Abstract
Urocortins (UCNs), belonging to corticotropin-releasing hormone (CRH) family, exert their function via CRH receptor type 1 (CRHR1) and 2 (CRHR2). Our previous studies have demonstrated that CRH acts on CRHR1 to potentiate prostaglandins (PGs) output induced by inflammatory stimuli in myometrial cells. In the present study, we sought to investigate the effects of UCNs on prostaglandin (PG) output via CRHR2 in cultured human uterine smooth muscle cells (HUSMCs) from pregnant women at term. We found that UCN and UCN 3 treatment promoted PGE2 and PGF2α secretion in a dose-dependent manner. In contrast, UCN2 dose-dependently inhibited PGE2 and PGF2α secretion. Their effects were reversed by CRHR2 antagonist and CRHR2 siRNA. Mechanically, we showed that UCN and UCN3 suppressed cAMP production and led to Gi activation while UCN2 stimulated cAMP production and activated Gs signaling. Further, UCN and UCN3 but not UCN2 activated NF-κB and MAPK signaling pathways through Gi signaling. UCN and UCN3 stimulation of PGs secretion were dependent on Gi/adenylyl cyclase (AC)/cAMP, NF-κB and MAPK signaling pathways. UCN2 suppression of PGs output was through Gs/AC/cAMP signaling pathways. Our data suggest that UCN, UCN2 and UCN3 can finely regulate PGs secretion via CRHR2, which facilitates the functional status of the uterus during pregnancy.
Introduction
Corticotropin-releasing hormone (CRH), a polypeptide that is primarily identified in the hypothalamus, has been implicated to play a pivotal role in the maintenance of pregnancy and initiation of parturition in humans (McLean & Smith 2001). It has been proposed that CRH regulates a placental clock which determines the length of gestation and controls a cascade of physiological events leading to parturition in humans (McLean & Smith 2001, Smith 2007). Although CRH was originally identified in the placenta and fetal membranes, it is now known to be expressed in the uterus including endometrium and myometrium (McLean & Smith 2001, Smith 2007, Petraglia et al. 2010). Several CRH signaling pathways have been found to be associated with the initiation of parturition. For instance, CRH stimulates glucocorticoid secretion in fetal adrenal glands, thereby leading to maturation of fetal organs and uterine activation (Karteris 2001, McLean & Smith 2001). CRH is also an important regulator of prostaglandin synthesis and metabolism in the placenta and fetal membranes (Karteris 2001, Gao et al. 2007, 2008, Petraglia et al. 2010). Besides placenta and fetal membranes, myometrium is a target of CRH within the uterus because CRH receptor type 1 (CRHR1) and CRHR2 are expressed in uterine smooth muscle cells in humans (Grammatopoulos 2007, Jin et al. 2007). We have previously shown that CRH can not only regulate spontaneous contractility but also modulate large-conductance Ca2+-activated K+ channel (BKCa) expression and inflammatory microenvironment in the myometrium, thereby controlling uterine activation for labor (Zhang et al. 2008, Xu et al. 2011).
In the CRH family, urocortins (UCN, UCN2 and UCN3) are the peptides showing sequence homology with CRH. CRH family members exert their function by interacting with CRH receptors (Deussing & Chen 2018). CRH binds with high affinity at CRHR1 and low affinity at CRHR2, while UCN highly binds at both receptors (Vitale et al. 2016, Deussing & Chen 2018). Compared with CRH, UCN binds with 40 times greater affinity to CRHR2. UCN2 and UCN3 peptides are the exclusive ligands of CRHR2 as both have a selective affinity for CRHR2 (Vitale et al. 2016, Chen & Deussing 2018). Although UCNs are identified in the placenta, fetal membranes, the levels of UCNs in maternal circulation do not change with gestational progress (Vannuccini et al. 2016, Vitale et al. 2016). It has been found that UCN is involved in a number of functions during pregnancy such as modulating placental prostaglandin secretion and myometrial contractility (Vannuccini et al. 2016, Vitale et al. 2016). The roles of UCN2 and UCN3 during pregnancy have also been reported. Some studies have shown that UCN2 regulates the estradiol secretion in cultured placental tissues and cells (Imperatore et al. 2009). Of note, Novembri et al. (2011b) have shown that UCN2 increases IL-10 and TNF-α secretion while UCN3 increases IL-10 secretion but not TNF-α secretion in placental explants, suggesting that UCN2 and UCN3 might have differential functions. Recently, Voltolini et al. (2015) reported that UCN2 mRNA expression is up-regulated in the myometrium approaching labor during pregnancy, and UCN2 increases proinflammatory mediators in myometrial cell lines. However, the role of UCN3 in the myometrium has not been reported.
It is well-known that prostaglandins (PGs) are involved in all the processes of parturition including rapture of fetal membranes, cervix ripening and myometrium contraction (Vannuccini et al. 2016). PGs act via both paracrine and autocrine mechanisms because they are produced in all tissues of the body. Myometrium is a major source of PGs for preparation for parturition. Our previous study has shown that CRH can promote the output of PGE2 and PGF2α via CRHR1 in cultured human myometrial cells in the presence of monocytes (You et al. 2014). In the present study, we sought to define the roles of CRHR2 ligands UCN, UCN2 and UCN3 in the secretion of PGs in human myometrium during pregnancy. First, we examined mRNA and protein levels of UCN, UCN2 and UCN3 in pregnant myometrium before and after the onset of labor. Then, we investigated the effects of UCN, UCN2 and UCN3 on the output of PGs and elucidated UCN, UCN2 and UCN3 signaling pathways in cultured human uterine smooth muscle cells (HUSMCs). We demonstrated the novel findings that UCN, UCN2 and UCN3 activate differential signaling pathways to regulate the secretion of PGs in the myometrium and revealed previously unrecognized roles of UCN, UCN2 and UCN3 in uterine activation for labor.
Materials and methods
Tissue collections
Tissue collections were performed with the approval of the specialty committee on ethics of biomedicine research, Navy Medical University, Shanghai, China, as well as the ethic committee of medical research, Xiangya Hospital, Changsha, China (201803381). Written informed consent was obtained from all patients. Biopsies of human myometrium were obtained from pregnant women undergoing elective cesarean section (not-in-labor, TNL) and emergency cesarean section (in-labor, TL) at term (37–41 weeks). Indications for cesarean section included a breech presentation, previous cesarean section, cephalopelvic disproportion, failure of labor to progress, fetal distress, or maternal request. Human myometrial tissues for determination of UCN, UCN2 and UCN3 expression levels were collected from the women who underwent elective and emergency cesarean section at Xiangya Hospital, Changsha. The tissues for cell cultures were collected from women who underwent elective cesarean section at Changhai Hospital, Navy Medical University, Shanghai. The patients who had evidence of underlying disease (e.g. hypertension, diabetes, preeclampsia, intrauterine growth restriction, etc.) were not included in this study. Biopsies of the myometrium were excised from the middle portion of the upper edge of the incision line in the lower uterine segment at the cesarean section. Collected samples were either frozen immediately in liquid nitrogen and then stored at −80 °C or fixed in buffered formalin for further analysis. Some myometrial tissues were immediately placed in PBS maintained at 4°C and transported to the laboratory for cell culture.
Cultures of human HUSMCs
HUSMCs were isolated by enzymatic dispersion as described previously (Xu et al. 2011, You et al. 2014). Briefly, myometrial tissues were incubated with DMEM containing 1 mg/mL collagenase type II (Invitrogen) and 1 mg/mL DNase I (Sigma-Aldrich) at 37°C with shaking for 30 min for two times. After filtration, the cell suspension was centrifuged, and the cell pellet was resuspended in DMEM containing 10% fetal calf serum (FCS), penicillin (100 U/mL) and streptomycin (100 mg/mL). The cells were then plated into 25 cm2 flasks and kept at 37°C in a 5% CO2-95% air humidified atmosphere until confluent (~10 days). The experiments were performed on the cells of passage 2. The cells were seeded in 12-well plates and maintained under 37°C in 5% CO2-95% air humidified atmosphere until confluent. Confluent cells were then treated with increasing concentrations (10−1–10−7M) of UCN, UCN2 or UCN 3 in the absence and presence of astressin 2b for 24 h, the culture media and cells were then collected and stored at −80°C until analysis. The concentrations of UCNs were chosen according to the literature (McLean & Smith 2001, Petraglia et al. 1999, 2010). For determining the signaling pathways of UCNs, the cells were treated with UCN, UCN2 and UCN3 for indicated times, and then the cells were harvested. For investigating the roles of various signaling pathways in UCNs regulation of PGs secretion, the cells were treated with UCNs in the presence of pertussis toxin (PTX, 0.1 μg/mL), melittin (10−5M), SQ22532 (10−5M), H89 (10−5M), 8-Br-cAMP (10−5M), pyrrolidine dithiocarbamate (PDTC, 10−5M), SB202190 (10−5M) and PD98059 (10−5M) for 24 h. Culture media were then harvested. The dosages of these reagents were chosen based on our previous studies (You et al. 2012, 2014, Xu et al. 2015) and literature (Fukushima et al. 1998, Wang et al. 2008). PTX and melittin were purchased from Calbiochem. H89,8-Br-cAMP, PDTC, SQ22532, SB202190 and PD98059 were provided by Sigma-Aldrich.
Total RNA extraction and quantitative real-time RT-PCR
Total RNA was prepared from myometrial tissues and cells by using TRIzol reagent (Invitrogen). Two microgram RNA was reverse transcribed with oligo(dT)18 primer using the M-MLV reverse transcriptase (Promega, Madison, WI). Specific primers for the amplification of UCN, UCN2 and UCN3 are listed in Table 1. Quantitative real-time PCR was carried out using Bio Rad CFX Connect™ Real Time System (Bio Rad). The reaction solution consisted of 2.0 µL diluted cDNA product, 0.2 µmol/L of each paired primer, 200 µmol/L deoxynucleotide triphosphates, 1 U Taq DNA polymerase (Qiagen), and 1× PCR buffer. SYBRGreen (Roche Ltd) was used as a detection dye. The annealing temperature was set at 60°C and amplification cycles were set at 40 cycles. The temperature range to detect the melting temperature of the PCR product was set from 60°C to 95°C. To determine the relative quantitation of gene expression for both target and housekeeping genes, the comparative Ct (threshold cycle) method with arithmetic formulae was used. Two reference genes β-actin and GAPDH were measured for each sample as an internal control for sample loading and normalization. Because remarkably similar results were obtained using these two internal control genes, the final data of mRNA levels were normalized relative to GAPDH values.
List of primers used for the amplification of urocortins in USMCs.
| Gene | Primer sequences (5’-3’) | Gene ID | Product size (bp) | |
|---|---|---|---|---|
| Forward | Reverse | |||
| UCN | GTCAGACTCGAAGCTGTGGC | CGCCGGCCAGGTTGTC | 7349 | 210 |
| UCN2 | CTGGTGGCGCCTGACC | CACTGTGACCCCCTCTCTCA | 90226 | 383 |
| UCN3 | CACTTCCTGCTGCTCCTGCTG | GGTAGTGGAAGCTCCTCTTGCTC | 114131 | 219 |
| ACTB | CTGTATGCCTCTGGTCGTAC | TGATGTCACGCACGATTTCC | 60 | 217 |
Western blotting analysis
Cells were harvested in the presence of M-Per lysis buffer (Pierce Biotechnology). The proteins (about 50 mg) were denatured and separated by SDS (10%)-PAGE and subsequently transferred to nitrocellulose membranes by electroblotting. Following the transfer, membranes were incubated in blocking buffer, then with specific antibodies (Santa Cruz Biotechnology, Inc.) that recognize the following molecules: p65(ab131485, Abcam), phospho-p65(ser-529) (ab97726, Abcam), extracellular signal-regulated kinase (ERK)1/2 (4695, Cell signaling), phospho-ERK1/2 (4370, Cell signaling), P38 (ab170099, Abcam), phospho-P-38 (T180) (ab178867, Abcam), CRHR1 (ab77686, Abcam) and CRHR2 (ab167379, Abcam) overnight at 4°C at a dilution of 1: 1000. Membranes were then washed and incubated with a secondary horseradish peroxidase-conjugated antibody and immunoreactive proteins visualized using ECL (Santa Cruz). The intensities of light-emitting bands were detected and quantified using Tanon 4600SF Image system (Shanghai Tanon. Ltd, Shanghai, China). To control sampling errors, the ratio of the band intensities to β-actin was obtained to quantify the relative protein expression level.
Enzyme-linked immunosorbent assay (ELISA)
PGE2 and PGF2α concentration in culture media of HUSMCs were measured by using a commercial kit (Cayman Chemical) according to the manufacturer’s protocol.
RNA interferences
For knockdown of CRHR1 and CRHR2, sequence-specific siRNA (siRNA) was used. The sequence of CRHR1 was sense 5'- GGUUGGUGACAGCCGCCUATT-3'; antisense 5'-UAGGCGGCUGUCACCAACCTT-3'. The sequence of CRHR2 was sense 5’-GGAAUGUGAUUCACUGGAATT-3’; antisense 5’-UUCCAGUGAAUCACAUUCCTT-3’). The following nonsense siRNA (sense 5'-GAAUCUGGGAUGUUAACCATT–3’; antisense 5’-UGGUUAACAUCCCAGAUUCTG-3') was used as the negative control. HUSMCs were transfected with siRNA targeting CRHR1, CRHR2, or control siRNA using Lipofectamine 3000 (Invitrogen) for 6 h, then incubated with DMEM for 18 h. The cells were changed with fresh DMEM containing UCN, UCN2 or UCN3 and incubated for 24 h.
cAMP assay
Myometrial cells were treated with increasing concentrations of UCN, UCN2 and UCN3 for 10 min, and then the cells were scraped off the plate in the presence of 50 mM sodium acetate (pH 4.75). Lysates were boiled at 95°C for 10 min, and then quickly sonified in an ice bath. The supernatants were collected by centrifuge and used for cAMP assay according to the protocol of a commercial 125I-RIA kit (Huaying Biotechnology Research Institute, Peking, China).
Measurement of activated Gs and Gi protein levels
The levels of activated, GTP-bound Gs and Gi proteins were determined by using commercial Gs and Gi activation assay kits (NewEast Biosciences, Malvern, USA). Myometrial cells were treated with increasing concentrations of UCN, UCN2 and UCN3 for 5 min, and then scraped off the plate in the presence of lysis buffer. The cell lysate was centrifuged for 10 s at 12,000 g . The supernatants were collected and then immunoprecipitated with anti-Gs-GTP or Gi-GTP MAB and the protein A/G beads. After incubating at 4°C for 1 h, the beads were washed three times (10 min each) in lysis buffer. Bound proteins were analyzed by western blotting with anti-Gs or anti-Gi MAB. To control sampling errors, the total Gs or Gi protein was also detected. The ratio of Gs-GTP or Gi-GTP band intensities to total Gs or Gi band intensities was obtained to quantify the relative Gs-GTP or Gi-GTP protein level.
Statistical analysis
The data were presented as the mean ± s.e.m. All data were tested for homogeneity of variance by Bartlett’s test before analyzing the significance. Statistical significance was determined according to sample distribution and homogeneity of variance. Statistical comparisons between two groups were determined by two-tailed Student’s t test. One-way ANOVA following by Bonferroni’s post hoc test was performed for comparisons among multiple groups. P < 0.05 was considered statistically significant.
Results
The expression levels of UCNs in human pregnant myometrium at term
We determined UCN, UCN2 and UCN3 mRNA and protein levels in the human myometrium of pregnant women before (TNL) and after the onset of labor (TL) at term. As shown in Fig. 1, UCN, UCN2 and UCN3 mRNA levels were significantly increased in the TL group compared with the TNL group (P < 0.01). The protein levels of UCN and UCN 3 were significantly increased (P < 0.01) while UCN2 levels were slightly increased without significance in the TL group compared with the TNL group.
The mRNA and protein levels of UCN, UCN2 and UCN3 in the human myometrium of the patients before (TNL) and after the onset of parturition (TL) at term. Myometrial samples were obtained from pregnant women who underwent elective and emergncy cesarean section at term. The mRNA levels of UCN,UCN2 and UCN3 were determined by quantiative real-time PCR (A). The protein levels of UCN, UCN2 and UCN3 were measured by ELISA (B). Data were expressed as mean ± s.e.m. (n = 10 in each group). **P < 0.01 vs TNL.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The mRNA and protein levels of UCN, UCN2 and UCN3 in the human myometrium of the patients before (TNL) and after the onset of parturition (TL) at term. Myometrial samples were obtained from pregnant women who underwent elective and emergncy cesarean section at term. The mRNA levels of UCN,UCN2 and UCN3 were determined by quantiative real-time PCR (A). The protein levels of UCN, UCN2 and UCN3 were measured by ELISA (B). Data were expressed as mean ± s.e.m. (n = 10 in each group). **P < 0.01 vs TNL.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The mRNA and protein levels of UCN, UCN2 and UCN3 in the human myometrium of the patients before (TNL) and after the onset of parturition (TL) at term. Myometrial samples were obtained from pregnant women who underwent elective and emergncy cesarean section at term. The mRNA levels of UCN,UCN2 and UCN3 were determined by quantiative real-time PCR (A). The protein levels of UCN, UCN2 and UCN3 were measured by ELISA (B). Data were expressed as mean ± s.e.m. (n = 10 in each group). **P < 0.01 vs TNL.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
UCNs exhibit differential effects on the output of PGE2 and PGF2α in cultured HUSMCs via CRHR2
Given that UCN can bind both CRHR1 and CRHR2, the cells were transfected with CRHR1 siRNA, and then treated with UCN in order to ensure UCN mainly interacting with CRHR2. CRHR1 siRNA could result in a 72.6 ± 7.9% reduction of CRHR1 expression (Supplementary Fig. 1A, see section on supplementary materials given at the end of this article). UCN treatment (10−10–10−7M) increased PGE2 and PGF2α secretion in a dose-dependent manner (Fig. 2A and B). The significant effect was reached at the dosage of 10−8 M. The stimulatory effect of UCN (10−8M) on PGE2 and PGF2α secretion was prevented by CRHR2 antagonist astressin 2b (10−6M).
The effects of UCN, UCN2 and UCN3 on PGE2 and PGF2α output in cultured HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN in the presence of absence of astressin 2b for 24 h. (C and E) Cultured HUSMCs were treated with UCN2 in the absence and presence of astressin 2b for 24 h. (D and F) The cells were transfected with CRHR2 siRNA, and then treated with UCN2 (10−8M) for 24 h. (G and I) Cultured HUSMCs were treated with UCN3 in the absence and presence of astressin 2b for 24 h. (H and J) HUSMCs were transfected with CRHR2 siRNA ,and then treated with UCN3 (10−8M) for 24 h. The supernatants were collected for determination of PGE2 and PGF2α by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs vehicle, #P < 0.05, ##P < 0.01 vs 10−8M UCNs.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of UCN, UCN2 and UCN3 on PGE2 and PGF2α output in cultured HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN in the presence of absence of astressin 2b for 24 h. (C and E) Cultured HUSMCs were treated with UCN2 in the absence and presence of astressin 2b for 24 h. (D and F) The cells were transfected with CRHR2 siRNA, and then treated with UCN2 (10−8M) for 24 h. (G and I) Cultured HUSMCs were treated with UCN3 in the absence and presence of astressin 2b for 24 h. (H and J) HUSMCs were transfected with CRHR2 siRNA ,and then treated with UCN3 (10−8M) for 24 h. The supernatants were collected for determination of PGE2 and PGF2α by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs vehicle, #P < 0.05, ##P < 0.01 vs 10−8M UCNs.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of UCN, UCN2 and UCN3 on PGE2 and PGF2α output in cultured HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN in the presence of absence of astressin 2b for 24 h. (C and E) Cultured HUSMCs were treated with UCN2 in the absence and presence of astressin 2b for 24 h. (D and F) The cells were transfected with CRHR2 siRNA, and then treated with UCN2 (10−8M) for 24 h. (G and I) Cultured HUSMCs were treated with UCN3 in the absence and presence of astressin 2b for 24 h. (H and J) HUSMCs were transfected with CRHR2 siRNA ,and then treated with UCN3 (10−8M) for 24 h. The supernatants were collected for determination of PGE2 and PGF2α by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs vehicle, #P < 0.05, ##P < 0.01 vs 10−8M UCNs.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
HUSMCs were treated with increasing concentration of UCN2 and UCN3 in the absence and presence of astressin 2b for 24 h. Interestingly, UCN2 treatment (10−1–10−7M) dose-dependently suppressed PGE2 and PGF2α output in HUSMCs (Fig. 2C and E). The inhibitory effect of UCN2 (10−8 M) was blocked in the presence of astressin 2b (10−6 M). To further confirm CRHR2 mediating UCN2 effects, the cells were transfected with CRHR2 siRNA, and then treated with UCN2. CRHR2 siRNA led to a 66.1 ± 1.5% decrease in CRHR2 level (Supplementary Fig. 1B). In the cells transfected with CRHR2 siRNA, the inhibitory effects of UCN2 on PGE2 and PGF2α output were prevented (Fig. 2D and F). UCN3 treatment displayed a stimulatory effect on PGE2 and PGF2α output. As shown in Fig. 2G and I, UCN3 dose-dependently stimulated PGE2 and PGF2α secretion. The significant effects were obtained at the dosage of 10−9 M. These effects were reversed by astressin 2b treatment. The stimulatory effects of UCN3 on PGE2 and PGF2α secretion were also prevented by CRHR2 siRNA (Fig. 2H and J).
UCN, UCN2 and UCN3 activate different signaling pathways in HUSMCs
An increasing body of evidence has indicated that G protein-coupled receptor (GPCR) can activate different G proteins in response to different ligand treatment (Wang et al. 2018). We, therefore, examined the intracellular signaling pathways which were activated by UCN, UCN2 and UCN3. Given that cAMP signaling is the common signaling molecule of GPCRs, we first examined the levels of cAMP in response to UCN, UCN2 and UCN3 treatment. As shown Fig. 3A, UCN dose-dependently decreased cAMP production in the HUSMCs with CRHR1 knockdown. Figure 3B and C showed that UCN3 treatment decreased cAMP production whereas UCN2 treatment increased cAMP production in a dose-dependent manner in HUSMCs.
UCN and UCN3 activate Gi/cAMP and UCN 2 activate Gs/cAMP signaling pathways in HUSMCs. (A, B and C) Cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN (A) for 10 min, or cultured HUSMCs were treated with increasing concentration of UCN 2 (B) or UCN3 (C) for 10 min. The cells were collected for determination of cAMP concentration. (D, E and F) cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN for 5 min (D), or cultured HUSMCs were treated with increasing concentration of UCN2 (E) or UCN3 (F) for 5 min. The cells were collected for determination of Gs or Gi activation using the commercial kit. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
UCN and UCN3 activate Gi/cAMP and UCN 2 activate Gs/cAMP signaling pathways in HUSMCs. (A, B and C) Cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN (A) for 10 min, or cultured HUSMCs were treated with increasing concentration of UCN 2 (B) or UCN3 (C) for 10 min. The cells were collected for determination of cAMP concentration. (D, E and F) cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN for 5 min (D), or cultured HUSMCs were treated with increasing concentration of UCN2 (E) or UCN3 (F) for 5 min. The cells were collected for determination of Gs or Gi activation using the commercial kit. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
UCN and UCN3 activate Gi/cAMP and UCN 2 activate Gs/cAMP signaling pathways in HUSMCs. (A, B and C) Cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN (A) for 10 min, or cultured HUSMCs were treated with increasing concentration of UCN 2 (B) or UCN3 (C) for 10 min. The cells were collected for determination of cAMP concentration. (D, E and F) cultured HUSMCs with CRHR1 knockdown were treated with increasing concentration of UCN for 5 min (D), or cultured HUSMCs were treated with increasing concentration of UCN2 (E) or UCN3 (F) for 5 min. The cells were collected for determination of Gs or Gi activation using the commercial kit. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
It is known that Gs protein activates while Gi protein inhibits adenylate cyclase activity, and subsequently leads to increased and decreased cAMP production, respectively (Wang et al. 2018). We then examined whether UCN and UCN3 activated Gi protein or UCN2 activated Gs protein. UCN treatment dose-dependently stimulated Gi protein activation in the cells with CRHR1 knockdown (Fig. 3D). UCN3 treatment promoted Gi-GTP protein (active Gi protein) level in a dose-dependent manner, in contrast, UCN2 treatment dose-dependently increased the level of Gs-GTP protein (i.e. active Gs protein) (Fig. 3E and F). These data suggest that UCN and UCN3 activate Gi/AC/cAMP signaling pathway while UCN2 activates Gs/AC/cAMP signaling pathway in HUSMCs.
Several studies have demonstrated that CRH receptors can activate MAPK and NF-κB signaling pathways (Grammatopoulos et al. 2000, You et al. 2012, 2014). We, therefore, examined ERK1/2, p38 and p65 signaling pathways upon to UCN, UCN2 and UCN3 treatment. As shown in Fig. 4A, UCN treatment (10−8M) increased p-ERK/12, p-p38 and p-p65 levels in a time-dependent manner in the cells with CRHR1 knockdown. We then investigated whether UCN activating MAPK and NF-κB signaling pathways is dependent on Gi activation. As shown in Fig. 4B, in the presence of PTX (0.1 μg/mL), an inhibitor of Gi protein, levels of p-ERK/12, p-p38 and p-p65 were not significantly changed upon UCN treatment. Figure 4C and D showed that UCN3 could also promote ERK1/2, p38 and p65 signaling pathways. UCN3 (10−8M) increased p-ERK/12, p-p38 and p-p65 levels in a time-dependent manner. PTX treatment reversed the stimulatory effects of UCN3 on ERK/12, p38 and p65 signaling pathways. As shown in Fig. 4E, the levels of p-ERK/12, p-p38 and p-p65 were not significantly changed upon UCN2 treatment (10−8 M).
The effects of UCN, UCN2 and UCN3 on ERK1/2, p38, p65 signaling pathways. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence (A) and presence (B) of PTX for indicated time. (C and D) Cultured HUSMCs were treated with UCN3 at 10−8M in the absence (C) and presence (D) of PTX for indicating time. (E) Cultured HUSMCs were treated with UCN2 at 10−8M for indicating time. The cells were collected for determination of ERK1/2, p-ERk1/2, p38, p-p38, p65 and p-p65 levels. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of UCN, UCN2 and UCN3 on ERK1/2, p38, p65 signaling pathways. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence (A) and presence (B) of PTX for indicated time. (C and D) Cultured HUSMCs were treated with UCN3 at 10−8M in the absence (C) and presence (D) of PTX for indicating time. (E) Cultured HUSMCs were treated with UCN2 at 10−8M for indicating time. The cells were collected for determination of ERK1/2, p-ERk1/2, p38, p-p38, p65 and p-p65 levels. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of UCN, UCN2 and UCN3 on ERK1/2, p38, p65 signaling pathways. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence (A) and presence (B) of PTX for indicated time. (C and D) Cultured HUSMCs were treated with UCN3 at 10−8M in the absence (C) and presence (D) of PTX for indicating time. (E) Cultured HUSMCs were treated with UCN2 at 10−8M for indicating time. The cells were collected for determination of ERK1/2, p-ERk1/2, p38, p-p38, p65 and p-p65 levels. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). *P < 0.05, **P < 0.01 vs control.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of UCNs on PGE2 and PGF2α secretion are dependent on Gi/AC/cAMP, Gs/AC/cAMP, MAPK and NF-κB signaling pathways
We then examined the roles of Gi/AC/cAMP, Gs/AC/cAMP, MAPK and NF-κB signaling pathways in UCN, UCN2 and UCN3 regulation of PGE2 and PGF2α output. As shown in Fig. 5A and B, PTX treatment (0.1 μg/mL) reversed the stimulatory effect of UCN on PGE2 and PGF2α secretion. AC activator forskolin (10−5M) and PKA agonist 8-Br-cAMP (10−5M) also reversed the effects of UCN on PGE2 and PGF2α secretion. As UCN could also activate ERK1/2, p38 and p65 signaling pathway, we examined the effects of PDTC (10−5M), an inhibitor of NF-κB, PD98059 (10−5M), an inhibitor of ERK1/2, and SB202190 (10−5M), the p38 inhibitor, on UCN stimulation of PGE2 and PGF2α secretion. As shown in Fig. 5C and D, PDTC, PD98059 and SB202190 blocked the stimulatory effects of UCN on PGE2 and PGF2α secretion. Similar results were obtained in UCN3 regulation of PGE2 and PGF2α secretion. As shown in Fig. 6, PTX, forskolin and 8-Br-cAMP reversed the up-regulatory effects of UCN3 on PGE2 and PGF2α secretion. Blocking ERK1/2, p38 and NF-κB signaling by PD98056, SB202190 and PDTC prevented UCN3 stimulation of PGE2 and PGF2α secretion.
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs with CRHR1 knockdown were treated with UCN (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN3 regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN3 (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN3 regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN3 (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The roles of Gi/AC/cAMP, MAPK and NF-κB signaling pathways in UCN3 regulation of PGE2 and PGF2α secretion in HUSMCs. (A and B) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PTX, forskolin and 8-Br cAMP for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. (C and D) Cultured HUSMCs were treated with UCN3 (10−8M) in the absence or presence of PDTC, PD98056 and SB202190 for 24 h. The supernatants were collected for determination of PGE2 (C) and PGF2α (D) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, #P < 0.05, ##P < 0.01 vs UCN3 (10−8M). Fors: forskolin; 8-Br: 8-Br cAMP; PD: PD98056; SB: SB202190.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
Given that UCN2 can activate Gs/AC/cAMP signaling pathway, we examined the effects of blocking Gs, AC and PKA on UCN2 regulation of PGE2 and PGF2α output. Melittin could inhibit Gs protein activation in a certain range of concentration (Fukushima et al. 1998). In the presence of melittin (10−7M), UCN2 inhibition of PGE2 and PGF2α output did not occurr (Fig. 7). Further, AC inhibitor SQ22532 (10−5M) and PKA inhibitor H89 (10−5M) totally blocked the inhibitory effect of UCN2 on PGE2 and PGF2α secretion.
The effects of Gs, AC and cAMP blockers on UCN2 inhibition of PGE2 and PGF2α secretion in HUSMCs. Cultured HUSMCs were treated with UCN 2 (10−8M) in the absence or presence of melittin (10−5M), SQ22532 (10−5M) and H89 (10−5M) for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, ##P < 0.01 vs UCN2 (10−8M). Mel: melittin; SQ: SQ22532.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of Gs, AC and cAMP blockers on UCN2 inhibition of PGE2 and PGF2α secretion in HUSMCs. Cultured HUSMCs were treated with UCN 2 (10−8M) in the absence or presence of melittin (10−5M), SQ22532 (10−5M) and H89 (10−5M) for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, ##P < 0.01 vs UCN2 (10−8M). Mel: melittin; SQ: SQ22532.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
The effects of Gs, AC and cAMP blockers on UCN2 inhibition of PGE2 and PGF2α secretion in HUSMCs. Cultured HUSMCs were treated with UCN 2 (10−8M) in the absence or presence of melittin (10−5M), SQ22532 (10−5M) and H89 (10−5M) for 24 h. The supernatants were collected for determination of PGE2 (A) and PGF2α (B) by ELISA. Data were expressed as mean ± s.e.m. (n = 5 independent cultures). **P < 0.01 vs control, ##P < 0.01 vs UCN2 (10−8M). Mel: melittin; SQ: SQ22532.
Citation: Reproduction 162, 1; 10.1530/REP-20-0659
Discussion
Prior studies have demonstrated that both CRHR1 and CRHR2 are identified in human pregnant myometrium (Grammatopoulos 2007, Jin et al. 2007, Wetzka et al. 2003 ). CRHR1 expression increased with gestational progress while CRHR2 level remains relatively stable during pregnancy (Jin et al. 2007). CRHR1 activation induces multiple functions in the human myometrium. For instance, it modulates spontaneous contractions, calcium transient, and expression of nitric oxide synthase and the secretion of proinflammatory cytokines (Grammatopoulos 2007, Zhang et al. 2008, You et al. 2012, 2014). There are a few studies about the functional roles of CRHR2 in the human myometrium. It has been shown that UCN2 increases the output of proinflammatory cytokines and induces myosin light chain phosphorylation in cultured human myometrial cells (Karteris et al. 2004, Voltolini et al. 2015). Petraglia et al. (1999) reported that UCN potentiates PGF2α-induced contractility of human pregnant myometrium. We previously reported that CRHR2 activation by CRH modulates BKCa expression in human myometrial cells (Xu et al. 2011). In the present study, we found that UCN, UCN2 and UCN3 acted on CRHR2 to modulate PGE2 and PGF2α secretion. Altogether, it suggests that CRHR2 controls the various function of the uterus during pregnancy. Of note, Voltolini et al. (2015) reported that UCN2 treatment increases cyclooxygenase-2 (COX-2) mRNA expression in the PHM1-41 cells, which is inconsistent with our data. However, they did not determine PGs concentration in the cultures. Although the reason for this controversy is unknown, it might be attributed to different myometrial cells used (PHM1-41 vs primary HUSMCs). It should point out that the phenotypes are not fully identical between PHM1-41 and primary HUSMCs although PHM1-41 cells are originally derived from pregnant human myometrial cells.
Interestingly, as the exclusive CRHR2 ligands, UCN2 and UCN3 also exhibited opposite effects on PGE2 and PGF2α secretion in HUSMCs. Further, we demonstrated that UCN2 and UCN3 activated different signaling pathways in HUSMCs. UCN2 promotes CRHR2 coupling to Gs and subsequently activates AC/cAMP signaling whereas UCN3 induces CRHR2 coupling to Gi and subsequently suppresses AC/cAMP signaling. In addition, we also showed that, like UCN3, UCN displays stimulatory effects on PGE2 and PGF2α secretion through CRHR2. Consistently, UCN acts on CRHR2 to activate Gi/AC/cAMP signaling pathway. It is now known that the GPCRs can couple to multiple types of G proteins and, therefore, lead to multiple signaling pathways. Several studies have demonstrated that CRH can induce CRHR1 coupling to multiple G proteins including Gs, Gi and Gq (Grammatopoulos 2007, You et al. 2012, 2014, Makrigiannakis et al. 2018). It seems that CRH induces CRHR1 coupling to different G proteins in TNL and TL myometrium, thereby leading to differential effects before and after the onset of labor (You et al. 2012, 2014, Makrigiannakis et al. 2018). In the present studies, we found that UCN, UCN2 and UCN3 induce different G protein activation, which provides the evidence underlying the different effects of UCN, UCN2 and UCN3 on the output of PGs in the myometrium. In fact, Novembri et al. (2011ab) have shown that UCN2 and UCN3 regulate different cytokines secretion in the placenta and endometrium, which implies the differential actions of UCN2 and UCN3.
As mentioned, the human uterus undergoes dramatic changes in its functions during pregnancy (Smith 2007). At the term, the uterus is transformed from quiescence to contractile phenotypes, which is associated with the remarkable changes in the molecular network in the uterus. Prior studies have shown that UCN, UCN2 and UCN3 are identified in the myometrium (Voltolini et al. 2015, Vannuccini et al. 2016, Vitale et al. 2016). As CRHR2 is expressed in the myometrium, UCN, UCN2 and UCN3 could exert their function via paracrine and autocrine fashion. In consistent with the above studies, we found that UCN and UCN2 mRNA expression was increased in pregnant human myometrium after the onset of labor. In addition, we also found that UCN3 mRNA expression was increased in the myometrium after the onset of labor. However, the UCN and UCN3 protein levels were increased, while UCN2 protein level was not significantly changed in the myometrium before and after the onset of labor. Given that UCN and UCN3 promote the output of PGE2 and PGF2α, increased UCN and UCN3 levels in the myometrium can facilitate the contractile phenotype of the uterus after the onset of labor. Our findings that CRHR2 mediates the differential effects of UCN, UCN2 and UCN3 on PGs secretion might suggest that a fine regulatory network exists in the myometrium, which would facilitate the functional changes of uterus during pregnancy.
There are several limitations in the present study. For instance: (1) the differential effects of UCN, UCN2 and UCN3 on PGs secretion in myometrium were obtained in cultured HUSMCs, which requires to be verified in vivo using an intact animal model; (2) the effects of UCN2 on NF-κB, p38 and ERK1/2 signaling pathways also require to be further confirmed; (3) interpretation of melittin effects should be done cautiously because melittin is not the specific inhibitor of Gs protein. It has been reported that melittin has an impact on other factors such as Gi, G11 and phospholipase A2 (Fukushima et al. 1998, Guild 2001). However, it has been shown that melittin treatment could subsequently lead to suppression of AC activity via activation of Gi and G11 protein (Fukushima et al. 1998). Of note, we found that the blunt effects of melittin treatment on UCN2 inhibition of PGE2 and PGF2α secretion were consistent with the effects of AC and PKA inhibitors, which suggests that melittin treatment causes suppression of AC activity.
In conclusion, UCN, UCN2 and UCN3 can differentially regulate PGE2 and PGF2α secretion in primary pregnant HUSMCs via CRHR2. UCN2 activate Gs/AC/cAMP signaling pathway whereas UCN and UCN3 activates Gi protein and leads to decreased AC/cAMP signaling, thereby leading to discrepant effects of UCNs on PGs secretion. Our data suggest that UCN, UCN2 and UCN3 act on CRHR2 to finely regulate the secretion of PGs in the myometrium during pregnancy, which facilitates the functional status of the uterus during pregnancy.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-20-0659.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by Sate Key Research and Development Program of China (2018YFC1002802 and 2017YFC1001404), Natural Science Foundation of China (No. 81620108013, 31971892 and 31771667), Science and Technology Commission of Shanghai Municipals (1814090300) and Hunan Provincial Science and Technology Department (2018RS3030).
Author contribution statement
Xin Ni conceived and designed the study. Xingji You performed most of the experiments. Zixi Chen assisted cell culture. Hang Gu, Qianqian Sun and Ruojin Yao collected human samples.
References
Deussing JM & Chen A 2018 The corticotropin-releasing factor family: physiology of the stress response. Physiological Reviews 98 2225–2286. (https://doi.org/10.1152/physrev.00042.2017)
Fukushima N, Kohno M, Kato T, Kawamoto S, Okuda K, Misu Y & Ueda H 1998 Melittin, a metabostatic peptide inhibiting Gs activity. Peptides 19 811–81 9. (https://doi.org/10.1016/s0196-9781(9800027-8)
Gao L, He P, Sha J, Liu C, Dai L, Hui N & Ni X 2007 Corticotropin-releasing hormone receptor type 1 and type 2 mediate differential effects on 15-hydroxy prostaglandin dehydrogenase expression in cultured human chorion trophoblasts. Endocrinology 148 3645–36 54 (https://doi.org/10.1210/en.2006-1212)
Gao L, Lu C, Xu C, Tao Y, Cong B & Ni X 2008 Differential regulation of prostaglandin production mediated by corticotropin-releasing hormone receptor type 1 and type 2 in cultured human placental trophoblasts. Endocrinology 149 2866–28 76. (https://doi.org/10.1210/en.2007-1377)
Grammatopoulos DK 2007 The role of CRH receptors and their agonists in myometrial contractility and quiescence during pregnancy and labour. Frontiers in Bioscience 12 561–5 71. (https://doi.org/10.2741/2082)
Grammatopoulos DK, Randeva HS, Levine MA, Katsanou ES & Hillhouse EW 2000 Urocortin, but not corticotropin-releasing hormone (CRH), activates the mitogen-activated protein kinase signal transduction pathway in human pregnant myometrium: an effect mediated via R1alpha and R2beta CRH receptor subtypes and stimulation of Gq-proteins. Molecular Endocrinology 14 2076–20 91. (https://doi.org/10.1210/mend.14.12.0574)
Guild SB 2001 Effects of phospholipase A(2) activating peptides upon GTP-binding protein-evoked adrenocorticotrophin secretion. European Journal of Pharmacology 424 163–1 71. (https://doi.org/10.1016/s0014-2999(0101149-9)
Imperatore A, Li W, Petraglia F & Challis JR 2009 Urocortin 2 stimulates estradiol secretion from cultured human placental cells: an effect mediated by the type 2 corticotrophin-releasing hormone (CRH) receptor. Reproductive Sciences 16 551–55 8. (https://doi.org/10.1177/1933719109332830)
Jin D, He P, You X, Zhu X, Dai L, He Q, Liu C, Hui N, Sha J & Ni X 2007 Expression of corticotropin-releasing hormone receptor type 1 and type 2 in human pregnant myometrium. Reproductive Sciences 14 568–5 77. (https://doi.org/10.1177/1933719107307821)
Karteris E, Grammatopoulos DK, Randeva HS & Hillhouse EW 2001 The role of corticotropin-releasing hormone receptors in placenta and fetal membranes during human pregnancy. Molecular Genetics and Metabolism 72 287–2 96. (https://doi.org/10.1006/mgme.2001.3159)
Karteris E, Hillhouse EW & Grammatopoulos D 2004 Urocortin II is expressed in human pregnant myometrial cells and regulates myosin light chain phosphorylation: potential role of the type-2 corticotropin-releasing hormone receptor in the control of myometrial contractility. Endocrinology 145 890–900. (https://doi.org/10.1210/en.2003-1210)
Makrigiannakis A, Vrekoussis T, Zoumakis E, Navrozoglou I & Kalantaridou SN 2018 CRH receptors in human reproduction. Current Molecular Pharmacology 11 81–87. (https://doi.org/10.2174/1874467210666170224094146)
McLean M & Smith R 2001 Corticotrophin-releasing hormone and human parturition. Reproduction 121 493–501. (https://doi.org/10.1530/rep.0.1210493)
Novembri R, Carrarelli P, Toti P, Rocha AL, Borges LE, Reis FM, Piomboni P, Florio P & Petraglia F 2011a Urocortin 2 and urocortin 3 in endometriosis: evidence for a possible role in inflammatory response. Molecular Human Reproduction 17 587–5 93. (https://doi.org/10.1093/molehr/gar020)
Novembri R, Torricelli M, Bloise E, Conti N, Galeazzi LR, Severi FM & Petraglia F 2011b Effects of urocortin 2 and urocortin 3 on IL-10 and TNF-alpha expression and secretion from human trophoblast explants. Placenta 32 969–9 74. (https://doi.org/10.1016/j.placenta.2011.09.013)
Petraglia F, Florio P, Benedetto C, Marozio L, Di Blasio AM, Ticconi C, Piccione E, Luisi S, Genazzani AR & Vale W 1999 Urocortin stimulates placental adrenocorticotropin and prostaglandin release and myometrial contractility in vitro. Journal of Clinical Endocrinology and Metabolism 84 1420–142 3. (https://doi.org/10.1210/jcem.84.4.5585)
Petraglia F, Imperatore A & Challis JR 2010 Neuroendocrine mechanisms in pregnancy and parturition. Endocrine Reviews 31 783–816. (https://doi.org/10.1210/er.2009-0019)
Smith R 2007 Parturition. New England Journal of Medicine 356 271–283. (https://doi.org/10.1056/NEJMra061360)
Vannuccini S, Bocchi C, Severi FM, Challis JR & Petraglia F 2016 Endocrinology of human parturition. Annales d’Endocrinologie 77 105–1 1 3. (https://doi.org/10.1016/j.ando.2016.04.025)
Vitale SG, Laganà AS, Rapisarda AM, Scarale MG, Corrado F, Cignini P, Butticè S & Rossetti D 2016 Role of urocortin in pregnancy: an update and future perspectives. World Journal of Clinical Cases 4 165–1 71. (https://doi.org/10.12998/wjcc.v4.i7.165)
Voltolini C, Battersby S, Novembri R, Torricelli M, Severi FM, Petraglia F & Norman JE 2015 Urocortin 2 role in placental and myometrial inflammatory mechanisms at parturition. Endocrinology 156 670–67 9. (https://doi.org/10.1210/en.2014-1432)
Wang W, Qiao Y & Li Z 2018 New insights into modes of GPCR activation. Trends in Pharmacological Sciences 39 367–386. (https://doi.org/10.1016/j.tips.2018.01.001)
Wang X, Yuan L, Huang J, Zhang TL & Wang K 2008 Lanthanum enhances in vitro osteoblast differentiation via pertussis toxin-sensitive Gi protein and ERK signaling pathway. Journal of Cellular Biochemistry 105 1307–1 31 5. (https://doi.org/10.1002/jcb.21932)
Wetzka B, Sehringer B, Schäfer WR, Biller S, Hör C, Benedek E, Deppert WR & Zahradnik HP 2003 Expression patterns of CRH, CRH receptors, and CRH binding protein in human gestational tissue at term. Experimental and Clinical Endocrinology and Diabetes 111 154–1 61. (https://doi.org/10.1055/s-2003-39778)
Xu C, Gao L, You X, Dai L, Li Y, Gu H, Slater DM, Olson DM & Ni X 2011 CRH acts on CRH-R1 and -R2 to differentially modulate the expression of large-conductance calcium-activated potassium channels in human pregnant myometrium. Endocrinology 152 4406–44 17. (https://doi.org/10.1210/en.2011-0262)
Xu C, You X, Liu W, Sun Q, Ding X, Huang Y & Ni X 2015 Prostaglandin F2α regulates the expression of uterine activation proteins via multiple signalling pathways. Reproduction 149 139–1 46. (https://doi.org/10.1530/REP-14-0479)
You X, Gao L, Liu J, Xu C, Liu C, Li Y, Hui N, Gu H & Ni X 2012 CRH activation of different signaling pathways results in differential calcium signaling in human pregnant myometrium before and during labor. Journal of Clinical Endocrinology and Metabolism 97 E1851–E18 61. (https://doi.org/10.1210/jc.2011-3383)
You X, Liu J, Xu C, Liu W, Zhu X, Li Y, Sun Q, Gu H & Ni X 2014 Corticotropin-releasing hormone (CRH) promotes inflammation in human pregnant myometrium: the evidence of CRH initiating parturition? Journal of Clinical Endocrinology and Metabolism 99 E199–E 208. (https://doi.org/10.1210/jc.2013-3366)
Zhang LM, Wang YK, Hui N, Sha JY, Chen X, Guan R, Dai L, Gao L, Yuan WJ & Ni X 2008 Corticotropin-releasing hormone acts on CRH-R1 to inhibit the spontaneous contractility of non-labouring human myometrium at term. Life Sciences 83 620–624. (https://doi.org/10.1016/j.lfs.2008.08.014)
