Abstract
A successful pregnancy requires sufficient decidualization of endometrial stromal cells (ESCs). CD82, a metastasis suppressor, is a critical regulator for trophoblast invasion but the effect in decidualization was largely unknown. Here we reported that there was a high level of CD82 in DSC by the immunohistochemistry staining and flow cytometer analysis. Stimulation with prostaglandin E2 (PGE2) elevated the expression of CD82 in ESCs. In contrast, celecoxib, a selective COX-2 inhibitor, significantly downregulated the expression of CD82 in decidual stromal cells (DSCs). Bioinformatics analysis and further research showed that recombinant human interleukin (IL)-1β protein (rhIL-1β) upregulated CD82 in ESCs. Of note, blocking IL-1β signaling with anti-human IL-1β neutralizing antibody could reverse the stimulatory effect of PGE2 on CD82 in ESCs. Silencing CD82 resulted in the decease of the decidualization markers PRL and IGFBP1 mRNA levels in DSCs. More importantly, we observed rhIL-1β also upregulated the expression of COX-2, and the upregulation of PRL and IGFBP1 induced by rhIL-1β could be abolished by celecoxib in ESCs or CD82 deficiency in DSCs. This study suggests that CD82 should be a novel promotor for decidualization under a positive regulation of the COX-2/PGE2/IL-1β positive feedback loop.
Introduction
A successful pregnancy relies first and foremost on the adequate decidualization of endometrial stromal cells (ESC) to guarantee effective implantation (Kelleher et al. 2018). Decidualization of the human endometrium is mainly driven by the postovulatory rise in progesterone levels and local increase of cyclic AMP rather than blastocyst implantation (Gellersen & Brosens 2014). In response to ovarian steroid hormones, the ESCs proliferate and differentiate into decidual stromal cells (DSCs) starting from the late secretory phase of the menstrual cycle. Once the embryo reaches the uterine cavity, decidualization subsequently spreads from the implantation site to the whole uterine lining, forming the pregnancy decidua (Cha et al. 2012). It not only provides important secretory factors to nourish the developing embryo but also accommodates an immune tolerance environment for the allograft embryo (Su et al. 2015). However, defective decidualization is not conducive to conception and ongoing pregnancy, leading to infertility (Piltonen et al. 2015), preeclampsia (Garrido-Gomez et al. 2017) as well as an increased risk of miscarriage (Gellersen & Brosens 2014).
The invasion of uterine decidua and maternal vasculature by trophoblast cells is another critical pregnancy event following decidualization, facilitating the adequate transfer of nutrients and oxygen to the growing fetus (Brosens et al. 2019). Deficient endovascular trophoblast invasion is associated with miscarriage, pre-eclampsia, and fetal intrauterine growth restriction (FGR) (Kaufmann et al. 2003, Fitzgerald et al. 2008, Mo et al. 2020, Qin et al. 2020). While the excessive invasion of trophoblastic cells is related to placenta accreta spectrum disorders (PAS) (Long et al. 2020) and gestational trophoblastic disease, such as hydatidiform moles and choriocarcinoma (Mak et al. 2015). Though trophoblast shares some features with tumor cells in terms of invasion and metastasis, there is rare unlimited progression and metastasis of trophoblast cells in a healthy pregnancy (Silva & Serakides 2016).
A successful decidualization requires a variety of hormones, growth factors, and cytokines, including estrogen and progesterone, trophoblast, and immune cells like decidua NK cells (Kaya Okur et al. 2016, Ochoa-Bernal & Fazleabas 2020). However, the precise mechanism of decidualization is still unclear. Prostaglandin E2 (PGE2), a potent activator of intercellular cAMP, is involved in the process of implantation and decidualization (Frank et al. 1994, Kang et al. 2006). Prostaglandin-endoperoxide synthase 2 (PTGS2), also known as cyclooxygenase 2 (COX-2), is the major rate-limiting enzyme for the synthesis of PGE2. It was demonstrated that the production of COX2 and COX-2 derived PGE2 is increased during decidualization (Ishihara et al. 1995). Moreover, COX2-deficient mice showed multiple reproductive failures in female processes including ovulation, fertilization, implantation, and decidualization (Lim et al. 1997). As a significant decidualizing stimuli, PGE2 is also capable of decidualizing human endometrial stromal cells in vitro apart from 8-Bromo-cAMP (cAMP) and progesterone (Erkenbrack et al. 2018).
CD82 (kangai1, KAI1), as a metastasis suppressor gene, is a member of tetraspanin proteins which contains four putative transmembrane domains. Previous studies showed CD82 was not expressed in trophoblast cells but highly expressed in decidual stromal cells (DSCs) (Gellersen et al. 2007). It acts as a key regulator in limiting the inappropriate invasion of trophoblasts during decidualization (Li et al. 2010, Gellersen et al. 2013) and inhibiting tumor cell migration and metastasis (Liu et al. 2021, Ma et al. 2021). Additionally, CD82 is involved in the regulation of infiltration and adhesion of decidual NK cells during early pregnancy (Lu et al. 2020). However, little is known about the specific mechanism of the upregulation of CD82 in decidua and its effect on decidualization.
Therefore, the present study was undertaken to investigate the potential mechanism of the expression of CD82 in decidua and their regulatory roles in decidualization. Our current results indicate that the upregulation of CD82 caused by a positive loop of COX-2/PGE2/IL-1β promotes decidualization via upregulating IL-1β in vitro.
Materials and methods
Tissue collection and ethical approval
The use of human samples was approved by the Ethical Committee of the Obstetrics and Gynecology Hospital, Fudan University. Every patient signed the written informed consent. Samples of decidua (n = 40) were obtained from normal women in the first trimester of pregnancy for selective termination (age, 18–35 years old; gestational age, 7–9 weeks). Endometrial tissues (n = 40) were collected from women with normal pregnancy history of reproductive ages (28–40 years old), who were diagnostic curettage or undergoing hysterectomy for benign reasons unrelated to endometrial dysfunction. All samples were evaluated by a histopathologist to identify the cyclic phase as the secretory phase and exclude endometrial pathology. No women had received hormonal medication at least 3 months prior to the surgical procedure.
Cell isolation
All decidual tissues were washed in Ca2+ Mg2+-free PBS (HyClone, Logan, UT, USA). Then sliced into 1 mm3 pieces and digested with 5% DNAse (3000IU; Sigma–Aldrich) and collagenase type IV (0.1%; Sigma–Aldrich) for 30 min at 37°C with constant agitation. The digested suspension was filtered through 100, 200, and 400 mesh sterile stainless-steel mesh in turn. After centrifugation (18 g, 8 min, 4°C), the supernatant was discarded, and the sediment was resuspended in PBS (HyClone). The cell suspension was carefully layered over a discontinuous Percoll gradient and subsequently centrifuged at 30 g for 30 min. Percoll bulk standard consists of 90% Percoll (Amersham, GE Healthcare Life Sciences) and 10% ten × PBS (HyClone). Collected cells from the 20%/40% interface were mainly DSCs. After been washed with PBS solution, these cells were cultured with 10% fetal bovine serum (FBS; Gibco) in DMEM/F12 medium (HyClone) for 80 min. Finally, the adherent DSCs were recovered free of leukocytes. Immunocytochemistry showed 98% vimentin-positive and cytokeratin-negative DSCs (Li et al. 2010).
The obtained endometrial tissues were pooled and digested by collagenase type IV (0.1%; Sigma) for 30 min at 37°C with constant agitation for recovering ESCs. The cell suspension was filtered through 70 μm cell strainer (Falcon BD Biosciences, Belgium), and the filtered suspension was centrifuged at 18 g for 8 min. The cells were resuspended and were filtered through a 40 μm cell strainer (Falcon BD Biosciences, Belgium), allowing single stromal cells to pass through, while glandular tubules were restrained. The filtrated suspension was layered over Ficoll to further remove leukocytes and erythrocytes. After centrifugation (24 g, 20 min), the middle layer was absorbed and washed with D-Hanks solution. The collected ESCs were able to grow adhere to flasks in DMEM/F12 medium supplemented with 10% FBS and 1% streptomycin–penicillin in a humidified incubator with 5% CO2 at 37°C. This method supplied 96% vimentin-positive and cytokeratin-negative ESCs (Liu et al. 2018).
Culture condition
DSCs and ESCs, 105/well, were seeded in six-well Costar plates (Sigma–Aldrich) and cultured in DMEM/F12 medium supplemented with 10% FBS and 1% penicillin–streptomycin. To monitor decidualization in vitro, media in ESCs was changed to DMEM/F12 without phenol red (Thermo Fischer Scientific), supplemented with 2% charcoal-stripped fetal bovine serum (Sigma–Aldrich) and 1% penicillin–streptomycin. Then, we treated the cells with 10−9 M 17β-estradiol (E2), 10−6 M medroxyprogesterone acetate (MPA, P4), 10−6 M PGE2 and/or 10−3 M cAMP (Sigma–Aldrich) for 6 days, respectively.
Flow cytometry (FCM)
The expression of CD82 on ESCs and DSCs was analyzed by flow cytometry. Following washing cells with PBS, cell surface staining was performed with the appropriate fluorochrome-conjugated antibodies at room temperature for 30 min in the dark (5 µL/sample separately). The following human monoclonal antibodies (mAbs) were used: phycoerythrin (PE)-conjugated anti-human CD82 (342104; Biolegend) mAbs.
For intracellular staining, cells were fixed and permeabilized using BD Cytofix/CytopermTM Fixation/Permeabilization Kit (BD Biosciences) following the manufacturer’s protocol. Then, cells were incubated at room temperature for 45 min in the dark (5 μL/sample separately). The following human mAbs were used: Alexa Fluor® 647 anti-human IL-1β (508208; Biolegend), PE-conjugated anti-human COX-2 (13314; Cell Signaling Technology), and FITC-conjugated anti-vimentin antibody (ab128507; Abcam) mAbs. Subsequently, the samples were washed in PBS and analyzed immediately by a Beckman CytoFLEXS flow cytometer (Beckman Coulter, Inc.) using Becton CytExpert software. The experiments were performed in triplicate.
Immunohistochemistry (IHC)
The decidual and endometrial tissues were fixed and embedded in paraffin and sectioned at a thickness of 5 μm. To block endogenous peroxidase and nonspecific binding of antibodies, they were treated with 3% hydrogen peroxide and incubated with 1% BSA at room temperature for 60 min. Subsequently, the sections were incubated overnight at 4°C with mouse anti-human CD82 mAB (1:100; Abcam) or mouse IgG isotype antibody. After washing with Tris-buffered saline (TBS) three times, the sections were incubated with biotin-labeled secondary antibody at 37°C for 30 min. 3,3-Diaminobiphenylamine (DAB) was then added, followed by counterstaining with hematoxylin. Olympus BX51 fluorescence microscope was applied to obtain images of the stained sections.
Rt-pcr
The gene expression level of PTGS2, PRL, and IGFBP1 in the ESCs/DSCs was verified by RT-PCR according to the standard protocols (RR036A and RR820A; Takara). The fold change in gene expression was calculated using the change in cycle threshold value method (ΔΔCt). All values obtained were normalized to the values obtained for β-actin (ACTB). The PCR efficiency with all amplicons was 90–100%, and all determinations were repeated a minimum of three times. Gene-specific primers are listed in Table 1.
Sequences of the primers used in this study.
| Gene | Primer sequences 5’–3’ | |
|---|---|---|
| Forward | Reverse | |
| PTGS2 | GCCCAGCACTTCACGCATCAG | TCATCAGACCAGGCACCAGACC |
| IGFBP1 | TGCTGCAGAGGCAGGGAGCCC | AAGGATCCTCTTCCCATTCCA |
| PRL | GAGACACCAAGAAGAATCGGAACATACAGG | TCGGGGGTGGCAAGGGAAGAA |
| CD82 | AGAAGTGGGCCCTGTGACC | TTGCCCATGTTGAAGTAGAAGAG |
| ACTB | GCCGACAGGATGCAGAAGGAGATCA | AAGCATTTGCGGTGGACGATGGA |
CD82 silence in DSCs
For siRNA transfection, the primary cultures of DSCs were seeded in 96-well plates. When cells had reached confluency, the medium was changed to OPTIMEM (Invitrogen). The siRNA oligonucleotides targeting CD82 (set of three oligonucleotides; Stealth Select RNAi; Invitrogen) and Lipofectamine 3000 (Invitrogen) were mixed in OPTIMEM and then added to the cells at room temperature, with nontargeting siRNA oligonucleotides as negative control according to previous procedure (Li et al. 2010).
Western blot analysis
Proteins were extracted and resolved by 10% SDS-PAGE and transferred to immobilon PVDF membranes. After being soaked in blocking buffer for 2 h, the membrane was incubated with rabbit anti-human CD82 polyclonal antibody (ab66400, Abcam) at a dilution of 1/1000 overnight at 4°C. Anti-GAPDH was used as an internal standard at a 1/2000 dilution, and then incubated with horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:3000; room temperature for 45 min). Signal was detected by a chemiluminescent detection system (Immobilon Western HRP substrate; Merck Millipore) and visualized with a Bio-Rad Gel Doc System. The experiments were repeated three times.
Enzyme linked immunosorbent assay (ELISA)
After stimulation with PGE2 (10−6 M) for 12, 24, or 48 h, the supernatant of ESCs was collected to analyze the secretion level of IL-1β ELISA (R&D Systems) according to the manufacturer’s instructions. Additionally, the concentration of IL-1β of ESCs, DSCs, and DSCs treated with or without celecoxib (10−5 M) was analyzed by ELISA.
Statistical analysis
The data analysis was conducted by SPSS version 25.0 (IBM). All values are presented as mean ± s.e.m. Normality of the data was tested with the Shapiro–Wilk test. Mean values of two normally distributed variables were compared by the Student’s t-test. One-way ANOVA was used to compare the means among three or more groups, followed by Fisher’s post hoc test for multiple comparisons. A P value of < 0.05 was considered to be statistically significant.
Results
CD82 is highly expressed in DSCs
To evaluate the expression of CD82 in the secretory endometrium from control women and decidual from women with normal pregnancy, the IHC staining was performed. Compared with normal secretory endometrium, CD82 was significantly increased in decidua (Fig. 1A). Meanwhile, primary ESCs isolated from the secretory endometrium and DSCs isolated from early pregnancy decidua were identified via flow cytometry (vimentin-positive cells). Consistently, CD82 protein expression in DSCs was significantly higher than that of the ESCs (P < 0.01) (Fig. 2B and C). These data suggest that there is a positive correlation between the CD82 level and the progress of decidualization in vivo.
The expression of CD82 in ESCs and DSCs. (A) The expression of CD82 in the secretory endometrium (n = 6) and decidua (n = 6) by immunohistochemistry. (B and C) Flow cytometry analysis of CD82 expression in human endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). The data are shown as mean ± s.e.m. ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
The expression of CD82 in ESCs and DSCs. (A) The expression of CD82 in the secretory endometrium (n = 6) and decidua (n = 6) by immunohistochemistry. (B and C) Flow cytometry analysis of CD82 expression in human endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). The data are shown as mean ± s.e.m. ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
The expression of CD82 in ESCs and DSCs. (A) The expression of CD82 in the secretory endometrium (n = 6) and decidua (n = 6) by immunohistochemistry. (B and C) Flow cytometry analysis of CD82 expression in human endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). The data are shown as mean ± s.e.m. ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 upregulates the expression of CD82 in ESCs in vitro. (A) Morphology of 17β-estradiol (E2, 10−9 M), medroxyprogesterone acetate (MPA, P4, 10−6 M), E2 plus P4, PGE2 (10−6 M) and 8-bromo-cAMP-(cAMP, 10−3 M)-treated human ESCs (n = 6). (B) The expression of CD82 in ESCs (n = 6) was analyzed by flow cytometry after treatment with E2, P4, E2 plus P4, PGE2 or cAMP for 6 days. (C) The expression of PTGS2 in ESCs (n = 6) and DSCs (n = 6) was detected by RT-PCR. (D) CD82 level in DSCs (n = 6) was detected by flow cytometry assay in control and celecoxib (3 × 10−5 M)-treated group. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 upregulates the expression of CD82 in ESCs in vitro. (A) Morphology of 17β-estradiol (E2, 10−9 M), medroxyprogesterone acetate (MPA, P4, 10−6 M), E2 plus P4, PGE2 (10−6 M) and 8-bromo-cAMP-(cAMP, 10−3 M)-treated human ESCs (n = 6). (B) The expression of CD82 in ESCs (n = 6) was analyzed by flow cytometry after treatment with E2, P4, E2 plus P4, PGE2 or cAMP for 6 days. (C) The expression of PTGS2 in ESCs (n = 6) and DSCs (n = 6) was detected by RT-PCR. (D) CD82 level in DSCs (n = 6) was detected by flow cytometry assay in control and celecoxib (3 × 10−5 M)-treated group. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 upregulates the expression of CD82 in ESCs in vitro. (A) Morphology of 17β-estradiol (E2, 10−9 M), medroxyprogesterone acetate (MPA, P4, 10−6 M), E2 plus P4, PGE2 (10−6 M) and 8-bromo-cAMP-(cAMP, 10−3 M)-treated human ESCs (n = 6). (B) The expression of CD82 in ESCs (n = 6) was analyzed by flow cytometry after treatment with E2, P4, E2 plus P4, PGE2 or cAMP for 6 days. (C) The expression of PTGS2 in ESCs (n = 6) and DSCs (n = 6) was detected by RT-PCR. (D) CD82 level in DSCs (n = 6) was detected by flow cytometry assay in control and celecoxib (3 × 10−5 M)-treated group. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 induces decidualization by upregulating the expression of CD82 in vitro
To investigate the possible roles of decidualization inducers (E2, P4, PGE2, and cAMP) on CD82 expression, we treated human primary ESCs with E2, P4, or their combination, as well as PGE2 and cAMP for 6 days. As depicted in Fig. 2A, ESCs exhibited a spindle-shaped fibroblast-like appearance when propagated in culture but acquired the typical morphology of decidual cells, that is, an enlarged cell size with larger nuclei and abundant cytoplasm, upon treatment with E2 plus P4, PGE2, or cAMP for 6 days. In all decidualization systems, only those ESCs stimulated by PGE2 and cAMP showed significantly increased CD82 expression (Fig. 2B). Given the most significant effect was promoted by PGE2, and COX-2 is essential for the production of PGE2, therefore, we compared the PTGS2 mRNA expression levels in ESCs and DSCs. We found DSCs had significantly higher expression of PTGS2 than ESCs (Fig. 2C). Interestingly, treatment with celecoxib (a specific inhibitor of COX-2) significantly reduced CD82 expression in primary cultured DSCs (Fig. 2D). The above results indicate that there is a significant increase in levels of CD82 during decidualization in vitro. Additionally, COX-2-derived PGE2 can modulate the expression of CD82 in the endometrium during decidualization in vitro.
COX-2 increases CD82 expression of ESCs during decidualization via upregulating IL-1β
To investigate how COX-2 influences the expression level of CD82 in ESCs/DSCs, we performed prediction-related networks of differential genes and bioinformatics analysis by STRING (available online: http://string-db.org). According to the predicted network among the PTGS2 and CD82, IL-1β was predicted as an important regulatory molecule (Fig. 3A). IL-1β, as a blastocyst-derived signal that triggers the decidual response, has been reported to induce the production of CD82 in ESCs (Gonzalez et al. 2011). To determine whether CD82 proteins were modulated by IL-1β in the endometrium during decidualization, we cultured ESCs with or without recombined human IL-1β (rhIL-1β). As shown in Fig. 3B, rhIL-1β significantly increased the expression of the CD82 in ESCs after treatment for 48 h. To elucidate the relationship between IL-1β and COX2-derived PGE2, we first stimulated ESCs with PGE2 for 12, 24, and 48 h. The results revealed that decidualized stromal cells induced by PGE2 for 24 h or 48 h significantly increased the secretion of IL-1β, suggesting PGE2 has a positive effect on the production of IL-1β (Fig. 3C). Then using celecoxib to inhibit the synthesis of COX2 and COX2-derived PGE2 in DSCs. Data showed that the IL-1β expression was obviously downregulated by celecoxib compared with controls (Fig. 3D). In addition, we found an ~7-fold increase in the IL-1β proteins of primary DSCs compared with ESCs (Fig. 3E). Of note, blocking IL-1β signaling with anti-human IL-1β neutralizing antibody (α-IL-1β) led to a markedly decrease of CD82 expression in DSCs, and abolished the stimulatory effect of PGE2 on CD82 expression in DSCs (Fig. 3F). Our results have demonstrated IL-1β mediated PGE2-induced CD82 upregulation in decidualizing, thereby participated in promoting decidualization.
COX-2/PGE2 upregulates CD82 expression in ESCs by upregulating IL-1β. (A) The predicted networks obtained from the String database (https://string-db.org) were shown. (B) FCM analysis of CD82 positive cells in control and recombinant human IL-1β protein (rhIL-1β, 1 ng/mL)-stimulated ESCs (n = 6). (C) The secretion levels of IL-1β in ESCs (n = 6) treated with PGE2 for 12, 24, and 48 h were analyzed by ELISA. (D) The secretion of IL-1β in DSCs (n = 6) was detected by ELISA after treatment with or without celecoxib (10−5 M). (E) The secretion level of IL-1β in ESC and DSCs (n = 6) was detected by ELISA. (F) FCM analysis of CD82+ DSCs (n = 6) after treatment with control, PGE2, anti-human IL-1β neutralizing antibody (α-IL-1β), or PGE2 plus α-IL-1β. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
COX-2/PGE2 upregulates CD82 expression in ESCs by upregulating IL-1β. (A) The predicted networks obtained from the String database (https://string-db.org) were shown. (B) FCM analysis of CD82 positive cells in control and recombinant human IL-1β protein (rhIL-1β, 1 ng/mL)-stimulated ESCs (n = 6). (C) The secretion levels of IL-1β in ESCs (n = 6) treated with PGE2 for 12, 24, and 48 h were analyzed by ELISA. (D) The secretion of IL-1β in DSCs (n = 6) was detected by ELISA after treatment with or without celecoxib (10−5 M). (E) The secretion level of IL-1β in ESC and DSCs (n = 6) was detected by ELISA. (F) FCM analysis of CD82+ DSCs (n = 6) after treatment with control, PGE2, anti-human IL-1β neutralizing antibody (α-IL-1β), or PGE2 plus α-IL-1β. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
COX-2/PGE2 upregulates CD82 expression in ESCs by upregulating IL-1β. (A) The predicted networks obtained from the String database (https://string-db.org) were shown. (B) FCM analysis of CD82 positive cells in control and recombinant human IL-1β protein (rhIL-1β, 1 ng/mL)-stimulated ESCs (n = 6). (C) The secretion levels of IL-1β in ESCs (n = 6) treated with PGE2 for 12, 24, and 48 h were analyzed by ELISA. (D) The secretion of IL-1β in DSCs (n = 6) was detected by ELISA after treatment with or without celecoxib (10−5 M). (E) The secretion level of IL-1β in ESC and DSCs (n = 6) was detected by ELISA. (F) FCM analysis of CD82+ DSCs (n = 6) after treatment with control, PGE2, anti-human IL-1β neutralizing antibody (α-IL-1β), or PGE2 plus α-IL-1β. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
A positive COX-2/IL-1β loop promotes the decidualization by upregulation of CD82 in vitro
PRL and IGFBP1, as two recognized decidual markers, are widely used to evaluate the differentiation status of hESCs (human endometrial stromal cells) cell line in culture (Richards et al. 1995). To further probe into the effect of CD82 on decidualization in vitro, we constructed CD82-silenced DSCs (si-CD82) by transfection (Fig. 4A). It was observed that si-CD82 obviously decreased the secretion of IGFBP1 and PRL in DSCs. Furthermore, PGE2 significantly enhanced the expression of IGFBP1 and PRL in DSCs; however, these effects could be reversed by si-CD82 (Fig. 4B). These results indicate that PGE2-induced decidualization should be dependent on CD82.
PGE2 promotes decidualization via upregulating CD82. (A) The expression of CD82 in the negative control (NC) and CD82-silenced (si-CD82) DSCs (n = 6) was analyzed by Western blotting. (B) After treatment with or without PGE2, the expression of IGFBP1 and PRL in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The data represent the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 promotes decidualization via upregulating CD82. (A) The expression of CD82 in the negative control (NC) and CD82-silenced (si-CD82) DSCs (n = 6) was analyzed by Western blotting. (B) After treatment with or without PGE2, the expression of IGFBP1 and PRL in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The data represent the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
PGE2 promotes decidualization via upregulating CD82. (A) The expression of CD82 in the negative control (NC) and CD82-silenced (si-CD82) DSCs (n = 6) was analyzed by Western blotting. (B) After treatment with or without PGE2, the expression of IGFBP1 and PRL in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The data represent the mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
It has been shown that IL-1β stimulates COX-2-dependent PGE2 synthesis (Neeb et al. 2011, Wang et al. 2019). We wondered whether the IL-1β signaling was involved in the regulation of COX-2/PGE2 signaling in decidualization. Interestingly, we observed the expression of COX2 in ESCs was significantly promoted by rhIL-1β stimulation (Fig. 5A). To investigate the modulation of IL-1β on decidualization, ESCs were divided into four groups and were immediately incubated with E2 plus P4. After 48 h, these cells were also treated with vehicle, celecoxib, rhIL-1β, or their combination. Then, qRT-PCR and ELISA analysis of PRL and IGFBP1 expression were performed after 6-day culture (Fig. 5B). The results showed that rhIL-1β significantly enhanced PRL and IGFBP1 expressions in hESCs. Inhibition of COX-2 signaling with celecoxib significantly decreased the expressions of PRL and IGFBP1, and this decrease could be partly reversed by rhIL-1β (Fig. 5C). More importantly, we also explored the effect of CD82 depletion on decidualization. As shown, si-CD82 markedly reduced PRL and IGFBP1 expressions in DSCs and this reduction could be partly reversed by rhIL-1β (Fig. 5D). These findings indicated that a positive COX-2/IL-1β loop is able to accelerate decidualization via upregulation of CD82.
A positive COX-2/IL-1β loop promotes the decidualization by upregulation of CD82 in vitro. (A) The expression of COX-2 (mean fluorescence intensity, MFI) in control ESCs and ESCs supplemented with IL-1β (n = 6) was analyzed by flow cytometry and representative flow cytometry histograms were shown. (B and C) ESCs (n = 6) were incubated with E2 plus P4. After 48 h, these cells were further treated with vehicle, celecoxib, rhIL-1β, or their combination. Then RT-PCR was performed to analyze the expression of PRL and IGFBP1 after 6-day culture. (D) After treatment with or without rhIL-1β, the expression of PRL and IGFBP1 in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The results show normalized mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
A positive COX-2/IL-1β loop promotes the decidualization by upregulation of CD82 in vitro. (A) The expression of COX-2 (mean fluorescence intensity, MFI) in control ESCs and ESCs supplemented with IL-1β (n = 6) was analyzed by flow cytometry and representative flow cytometry histograms were shown. (B and C) ESCs (n = 6) were incubated with E2 plus P4. After 48 h, these cells were further treated with vehicle, celecoxib, rhIL-1β, or their combination. Then RT-PCR was performed to analyze the expression of PRL and IGFBP1 after 6-day culture. (D) After treatment with or without rhIL-1β, the expression of PRL and IGFBP1 in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The results show normalized mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
A positive COX-2/IL-1β loop promotes the decidualization by upregulation of CD82 in vitro. (A) The expression of COX-2 (mean fluorescence intensity, MFI) in control ESCs and ESCs supplemented with IL-1β (n = 6) was analyzed by flow cytometry and representative flow cytometry histograms were shown. (B and C) ESCs (n = 6) were incubated with E2 plus P4. After 48 h, these cells were further treated with vehicle, celecoxib, rhIL-1β, or their combination. Then RT-PCR was performed to analyze the expression of PRL and IGFBP1 after 6-day culture. (D) After treatment with or without rhIL-1β, the expression of PRL and IGFBP1 in NC and si-CD82 DSCs (n = 6) was analyzed by RT-PCR. The results show normalized mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significance.
Citation: Reproduction 162, 3; 10.1530/REP-21-0204
Discussion
Decidualization is initiated in the mid-secretory phase of the menstrual cycle to accommodate implantation of the blastocyst and establishment of placentation. Under the influence of ovarian progesterone, ESCs transform to more rounded enlarged secretory cells, namely DSCs. Dysregulation of genes induced in this process is associated with reduced fertility and adverse pregnancy outcomes (Salamonsen et al. 2016). Conceivably, there are crucial decidual-trophoblast interactions to guarantee finely tuned decidualization and restrict trophoblast unlimited proliferation. Previous studies have reported that CD82 is upregulated in the endometrium during decidualization, and localized it to decidual cells at the sites of trophoblast invasion, exerting an important role in keeping the invasion of trophoblast cells in control (Gellersen et al. 2007, Li et al. 2010, Gonzalez et al. 2011, Palomba et al. 2012). But the impact of CD82 on decidualization has not been elucidated. Here, we observed that CD82 expression was significantly higher in DSCs compared with ESCs from secretory endometrium. More importantly, depletion of CD82 significantly restricted decidualization in vitro. With the positive effect of CD82 on decidualization, our results strongly support that CD82 should serve as a potential marker of decidualization.
PGE2 is required for the initiation and maintenance of decidualization in humans (Poyser 1995). During pregnancy, upregulation of COX-2 in response to human chorionic gonadotropin (hCG) has been verified in both human endometrial stromal and epithelial cells (Han et al. 1996, Zhou et al. 1999). Notably, we demonstrated that PGE2 and cAMP-induced CD82 expression, as well as decidualization of ESCs in vitro. PGE2 is known to be vasodilating and an activator of adenylyl cyclase, producing elevated cAMP concentrations through EP2 or EP4 receptors (Milne et al. 2001). It is believed PGE2 contributes to vascular permeability, favoring leukocyte invasion, and uterine receptivity (Kang et al. 2006). High intracellular cAMP and PGE2 concentrations are also reported to sensitize the cells to the action of progesterone (Frank et al. 1994, Brosens et al. 1999) but the specific molecular mechanisms are inconclusive. In the current study, we also observed that by blocking the COX-2 signaling, the level of CD82 in DSCs was reduced significantly. In addition, we identified IL-1β as the intermediate regulator between COX-2 and CD82 based on previous research (Gellersen et al. 2007) and the STRING database, and further confirmed its role in regulating CD82 during decidualization.
IL-1β, a proinflammatory cytokine, is reported to be expressed by human endometrium of the late secretory phase and in the decidua of early pregnancy (Simon et al. 1994) while downregulated from second and third trimester (Librach et al. 1994). Consistent with our observations, Strakova et al. found IL-1β upregulated IGFBP1 by inducing matrix metalloproteinase-3 (MMP-3) and COX2 expression (Strakova et al. 2002). Additionally, the expressions of IGFBP1, PGE2, PGF2, and COX2 in endometrial cells incubated with IL-1β or IL-lα were shown a significant increase (Kniss et al. 1997, Huang et al. 1998, Strakova et al. 2000). In contrast to the current study, a study showed IL-1β and IL-lα were equipotent in impairing decidualization (Frank et al. 1995). Moreover, Yu et al. reported IL-1β suppressed connexin 43 (a uterine gap junction protein) and compromised decidualization via activating ERK1/2 and mitogen-activated protein kinase p38 (Yu et al. 2017). They recently revealed IL-1β can block decidualization through inhibiting estrogen receptor-α, progesterone receptors A and B in vitro (Yu et al. 2019). On the one hand, we chose different in vitro endometrial decidualization models and stimuli as well as different differentiation times to determine whether there is a continuum of changing phenotype as decidual cells differentiate. On the other hand, these conflicting data may reflect intrinsic differences between in vitro decidualized cells derived from non-pregnant endometrium and pregnant decidua. Collectively, it seems IL-1β can activate multiple signaling pathways that either positively or negatively regulate decidualization in vitro.
The CD82 promoter is found to be a transcriptional target of nuclear factor-κB (NF-κB) as the downstream effector of IL-1β signaling (Baek et al. 2002). Moreover, IL-1β was shown to rapidly stimulate CD82 expression at the transcript level and protein level (Gellersen et al. 2007). Hypothetically, IL-1β can cooperate with CD82 to govern trophoblast invasion and decidualization with their important roles in blastocyst-endometrium dialogue (Gellersen et al. 2007, Massimiani et al. 2019). Remarkably, an apparent upregulation of IL-1β was observed in PGE2-induced decidualized ESCs and DSCs in this study. α-IL-1β can antagonize the upregulation of CD82 induced by PGE2. Consistently, rhIL-1β enhanced CD82 expression, and inhibition of COX-2 in DSCs downregulated IL-1β. This suggests the COX2/PGE2 axis upregulates CD82 during decidualization by promoting the secretion of IL-1β. This also supports CD82 expression is intimately linked with the process of decidualization not merely a consequence of decidualization (Gellersen et al. 2007). Evidence exhibited IL-1β was essential for assuring COX-2 mRNA stability and levels of COX-2 and PGE2 production in IL-1β-treated ESCs are decreased by inhibiting PKA, NF-κB, and ERK1/2 signal transduction pathways (Tamura et al. 2002). Correspondingly, a recent study demonstrated that PGE2 together with IL-1β had a synergistic effect on COX-2 induction (Cho & Choe 2020) since they share a common feature of p38 activation that is required for COX-2 induction (Fiebich et al. 2000). Taken together, there should be a positive COX-2/IL-1β loop in ESCs, and synergistically upregulation of CD82 during decidualization. This positive feedback mechanism contributes to a higher level of CD82 during decidualization and further accelerates decidualization.
Our previous studies have elucidated that CD82 in decidua plays many biological functions. For example, CD82 in DSCs is involved in controlling invasiveness of extravillous trophoblast (Li et al. 2010), and CD82 in NK cells participates in the regulation of cell adhesion and residence in decidua during early pregnancy (Lu et al. 2020). Based on this study and previous reports, we conclude that a higher level of CD82 under a positive regulation of COX-2/PGE2 promotes decidualization in vitro. Mechanically, this effect should be dependent on IL-1β. Under the influence of ovarian hormones, a positive COX-2/IL-1β loop in ESCs contributes to the decidualization by upregulating CD82 in vitro. Therefore, the homeostasis of CD82 expression in decidua should play important role in maintaining the decidualization, trophoblast invasion, and maternal–fetal immune tolerance, more mechanisms need further research.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by the Major Research Program of National Natural Science Foundation of China (NSFC) (No. 92057119, 31970798), the Project of Nantong Science and Technology Bureau (MSZ20007), the Affiliated Changzhou No. 2 People’s Hospital of Nanjing Medical University (2018K006), the Open Project Program of Shanghai Key Laboratory of Female Reproductive Endocrine-Related Diseases (No. 17DZ2273600), the Innovation-oriented Science and Technology Grant from NPFPC Key Laboratory of Reproduction Regulation (CX2017-2), the Program for Zhuoxue of Fudan University (JIF157602), the Support Project for Original Personalized Research of Fudan University, and the Clinical Research Project of Shanghai Municipal Health Commission (20194Y0305).
Author contribution statement
Q C Q and H H S collected the clinical samples, conducted all the experiments, and prepared the figures and the manuscript. C J W, X M Q, X Y Z helped for the clinical samples collection. J N W helped for the data analysis. J Y D helped for editing the manuscript. X F T, L B L, M Q L designed, initiated and supervised the project, and edited the manuscript. All the authors were involved in writing the manuscript.
References
Baek SH, Ohgi KA, Rose DW, Koo EH, Glass CK & Rosenfeld MG 2002 Exchange of N-CoR corepressor and Tip60 coactivator complexes links gene expression by NF-kappaB and beta-amyloid precursor protein. Cell 110 55–67. (https://doi.org/10.1016/s0092-8674(0200809-7)
Brosens JJ, Hayashi N & White JO 1999 Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology 140 4809–48 20. (https://doi.org/10.1210/endo.140.10.7070)
Brosens I, Puttemans P & Benagiano G 2019 Placental bed research: I. The placental bed: from spiral arteries remodeling to the great obstetrical syndromes. American Journal of Obstetrics and Gynecology 221 437–456. (https://doi.org/10.1016/j.ajog.2019.05.044)
Cha J, Sun X & Dey SK 2012 Mechanisms of implantation: strategies for successful pregnancy. Nature Medicine 18 1754–17 67. (https://doi.org/10.1038/nm.3012)
Cho W & Choe J 2020 Prostaglandin E2 stimulates COX-2 expression via mitogen-activated protein kinase p38 but not ERK in human follicular dendritic cell-like cells. BMC Immunology 21 20. (https://doi.org/10.1186/s12865-020-00347-y)
Erkenbrack EM, Maziarz JD, Griffith OW, Liang C, Chavan AR, Nnamani MC & Wagner GP 2018 The mammalian decidual cell evolved from a cellular stress response. PLoS Biology 16 e2005594. (https://doi.org/10.1371/journal.pbio.2005594)
Fiebich BL, Mueksch B, Boehringer M & Hull M 2000 Interleukin-1beta induces cyclooxygenase-2 and prostaglandin E(2) synthesis in human neuroblastoma cells: involvement of p38 mitogen-activated protein kinase and nuclear factor-kappaB. Journal of Neurochemistry 75 2020–202 8. (https://doi.org/10.1046/j.1471-4159.2000.0752020.x)
Fitzgerald JS, Poehlmann TG, Schleussner E & Markert UR 2008 Trophoblast invasion: the role of intracellular cytokine signalling via signal transducer and activator of transcription 3 (STAT3). Human Reproduction Update 14 335–3 44. (https://doi.org/10.1093/humupd/dmn010)
Frank GR, Brar AK, Cedars MI & Handwerger S 1994 Prostaglandin E2 enhances human endometrial stromal cell differentiation. Endocrinology 134 258–2 63. (https://doi.org/10.1210/endo.134.1.7506205)
Frank GR, Brar AK, Jikihara H, Cedars MI & Handwerger S 1995 Interleukin-1 beta and the endometrium: an inhibitor of stromal cell differentiation and possible autoregulator of decidualization in humans. Biology of Reproduction 52 184–1 91. (https://doi.org/10.1095/biolreprod52.1.184)
Garrido-Gomez T, Dominguez F, Quinonero A, Diaz-Gimeno P, Kapidzic M, Gormley M, Ona K, Padilla-Iserte P, McMaster M & Genbacev O et al.2017 Defective decidualization during and after severe preeclampsia reveals a possible maternal contribution to the etiology. PNAS 114 E8468–E8477. (https://doi.org/10.1073/pnas.1706546114)
Gellersen B & Brosens JJ 2014 Cyclic decidualization of the human endometrium in reproductive health and failure. Endocrine Reviews 35 851–905. (https://doi.org/10.1210/er.2014-1045)
Gellersen B, Briese J, Oberndorfer M, Redlin K, Samalecos A, Richter DU, Loning T, Schulte HM & Bamberger AM 2007 Expression of the metastasis suppressor KAI1 in decidual cells at the human maternal-fetal interface: regulation and functional implications. American Journal of Pathology 170 126–1 39. (https://doi.org/10.2353/ajpath.2007.060175)
Gellersen B, Wolf A, Kruse M, Schwenke M & Bamberger AM 2013 Human endometrial stromal cell-trophoblast interactions: mutual stimulation of chemotactic migration and promigratory roles of cell surface molecules CD82 and CEACAM1. Biology of Reproduction 88 80. (https://doi.org/10.1095/biolreprod.112.106724)
Gonzalez M, Neufeld J, Reimann K, Wittmann S, Samalecos A, Wolf A, Bamberger AM & Gellersen B 2011 Expansion of human trophoblastic spheroids is promoted by decidualized endometrial stromal cells and enhanced by heparin-binding epidermal growth factor-like growth factor and interleukin-1 beta. Molecular Human Reproduction 17 421–4 33. (https://doi.org/10.1093/molehr/gar015)
Han SW, Lei ZM & Rao CV 1996 Up-regulation of cyclooxygenase-2 gene expression by chorionic gonadotropin in mucosal cells from human fallopian tubes. Endocrinology 137 2929–29 37. (https://doi.org/10.1210/endo.137.7.8770916)
Huang JC, Liu DY, Yadollahi S, Wu KK & Dawood MY 1998 Interleukin-1 beta induces cyclooxygenase-2 gene expression in cultured endometrial stromal cells. Journal of Clinical Endocrinology and Metabolism 83 538–5 41. (https://doi.org/10.1210/jcem.83.2.4533)
Ishihara O, Matsuoka K, Kinoshita K, Sullivan MH & Elder MG 1995 Interleukin-1 beta-stimulated PGE2 production from early first trimester human decidual cells is inhibited by dexamethasone and progesterone. Prostaglandins 49 15–26. (https://doi.org/10.1016/0090-6980(9400009-l)
Kang J, Chapdelaine P, Laberge PY & Fortier MA 2006 Functional characterization of prostaglandin transporter and terminal prostaglandin synthases during decidualization of human endometrial stromal cells. Human Reproduction 21 592–59 9. (https://doi.org/10.1093/humrep/dei400)
Kaufmann P, Black S & Huppertz B 2003 Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biology of Reproduction 69 1–7. (https://doi.org/10.1095/biolreprod.102.014977)
Kaya Okur HS, Das A, Taylor RN, Bagchi IC & Bagchi MK 2016 Roles of estrogen receptor-alpha and the coactivator MED1 during human endometrial decidualization. Molecular Endocrinology 30 302–3 13. (https://doi.org/10.1210/me.2015-1274)
Kelleher AM, Milano-Foster J, Behura SK & Spencer TE 2018 Uterine glands coordinate on-time embryo implantation and impact endometrial decidualization for pregnancy success. Nature Communications 9 2435. (https://doi.org/10.1038/s41467-018-04848-8)
Kniss DA, Zimmerman PD, Garver CL & Fertel RH 1997 Interleukin-1 receptor antagonist blocks interleukin-1-induced expression of cyclooxygenase-2 in endometrium. American Journal of Obstetrics and Gynecology 177 559–5 67. (https://doi.org/10.1016/s0002-9378(9770146-7)
Li MQ, Hou XF, Shao J, Tang CL & Li DJ 2010 The DSCs-expressed CD82 controls the invasiveness of trophoblast cells via integrinbeta1/MAPK/MAPK3/1 signaling pathway in human first-trimester pregnancy. Biology of Reproduction 82 968–9 79. (https://doi.org/10.1095/biolreprod.109.080739)
Librach CL, Feigenbaum SL, Bass KE, Cui TY, Verastas N, Sadovsky Y, Quigley JP, French DL & Fisher SJ 1994 Interleukin-1 beta regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. Journal of Biological Chemistry 269 17125–171 31. (https://doi.org/10.1016/S0021-9258(1732529-2)
Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM & Dey SK 1997 Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91 197–208. (https://doi.org/10.1016/s0092-8674(0080402-x)
Liu XT, Sun HT, Zhang ZF, Shi RX, Liu LB, Yu JJ, Zhou WJ, Gu CJ, Yang SL & Liu YK et al.2018 Indoleamine 2,3-dioxygenase suppresses the cytotoxicity of 1 NK cells in response to ectopic endometrial stromal cells in endometriosis. Reproduction 156 397–404. (https://doi.org/10.1530/REP-18-0112)
Liu X, Guo X, Li H, Chen J & Han H 2021 Effects of KAI gene expression on ferroptosis in pancreatic cancer cells. Molecular Medicine Reports 23 163. (https://doi.org/10.3892/mmr.2020.11802)
Long Y, Jiang Y, Zeng J, Dang Y, Chen Y, Lin J, Wei H, Xia H, Long J & Luo C et al.2020 The expression and biological function of chemokine CXCL12 and receptor CXCR4/CXCR7 in placenta accreta spectrum disorders. Journal of Cellular and Molecular Medicine 24 3167–3182. (https://doi.org/10.1111/jcmm.14990)
Lu H, Jin LP, Huang HL, Ha SY, Yang HL, Chang RQ, Li DJ & Li MQ 2020 Trophoblast-derived CXCL12 promotes CD56(bright) CD82(-) CD29(+) NK cell enrichment in the decidua. American Journal of Reproductive Immunology 83 e13203. (https://doi.org/10.1111/aji.13203)
Ma X, He X, Wang C, Huang X, Li Y & Ma K 2021 Small extracellular ring domain is necessary for CD82/KAI1’anti-metastasis function. Biochemical and Biophysical Research Communications 557 110–116. (https://doi.org/10.1016/j.bbrc.2021.04.001)
Mak VC, Wong OG, Siu MK, Wong ES, Ng WY, Wong RW, Chan KK, Ngan HY & Cheung AN 2015 FBI-1 is overexpressed in gestational trophoblastic disease and promotes tumor growth and cell aggressiveness of choriocarcinoma via PI3K/Akt signaling. American Journal of Pathology 185 2038–20 48. (https://doi.org/10.1016/j.ajpath.2015.03.011)
Massimiani M, Lacconi V, La Civita F, Ticconi C, Rago R & Campagnolo L 2019 Molecular signaling regulating endometrium-blastocyst crosstalk. International Journal of Molecular Sciences 21 2 3. (https://doi.org/10.3390/ijms21010023)
Milne SA, Perchick GB, Boddy SC & Jabbour HN 2001 Expression, localization, and signaling of PGE(2) and EP2/EP4 receptors in human nonpregnant endometrium across the menstrual cycle. Journal of Clinical Endocrinology and Metabolism 86 4453–445 9. (https://doi.org/10.1210/jcem.86.9.7856)
Mo HQ, Tian FJ, Ma XL, Zhang YC, Zhang CX, Zeng WH, Zhang Y & Lin Y 2020 PDIA3 regulates trophoblast apoptosis and proliferation in preeclampsia via the MDM2/p53 pathway. Reproduction 160 293–305. (https://doi.org/10.1530/REP-20-0156)
Neeb L, Hellen P, Boehnke C, Hoffmann J, Schuh-Hofer S, Dirnagl U & Reuter U 2011 IL-1beta stimulates COX-2 dependent PGE(2) synthesis and CGRP release in rat trigeminal ganglia cells. PLoS ONE 6 e17360. (https://doi.org/10.1371/journal.pone.0017360)
Ochoa-Bernal MA & Fazleabas AT 2020 Physiologic events of embryo implantation and decidualization in human and non-human primates. International Journal of Molecular Sciences 21 1973. (https://doi.org/10.3390/ijms21061973)
Palomba S, Russo T, Falbo A, Di Cello A, Amendola G, Mazza R, Tolino A, Zullo F, Tucci L & La Sala GB 2012 Decidual endovascular trophoblast invasion in women with polycystic ovary syndrome: an experimental case-control study. Journal of Clinical Endocrinology and Metabolism 97 2441–244 9. (https://doi.org/10.1210/jc.2012-1100)
Piltonen TT, Chen JC, Khatun M, Kangasniemi M, Liakka A, Spitzer T, Tran N, Huddleston H, Irwin JC & Giudice LC 2015 Endometrial stromal fibroblasts from women with polycystic ovary syndrome have impaired progesterone-mediated decidualization, aberrant cytokine profiles and promote enhanced immune cell migration in vitro. Human Reproduction 30 1203–1 21 5. (https://doi.org/10.1093/humrep/dev055)
Poyser NL 1995 The control of prostaglandin production by the endometrium in relation to luteolysis and menstruation. Prostaglandins, Leukotrienes, and Essential Fatty Acids 53 147–1 95. (https://doi.org/10.1016/0952-3278(9590115-9)
Qin S, Zhang Y, Zhang J, Tian F, Sun L, He X, Ma X, Zhang J, Liu XR & Zeng W et al.2020 SPRY4 regulates trophoblast proliferation and apoptosis via regulating IFN-gamma-induced STAT1 expression and activation in recurrent miscarriage. American Journal of Reproductive Immunology 83 e13234. (https://doi.org/10.1111/aji.13234)
Richards RG, Brar AK, Frank GR, Hartman SM & Jikihara H 1995 Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression. Biology of Reproduction 52 609–6 15. (https://doi.org/10.1095/biolreprod52.3.609)
Salamonsen LA, Evans J, Nguyen HP & Edgell TA 2016 The microenvironment of human implantation: determinant of reproductive success. American Journal of Reproductive Immunology 75 218–2 2 5. (https://doi.org/10.1111/aji.12450)
Silva JF & Serakides R 2016 Intrauterine trophoblast migration: a comparative view of humans and rodents. Cell Adhesion and Migration 10 88–110. (https://doi.org/10.1080/19336918.2015.1120397)
Simon C, Frances A, Piquette G, Hendrickson M, Milki A & Polan ML 1994 Interleukin-1 system in the materno-trophoblast unit in human implantation: immunohistochemical evidence for autocrine/paracrine function. Journal of Clinical Endocrinology and Metabolism 78 847–8 54. (https://doi.org/10.1210/jcem.78.4.8157710)
Strakova Z, Srisuparp S & Fazleabas AT 2000 Interleukin-1beta induces the expression of insulin-like growth factor binding protein-1 during decidualization in the primate. Endocrinology 141 4664–46 70. (https://doi.org/10.1210/endo.141.12.7810)
Strakova Z, Srisuparp S & Fazleabas AT 2002 IL-1beta during in vitro decidualization in primate. Journal of Reproductive Immunology 55 35–47. (https://doi.org/10.1016/s0165-0378(0100141-3)
Su RW, Strug MR, Joshi NR, Jeong JW, Miele L, Lessey BA, Young SL & Fazleabas AT 2015 Decreased notch pathway signaling in the endometrium of women with endometriosis impairs decidualization. Journal of Clinical Endocrinology and Metabolism 100 E433–E442. (https://doi.org/10.1210/jc.2014-3720)
Tamura M, Sebastian S, Yang S, Gurates B, Fang Z & Bulun SE 2002 Interleukin-1beta elevates cyclooxygenase-2 protein level and enzyme activity via increasing its mRNA stability in human endometrial stromal cells: an effect mediated by extracellularly regulated kinases 1 and 2. Journal of Clinical Endocrinology and Metabolism 87 3263–32 73. (https://doi.org/10.1210/jcem.87.7.8594)
Wang G, Liang R, Liu T, Wang L, Zou J, Liu N, Liu Y, Cai X, Liu Y & Ding X et al.2019 Opposing effects of IL-1beta/COX-2/PGE2 pathway loop on islets in type 2 diabetes mellitus. Endocrine Journal 66 691–699. (https://doi.org/10.1507/endocrj.EJ19-0015)
Yu J, Berga SL, Zou W, Yook DG, Pan JC, Andrade AA, Zhao L, Sidell N, Bagchi IC & Bagchi MK et al.2017 IL-1beta inhibits connexin 43 and disrupts decidualization of human endometrial stromal cells through ERK1/2 and p38 MAP kinase. Endocrinology 158 4270–4285. (https://doi.org/10.1210/en.2017-00495)
Yu J, Berga SL, Zou W & Taylor RN 2019 Interleukin-1beta inhibits estrogen receptor-alpha, progesterone receptors A and B and biomarkers of human endometrial stromal cell differentiation: implications for endometriosis. Molecular Human Reproduction 25 625–637. (https://doi.org/10.1093/molehr/gaz045)
Zhou XL, Lei ZM & Rao CV 1999 Treatment of human endometrial gland epithelial cells with chorionic gonadotropin/luteinizing hormone increases the expression of the cyclooxygenase-2 gene. Journal of Clinical Endocrinology and Metabolism 84 3364–3377. (https://doi.org/10.1210/jcem.84.9.5943)
