care and Use Committee of Nanjing Agricultural University (SYXK2017-0027). Unless otherwise indicated, the chemicals used in the current study were purchased from Sigma–Aldrich Company and the media were from Life Technologies. A schematic representation of the experimental design was shown in Fig. 1.
A schematic representation of the experimental design based on the lncRNA sequencing database. The lncRNA LOC102176306/miR-1197-3p/PPARGC1A network was constructed by bioinformatics analysis and dual-Luciferase reporter assay, and gain-and loss-of-function experiments were conducted to investigate the function of lncRNA LOC102176306/miR-1197-3p/PPARGC1A network in testosterone production, cell proliferation, and oxidative stress of cultured goat LCs.
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
A schematic representation of the experimental design based on the lncRNA sequencing database. The lncRNA LOC102176306/miR-1197-3p/PPARGC1A network was constructed by bioinformatics analysis and dual-Luciferase reporter assay, and gain-and loss-of-function experiments were conducted to investigate the function of lncRNA LOC102176306/miR-1197-3p/PPARGC1A network in testosterone production, cell proliferation, and oxidative stress of cultured goat LCs.
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
A schematic representation of the experimental design based on the lncRNA sequencing database. The lncRNA LOC102176306/miR-1197-3p/PPARGC1A network was constructed by bioinformatics analysis and dual-Luciferase reporter assay, and gain-and loss-of-function experiments were conducted to investigate the function of lncRNA LOC102176306/miR-1197-3p/PPARGC1A network in testosterone production, cell proliferation, and oxidative stress of cultured goat LCs.
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Bioinformatic analysis
LncRNA data used for the construction of lncRNA/miR-1197-3p/PPARGC1A interaction network were taken from the sequencing datasets of goat oocytes at different development stages (germinal vesicle vs metaphase II) based on our previous study (Liu et al. 2020). Candidate PPARGC1A-associated lncRNAs (Supplementary Table 1, see section on supplementary materials given at the end of this article) were predicted and explored using the cis (neighbor the site of lncRNA production) and trans (co-expression with target genes) model (Wang & Chang 2011). Candidate miR-1197-3p-targeted lncRNAs (Supplementary Table 2) were predicted by using RNAhybrid (https://bibiserv. cebitec.uni-bielefeld.de/rnahybrid), miRanda (www.microrna.org) and TargetScan (www.targetscan.org/mamm_31/). The ceRNA network of lncRNAs/miR-1197-3p/ PPARGC1A was visualized using Cytoscape software (Shannon et al. 2003) and further investigated in goat LCs.
Sequences of lncRNA LOC102176306 siRNA candidates and scramble siRNA used in the current study.
| Candidate siRNA | Sequence (5′–3′) | ||
|---|---|---|---|
| Sense | Antisense | ||
| siRNA-1-LOC102176306 | LOC102176306-1607 | GCCUAUUAUACAGAGUGAATT | UUCACUCUGUAUAAUAGGCTT |
| siRNA-2-LOC102176306 | LOC102176306-735 | GCGGAAUACGCGUAAUAUATT | UAUAUUACGCGUAUUCCGCTT |
| siRNA-3-LOC102176306 | LOC102176306-626 | GGAACUGUCUGCUGGUCAATT’ | UUGACCAGCAGACAGUUCCTT |
| Scramble siRNA | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT | |
siRNA, small interference RNA.
Dual-luciferase reporter assay
The sequences containing the putative miR-1197-3p target sites or mutant sequences in the candidate lncRNAs were cloned into pmir-GLO-basic vectors (Genepharma, Shanghai, China). All the recombinant vectors were sequenced to confirm the correct insertion by GenScript (Nanjing, China). Luciferase reporter assays were performed in 293FT cells using the Dual-Luciferase® Reporter Assay System (Promega) following the manufacturer’s instructions. All the experiments were performed in triplicate and repeated five times.
Cell culture and transfection
The LCs were isolated from goat testis and cultured as previously described (An et al. 2019). Briefly, the LCs were cultured in low glucose DMEM/F12 medium with 15% fetal bovine serum, 2 mM l-glutamine, 100 IU/mL penicillin and 100 µg/mL streptomycin, under a humidified atmosphere containing 5% CO2 at 37°C. After 18 h of culture, the LCs were transfected with the oligonucleotides or plasmids using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. The oligonucleotides of miR-1197-3p mimics and inhibitor were synthesized as previously described (An et al. 2019). Three specific small-interference RNAs (siRNAs) for lncRNA LOC102176306 (NCBI accession number: XR_001297477.2) and scramble siRNA were purchased from GenePharma and shown in Table 1. LncRNA LOC102176306 overexpression vector (pEX-3-LOC102176306) was constructed by cloning lncRNA LOC102176306 sequence into pEX-3 vector, and purchased from GenePharma. The recombinant pEX-3-LOC102176306 vector was sequenced by GenScript to confirm its correct insertion. After 48 h of transfection, the cells and spent culture media were collected for further analysis.
RNA isolation of nuclear and cytoplasmic fractions
Nuclear and cytoplasmic RNA was isolated from the cells using PARIS™ kit according to the manufacturer’s protocol (Thermo, DE, USA). The relative levels of the candidate lncRNA in both cytoplasmic and nuclear fractions were detected by quantitative real-time PCR (qRT-PCR), and the assay was performed in triplicate and repeated three times.
RNA fluorescence in situ hybridization (FISH) assay
RNA FISH analysis was performed using a Fluorescent in situ hybridization kit (GenePharma) following the manufacturer’s instruction. Cell nuclei were stained with DAPI (Beyotime, Shanghai, China). Fluorescence images were observed with LSM710 laser scanning confocal microscope (Carl Zeiss) under the same conditions. The sequence of FISH probe for lncRNA LOC102176306 was 5′-ttctcacactcacagatcctagaaaa caatgtgactgagcctcgcagtacctctaaacatggatgg-3′. The assay was performed in triplicate and repeated three times.
Determinatin of T secretion
The T concentration in the collected culture media was measured using a Goat T ELISA kit (Kamels, Shanghai, China) following the manufacturer’s instruction. The sensitivity of the assay was 0.03 ng/mL, and the intra- and inter-assay coefficients of variation were 7.2 and 8.9%, respectively. The assay was performed in triplicate and repeated four times.
Cell proliferation assay
Cell proliferation was assessed using the Click-iT EdU kit (Keygene BioTECH, Nanjing, China) following the manufacturer’s instruction. Ethynyl-2-deoxyuridine (EdU) positive cells (red nuclei) and negative cells (blue only) were observed and photographed by LSM710 laser scanning confocal microscope (Carl Zeiss), under the same conditions. Each assay was performed in triplicate and repeated three times, and at least 5000 cells were counted per time.
Measurement of ATP level and antioxidant enzyme activity
The LCs were homogenized in lysis buffer and centrifuged at 12,000 g for 15 min at 4°C. The supernatant was used for the measurement of ATP level and antioxidant enzyme activity. The protein concentration was determined by using bicinchoninic acid (BCA) Protein Assay kit (Beyotime). ATP level (ATP Determination kit, No.A22066, Invitrogen) and the enzyme activity of superoxide dismutase (SOD, SOD Assay kit, No.S311-10, Dojindo Molecular Technologies, Tokyo, Japan) were determined by using the commercial kits. Likewise, the enzyme activities of catalase (CAT), glutathione peroxidase (GPx), glutathione (GSH) and oxidized glutathione (GSSG) were measured by using Beyotime Biotechnology kits (Catalase Assay kit, No. S0051; Cellular Glutathione Peroxidase Assay kit, No. S0056; GSH and GSSG Assay kit, No. S0053; respectively; Shanghai, China) and strictly followed the manufacturer’s instruction. All the experiments were performed in triplicate and repeated four times.
Measurement of mitochondrial membrane potential (MMP)
The MMP was measured using the mitochondrial membrane potential assay kit with JC-1 (Beyotime) following the manufacturer’s instructions. In the healthy cells, JC-1 accumulates in the mitochondria and selectively generates a red or an orange J-aggregate emission profile (590 nm). However, in the injured cells, the MMP decreases and JC-1 monomers emit green fluorescence at 530 nm. JC-1 is excited at 488 nm and non-conjugated light emissions are collected at 530 nm and conjugated at 590 nm. The assay was performed in triplicate and repeated five times, and at least 8000 cells were counted per time. The Δ𝜓m of goat LCs in each group was calculated as the ratio of red (J-aggregate) to green (monomeric JC-1) fluorescence and normalized to the control group.
Assessment of mitochondrial electron transport chain (ETC) enzyme activity
Mitochondria were isolated from the cells using Tissue Mitochondria Isolation kit (No. C3606, Beyotime) according to the manufacturer’s instruction. The protein concentration was determined by using the BCA method. The activities of NAD hydride (NADH) ubiquinone reductase (complex I), succinate ubiquinone reductase (complex II), ubiquinol cytochrome c reductase (complex III), and cytochrome c oxidase (complex IV) were measured according to the method described by Medja et al. (2009). The activities of ETC complexes I to IV were expressed as nanomole per minute per microgram protein, and each assay was performed in triplicate and repeated four times.
RNA isolation and qRT-PCR analysis
Total RNA was isolated from the testis of 3- and 9-month-old goat (nine individuals per group) and the cultured LCs using the RNA isolation kit (Qiagen) according to the manufacturer’s instructions. The cDNA was reverse transcribed using a PrimeScript™ RT reagent kit with gDNA Eraser (Takara), using the total RNA as template. The qRT-PCR was performed on a Step One Plus Real-Time PCR System (Applied BioSystems) to analyze the relative abundances of candidate lncRNAs in 3- and 9-month-old goat testis tissues, and the mRNA expressions of PPARGC1A, testosterone biosynthesis-related genes (STAR ; CYP11A1, cholesterol side-chain cleavage enzyme, mitochondrial; 3BHSD, 3beta-hydroxysteroid dehydrogenase/isomerase; CYP17A1, steroid 17-alpha-hydroxylase/17, 20 lyase), PCNA (proliferating cell nuclear antigen) and antioxidant-related genes (SOD2, superoxide dismutase 2; CAT, catalase; GPX1, glutathione peroxidase 1) in the cultured LCs, using FastStart Universal SYBR Green Master kit (Roche). Primers were designed online using Primer 5 software and provided in Tables 2 and 3. The specificity of each primer for the target genes was confirmed by PCR product sequencing and BLAST analysis. The melting curve of each lncRNA or mRNA was used to evaluate the amplification quality. The expression data were quantified using the form of 2−△△CT and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). All the experiments were performed in triplicate and repeated three times.
Details of lncRNA primer sequences, expected product size and Genbank accession number used for qRT-PCR in the current study.
| LncRNA | Primer sequence (5′– 3′) | Product size (bp) | Accession number | |
|---|---|---|---|---|
| Forward | Reverse | |||
| LOC102181394 | AGCAGCTGCCTGCATTTCTA | GTTACGGGCCTGCCACTATT | 169 | XR_310320.3 |
| LOC102176306 | CAACACACGGATGGGAGACA | TCACAGATCCTAGGCCGGAA | 187 | XR_001297477.2 |
| LOC106502026 | AGGGATTGCCCCCACAAATC | GCAGCTTGGAAACAACCGTC | 140 | XR_001295581.1 |
| LOC108634476 | GAAGAAGTCAAAGTGCCGCC | TGGGCGGTTCTACATCTGTC | 198 | XR_001917636.1 |
| LOC102186225 | GCTGCGCCGTTTGTTATAGG | AGATCAGGCCTCCAGGATGT | 298 | XR_001919158.1 |
| LOC106502609 | GTCAGAGTCAAGGCCTGCAT | TCTGATGTTACCACGGGCAC | 115 | XR_001296255.2 |
| LOC102184972 | AACAGACTGCTGTGACACCT | CCTGGAGTGAGCAGCTTCAA | 288 | XR_001917949.1 |
| LOC108638502 | GCACCGGTTGTCAAAGACAC | GCACCGGTTGTCAAAGACAC | 251 | XR_001919851.1 |
| LUZP1 | CCTCAACGAAGACACGCCT | TTCTTCTGGTGCTAGCGGTG | 196 | XR_001918822.1 |
| LOC108636833 | TGGCTGCTCGTCCTATTTCG | ATTGGCTAACGCTGCTGCTA | 259 | XR_001918595.1 |
| LOC108633557 | CATTCTGTTCCACGCTGCAC | CAACCTTGAACGTGGGGAGA | 100 | XR_001917138.1 |
| XIST | TGGCAGTTTGTCACGTGGAT | CACGCGGCAATCTAACACTG | 154 | HM016914.1 |
XIST, X-inactive specific transcript.
Details of gene symbol, primer sequence, expected product size and Genbank accession number of target genes used for qRT-PCR in the current study.
| Genes | Primer sequence (5′–3′) | Product size (bp) | Accession number | |
|---|---|---|---|---|
| Forward | Reverse | |||
| PPARGC1A | TGTGCAACCAGGACTCTGTA | TTGAGTCCACCCAGAAAGCTG | 148 | NM_001285631.1 |
| STAR | GGTCCCCGAGACTTTGTGAG | AATCCACTTGGGTCTGCGAG | 262 | XM_013975437.2 |
| CYP11A1 | CACTTTCGCCACATCGAGAAC | AGGCTCCTGACTTCTTAAACAGG | 217 | NM_001287574.1 |
| HSD3B1 | AGACCAGAAGTTCGGGAGGAA | TCTCCCTGTAGGAGTTGGGC | 292 | XM_013962473.2 |
| CYP17A1 | CCAACCATCAGTGACCGGAA | TGGCGAGATGAGTTGTGTCC | 261 | NM_001314145.1 |
| PCNA | ATCAGCTCAAGTGGCGTGAA | TGCCAAGGTGTCCGCATTAT | 213 | XM_005688167.3 |
| SOD2 | GTGAACAACCTCAACGTCGC | GCGTCCCTGCTCCTTATTGA | 300 | XM_013966636 |
| CAT | CACTCAGGTGCGGGATTTCT | ATGCGGGAGCCATATTCAGG | 159 | GQ204786.1 |
| GPX1 | ACATTGAAACCCTGCTGTCC | TCATGAGGAGCTGTGGTCTG | 216 | XM_005695962.2 |
| GAPDH | CCGTTCGACAGATAGCCGTAA | AGGATCTCGCTCCTGGAAGAT | 296 | XM_005680968.3 |
Western blot analysis
Following transfection for 48 h, the total protein was extracted from the cultured LCs with the addition of radioimmunoprecipitation assay lysis buffer and quantified by the BCA method. Protein samples were diluted in gel-loading buffer, and boiled for 10 min, followed by electrophoresis of 30 µg of total protein on 10% SDS-polyacrylamide gel, and then electro-transferred to a polyvinylidene fluoride membrane (Millipore). After blocked with 5% (v/v) bovine serum albumin (BSA), the membrane was incubated with a primary antibody overnight at 4°C, and then incubated with the secondary antibody for 1 h. The detailed information of antibodies used is provided in Table 4. After washing, protein signals were detected with an enhanced chemiluminescence (ECL) Western blot detection system (Fujifilm, Tokyo, Japan). Band intensities were quantified by using ImageJ software (Wayne Rasband, MD, USA), and the target protein levels were calculated and normalized to GAPDH. The experiments were performed in triplicate and repeated four times.
Details of antibodies used for Western blot in the current study.
| Protein | Antibody | Cat no. | Source | Dilution |
|---|---|---|---|---|
| PPARGC1A | PGC1 alpha antibody | NBP1-04676SS | Novus (CO, USA) | 1:500 |
| STAR | Rabbit anti-StAR polyclonal antibody | bs-3570R | Bioss (Beijing, China) | 1:500 |
| CYP11A1 | Rabbit anti-CYP11A1 polyclonal antibody | bs-10099R | Bioss (Beijing, China) | 1:500 |
| 3BHSD | HSD3B1 antibody | NB110-78644SS | Novus (CO, USA) | 1:200 |
| CYP17A1 | Rabbit anti-cytochrome P450 17A1 antibody | bs-6695R | Bioss (Beijing, China) | 1:1000 |
| PCNA | Anti-PCNA antibody | ab18197 | Abcam (MA, USA) | 1:500 |
| SOD2 | SOD2/Mn-SOD antibody | NB100-1992 | Novus (CO, USA) | 1:5000 |
| CAT | Catalase polyclonal antibody | 21260-1-AP | ProteinTech group (Rosemont, IL,USA) | 1:2000 |
| GPX1 | Anti-glutathione peroxidase 1 | ab59546 | Abcam (MA, USA) | 1:2000 |
| GAPDH | GAPDH antibody | 60004-1-Ig | Proteintech group (Rosemont, IL,USA) | 1:8000 |
| − | HRP-conjugated affinipure goat anti- rabbit IgG(H+L) | SA00001-2 | Proteintech group (Rosemont, IL,USA) | 1:4000 |
| − | HRP-conjugated affinipure goat anti-mouse IgG(H+L) | SA00001-1 | Proteintech group (Rosemont, IL,USA) | 1:4000 |
−, absent.
Statistical analysis
All data were analyzed with SPSS 19.0 (SPSS Inc. ) and are presented as mean values ±s.e.m. For comparison, differences between two independent groups were assessed by t-test and one-way ANOVA was performed among multiple group comparisons, followed by Tukey’s test. Values of P < 0.05 were considered as statistically significant.
Results
LncRNA LOC102176306 functions as a sponge for miR-1197-3p in goat LCs
Based on the lncRNA dataset of goat oocytes, 11 candidate lncRNAs interacted with both PPARGC1A and miR-1197-3p were screened by bioinformatics analytical tools (Fig. 2A). The numbers of binding sites between miR-1197-3p and each candidate lncRNA were listed in Table 5. Among these candidate lncRNAs, the expressions of lncRNA LOC102181394, LOC102176306, LOC106502026 and LOC108634476 were significantly increased, while the expressions of lncRNA LOC102186225 and LOC106502609 were significantly decreased in 9-month-old goat testis tissue compared with those of 3-month-old goat (P < 0.05; Fig. 2B). In addition, no significant difference in the expressions of lncRNA LOC102184972, LOC108638502, LUZP1, LOC108636833 and LOC108633557 was detected between 3- and 9-month-old goat testis (Fig. 2B). In view of the numbers of binding sites and the targeting relationship between candidate lncRNAs and miR-1197-3p or PPARGC1A, we choose lncRNA LOC102181394 and LOC102176306 for the following research.
Screening of candidate lncRNAs as sponges for miR-1197-3p to regulate PPARGC1A expression. (A) The predicted lncRNAs/miR-1197-3p/PPARGC1A network was visualized by Cytoscape. (B) The relative abundances of candidate lncRNAs in 3- and 9-month-old goat testis tissues were examined by qRT-PCR. The relative expression levels were normalized to the expression amount of GAPDH. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Screening of candidate lncRNAs as sponges for miR-1197-3p to regulate PPARGC1A expression. (A) The predicted lncRNAs/miR-1197-3p/PPARGC1A network was visualized by Cytoscape. (B) The relative abundances of candidate lncRNAs in 3- and 9-month-old goat testis tissues were examined by qRT-PCR. The relative expression levels were normalized to the expression amount of GAPDH. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Screening of candidate lncRNAs as sponges for miR-1197-3p to regulate PPARGC1A expression. (A) The predicted lncRNAs/miR-1197-3p/PPARGC1A network was visualized by Cytoscape. (B) The relative abundances of candidate lncRNAs in 3- and 9-month-old goat testis tissues were examined by qRT-PCR. The relative expression levels were normalized to the expression amount of GAPDH. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Numbers of the binding sites of miR-1197-3p and candidate lncRNAs in the current study.
| miRNA | lncRNA | Numbers of binding sites |
|---|---|---|
| miR-1197-3p | LOC102181394 | 10 |
| miR-1197-3p | LOC108638502 | 10 |
| miR-1197-3p | LUZP1 | 10 |
| miR-1197-3p | LOC102184972 | 10 |
| miR-1197-3p | LOC102176306 | 9 |
| miR-1197-3p | LOC108636833 | 8 |
| miR-1197-3p | LOC102186225 | 7 |
| miR-1197-3p | LOC106502609 | 5 |
| miR-1197-3p | LOC106502026 | 3 |
| miR-1197-3p | LOC108633557 | 2 |
| miR-1197-3p | LOC108634476 | 1 |
Luciferase activity assay showed that miR-1197-3p decreased the activity of WT reporter but not the mutant reporter of lncRNA LOC102176306 (P < 0.05, Fig. 3A), indicating lncRNA LOC102176306 directly combined with miR-1197-3p. In addition, luciferase activity assay showed that miR-1197-3p could not directly interact with lncRNA LOC102181394 (Fig. 3A). Moreover, FISH experiments showed that lncRNA LOC102176306 was abundant in both the cytoplasm and the nucleus of goat LCs (Fig. 3B), and greater amounts of lncRNA LOC102176306 in the cytoplasm compared with the nucleus were observed by cytoplasmic and nuclear RNA fractionation assay (Fig. 3C).
Validation and location of LncRNA LOC102176306 as a miR-1197-3p sponge. (A) The regulatory relationship between lncRNA LOC102176306 or LOC102181394 and miR-1197-3p was verified by dual luciferase reporter gene assay. 293FT cells were transfected with the reporter vector including negative control (null), WT or mutant miR-1197-3p binding site (mut), respectively. (B) Localization of lncRNA LOC102176306 in goat LCs was detected by FISH. Nuclei were blue stained, and lncRNA LOC102176306 was green stained. Scale bar = 50 μM. (C) qRT-PCR analysis of RNAs purified from nuclear (black) and cytosolic (white) compartments in goat LCs. LncRNA XIST served as the nuclear control and GAPDH was the cytosolic control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Validation and location of LncRNA LOC102176306 as a miR-1197-3p sponge. (A) The regulatory relationship between lncRNA LOC102176306 or LOC102181394 and miR-1197-3p was verified by dual luciferase reporter gene assay. 293FT cells were transfected with the reporter vector including negative control (null), WT or mutant miR-1197-3p binding site (mut), respectively. (B) Localization of lncRNA LOC102176306 in goat LCs was detected by FISH. Nuclei were blue stained, and lncRNA LOC102176306 was green stained. Scale bar = 50 μM. (C) qRT-PCR analysis of RNAs purified from nuclear (black) and cytosolic (white) compartments in goat LCs. LncRNA XIST served as the nuclear control and GAPDH was the cytosolic control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Validation and location of LncRNA LOC102176306 as a miR-1197-3p sponge. (A) The regulatory relationship between lncRNA LOC102176306 or LOC102181394 and miR-1197-3p was verified by dual luciferase reporter gene assay. 293FT cells were transfected with the reporter vector including negative control (null), WT or mutant miR-1197-3p binding site (mut), respectively. (B) Localization of lncRNA LOC102176306 in goat LCs was detected by FISH. Nuclei were blue stained, and lncRNA LOC102176306 was green stained. Scale bar = 50 μM. (C) qRT-PCR analysis of RNAs purified from nuclear (black) and cytosolic (white) compartments in goat LCs. LncRNA XIST served as the nuclear control and GAPDH was the cytosolic control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
As shown in Fig. 4A, the high efficiency of lncRNA LOC102176306 overexpression vector was verified in goat LCs (P < 0.05). Among the three candidate siRNAs, siRNA-2-LOC102176306 (LOC102176306-siRNA) showed the highest efficiency on the downregulation of lncRNA LOC102176306 expression (P < 0.05, Fig. 4B). Moreover, LOC102176306-siRNA treatment significantly down-regulated the mRNA and protein abundances of PPARGC1A (P < 0.05, Fig. 4C and D), while miR-1197-3p inhibitor could rescue the LOC102176306-siRNA induced low expression of PPARGC1A in goat LCs (P < 0.05, Fig. 4C and D). Conversely, the expression of PPARGC1A was significantly upregulated with lncRNA LOC102176306 overexpression (P < 0.05, Fig. 4E and F), while miR-1197-3p mimics could restore the aberrant expression of PPARGC1A in lncRNA LOC102176306 overexpressed LCs (P < 0.05, Fig. 4E and F). Taken together, these results indicate that lncRNA LOC102176306 could function as a sponge for miR-1197-3p to regulate the expression of PPARGC1A in goat LCs.
LncRNA LOC102176306 functions as a ceRNA for miR-1197-3p to regulate PPARGC1A expression. (A) The efficiency of lncRNA LOC102176306 overexpression vector was verified by qRT-PCR. (B) The knockdown efficiency of lncRNA LOC102176306 siRNA was verified by qRT-PCR. siRNA-2-LOC102176306 (LOC102176306-siRNA) showed the highest efficiency on the down-regulation of lncRNA LOC102176306 expression. The mRNA (C) and protein (D) expression levels of PPARGC1A were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (E) and protein (F) expression levels of PPARGC1A were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 functions as a ceRNA for miR-1197-3p to regulate PPARGC1A expression. (A) The efficiency of lncRNA LOC102176306 overexpression vector was verified by qRT-PCR. (B) The knockdown efficiency of lncRNA LOC102176306 siRNA was verified by qRT-PCR. siRNA-2-LOC102176306 (LOC102176306-siRNA) showed the highest efficiency on the down-regulation of lncRNA LOC102176306 expression. The mRNA (C) and protein (D) expression levels of PPARGC1A were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (E) and protein (F) expression levels of PPARGC1A were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 functions as a ceRNA for miR-1197-3p to regulate PPARGC1A expression. (A) The efficiency of lncRNA LOC102176306 overexpression vector was verified by qRT-PCR. (B) The knockdown efficiency of lncRNA LOC102176306 siRNA was verified by qRT-PCR. siRNA-2-LOC102176306 (LOC102176306-siRNA) showed the highest efficiency on the down-regulation of lncRNA LOC102176306 expression. The mRNA (C) and protein (D) expression levels of PPARGC1A were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (E) and protein (F) expression levels of PPARGC1A were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate testosterone synthesis in goat LCs
As shown in Fig. 5, the concentration of T in the spent culture media, and the mRNA and protein expression levels of T biosynthesis-related genes STAR, CYP11A1, 3BHSD and CYP17A1 in goat LCs were significantly decreased with lncRNA LOC102176306 suppression (P < 0.05), while miR-1197-3p knockdown alleviated LOC102176306-siRNA induced low secretion of T and decreased expressions of STAR, CYP11A1, 3BHSD and CYP17A1 in goat LCs (P < 0.05, Fig. 5A, B, C). Likewise, the significant increase of T production and T biosynthesis-related gene expressions in goat LCs triggered by lncRNA LOC102176306 overexpression could be significantly alleviated by miR-1197-3p mimics treatment (P < 0.05, Fig. 5D, E and 5F).
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate testosterone synthesis of goat LCs. (A) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (B) and protein (C) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. The mRNA (E) and protein (F) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate testosterone synthesis of goat LCs. (A) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (B) and protein (C) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. The mRNA (E) and protein (F) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate testosterone synthesis of goat LCs. (A) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (B) and protein (C) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) The concentration of testosterone in the spent culture medium of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. The mRNA (E) and protein (F) expression levels of testosterone biosynthesis-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 functions as a sponge for miR-1197-3p to regulate cell proliferation in goat LCs
Knockdown of lncRNA LOC102176306 significantly decreased the numbers of EdU-labeled LCs (Fig. 6A) and the expression of PCNA (P < 0.05, Fig. 6B and C), while the impaired cell proliferation in LOC102176306 suppressed LCs was restored by miR-1197-3p inhibitor treatment (P < 0.05, Fig. 6A, B and C). Conversely, the overexpression of lncRNA LOC102176306 promoted cell proliferation and the expression of PCNA in goat LCs, while the high proliferation capacity in lncRNA LOC102176306 overexpressed LCs could be abated by miR-1197-3p mimics treatment (P < 0.05, Fig. 6D, E and F).
LncRNA LOC102176306 functions as a sponge for miR-1197-3p to regulate the proliferation of goat LCs. (A) Representative images of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (B) and protein (C) expression levels of PCNA were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) Representative images of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (E) and protein (F) expression levels of PCNA were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 functions as a sponge for miR-1197-3p to regulate the proliferation of goat LCs. (A) Representative images of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (B) and protein (C) expression levels of PCNA were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) Representative images of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (E) and protein (F) expression levels of PCNA were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 functions as a sponge for miR-1197-3p to regulate the proliferation of goat LCs. (A) Representative images of lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (B) and protein (C) expression levels of PCNA were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. GAPDH served as an internal control. (D) Representative images of lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. Nuclei were blue stained, and EdU positive cells were red stained. Scale bar = 50 μM. The mRNA (E) and protein (F) expression levels of PCNA were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate antioxidant activity in goat LCs
SOD, CAT, GPx and GSH activities and GSH/GSSG ratio were significantly down-regulated in lncRNA LOC102176306 suppressed LCs, while these reductions were restored by miR-1197-3p inhibitor treatment (P < 0.05, Table 6). Meanwhile, the expression levels of SOD2, CAT and GPX1 in goat LCs were significantly decreased with lncRNA LOC102176306 suppression, while these reductions of antioxidant-related genes were restored by miR-1197-3p inhibitor treatment (P < 0.05, Fig. 7A and B). Conversely, lncRNA LOC102176306 overexpression significantly increased the enzyme activities of SOD, CAT, GPx, GSH and the ratio of GSH/GSSG in goat LCs, as well as the expressions of antioxidant-related genes (P < 0.05, Table 6, Fig. 7C and D). Meanwhile, the high levels of antioxidant-related gene expressions and enzyme activities induced by lncRNA LOC102176306 overexpression were significantly decreased with miR-1197-3p mimics treatment in goat LCs (P < 0.05, Table 6, Fig. 7C and D). Additionally, there was no significant difference of GSSG activity in goat LCs with different treatments (Table 6).
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the expression of an antioxidant-related genes in goat LCs The mRNA (A) and protein (B) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (C) and protein (D) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the expression of an antioxidant-related genes in goat LCs The mRNA (A) and protein (B) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (C) and protein (D) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the expression of an antioxidant-related genes in goat LCs The mRNA (A) and protein (B) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 suppressed goat LCs with or without miR-1197-3p inhibitor treatment. The mRNA (C) and protein (D) expression levels of antioxidant-related genes were examined in lncRNA LOC102176306 overexpressed goat LCs with or without miR-1197-3p mimics treatment. GAPDH served as an internal control. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Effects of lncRNA LOC102176306 on the antioxidant activity in goat LCs. Data are presented as mean ± s.e.m.
| Parameters | lncRNA LOC102176306 knockdown experiments | lncRNA LOC102176306 overexpression experiments | ||||
|---|---|---|---|---|---|---|
| Scramble siRNA | LOC102176306-siRNA | LOC102176306-siRNA+ miR-1197-3p inhibitor | pEX-3 control | pEX-3-LOC102176306 | pEX-3-LOC102176306+ miR-1197-3p mimics | |
| SOD (U/mg pro) | 18.46 ± 2.51 | 9.85 ± 1.32* | 14.93 ± 2.37 | 17.79 ± 2.65a | 28.03 ± 3.17b | 20.16 ± 2.78a |
| CAT (U/mg pro) | 12.13 ± 1.84 | 7.19 ± 1.23* | 11.68 ± 2.01 | 13.35 ± 2.17a | 20.36 ± 1.78b | 12.93 ± 2.65a |
| GPx (mU/mg pro) | 62.69 ± 3.91 | 35.17 ± 0.89* | 67.12 ± 4.25 | 59.43 ± 3.73a | 84.26 ± 5.18b | 64.26 ± 4.25a |
| GSH (nmol/mg pro) | 15.74 ± 1.67 | 8.42 ± 1.76* | 13.75 ± 1.98 | 14.92 ± 1.84a | 19.57 ± 2.49b | 15.08 ± 1.31a |
| GSSG (nmol/mg pro) | 1.28 ± 0.49 | 1.96 ± 0.54 | 1.17 ± 0.61 | 1.16 ± 0.29 | 1.05 ± 0.63 | 1.24 ± 0.57 |
| GSH/GSSG | 11.83 ± 1.96 | 4.38 ± 2.65* | 11.27 ± 2.46 | 12.14 ± 3.02a | 18.72 ± 2.51b | 11.75 ± 2.49a |
In the same parameter, *Values represent significant difference among Scramble siRNA, LOC102176306-siRNA (lncRNA LOC102176306 silencing), and LOC102176306-siRNA and miR-1197-3p inhibitor treatment groups (P < 0.05); a, bValues represent significant difference among pEX-3 control, pEX-3-LOC102176306 (lncRNA LOC102176306 overexpression), and pEX-3-LOC102176306 and miR-1197-3p mimics treatment groups (P < 0.05).
CAT, catalase; GPx, glutathione peroxidase; GSH, reduced glutathione; GSSG, oxidized glutathione; pro, protein; SOD, superoxide dismutase.
LncRNA LOC102176306 functions as a sponge for miR-1197-3p to regulate mitochondrial function in goat LCs
As shown in Table 7, the ATP level and enzyme activities of ETC complex I and complex III were significantly decreased in lncRNA LOC102176306 suppressed LCs, while miR-1197-3p inhibitor treatment restored these reductions (P < 0.05). Meanwhile, the significant increase in ATP level and enzyme activities of complex I and complex III in goat LCs triggered by lncRNA LOC102176306 overexpression were alleviated by miR-1197-3p mimics treatment (P < 0.05, Table 7). In addition, there was no significant difference in complex II and complex IV activities in goat LCs with different treatments (Table 7). Moreover, MMP assays showed the loss of MMP in lncRNA LOC102176306 suppressed LCs could be alleviated by miR-1197-3p inhibitor treatment (P < 0.05, Fig. 8A). Additionally, the increase of MMP in goat LCs induced by lncRNA LOC102176306 overexpression was significantly reverted by miR-1197-3p mimics treatment (P < 0.05; Fig. 8B).
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the mitochondrial membrane potential of goat LCs (A) The mitochondrial membrane potential of lncRNA LOC102176306 suppressed LCs with or without miR-1197-3p inhibitor treatment. (B) The mitochondrial membrane potential of lncRNA LOC102176306 overexpressed LCs with or without miR-1197-3p mimics treatment. Scale bar = 50 μM. The Δ𝜓m of goat LCs in each group was calculated as the ratio of red to green fluorescence, and normalized to control group. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the mitochondrial membrane potential of goat LCs (A) The mitochondrial membrane potential of lncRNA LOC102176306 suppressed LCs with or without miR-1197-3p inhibitor treatment. (B) The mitochondrial membrane potential of lncRNA LOC102176306 overexpressed LCs with or without miR-1197-3p mimics treatment. Scale bar = 50 μM. The Δ𝜓m of goat LCs in each group was calculated as the ratio of red to green fluorescence, and normalized to control group. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
LncRNA LOC102176306 acts as a sponge for miR-1197-3p to regulate the mitochondrial membrane potential of goat LCs (A) The mitochondrial membrane potential of lncRNA LOC102176306 suppressed LCs with or without miR-1197-3p inhibitor treatment. (B) The mitochondrial membrane potential of lncRNA LOC102176306 overexpressed LCs with or without miR-1197-3p mimics treatment. Scale bar = 50 μM. The Δ𝜓m of goat LCs in each group was calculated as the ratio of red to green fluorescence, and normalized to control group. Data are expressed as mean ± s.e.m. Different letters (a and b) indicate statistically significant differences (P < 0.05).
Citation: Reproduction 161, 5; 10.1530/REP-20-0568
Effects of lncRNA LOC102176306 on ATP level and mitochondrial function in goat LCs. Data are presented as mean ± s.e.m..
| lncRNA LOC102176306 knockdown experiments | lncRNA LOC102176306 overexpression experiments | |||||
|---|---|---|---|---|---|---|
| Parameters | Scramble siRNA | LOC102176306-siRNA | LOC102176306-siRNA+ miR-1197-3p inhibitor |
pEX-3 control | pEX-3-LOC102176306 | pEX-3-LOC102176306+ miR-1197-3p mimics |
| ATP (nmol/mg pro) | 31.65 ± 2.73 | 22.97 ± 2.48* | 28.19 ± 1.93 | 27.81 ± 2.65a | 41.06 ± 3.86b | 31.19 ± 2.37a |
| Complex I (nmol/min/mg protein) | 124.53 ± 18.27 | 86.34 ± 11.61* | 119.78 ± 13.44 | 116.29 ± 15.32a | 218.64 ± 17.51b | 134.19 ± 13.83a |
| Complex II (nmol/min/mg protein) | 608.64 ± 29.71 | 563.25 ± 31.68 | 588.39 ± 24.37 | 615.92 ± 27.75 | 634.19 ± 34.46 | 597.28 ± 26.69 |
| Complex III (nmol/min/mg protein) | 392.87 ± 24.65 | 237.14 ± 28.93* | 378.42 ± 19.76 | 405.61 ± 32.84a | 479.54 ± 25.61b | 413.49 ± 26.25a |
| Complex IV (nmol/min/mg protein) | 145.32 ± 22.75 | 123.84 ± 19.83 | 137.58 ± 16.91 | 136.14 ± 25.36 | 152.34 ± 27.03 | 141.85 ± 18.29 |
In the same parameter, *Values represent significant difference among Scramble siRNA, LOC102176306-siRNA (lncRNA LOC102176306 silencing), and LOC102176306-siRNA and miR-1197-3p inhibitor treatment groups (P < 0.05); a, bValues represent significant difference among pEX-3 control, pEX-3-LOC102176306 (lncRNA LOC102176306 overexpression), and pEX-3-LOC102176306 and miR-1197-3p mimics treatment groups (P < 0.05).
Complex I, NAD hydride ubiquinone reductase; Complex II, succinate ubiquinone reductase; Complex III, ubiquinol cytochrome c reductase; Complex IV, cytochrome c oxidase; pro, protein.
Discussion
Accumulating reports have highlighted that lncRNAs and miRNAs played key roles in androgen production and testis development (Zhang et al. 2017, An et al. 2019, Gao et al. 2020). Although recent RNA sequencing studies have identified many lncRNAs participated in goat reproduction (Gao et al. 2017, Deng et al. 2018, Ling et al. 2019), the functions of most of these lncRNAs are still unclear, especially for male reproduction. In the current study, we observed that the expression of lncRNA LOC102176306 in goat testis tissue was significantly increased with the testicular development (3-month-old vs 9-month-old), and lncRNA LOC102176306 was abundant in both the cytoplasm and nucleus of goat LCs. In addition, gain- and loss-of-function experiments showed that lncRNA LOC102176306 was involved in regulating T synthesis, cell proliferation and antioxidant activity in goat LCs. These results indicate that lncRNA LOC102176306 could play an important role in the goat testicular development.
Understanding the potential molecular mechanism of key lncRNAs is of great significance for clarifying the biological functions. It has been demonstrated that lncRNAs regulate the gene expressions at both transcriptional and posttranscriptional levels through several mechanisms, including (i) transcription co-activators, since nuclear lncRNAs can recruit chromatin remodeling complexes to specific genomic loci, to activate enhancer/inhibitor RNAs or affect pre-mRNA splicing; (ii) post-transcriptional and translational regulation, since cytoplasmic lncRNAs can regulate mRNA translation, stability and decay, besides acting as ceRNAs (Merry et al. 2015, Kong et al. 2019). In the current study, lncRNA LOC102176306 had nine binding sites of miR-1197-3p seed sequence, and dual-luciferase reporter assay showed lncRNA LOC102176306 could directly bind to miR-1197-3p. Moreover, PPARGC1A was a functional target of miR-1197-3p in goat luteinized granulosa cells (Zhang et al. 2019) and LCs (An et al. 2019). The expression of PPARGC1A in goat testis tissue was increased with the testicular development (An et al. 2019). Combined with the data from co-transfection of LOC102176306-siRNA with miR-1197-3p inhibitor or pEX-3-LOC102176306 with miR-1197-3p mimics in the present study, we demonstrate that lncRNA LOC102176306 could participate in regulating the functions of goat LCs by acting as a ceRNA for miR-1197-3p via mediating PPARGC1A.
In LCs, steroidogenic enzymes orchestrate T biosynthesis from cholesterol. STAR participates in the initial and rate limiting step of T synthesize by mediating the transport of cholesterol from the outer to the inner mitochondrial membrane (Aghazadeh et al. 2015, Zirkin & Papadopoulos 2018). Cholesterol is converted to pregnenolone by CYP11A1, which is located in the matrix side of the inner mitochondrial membrane, and then pregnenolone is metabolized into T by the key enzymes, including 3BHSD, CYP17A1 and 17β-hydroxysteroid dehydrogenase (17BHSD) in the smooth endoplasmic reticulum (Beattie et al. 2015, Wang et al. 2017). Consequently, the expressions of steroidogenesis related proteins could reflect the efficiency of T production (Ye et al. 2011). Our previous research showed that miR-1197-3p regulated T synthesis in goat LCs, as well as the expressions of T biosynthesis-related genes by targeting PPARGC1A (An et al. 2019). In the present study, miR-1197-3p mimics alleviated lncRNA LOC102176306 overexpression induced T production and increased expressions of PPARGC1A, STAR, CYP11A1, 3BHSD and CYP17A1 in goat LCs. These results suggest that lncRNA LOC102176306 could act as a sponge for miR-1197-3p to regulate T synthesis in goat LCs by targeting PPARGC1A.
Previous researches showed that T could enhance LC proliferation via autocrine mechanisms (Ipsa et al. 2019), and the high proliferation of LCs in turn increased T secretion from testis (Hwang et al. 2007, Lv et al. 2019), in line with our results that the increased T secretion was accompanied with the high cell proliferation capacity of goat LCs. PPARGC1A could function as a powerful coactivator of many transcriptional factors related to steroidogenesis and cell proliferation in steroid hormone-producing cells (Hescot et al. 2013, Gak et al. 2015). In the current study, PPARGC1A modulated cell proliferation through regulating PCNA expression and mitochondrial biogenesis in goat LCs, in line with the previous study in pulmonary artery vascular smooth muscle cells (Rao et al. 2012). Previous research showed that lncRNA myocardial infarction-associated transcript (MIAT) promoted the proliferation of SK-N-MC cells by miR-29b/sirtuin1 (SIRT1)/PPARGC1A network (Hao et al. 2019), and lncRNA maternally expressed gene 3 (MEG3)-promoted hepatic gluconeogenesis by regulating miR-302a-3p/CREB-regulated transcriptional coactivator 2 (CRTC2)/PPARGC1A axis (Zhu et al. 2019). In the current study, miR-1197-3p inhibitor treatment restored LOC102176306-siRNA-induced low cell proliferation capability and decreased PCNA expression in goat LCs. These results suggest that lncRNA LOC102176306 could regulate the proliferation of goat LCs via miR-1197-3p/PPARGC1A axis.
The enzymatic (e.g. SOD, GPx and CAT) and nonenzymatic (eg. GSH) antioxidants form the interactive defense system to dominate redox homeostasis, which is essential for the maintenance of many cellular processes (Balaban et al. 2005, Ayer et al. 2014). The decreased gene expressions and low activities of antioxidant enzymes, along with the low GSH/GSSG ratio, have been reported to diminish T synthesis of LCs (Murugesan et al. 2007, 2008), consistent with our results. Mitochondria are a main source of cellular reactive oxygen species that are crucial contributors to oxidative stress (Balaban et al. 2005, Ayer et al. 2014). Complexes I and III of the mitochondrial respiratory chain are believed to be the major sites of reactive oxygen species generation. The damaged or reduced complex activities can overproduce the reactive oxygen species and exacerbate oxidative stress (Chan et al. 2009, Murphy 2009). In the current study, lncRNA LOC102176306 knockdown decreased the activities of complexes I and III, and antioxidant enzymes by repressing PPARGC1A expression in goat LCs, reinforced the previous notion that PPARGC1A ablation resulted in mitochondrial dysfunction and oxidative stress of steroid hormone-producing cells (Gak et al. 2015, Guo et al. 2019). In addition, the mitochondrial dysfunction of steroidogenic cells contributed to the impaired steroidogenesis (Cheng et al. 2005, Sreerangaraja Urs et al. 2020). Moreover, ATP was generated through oxidative phosphorylation, and ATP synthesis had a cooperative effect on steroidogenesis (Hales et al. 2005, Midzak et al. 2011). The perturbation of MMP would inhibit the production of ATP and decrease the cellular ATP level in rat LCs (Fa et al. 2015), in line with our study. Additionally, miRNAs and lncRNAs have gained attention as direct or indirect modulators of the mitochondrial proteome homeostasis. In the current study, lncRNA LOC102176306 acted as a sponge for miR-1197-3p to regulate PPARGC1A expression and affected mitochondrial state, which could regulate the steroid biosynthesis and redox homeostasis of goat LCs. These results suggest that lncRNA LOC102176306/miR-1197-3p/PPARGC1A axis could be a fundamental regulator of the mitochondrial function in goat LCs.
In summary, our study demonstrates that lncRNA LOC102176306 acted as a ceRNA for miR-1197-3p to regulate the expression of PPARGC1A via the lncRNA LOC102176306/miR-1197-3p/PPARGC1A axis, and played important roles in mediating steroidogenesis, cell proliferation and oxidative stress in goat LCs. These findings could provide a new theoretical basis for genetic and molecular studies on the steroidogenesis and testis development in goats. Nevertheless, further in-depth studies should be carried out to reveal the roles of ceRNA regulatory network in testicular development.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-20-0568.
Declaration of interest
All the authors of the manuscript declare that: we have no financial and personal relationships with other people or organizations that could inappropriately influence (bias) this work.
Funding
This study was supported by the earmarked fund for the National Nature Science Foundation of China (No.31802148), Key Project for Jiangsu Agricultural New Variety Innovation (No.PZCZ201740), National Key R&D Program of China (2018YFD0501900), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (No.280100745113).
Author contribution statement
SA and GZ: conceptualization, investigation, visualization, writing, original draft; ZL and MAS: validation, formal analysis, data curation; MD: conceptualization, investigation, visualization; XG: validation, formal analysis, review and editing; YL: visualization, resources; CS and ZL: resources, review and editing; FW and GZ: supervision, funding acquisition. All authors critically reviewed the text and figures, and approved the final manuscript.
Acknowledgements
The authors thank the High-Performance Computing Platform of Bioinformatics Center, Nanjing Agricultural University for their data analysis support. The authors also thank all the members of Feng Wang’s laboratory who contributed to sample collection.
References
Aghazadeh Y, Zirkin BR & Papadopoulos V 2015 Pharmacological regulation of the cholesterol transport machinery in steroidogenic cells of the testis. Vitamins & Hormones 98 189–227. (https://doi.org/10.1016/bs.vh.2014.12.006)
Ambros V 2004 The functions of animal microRNAs. Nature 431 350–355. (https://doi.org/10.1038/nature02871)
An SY, Zhang GM, Liu ZF, Zhou C, Yang PC & Wang F 2019 MiR-1197-3p regulates testosterone secretion in goat Leydig cells via targeting PPARGC1A. Gene 710 131–139. (https://doi.org/10.1016/j.gene.2019.05.057)
Andric SA & Kostic TS 2019 Regulation of Leydig cell steroidogenesis: intriguing network of signaling pathways and mitochondrial signalosome. Current Opinion in Endocrine & Metabolic Research 6 7–20. (https://doi.org/10.1016/j.coemr.2019.03.001)
Ayer A, Gourlay CW & Dawes IW 2014 Cellular redox homeostasis, reactive oxygen species and replicative ageing in Saccharomyces cerevisiae. FEMS Yeast Research 14 60–72. (https://doi.org/10.1111/1567-1364.12114)
Balaban RS, Nemoto S & Finkel T 2005 Mitochondria, oxidants, and aging. Cell 120 483–495. (https://doi.org/10.1016/j.cell.2005.02.001)
Beattie MC, Adekola L, Papadopoulos V, Chen H & Zirkin BR 2015 Leydig cell aging and hypogonadism. Experimental Gerontology 68 87–91. (https://doi.org/10.1016/j.exger.2015.02.014)
Chan SH, Wu KL, Chang AY, Tai MH & Chan JY 2009 Oxidative impairment of mitochondrial electron transport chain complexes in rostral ventrolateral medulla contributes to neurogenic hypertension. Hypertension 53 217–227. (https://doi.org/10.1161/HYPERTENSIONAHA.108.116905)
Chen H, Guo X, Xiao X, Ye L, Huang Y, Lu C & Su Z 2019 Identification and functional characterization of microRNAs in rat Leydig cells during development from the progenitor to the adult stage. Molecular & Cellular Endocrinology 493 110453. (https://doi.org/10.1016/j.mce.2019.110453)
Cheng J, Fu J & Zhou Z 2005 The mechanism of manganese-induced inhibition of steroidogenesis in rat primary Leydig cells. Toxicology 211 1–11. (https://doi.org/10.1016/j.tox.2005.01.020)
Cui Y, Chen R, Ma L, Yang W, Chen M, Zhang Y, Yu S, Dong W, Zeng W & Lan X et al. 2020 miR-205 expression elevated With EDS Treatment and Induced Leydig Cell Apoptosis by Targeting RAP2B via the PI3K/AKT Signaling Pathway. Frontiers in Cell & Developmental Biology 8 448. (https://doi.org/10.3389/fcell.2020.00448)
Deng M, Liu Z, Ren C, Zhang G, Pang J, Zhang Y, Wang F & Wan Y 2018 Long noncoding RNAs exchange during zygotic genome activation in goat. Biology of Reproduction 99 707–717. (https://doi.org/10.1093/biolre/ioy118)
Fa S, Pogrmic-Majkic K, Samardzija D, Hrubik J, Glisic B, Kovacevic R & Andric N 2015 HBCDD-induced sustained reduction in mitochondrial membrane potential, ATP and steroidogenesis in peripubertal rat Leydig cells. Toxicology & Applied Pharmacology 282 20–29. (https://doi.org/10.1016/j.taap.2014.11.001)
Gak IA, Radovic SM, Dukic AR, Janjic MM, Stojkov-Mimic NJ, Kostic TS & Andric SA 2015 Stress triggers mitochondrial biogenesis to preserve steroidogenesis in Leydig cells. Biochimica & Biophysica Acta 1853 2217–2227. (https://doi.org/10.1016/j.bbamcr.2015.05.030)
Gao X, Ye J, Yang C, Zhang K, Li X, Luo L, Ding J, Li Y, Cao H & Ling Y et al. 2017 Screening and evaluating of long noncoding RNAs in the puberty of goats. BMC Genomics 18 164. (https://doi.org/10.1186/s12864-017-3578-9)
Gao X, Zhu M, An S, Liang Y, Yang H, Pang J, Liu Z, Zhang G & Wang F 2020 Long non-coding RNA LOC105611671 modulates fibroblast growth factor 9 (FGF9) expression by targeting oar-miR-26a to promote testosterone biosynthesis in Hu sheep. Reproduction, Fertility, & Development 32 373–382. (https://doi.org/10.1071/RD19116)
Guil S & Esteller M 2015 RNA-RNA interactions in gene regulation: the coding and noncoding players. Trends in Biochemical Sciences 40 248–256. (https://doi.org/10.1016/j.tibs.2015.03.001)
Guo YX, Zhang GM, Yao XL, Tong R, Cheng CY, Zhang TT, Wang ST, Yang H & Wang F 2019 Effects of nitric oxide on steroidogenesis and apoptosis in goat luteinized granulosa cells. Theriogenology 126 55–62. (https://doi.org/10.1016/j.theriogenology.2018.12.007)
Haider SG 2007 Leydig cell steroidogenesis: unmasking the functional importance of mitochondria. Endocrinology 148 2581–2582. (https://doi.org/10.1210/en.2007-0330)
Hales DB, Allen JA, Shankara T, Janus P, Buck S, Diemer T & Hales KH 2005 Mitochondrial function in Leydig cell steroidogenesis. Annals of the New York Academy of Sciences 1061 120–134. (https://doi.org/10.1196/annals.1336.014)
Hao S, Wang L, Zhao K, Zhu X & Ye F 2019 Rs1894720 polymorphism in MIAT increased susceptibility to age-related hearing loss by modulating the activation of miR-29b/SIRT1/PGC-1alpha signaling. Journal of Cellular Biochemistry 120 4975–4986. (https://doi.org/10.1002/jcb.27773)
Hescot S, Slama A, Lombes A, Paci A, Remy H, Leboulleux S, Chadarevian R, Trabado S, Amazit L & Young J et al. 2013 Mitotane alters mitochondrial respiratory chain activity by inducing cytochrome c oxidase defect in human adrenocortical cells. Endocrine-Related Cancer 20 371–381. (https://doi.org/10.1530/ERC-12-0368)
Hwang GS, Wang SW, Tseng WM, Yu CH & Wang PS 2007 Effect of hypoxia on the release of vascular endothelial growth factor and testosterone in mouse TM3 Leydig cells. American Journal of Physiology. Endocrinology & Metabolism 292 E1763–E1769. (https://doi.org/10.1152/ajpendo.00611.2006)
Ipsa E, Cruzat VF, Kagize JN, Yovich JL & Keane KN 2019 Growth hormone and insulin-like growth factor action in reproductive tissues. Frontiers in Endocrinology 10 777. (https://doi.org/10.3389/fendo.2019.00777)
Kong Y, Lu Z, Liu P, Liu Y, Wang F, Liang EY, Hou FF & Liang M 2019 Long noncoding RNA: genomics and relevance to physiology. Comprehensive Physiology 9 933–946. (https://doi.org/10.1002/cphy.c180032)
Li J, Tian H, Yang J & Gong Z 2016 Long noncoding RNAs regulate cell growth, proliferation, and apoptosis. DNA & Cell Biology 35 459–470. (https://doi.org/10.1089/dna.2015.3187)
Ling YH, Zheng Q, Li YS, Sui MH, Wu H, Zhang YH, Chu MX, Ma YH, Fang FG & Xu LN 2019 Identification of lncRNAs by RNA sequencing analysis During in vivo pre-implantation developmental transformation in the goat. Frontiers in Genetics 10 1040. (https://doi.org/10.3389/fgene.2019.01040)
Liu Z, Zhang G, Deng M, Yang H, Pang J, Cai Y, Wan Y & Wang F 2020 Inhibition of lysine-specific histone demethylase 1A results in meiotic aberration during oocyte maturation in vitro in goats. Theriogenology 143 168–178. (https://doi.org/10.1016/j.theriogenology.2019.12.011)
Long J, Badal SS, Ye Z, Wang Y, Ayanga BA, Galvan DL, Green NH, Chang BH, Overbeek PA & Danesh FR 2016 Long noncoding RNA Tug1 regulates mitochondrial bioenergetics in diabetic nephropathy. Journal of Clinical Investigation 126 4205–4218. (https://doi.org/10.1172/JCI87927)
Lv Y, Dong Y, Wang Y, Zhu Q, Li L, Li X, Lin Z, Fan L & Ge RS 2019 Benzyl butyl phthalate non-linearly affects rat Leydig cell development during puberty. Toxicology Letters 314 53–62. (https://doi.org/10.1016/j.toxlet.2019.07.016)
Medar MLJ, Marinkovic DZ, Kojic Z, Becin AP, Starovlah IM, Kravic-Stevovic T, Andric SA & Kostic TS 2020 Dependence of Leydig cell's mitochondrial physiology on luteinizing hormone signaling. Life 11 19. (https://doi.org/10.3390/life11010019)
Medja F, Allouche S, Frachon P, Jardel C, Malgat M, Mousson de Camaret B, Slama A, Lunardi J, Mazat JP & Lombes A 2009 Development and implementation of standardized respiratory chain spectrophotometric assays for clinical diagnosis. Mitochondrion 9 331–339. (https://doi.org/10.1016/j.mito.2009.05.001)
Merry CR, Forrest ME, Sabers JN, Beard L, Gao XH, Hatzoglou M, Jackson MW, Wang Z, Markowitz SD & Khalil AM 2015 DNMT1-associated long non-coding RNAs regulate global gene expression and DNA methylation in colon cancer. Human Molecular Genetics 24 6240–6253. (https://doi.org/10.1093/hmg/ddv343)
Midzak AS, Chen H, Aon MA, Papadopoulos V & Zirkin BR 2011 ATP synthesis, mitochondrial function, and steroid biosynthesis in rodent primary and tumor Leydig cells. Biology of Reproduction 84 976–985. (https://doi.org/10.1095/biolreprod.110.087460)
Miller WL 2013 Steroid hormone synthesis in mitochondria. Molecular & Cellular Endocrinology 379 62–73. (https://doi.org/10.1016/j.mce.2013.04.014)
Murphy MP 2009 How mitochondria produce reactive oxygen species. Biochemical Journal 417 1–13. (https://doi.org/10.1042/BJ20081386)
Murugesan P, Balaganesh M, Balasubramanian K & Arunakaran J 2007 Effects of polychlorinated biphenyl (aroclor 1254) on steroidogenesis and antioxidant system in cultured adult rat Leydig cells. Journal of Endocrinology 192 325–338. (https://doi.org/10.1677/joe.1.06874)
Murugesan P, Muthusamy T, Balasubramanian K & Arunakaran J 2008 Polychlorinated biphenyl (aroclor 1254) inhibits testosterone biosynthesis and antioxidant enzymes in cultured rat Leydig cells. Reproductive Toxicology 25 447–454. (https://doi.org/10.1016/j.reprotox.2008.04.003)
Qiannan E, Wang C, Gu X, Gan X, Zhang X, Wang S, Ma J, Zhang L, Zhang R & Su L 2020 Competitive endogenous RNA (ceRNA) regulation network of lncRNA-miRNA-mRNA during the process of the nickel-induced steroidogenesis disturbance in rat Leydig cells. Toxicology in Vitro 63 104721 .
Radovic SM, Starovlah IM, Capo I, Miljkovic D, Nef S, Kostic TS & Andric SA 2019 Insulin/IGF1 signaling regulates the mitochondrial biogenesis markers in steroidogenic cells of prepubertal testis, but not ovary. Biology of Reproduction 100 253–267. (https://doi.org/10.1093/biolre/ioy177)
Rao J, Li J, Liu Y, Lu P, Sun X, Sugumaran PK & Zhu D 2012 The key role of PGC-1alpha in mitochondrial biogenesis and the proliferation of pulmonary artery vascular smooth muscle cells at an early stage of hypoxic exposure. Molecular & Cellular Biochemistry 367 9–18. (https://doi.org/10.1007/s11010-012-1313-z)
Roy VK, Verma R & Krishna A 2017 Carnitine-mediated antioxidant enzyme activity and Bcl2 expression involves peroxisome proliferator-activated receptor-gamma coactivator-1alpha in mouse testis. Reproduction, Fertility, & Development 29 1057–1063. (https://doi.org/10.1071/RD15336)
Salmena L, Poliseno L, Tay Y, Kats L & Pandolfi PP 2011 A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146 353–358. (https://doi.org/10.1016/j.cell.2011.07.014)
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B & Ideker T 2003 Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Research 13 2498–2504. (https://doi.org/10.1101/gr.1239303)
Sreerangaraja Urs DB, Wu WH, Komrskova K, Postlerova P, Lin YF, Tzeng CR & Kao SH 2020 Mitochondrial function in modulating human granulosa cell steroidogenesis and female fertility. International Journal of Molecular Sciences 21 3592. (https://doi.org/10.3390/ijms21103592)
Su Z, Xiong H, Pang J, Lin H, Lai L, Zhang H, Zhang W & Zheng Y 2019 LncRNA AW112010 promotes mitochondrial biogenesis and hair cell survival: implications for age-related hearing loss. Oxidative Medicine & Cellular Longevity 2019 6150148. (https://doi.org/10.1155/2019/6150148)
Tian T, Lv X, Pan G, Lu Y, Chen W, He W, Lei X, Zhang H, Liu M & Sun S et al. 2019 Long noncoding RNA MPRL promotes mitochondrial fission and cisplatin chemosensitivity via disruption of pre-miRNA processing. Clinical Cancer Research 25 3673–3688. (https://doi.org/10.1158/1078-0432.CCR-18-2739)
Wang KC & Chang HY 2011 Molecular mechanisms of long noncoding RNAs. Molecular Cell 43 904–914. (https://doi.org/10.1016/j.molcel.2011.08.018)
Wang Y, Chen F, Ye L, Zirkin B & Chen H 2017 Steroidogenesis in Leydig cells: effects of aging and environmental factors. Reproduction 154 R111–R122. (https://doi.org/10.1530/REP-17-0064)
Wichman L, Somasundaram S, Breindel C, Valerio DM, McCarrey JR, Hodges CA & Khalil AM 2017 Dynamic expression of long noncoding RNAs reveals their potential roles in spermatogenesis and fertility. Biology of Reproduction 97 313–323. (https://doi.org/10.1093/biolre/iox084)
Wu H, Liu B, Chen Z, Li G & Zhang Z 2020 MSC-induced lncRNA HCP5 drove fatty acid oxidation through miR-3619-5p/AMPK/PGC1alpha/CEBPB axis to promote stemness and chemo-resistance of gastric cancer. Cell Death & Disease 11 233. (https://doi.org/10.1038/s41419-020-2426-z)
Ye L, Su ZJ & Ge RS 2011 Inhibitors of testosterone biosynthetic and metabolic activation enzymes. Molecules 16 9983–10001. (https://doi.org/10.3390/molecules16129983)
Zhang GM, An SY, El-Samahy MA, Zhang YL, Wan YJ, Wang ZY, Xiao SH, Meng FX, Wang F & Lei ZH 2019 Suppression of miR-1197-3p attenuates H2O2-induced apoptosis of goat luteinized granulosa cells via targeting PPARGC1A. Theriogenology 132 72–82. (https://doi.org/10.1016/j.theriogenology.2019.04.008) H2O2
Zhang Q, Ma XF, Dong MZ, Tan J, Zhang J, Zhuang LK, Liu SS & Xin YN 2020 MiR-30b-5p regulates the lipid metabolism by targeting PPARGC1A in Huh-7 cell line. Lipids in Health & Disease 19 76. (https://doi.org/10.1186/s12944-020-01261-3)
Zhang Y, Yang H, Han L, Li F, Zhang T, Pang J, Feng X, Ren C, Mao S & Wang F 2017 Long noncoding RNA expression profile changes associated with dietary energy in the sheep testis during sexual maturation. Scientific Reports 7 5180. (https://doi.org/10.1038/s41598-017-05443-5)
Zhu X, Li H, Wu Y, Zhou J, Yang G, Wang W, Kang D & Ye S 2019 CREB-upregulated lncRNA MEG3 promotes hepatic gluconeogenesis by regulating miR-302a-3p-CRTC2 axis. Journal of Cellular Biochemistry 120 4192–4202. (https://doi.org/10.1002/jcb.27706)
Zirkin BR & Papadopoulos V 2018 Leydig cells: formation, function, and regulation. Biology of Reproduction 99 101–111. (https://doi.org/10.1093/biolre/ioy059)
