Abstract
Emerging evidence has demonstrated that melatonin (MT) plays a crucial role in regulating mammalian reproductive functions. It has been reported that MT has a protective effect on polycystic ovary syndrome (PCOS). However, the protective mechanisms of MT remain poorly understood. This study aims to explore the effect of MT on ovarian function in PCOS and to elucidate the relevant molecular mechanisms in vivo and in vitro. We first analysed MT expression levels in the follicular fluid of PCOS patients. A significant reduction in MT expression levels was noted in PCOS patients. Intriguingly, reduced MT levels correlated with serum testosterone and inflammatory cytokine levels in follicular fluid. Moreover, we confirmed the protective function of MT through regulating autophagy in a DHEA-induced PCOS rat model. Autophagy was activated in the ovarian tissue of the PCOS rat model, whereas additional MT inhibited autophagy by increasing PI3K−-Akt pathway expression. In addition, serum-free testosterone, inflammatory and apoptosis indexes were reduced after MT supplementation. Furthermore, we also found that MT suppressed autophagy and apoptosis by activating the PI3K-Akt pathway in the DHEA-exposed human granulosa cell line KGN. Our study showed that MT ameliorated ovarian dysfunction by regulating autophagy in DHEA-induced PCOS via the PI3K-Akt pathway, revealing a potential therapeutic drug target for PCOS.
Introduction
Polycystic ovary syndrome (PCOS) is the most complex and common endocrine and metabolic disorder disease, affecting 4–21% of females of reproductive age globally (Brakta et al. 2017). PCOS is characterised by hyperandrogenism, ovulation disorder and morphological changes in polycystic ovaries, which are often accompanied by insulin resistance, obesity, and chronic inflammation (Caldwell et al. 2014), representing one of the main causes of female infertility. However, the aetiology of PCOS can be very complex and involve multiple factors. Genetics, diet, environment or even social psychology can all cause PCOS (Rothenberg et al. 2018). Current treatment options for PCOS mostly provide symptomatic relief without addressing the cause of this disease or overcoming it. Thus, many questions and possible factors involved in the occurrence and development of PCOS remain unknown, and we sought to explore this topic in this study.
Recent research on the application of melatonin (MT) to female reproductive system diseases (Reiter et al. 2014), especially PCOS, has attracted considerable attention. Many studies have shown that MT plays an important role in female reproduction. Sarayu et al. reported that MT could improve metabolic and reproductive disorders in PCOS rats (Pai & Majumdar 2014), including reducing body weight and BMI, decreasing total serum testosterone levels and insulin resistance, improving the oestrous cycle, and reducing serum total cholesterol and very low-density lipoprotein (VLDL). In in vitro culture of immature oocytes of PCOS mice, adding MT into the culture medium can effectively improve the nuclear maturation rate of oocytes, fertilisation rate and cleavage rate of embryos (Nikmard et al. 2017).
Moreover, treating PCOS patients with exogenous MT for 6 months can significantly reduce the levels of testosterone (T) and anti-Mullerian hormone (AMH) in peripheral blood and improve the level of follicle-stimulating hormone (FSH), which improves the irregular menstrual cycle in approximately 95% of PCOS patients (Tagliaferri et al. 2018). The latest clinical research report also showed that in PCOS patients who underwent 12 weeks of MT supplementation, significantly reduced hair symptoms, reduced total T levels in peripheral blood, downregulated gene expression of the inflammatory factors IL-1 and TNF-α, and reduced oxidative stress indicators were noted (Jamilian et al. 2019). These studies demonstrated that MT could improve symptoms of PCOS, whereas the protective mechanism of MT remains unclear. The effect of MT on the treatment of endocrine and metabolic abnormalities in PCOS patients remains limited. Therefore, it is necessary to further explore the mechanism of the occurrence and development of MT protection against PCOS.
MT (N-acetyl-5-methoxytryptamine) is a type of neuroamine hormone that is widely distributed in animals, plants, algae and other species. MT was originally thought to be synthesised and secreted from the pineal gland of mammals; later, it was demonstrated that MT could also be produced in other tissues, such as the testis, placenta, skin, gastrointestinal tract, lymphocytes, and especially ovaries (Itoh et al. 1997, 1999). The main function of MT is the regulation of various central and peripheral regions related to circadian rhythm and reproduction. It is also associated with various important physiological activities, including antioxidation, anti-inflammation, inhibition of apoptosis and tumours, regulation of autophagy and endocrine signalling and preservation of mitochondrial homeostasis. In the pathogenesis of PCOS, inflammation (Alanbay et al. 2012, González 2012), apoptosis (Li et al. 2020, Masjedi et al. 2020) and autophagy (Li et al. 2018, Lajtai et al. 2019) are all involved in the occurrence and development of pathological processes. This finding suggests that the protective mechanism of MT pretreatment on PCOS may occur through inflammation, autophagy or apoptosis.
Based on clinical samples from PCOS patients, we found MT expression levels in follicular fluid were significantly reduced compared with the normal population, and MT expression levels were correlated with that of serum sex hormones and inflammatory factors in follicular fluid, suggesting that decreased follicular fluid MT levels may be related to PCOS ovarian dysfunction and anovulation. To explore the protective mechanism of MT pretreatment, animal models of DHEA-induced PCOS and DHEA-exposed KGN cells will be established in this study. Through in vitro and in vivo experiments, we showed that MT pretreatment could ameliorate the symptoms and ovarian function by reducing inflammation and inhibiting autophagy and apoptosis. These inhibitory effects mainly act by activating the PI3K-Akt pathway, which may represent the protective mechanism of MT in PCOS ovarian function.
Materials and methods
Ethics authorisation
The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Anhui Medical University. The approved protocol numbers for animals and human subjects were LLSC20170062 and 20170046, respectively. The animal experiments and care procedures were performed under the guidelines for laboratory animal experiments at Anhui Medical University. Clinical samples were obtained from the First Affiliated Hospital of Anhui Medical University, and written informed consent was obtained from all subjects prior to enrolment in the study.
Study participants and sample collection
All the participants from Han Chinese were 22–35 years of age. To exclude the interference of obesity, high BMI and other factors on PCOS, the samples of the PCOS population selected in this study were all obtained from a PCOS population with standard BMI (18.5–24.9). Study subjects included infertile women with PCOS (n = 20) and non-PCOS women (n = 20) undergoing in vitro fertilisation (IVF) or intracytoplasmic sperm injection (ICSI) willing to donate their follicular fluid and ovarian granulosa cell samples from May 2017 to December 2017. The criteria of PCOS diagnosis complied with the Rotterdam Consensus Conference (Rotterdam ESHRE/ASRM 2004). Women who did not have normal fertility merely due to male infertility or fallopian tube disease but had a normal ovulation cycle were considered the non-PCOS control group. The clinical features of the PCOS group and non-PCOS control group are presented in Table 1.
Clinical features of PCOS group and control group.
| Clinical parameters | Control (n = 20) | PCOS (n = 20) |
|---|---|---|
| Age (years) | 29.48 ± 0.33 | 28.45 ± 0.50 |
| BMI (kg/m2) | 20.62 ± 0.24 | 21.03 ± 0.25 |
| LH (IU/L) | 5.23 ± 0.34 | 11.37 ± 1.05** |
| FSH (IU/L) | 7.76 ± 0.39 | 6.47 ± 0.28* |
| E2 (pmol/L) | 139.30 ± 10.06 | 126.10 ± 11.29 |
| P (nmol/L) | 3.62 ± 0.92 | 2.71 ± 0.43 |
| T (nmol/L) | 1.24 ± 0.08 | 1.84 ± 0.14** |
| PRL (ng/ml) | 17.11 ± 0.96 | 25.98 ± 8.37 |
| LH/FSH | 0.72 ± 0.05 | 1.89 ± 0.21** |
| Fasting glucose (mmol/L) | 5.21 ± 0.06 | 5.05 ± 0.07 |
| Fasting insulin (IU/mL) | 8.84 ± 0.49 | 10.02 ± 1.15 |
| HOMA-IR | 2.03 ± 0.11 | 2.28 ± 0.27 |
| TSH (mIU/L) | 2.79 ± 0.19 | 2.48 ± 0.19 |
| FT3 (nmol/L) | 4.29 ± 0.11 | 4.42 ± 0.11 |
| FT4 (nmol/L) | 15.49 ± 0.52 | 16.62 ± 0.30 |
*P < 0.05 vs control; **P < 0.01 vs Control.
Enzyme-linked immunosorbent assay (ELISA)
Follicular fluid samples of patients with PCOS (n =20) and non-PCOS women (n =20) were used to test MT and inflammatory cytokine expression levels with ELISA kits (Wuhan Cloud-Clone Biotechnology, Hubei, China; Si Zheng Bai Biotechnology, Beijing, China). The levels of serum sex hormones and inflammatory cytokines in the PCOS rat model were determined using commercially available kits (Wuhan Elabscience Biotechnology, Hubei, China). All procedures were conducted according to the manufacturer’s instructions.
Real-time PCR
Human ovarian granulosa cells were collected for real-time PCR (RT-PCR). Total RNA was extracted from granulosa cells using TRIzol reagent (Invitrogen) and then converted to cDNA using a RT kit (TaKaRa). cDNA was prepared for quantitative PCR amplification of IL-6, IL-18, IL-8 and IL-10 using a LightCycler 480 SYBR Green I Master kit (Roche) with a fluorescence ration PCR instrument (LightCycler®480II, Roche). Actin mRNA served as an internal reference. Data were calculated using the 2-−ΔΔCT formula. All experiments were repeated at least three times independently. The specific primer sequences were as follows: IL-6, ACTCACCTCTTCAGAACGAATTG (F), CCATCTTTGGA AGGTTCAGGTTG (R); IL-18, TCTTCATTGACCAAGGAAATCGG (F), CAGCCAGATGCAATCAATGCC (R); IL-8, TTTTGCCAAGGAGTGCTAAAGA (F), AACCCTCTGCACCCAGTTTTC (R); IL-10, GACTTTAAGGGTTACCTGGGTTG (F), TCACATGCGCCTTGATGTCTG (R).
Establishing PCOS rat model
Sixty female Sprague–Dawley rats (25 days old) were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. They were housed in a standard specific pathogen-free (SPF) animal laboratory. All rats were subjected to 12 h light:12 h darkness cycles (room temperature 20–24°C, humidity 60–65%). After 3 days of adjustable feeding, these rats were randomly and equally divided into four groups: the control group, MT group, DHEA group and DHEA+MT group (n = 15 for each group). The PCOS rat model was administered a daily s.c. injection with DHEA (6 mg/100 g body weight, Solarbio, Beijing, China) dissolved in corn oil (Sigma) at 08:30 h for 20 consecutive days and received intragastric administration with normal saline (NS) (1 mL/100 g body weight) at 07:30 h before DHEA injection. In the DHEA+MT group, daily intragastric administration was replaced with MT (Sigma) (5 mg/100 g body weight). The MT group received daily s.c. injection of pure corn oil (0.1 mL/100 g body weight) after MT daily intragastric administration. Then, the control group was intragastrically administered NS at 07:30 h and subcutaneously injected with corn oil at 08:30 h for 20 consecutive days. Body weight and food intake were recorded daily. On approximately the 11th day after the first treatment to establish the PCOS rat model, vaginal cytology was performed for the following 10 consecutive days to observe the oestrous cycle. Blood samples from the abdominal aorta were collected under anaesthesia, and plasma was applied for analysis of sex hormone levels using ELISA kits. Ovary tissue samples were placed in 4% paraformaldehyde for further use, such as haematoxylin–eosin staining and immunohistochemistry.
Haematoxylin–eosin staining (HE staining)
The sections of rat ovaries were dewaxed in water and placed into haematoxylin dye for 5 min and eosin dye for 1 min in an orderly manner. Then, the sections underwent dehydration, clearing and mounting. Images were captured and analysed by fluorescence microscopy (Axio scope, Zeiss).
Immunohistochemical staining
The sections of rat ovaries were dewaxed in water, rinsed in PBS and then treated with 1.5% hydrogen peroxide for 1 h at room temperature. Then, the sections were microwaved in 0.05 M citrate-buffered saline (pH 6.0) for four times for 6 min for antigen retrieval. Subsequently, the sections were blocked with 5% goat serum for 1 h at room temperature. Next, the ovarian sections were incubated with primary antibody overnight at 4°C (anti-NF-κB, 1:4000, rabbit polyclonal; Abcam). Then, the sections were incubated with biotinylated goat anti-rabbit IgG (1:200) for 1 h, incubated with avidin-biotin peroxidase complex (1:200) for another 1 h at room temperature, dehydrated and mounted.
Western blotting
The protocols used for the protein extraction of the rat ovary tissues and KGN cells were described in a previous study (Li et al. 2019b). The protein samples were added to 6% or 12% SDS-PAGE gels and electrophoretically transferred onto nitrocellulose membranes. Subsequently, these membranes containing proteins were incubated with primary antibodies overnight. The primary antibodies were listed as follows: Beclin 1 (1:1000, rabbit monoclonal; Cell Signalling Technology), p62 (1:1000, rabbit monoclonal; Sigma), LC3 (1:1000, rabbit monoclonal; Sigma), NF-κB (1:5000, rabbit monoclonal; Abcam), p-IκB (1:1000, rabbit monoclonal; Abcam), Bcl2 (1:1000, mouse monoclonal; Abcam), BAX (1:1000, rabbit monoclonal; Abcam), Caspase3 (1:1000, rabbit monoclonal; Abcam), Akt (1:1000, rabbit monoclonal; Affinity, USA), p-Akt (1:1000, rabbit monoclonal; Affinity), PI3K (1:1000, rabbit monoclonal; Affinity), mTOR (1:1000, rabbit monoclonal; Abcam), p-mTOR (1:1000, rabbit monoclonal; Abcam), GAPDH (1:1000, mouse monoclonal; Zhongshanjinqiao, China) and Tubulin (1:1000, mouse monoclonal; Zhongshanjinqiao).
Cell culture and DHEA-exposed KGN Cells
KGN cells were kindly provided by Shanghai Jiaotong University. Cells were maintained in DMEM/F-12 (Gibco) supplemented with 10% foetal bovine serum (Gibco), 0.1 mg/L streptomycin and 100 units/mL penicillin G (Biyuntian, China). Cells were plated into six-well plates at a density of 2.0 × 105 cells per well, followed by stimulation with DHEA (100 μM), pretreated with MT (200 μM) with or without BEZ235 (250 nM) (PI3K-Akt pathway inhibitor).
Cell apoptosis analysis
Cell apoptosis was determined using an annexin v-FITC/PI apoptosis detection kit (Beibo Biotechnology, Shanghai, China) and performed according to the manufacturer’s instructions with a flow cytometer (CytoFlex, Beckman, USA).
Statistical analysis
The results were presented as the mean ± S.E.M. for continuous variables. Statistical data were determined by using the t test for two groups and ANOVA with Dunnett’s multiple comparisons test for more than three groups using SPSS 17.0 software (SPSS, Inc.). The correlation analysis was conducted by Pearson’s correlation coefficient. A P-value < 0.05 was considered statistically significant.
Results
Decreased MT expression correlated with serum sex hormones in the human PCOS group
To investigate the MT alteration of PCOS patients, we assessed MT expression levels in follicular fluid using ELISA. A significant decrease was noted in the PCOS group compared with the control group (Fig. 1A). Serum T, LH and FSH expression levels and the LH/FSH ratio were significantly different between the PCOS group and the control group (see details in Table 1). Moreover, the correlation between MT and serum sex hormones was further analysed. The results revealed that MT was not only negatively correlated with serum T and LH (Fig. 1B and C) as well as the LH/FSH ratio (Fig. 1E) but also positively correlated with serum FSH (Fig. 1D). This finding implied that decreased MT expression levels in follicular fluid might be associated with ovarian endocrine dysfunction in PCOS patients.
Reduced MT expression level correlated with serum sex hormones in the human PCOS group. (A) ELISA for MT levels in follicular fluid in the clinical control and PCOS groups. (B) Correlations between serum MT and T levels in the clinical control and PCOS groups (R = 0.34*). (C) Correlations between serum MT and LH levels in the clinical control and PCOS groups (R = 0.49**). (D) Correlations between serum MT and FSH levels in the clinical control and PCOS groups (R = 0.44**). (E) Correlations between MT level and LH/FSH value of serum in clinical control and PCOS group (R = 0.49**). The correlation was assessed using Pearson's correlation test. Data are presented as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Reduced MT expression level correlated with serum sex hormones in the human PCOS group. (A) ELISA for MT levels in follicular fluid in the clinical control and PCOS groups. (B) Correlations between serum MT and T levels in the clinical control and PCOS groups (R = 0.34*). (C) Correlations between serum MT and LH levels in the clinical control and PCOS groups (R = 0.49**). (D) Correlations between serum MT and FSH levels in the clinical control and PCOS groups (R = 0.44**). (E) Correlations between MT level and LH/FSH value of serum in clinical control and PCOS group (R = 0.49**). The correlation was assessed using Pearson's correlation test. Data are presented as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Reduced MT expression level correlated with serum sex hormones in the human PCOS group. (A) ELISA for MT levels in follicular fluid in the clinical control and PCOS groups. (B) Correlations between serum MT and T levels in the clinical control and PCOS groups (R = 0.34*). (C) Correlations between serum MT and LH levels in the clinical control and PCOS groups (R = 0.49**). (D) Correlations between serum MT and FSH levels in the clinical control and PCOS groups (R = 0.44**). (E) Correlations between MT level and LH/FSH value of serum in clinical control and PCOS group (R = 0.49**). The correlation was assessed using Pearson's correlation test. Data are presented as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Decreased expression of MT correlated with inflammatory cytokines in the human PCOS group
To explore the expression levels of inflammatory cytokines in the PCOS group, IL-6, IL-18, IL-8 and IL-10 levels in follicular fluid were first measured by ELISA. Compared with the control group, IL-6, IL-18 and IL-8 levels were markedly increased in the PCOS group, whereas IL-10 levels were decreased (Fig. 2A). To further verify the changes in ovarian local inflammation in PCOS patients, human ovarian granulosa cells were collected for RT-PCR to determine the inflammatory cytokines described above. The results were consistent with those in the follicular fluid. IL-18 and IL-8 levels were increased, and IL-10 levels were decreased in the PCOS group compared with the control group (Fig. 2B). Then, we assessed the correlation between the expression levels of MT and inflammatory cytokines in follicular fluid. Not surprisingly, in the PCOS group, decreased MT levels were correlated with increased IL-18 and IL-8 expression and decreased IL-10 expression (Fig. 2C, D and E). Thus, these results indicated that decreased MT expression levels in follicular fluid might be involved in ovarian local inflammation in PCOS patients.
Reduced MT expression level correlated with inflammatory cytokines in the human PCOS group. (A) ELISA for IL-6, IL-18, IL-8 and IL-10 levels in follicular fluid in the clinical control and PCOS groups. (B) Real-time PCR analysis of IL-6, IL-18, IL-8 and IL-10 expression in human ovarian granulosa cells of the clinical control and PCOS groups. (C) Correlations between MT and IL-18 levels in follicular fluid in the clinical control and PCOS groups (R = 0.33*). (D) Correlations between MT and IL-8 levels in follicular fluid in the clinical control and PCOS groups (R = 0.36*). (E) Correlations between MT and IL-10 levels in follicular fluid in the clinical control and PCOS groups (R = 0.35*). Data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Reduced MT expression level correlated with inflammatory cytokines in the human PCOS group. (A) ELISA for IL-6, IL-18, IL-8 and IL-10 levels in follicular fluid in the clinical control and PCOS groups. (B) Real-time PCR analysis of IL-6, IL-18, IL-8 and IL-10 expression in human ovarian granulosa cells of the clinical control and PCOS groups. (C) Correlations between MT and IL-18 levels in follicular fluid in the clinical control and PCOS groups (R = 0.33*). (D) Correlations between MT and IL-8 levels in follicular fluid in the clinical control and PCOS groups (R = 0.36*). (E) Correlations between MT and IL-10 levels in follicular fluid in the clinical control and PCOS groups (R = 0.35*). Data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Reduced MT expression level correlated with inflammatory cytokines in the human PCOS group. (A) ELISA for IL-6, IL-18, IL-8 and IL-10 levels in follicular fluid in the clinical control and PCOS groups. (B) Real-time PCR analysis of IL-6, IL-18, IL-8 and IL-10 expression in human ovarian granulosa cells of the clinical control and PCOS groups. (C) Correlations between MT and IL-18 levels in follicular fluid in the clinical control and PCOS groups (R = 0.33*). (D) Correlations between MT and IL-8 levels in follicular fluid in the clinical control and PCOS groups (R = 0.36*). (E) Correlations between MT and IL-10 levels in follicular fluid in the clinical control and PCOS groups (R = 0.35*). Data are expressed as the mean ± s.e.m. *P < 0.05; **P < 0.01.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Protective effect of MT on ovarian morphology and function in DHEA-induced PCOS rats
To better identify the protective effect of MT in vivo, we used DHEA to establish a PCOS rat model. The PCOS rat model exhibited the major symptoms of human PCOS patients, including high androgen levels, ovulation disorder and morphological changes in polycystic ovaries. The model rats were randomly and equally divided into four groups: the control group, MT group, DHEA group and DHEA+MT group (see details in the Materials and methods). Serum F-TESTO, LH and LH/FSH levels were all significantly increased in the DHEA group, whereas these values were all downregulated in the DHEA+MT group (Fig. 3A, B, C and D). However, there was no statistical significance of the average body weight in the four groups, although there was a downward trend in the DHEA+MT group compared to the DHEA group (n = 15 for each group) (Fig. 3E). Consistently, irregular oestrus cyclicity was obvious in the DHEA group, but it was markedly alleviated in the DHEA+MT group (Fig. 3F, G and H). Remarkably, the average ovary volume and weights in the DHEA group were significantly increased. Moreover, the ovarian texture became tough, and several large cystic processes under the capsule could be clearly observed. These processes protruded to the surface, resulting in extremely irregular morphology of ovaries in the DHEA group. Upon pretreatment with MT, the symptoms in the DHEA+MT group were ameliorated (Fig. 3I and J). Additionally, in HE sections, the typical polycystic ovary features were greatly reduced in the DHEA+MT group (Fig. 3K). In summary, MT ameliorated the morphology, weights and function of ovaries in DHEA-induced PCOS rats.
Protective effect of MT on ovarian morphology and function in DHEA-induced PCOS rats. PCOS rats were created by injecting DHEA along with other experimental groups, such as the control, MT and DHEA+MT groups. (A) ELISA for serum F-TESTO levels four groups. (B) ELISA for serum LH levels in four groups. (C) ELISA for serum FSH levels in four groups. (D) Serum LH/FSH values in four groups. (E) Body weight monitoring during the injection period in the experimental groups. (F) Oestrous cycles in four groups. (G) The frequency of oestrous cycle in four groups. (H) Unstained vaginal cytology as assessed by phase contrast microscopy in the four groups. (I) Gross observation of ovarian morphology in the four groups. (J) Weight analysis of ovaries in four groups. (K) Histological changes of ovaries in the four groups with HE staining were observed by microscopy. Scale bar: 100 μm. Data are presented as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Protective effect of MT on ovarian morphology and function in DHEA-induced PCOS rats. PCOS rats were created by injecting DHEA along with other experimental groups, such as the control, MT and DHEA+MT groups. (A) ELISA for serum F-TESTO levels four groups. (B) ELISA for serum LH levels in four groups. (C) ELISA for serum FSH levels in four groups. (D) Serum LH/FSH values in four groups. (E) Body weight monitoring during the injection period in the experimental groups. (F) Oestrous cycles in four groups. (G) The frequency of oestrous cycle in four groups. (H) Unstained vaginal cytology as assessed by phase contrast microscopy in the four groups. (I) Gross observation of ovarian morphology in the four groups. (J) Weight analysis of ovaries in four groups. (K) Histological changes of ovaries in the four groups with HE staining were observed by microscopy. Scale bar: 100 μm. Data are presented as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Protective effect of MT on ovarian morphology and function in DHEA-induced PCOS rats. PCOS rats were created by injecting DHEA along with other experimental groups, such as the control, MT and DHEA+MT groups. (A) ELISA for serum F-TESTO levels four groups. (B) ELISA for serum LH levels in four groups. (C) ELISA for serum FSH levels in four groups. (D) Serum LH/FSH values in four groups. (E) Body weight monitoring during the injection period in the experimental groups. (F) Oestrous cycles in four groups. (G) The frequency of oestrous cycle in four groups. (H) Unstained vaginal cytology as assessed by phase contrast microscopy in the four groups. (I) Gross observation of ovarian morphology in the four groups. (J) Weight analysis of ovaries in four groups. (K) Histological changes of ovaries in the four groups with HE staining were observed by microscopy. Scale bar: 100 μm. Data are presented as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT alleviated systemic and local inflammation in DHEA-induced PCOS rats
Given that inflammation appeared in PCOS patients, we assessed the effect of MT on inflammation in PCOS rats induced by DHEA. As measured by ELISA, serum IL-6 and MIP-2 levels were both dramatically upregulated in the DHEA group but were not different in the DHEA+MT group compared to the nontreatment control group (Fig. 4A and B). Immunohistochemistry and Western blotting were performed to detect the expression of members of the NF-κB signalling pathway in ovaries. High NF-κB and p-IκB expression levels were observed in the DHEA-induced PCOS rat group, whereas cotreatment with MT reduced the expression of those factors (Fig. 4C and D). Therefore, MT alleviated inflammation in the DHEA-induced PCOS rat model.
MT alleviated systemic and local inflammation in DHEA-induced PCOS rats. (A) ELISA for serum IL-6 levels in four groups. (B) ELISA for MIP-2 level of serum in four groups. (C) Immunohistochemistry analysis of the NF-κB signalling pathway in rat ovaries in the four groups. Scale bar: 20 μm. (D) Western blot analysis of NF-κB and p-IκB expression in rat ovaries in the four groups. Data are expressed as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT alleviated systemic and local inflammation in DHEA-induced PCOS rats. (A) ELISA for serum IL-6 levels in four groups. (B) ELISA for MIP-2 level of serum in four groups. (C) Immunohistochemistry analysis of the NF-κB signalling pathway in rat ovaries in the four groups. Scale bar: 20 μm. (D) Western blot analysis of NF-κB and p-IκB expression in rat ovaries in the four groups. Data are expressed as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT alleviated systemic and local inflammation in DHEA-induced PCOS rats. (A) ELISA for serum IL-6 levels in four groups. (B) ELISA for MIP-2 level of serum in four groups. (C) Immunohistochemistry analysis of the NF-κB signalling pathway in rat ovaries in the four groups. Scale bar: 20 μm. (D) Western blot analysis of NF-κB and p-IκB expression in rat ovaries in the four groups. Data are expressed as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT decreased autophagy by activating the PI3K/Akt/mTOR pathway
Autophagy may also be an important molecular event in the pathogenesis of PCOS. To determine the effect of MT on autophagy in DHEA-induced PCOS rat ovaries and DHEA-exposed KGN cells, the expression levels of Beclin1, P62, LC3 and the PI3K-A Akt signalling pathway were examined by Western blotting. As shown in Fig. 5A, Beclin-1 and LC3 expression levels were much higher, and P62 expression level was lower in the DHEA group compared with the control and MT groups, whereas the expression observed in the DHEA+MT group was more similar to the control and MT groups. In addition, p-Akt, PI3K and p-mTOR expression levels were all significantly decreased in the DHEA group but increased in the DHEA+MT group (Fig. 5B). In DHEA-exposed KGN cells, we obtained consistent results from PCOS rats. However, after adding BEZ235, an inhibitor of the PI3K-Akt signalling pathway, to DHEA+MT-cotreated KGN cells, the protective function of MT was suppressed (Fig. 5C and D). The results indicated that MT pretreatment could inhibit autophagy in ovaries in DHEA-induced PCOS model rats and DHEA-exposed KGN cells by activating the PI3K-Akt pathway and subsequently protecting ovarian function.
MT decreased autophagy by activating the PI3K/AKT/mTOR pathway. (A) Western blot analysis of Beclin1, P62 and LC3 in rat ovaries in the four groups. (B) Western blot analysis of the PI3K-AKT signalling pathway in rat ovaries in the four groups. KGN cells were subject to five different treatments: control, MT, DHEA, DHEA+MT, and DHEA+MT+BEZ235. KGN cells were stimulated with DHEA (100 μM) and pretreated with MT (200 μM) with or without BEZ235 (250 nM) (PI3K-AKT pathway inhibitor). (C) Western blot analysis of Beclin1, P62 and LC3 in the five groups of KGN cells. (D) Western blot analysis of the PI3K-AKT signalling pathway in five groups of KGN cells. Data are presented as the mean ± s.e.m *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT decreased autophagy by activating the PI3K/AKT/mTOR pathway. (A) Western blot analysis of Beclin1, P62 and LC3 in rat ovaries in the four groups. (B) Western blot analysis of the PI3K-AKT signalling pathway in rat ovaries in the four groups. KGN cells were subject to five different treatments: control, MT, DHEA, DHEA+MT, and DHEA+MT+BEZ235. KGN cells were stimulated with DHEA (100 μM) and pretreated with MT (200 μM) with or without BEZ235 (250 nM) (PI3K-AKT pathway inhibitor). (C) Western blot analysis of Beclin1, P62 and LC3 in the five groups of KGN cells. (D) Western blot analysis of the PI3K-AKT signalling pathway in five groups of KGN cells. Data are presented as the mean ± s.e.m *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT decreased autophagy by activating the PI3K/AKT/mTOR pathway. (A) Western blot analysis of Beclin1, P62 and LC3 in rat ovaries in the four groups. (B) Western blot analysis of the PI3K-AKT signalling pathway in rat ovaries in the four groups. KGN cells were subject to five different treatments: control, MT, DHEA, DHEA+MT, and DHEA+MT+BEZ235. KGN cells were stimulated with DHEA (100 μM) and pretreated with MT (200 μM) with or without BEZ235 (250 nM) (PI3K-AKT pathway inhibitor). (C) Western blot analysis of Beclin1, P62 and LC3 in the five groups of KGN cells. (D) Western blot analysis of the PI3K-AKT signalling pathway in five groups of KGN cells. Data are presented as the mean ± s.e.m *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT reduced apoptosis via the PI3K-Akt pathway
Apoptosis is involved in the occurrence and development of PCOS. Abnormal apoptosis of ovarian granulosa cells is thought to be related to the pathogenesis of PCOS. To observe the effect of MT on apoptosis in DHEA-induced PCOS rat ovaries and DHEA-exposed KGN cells, Western blotting and flow cytometry were performed. In the PCOS rat model, reduced Bcl-2 expression and increased BAX and Caspase3 expression was observed in the DHEA group compared with the control and MT groups, but these changes were reversed in the DHEA+MT group (Fig. 6A). Similarly, in DHEA-exposed KGN cells, the same results for these apoptosis indicators were observed. However, this effect could be inhibited by BEZ235 (Fig. 6E and F). In summary, the protective function of MT on DHEA-induced PCOS model rats and DHEA-exposed KGN cells was exerted through inhibiting apoptosis by activating the PI3K-Akt pathway, potentially representing the protective mechanism of MT on ovarian function in PCOS.
MT reduced apoptosis via the PI3K-AKT pathway. (A) Western blot analysis of Bcl-2, Bax and Caspase3 in rat ovaries in the four groups. (B) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with dose–response experiments. (C) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with time-response experiments. (D) The protective effect of different concentrations of MT on apoptosis in DHEA-exposed KGN cells. (E) Flow cytometry analysis for determining the rate of apoptosis in five different treated KGN cell groups. (F) Western blot analysis of Bcl-2, Bax and Caspase3 in five different treated KGN cell groups. Data are reported as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT reduced apoptosis via the PI3K-AKT pathway. (A) Western blot analysis of Bcl-2, Bax and Caspase3 in rat ovaries in the four groups. (B) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with dose–response experiments. (C) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with time-response experiments. (D) The protective effect of different concentrations of MT on apoptosis in DHEA-exposed KGN cells. (E) Flow cytometry analysis for determining the rate of apoptosis in five different treated KGN cell groups. (F) Western blot analysis of Bcl-2, Bax and Caspase3 in five different treated KGN cell groups. Data are reported as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
MT reduced apoptosis via the PI3K-AKT pathway. (A) Western blot analysis of Bcl-2, Bax and Caspase3 in rat ovaries in the four groups. (B) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with dose–response experiments. (C) The rate of apoptosis in DHEA-exposed KGN cells was determined by flow cytometry with time-response experiments. (D) The protective effect of different concentrations of MT on apoptosis in DHEA-exposed KGN cells. (E) Flow cytometry analysis for determining the rate of apoptosis in five different treated KGN cell groups. (F) Western blot analysis of Bcl-2, Bax and Caspase3 in five different treated KGN cell groups. Data are reported as the mean ± s.e.m. *P < 0.05 vs control; **P < 0.01 vs control; ##P < 0.01 vs DHEA.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Discussion
MT appears to be a multifunctional molecule that plays an important role in scavenging free radicals, antioxidation, regulating circadian rhythm, and autophagy. MT also participates in the regulation of reproductive physiology through receptor-mediated and nonreceptor-mediated mechanisms. MT is synthesised in the mitochondria, and ovarian cells can produce MT. Locally generated MT plays an important role in its anti-inflammatory and immune effects on PCOS. These effects may be mediated by the MT receptor located in the mitochondria (Tan & Hardeland 2020). Given that the clinical symptoms of PCOS are diversified and heterogeneous and the pathogenesis can be multifactorial, exogenous MT is likely to exert its multiple effects and prevent the occurrence and development of PCOS based on different physiological processes.
The results from our studies showed that women with PCOS exhibited reduced MT levels in follicular fluid compared with women in the non-PCOS control group. The MT level in the follicular fluid of PCOS cases exhibits a positive correlation with serum FSH levels and negative correlations with serum T and LH levels and even the LH/FSH ratio. Therefore, MT secretion in the follicular fluid could serve as a valuable biomarker for the clinical prediction of PCOS.
Obesity is closely related to the fertility of PCOS patients. Weight control is also a major clinical measure for symptomatic treatment of PCOS patients. In this study, based on the comparative analysis of the body weight of model animals in each group, the results of MT pretreatment exhibited a tendency to reduce the body weight of PCOS model rats, suggesting that MT may improve obesity-related diseases. Therefore, MT might effectively reduce the weight of PCOS patients, which is of great significance for preventing the occurrence and development of PCOS.
Chronic inflammation plays an important role in the occurrence and development of PCOS. Solano ME et al. reported that in a PCOS mouse model, the expression of IL-6, TNF-α and other inflammatory factors was significantly increased, and a large number of CD4+ cells infiltrated the follicular granular cell layer, causing persistent local inflammation of the ovaries (Solano et al. 2011). Our results demonstrated that MT pretreatment downregulates NF-κB expression in ovarian tissue and reduces IL-6 and MIP-2 levels in the serum of PCOS rats, effectively inhibiting inflammation.
Granulosa cell apoptosis is one of the main pathological features of PCOS ovaries. In this study, we found that Bcl-2 expression in both PCOS ovary tissues and DHEA-exposed KGN cells decreased, whereas BAX and Caspase3 expression increased. MT pretreatment increased Bcl-2 levels and reduced BAX and Caspase3 levels. Subsequently, apoptosis in PCOS was inhibited. Cell experiments further demonstrated that MT inhibited PCOS ovarian cell apoptosis by activating the PI3K-Akt pathway. The PI3K-Akt signalling pathway is an important pathway involved in cell cycle regulation and cell proliferation. Studies on the regulation of the PI3K-Akt pathway report that MT promotes cell proliferation and inhibits cell apoptosis in a variety of cells, including nerve cells (Li et al. 2019a), cardiomyocytes (An et al. 2016) and sperm (Najafi et al. 2018). Reduced expression of PI3K-Akt in PCOS ovarian tissue and DHEA-exposed KGN cells was associated with apoptosis, suggesting that MT inhibited apoptosis by activating the PI3K-Akt pathway and promoted the proliferation of ovarian granulosa cells.
The importance of autophagy in PCOS and related metabolic diseases is increasingly being recognised. In this study, the expression of the autophagy-related proteins LC3 and Beclin-1 was significantly increased, whereas the expression of P62 was decreased in PCOS rat ovarian tissue and DHEA-exposed KGN cells. MT inhibited autophagy by activating the PI3K/Akt/mTOR pathway. The PI3K/Akt/mTOR signalling pathway is a classic pathway involved in the regulation of autophagy. At present, many conclusions about the relationship between PCOS and mTOR signals are contradictory and complex. Studies have shown that the expression of mTOR and p-mTOR (Serine-2448) in the ovary in a DHEA-induced PCOS mouse model is increased compared with that in normal mice (Yaba & Demir 2012). However, in another study, mTOR protein expression decreased only after insulin stimulation in ovarian granulosa cells of PCOS patients (Song et al. 2018). In this study, p-mTOR expression in DHEA-induced PCOS rat ovarian tissue was reduced compared with that in the control group, thus resulting in autophagy. In addition, MT pretreatment upregulated the expression of p-mTOR and inhibited autophagy. In different in vitro and in vivo studies, MT enhances significant protective effects by enhancing or inhibiting autophagy processes, revealing the potential for MT in the treatment of several major diseases (Roohbakhsh et al. 2018). Therefore, MT is considered to be an autophagy regulatory factor possessing therapeutic potential (Boga et al. 2019). Our study demonstrated that MT suppressed autophagy and apoptosis in PCOS by increasing the expression of members of the PI3K/Akt/mTOR pathway.
Conclusion
This study demonstrated the protective effect of MT on ovarian function through regulating autophagy in PCOS likely via the PI3K-Akt signalling pathway. Our findings provide a potential therapeutic drug target for PCOS. The roles of MT in ovarian function in PCOS are summarised in Fig. 7.
The potential mechanisms of MT on the PCOS.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
The potential mechanisms of MT on the PCOS.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
The potential mechanisms of MT on the PCOS.
Citation: Reproduction 162, 1; 10.1530/REP-20-0643
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The present work was supported by National Key R&D Programme of China (2016YFC1000200 and 2016YFC1000204), Natural Science Research Project of Universities in Anhui Province (KJ2020A0198), the National Natural Science Foundation of China (81771653), Open Project of Anhui Province Key Laboratory of Reproductive Health and Genetics (RHG-2020-8), the key research and development programme of Anhui Province (202004j07020043), the Excellent Young Talents Support Programme at universities of Anhui Province (2009SQRZ046), Nonprofit Central Research Institute Fund of Chinese Academy of Medical Sciences (2019PT310002), and the Key Excellent Young Talents Support Programme at universities of Anhui Province (gxyqZD2017031).
Author contribution statement
Fenfen Xie and Yajing Liu contributed to the conception and design of this work. Yunxia Cao and Dan Liang were responsible for the supervision and editing of the study. Junhui Zhang performed the experiments in vivo. Muxin Zhai and Hui Hu completed the experiments in vitro. Zhen Yu and Junqiang Zhang were responsible for technical and material support. Shuai Lin analysed the data. All authors read and approved the final version.
Acknowledgements
The authors would like to thank Academician Hefeng Huang at Shanghai Jiaotong University for kindly providing KGN cells for research.
References
Alanbay I, Ercan CM, Sakinci M, Coksuer H, Ozturk M & Tapan S 2012 A macrophage activation marker chitotriosidase in women with PCOS: does low-grade chronic inflammation in PCOS relate to PCOS itself or obesity? Archives of Gynecology and Obstetrics 286 1065–1071. (https://doi.org/10.1007/s00404-012-2425-0)
An R, Zhao L, Xi C, Li H, Shen G, Liu H, Zhang S & Sun L 2016 Melatonin attenuates sepsis-induced cardiac dysfunction via a PI3K/Akt-dependent mechanism. Basic Research in Cardiology 111 8. (https://doi.org/10.1007/s00395-015-0526-1)
Boga JA, Caballero B, Potes Y, Perez-Martinez Z, Reiter RJ, Vega-Naredo I & Coto-Montes A 2019 Therapeutic potential of melatonin related to its role as an autophagy regulator: a review. Journal of Pineal Research 66 e12534. (https://doi.org/10.1111/jpi.12534)
Brakta S, Lizneva D, Mykhalchenko K, Imam A, Walker W, Diamond MP & Azziz R 2017 Perspectives on polycystic ovary syndrome: is polycystic ovary syndrome research underfunded? Journal of Clinical Endocrinology and Metabolism 102 4421–4427. (https://doi.org/10.1210/jc.2017-01415)
Caldwell AS, Middleton LJ, Jimenez M, Desai R, McMahon AC, Allan CM, Handelsman DJ & Walters KA 2014 Characterization of reproductive, metabolic, and endocrine features of polycystic ovary syndrome in female hyperandrogenic mouse models. Endocrinology 155 3146–3159. (https://doi.org/10.1210/en.2014-1196)
González F 2012 Inflammation in polycystic ovary syndrome: underpinning of insulin resistance and ovarian dysfunction. Steroids 77 300–305. (https://doi.org/10.1016/j.steroids.2011.12.003)
Itoh MT, Ishizuka B, Kudo Y, Fusama S, Amemiya A & Sumi Y 1997 Detection of melatonin and serotonin N-acetyltransferase and hydroxyindole-O-methyltransferase activities in rat ovary. Molecular and Cellular Endocrinology 136 7–13. (https://doi.org/10.1016/s0303-7207(9700206-2)
Itoh MT, Ishizuka B, Kuribayashi Y, Amemiya A & Sumi Y 1999 Melatonin, its precursors, and synthesizing enzyme activities in the human ovary. Molecular Human Reproduction 5 402–408. (https://doi.org/10.1093/molehr/5.5.402)
Jamilian M, Foroozanfard F, Mirhosseini N, Kavossian E, Aghadavod E, Bahmani F, Ostadmohammadi V, Kia M, Eftekhar T & Ayati E et al. 2019 Effects of melatonin supplementation on hormonal, inflammatory, genetic, and oxidative stress parameters in women With polycystic ovary syndrome. Frontiers in Endocrinology 10 273. (https://doi.org/10.3389/fendo.2019.00273)
Lajtai K, Nagy CT, Tarszabó R, Benkő R, Hadjadj L, Sziva RE, Gerszi D, Bányai B, Ferdinandy P & Nádasy GL et al. 2019 Effects of vitamin D deficiency on proliferation and autophagy of ovarian and liver tissues in a rat model of polycystic ovary syndrome. Biomolecules 9 471. (https://doi.org/10.3390/biom9090471)
Li D, You Y, Bi FF, Zhang TN, Jiao J, Wang TR, Zhou YM, Shen ZQ, Wang XX & Yang Q 2018 Autophagy is activated in the ovarian tissue of polycystic ovary syndrome. Reproduction 155 85–92. (https://doi.org/10.1530/REP-17-0499)
Li L, Zhu J, Ye F, Duan Z, Zhou J, Huang Z & Wang L 2020 Upregulation of the lncRNA SRLR in polycystic ovary syndrome regulates cell apoptosis and IL-6 expression. Cell Biochemistry and Function 38 880–885. (https://doi.org/10.1002/cbf.3507)
Li Y, Guo Y, Fan Y, Tian H, Li K & Mei X 2019a Melatonin enhances autophagy and reduces apoptosis to promote locomotor recovery in spinal cord injury via the PI3K/AKT/mTOR signaling pathway. Neurochemical Research 44 2007–2019. (https://doi.org/10.1007/s11064-019-02838-w)
Li Y, Zheng Q, Sun D, Cui X, Chen S, Bulbul A, Liu S & Yan Q 2019b Dehydroepiandrosterone stimulates inflammation and impairs ovarian functions of polycystic ovary syndrome. Journal of Cellular Physiology 234 7435–7447. (https://doi.org/10.1002/jcp.27501)
Masjedi F, Keshtgar S, Zal F, Talaei-Khozani T, Sameti S, Fallahi S & Kazeroni M 2020 Effects of vitamin D on steroidogenesis, reactive oxygen species production, and enzymatic antioxidant defense in human granulosa cells of normal and polycystic ovaries. Journal of Steroid Biochemistry and Molecular Biology 197 105521. (https://doi.org/10.1016/j.jsbmb.2019.105521)
Najafi A, Adutwum E, Yari A, Salehi E, Mikaeili S, Dashtestani F, Abolhassani F, Rashki L, Shiasi S & Asadi E 2018 Melatonin affects membrane integrity, intracellular reactive oxygen species, caspase3 activity and AKT phosphorylation in frozen thawed human sperm. Cell and Tissue Research 372 149–159. (https://doi.org/10.1007/s00441-017-2743-4)
Nikmard F, Hosseini E, Bakhtiyari M, Ashrafi M, Amidi F & Aflatoonian R 2017 Effects of melatonin on oocyte maturation in PCOS mouse model. Animal Science Journal 88 586–592. (https://doi.org/10.1111/asj.12675)
Pai SA & Majumdar AS 2014 Protective effects of melatonin against metabolic and reproductive disturbances in polycystic ovary syndrome in rats. Journal of Pharmacy and Pharmacology 66 1710–1721. (https://doi.org/10.1111/jphp.12297)
Reiter RJ, Tamura H, Tan DX & Xu XY 2014 Melatonin and the circadian system: contributions to successful female reproduction. Fertility and Sterility 102 321–328. (https://doi.org/10.1016/j.fertnstert.2014.06.014)
Roohbakhsh A, Shamsizadeh A, Hayes AW, Reiter RJ & Karimi G 2018 Melatonin as an endogenous regulator of diseases: the role of autophagy. Pharmacological Research 133 265–276. (https://doi.org/10.1016/j.phrs.2018.01.022)
Rothenberg SS, Beverley R, Barnard E, Baradaran-Shoraka M & Sanfilippo JS 2018 Polycystic ovary syndrome in adolescents. Best Practice and Research. Clinical Obstetrics and Gynaecology 48 103–114. (https://doi.org/10.1016/j.bpobgyn.2017.08.008)
Solano ME, Sander VA, Ho H, Motta AB & Arck PC 2011 Systemic inflammation, cellular influx and up-regulation of ovarian VCAM-1 expression in a mouse model of polycystic ovary syndrome (PCOS). Journal of Reproductive Immunology 92 33–44. (https://doi.org/10.1016/j.jri.2011.09.003)
Song WJ, Shi X, Zhang J, Chen L, Fu SX & Ding YL 2018 Akt-mTOR signaling mediates abnormalities in the proliferation and apoptosis of ovarian granulosa cells in patients with polycystic ovary syndrome. Gynecologic and Obstetric Investigation 83 124–132. (https://doi.org/10.1159/000464351)
Tagliaferri V, Romualdi D, Scarinci E, Cicco S, Florio CD, Immediata V, Tropea A, Santarsiero CM, Lanzone A & Apa R 2018 Melatonin treatment may be able to restore menstrual cyclicity in women with PCOS: a pilot study. Reproductive Sciences 25 269–275. (https://doi.org/10.1177/1933719117711262)
Tan DX & Hardeland R 2020 Targeting host defense system and rescuing compromised mitochondria to increase tolerance against pathogens by melatonin may impact outcome of deadly virus infection pertinent to COVID-19. Molecules 25. (https://doi.org/10.3390/molecules25194410)
Yaba A & Demir N 2012 The mechanism of mTOR (mammalian target of rapamycin) in a mouse model of polycystic ovary syndrome (PCOS). Journal of Ovarian Research 5 38. (https://doi.org/10.1186/1757-2215-5-38)
