GRIM19 is involved in WT1 expression and epithelial-to-mesenchymal transition in adenomyotic lesions

in Reproduction
Authors:
Chen GengCenter for Reproductive Medicine, Department of Obstetrics and Gynecology, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, People’s Republic of China

Search for other papers by Chen Geng in
Current site
Google Scholar
PubMed
Close
,
Hao-ran LiuCenter for Reproductive Medicine, Department of Obstetrics and Gynecology, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, People’s Republic of China

Search for other papers by Hao-ran Liu in
Current site
Google Scholar
PubMed
Close
,
Yue ZhaoCenter for Reproductive Medicine, Department of Obstetrics and Gynecology, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, People’s Republic of China

Search for other papers by Yue Zhao in
Current site
Google Scholar
PubMed
Close
,
Yang YangCenter for Reproductive Medicine, Department of Obstetrics and Gynecology, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, People’s Republic of China

Search for other papers by Yang Yang in
Current site
Google Scholar
PubMed
Close
, and
Lan ChaoCenter for Reproductive Medicine, Department of Obstetrics and Gynecology, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, People’s Republic of China

Search for other papers by Lan Chao in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to L Chao; Email: qlszcl@163.com
Free access

The epithelial-to-mesenchymal transition may play a role in adenomyosis. GRIM19 expression is downregulated in adenomyotic lesions, and the effects of this downregulation in adenomyosis remain relatively unclear. In this study, we aimed to explore whether aberrant GRIM19 expression is associated with the epithelial-to-mesenchymal transition in adenomyosis and found that the expression of both GRIM19 and WT1 was low, and epithelial-to-mesenchymal transition, which included significant changes in CDH1, CDH2 and KRT8 expression, occurred in adenomyotic lesions, as confirmed by Western blotting and quantitative real-time PCR. We provided novel insights into WT1 expression in adenomyosis, revealing that WT1 expression was increased in the endometrial glands of adenomyotic lesions by immunohistochemistry. In vitro, knockdown of GRIM19 expression by small interfering RNA (siRNA) promoted the proliferation, migration and invasion of Ishikawa cells, as measured by Cell Counting Kit-8, wound healing assay and Transwell assays. Western blotting and quantitative real-time PCR confirmed that WT1 expression increased and epithelial-to-mesenchymal transition was induced, including the upregulation of CDH2 and downregulation of CDH1 and KRT8after transfecting the GRIM19 siRNA to Ishikawa cells. Furthermore, Wt1 expression was upregulated and epithelial-to-mesenchymal transition was observed, including downregulation of Cdh1 and Krt8 in Grim19 gene-knockdown mice. Upregulation of Wt1 expression in the endometrial glands of Grim19 knockdown mice was also verified by immunohistochemistry. Taken together, these results reveal that low expression of GRIM19 in adenomyosis may upregulate WT1 expression and induce epithelial-to-mesenchymal transition in the endometria, providing new insights into the pathogenesis of adenomyosis.

Abstract

The epithelial-to-mesenchymal transition may play a role in adenomyosis. GRIM19 expression is downregulated in adenomyotic lesions, and the effects of this downregulation in adenomyosis remain relatively unclear. In this study, we aimed to explore whether aberrant GRIM19 expression is associated with the epithelial-to-mesenchymal transition in adenomyosis and found that the expression of both GRIM19 and WT1 was low, and epithelial-to-mesenchymal transition, which included significant changes in CDH1, CDH2 and KRT8 expression, occurred in adenomyotic lesions, as confirmed by Western blotting and quantitative real-time PCR. We provided novel insights into WT1 expression in adenomyosis, revealing that WT1 expression was increased in the endometrial glands of adenomyotic lesions by immunohistochemistry. In vitro, knockdown of GRIM19 expression by small interfering RNA (siRNA) promoted the proliferation, migration and invasion of Ishikawa cells, as measured by Cell Counting Kit-8, wound healing assay and Transwell assays. Western blotting and quantitative real-time PCR confirmed that WT1 expression increased and epithelial-to-mesenchymal transition was induced, including the upregulation of CDH2 and downregulation of CDH1 and KRT8after transfecting the GRIM19 siRNA to Ishikawa cells. Furthermore, Wt1 expression was upregulated and epithelial-to-mesenchymal transition was observed, including downregulation of Cdh1 and Krt8 in Grim19 gene-knockdown mice. Upregulation of Wt1 expression in the endometrial glands of Grim19 knockdown mice was also verified by immunohistochemistry. Taken together, these results reveal that low expression of GRIM19 in adenomyosis may upregulate WT1 expression and induce epithelial-to-mesenchymal transition in the endometria, providing new insights into the pathogenesis of adenomyosis.

Introduction

Adenomyosis, which is characterized by the presence of endometrial tissue in the myometrium and hypertrophic smooth muscle, is considered a chronic, costly and debilitating disorder that affects 20% of women of premenopausal age, impairing quality of life (Ferenczy 1998, Donnez et al. 2018). Patients often suffer from infertility, abnormal uterine bleeding and frequent pain symptoms, including dysmenorrhoea, deep dyspareunia and chronic pelvic pain (Gordts et al. 2018, Critchley et al. 2020). Treatments, such as hysterectomy, gonadotrophin-releasing hormone agonists and pain medications, are used to suppress adenomyosis, but available long-term medical therapies remain limited (Yu et al. 2020).

The pathogenesis of adenomyosis is still under debate since the discovery of endometrial glands in the myometrium by Carl von Rokitansky in 1860 (Benagiano & Brosens 1991). A common hypothesis of adenomyosis is chronic wounds occur at the endometrial-myometrial junctional zone, and mechanical injury is more serious than thermal damage (Hao et al. 2020). However, other factors cannot be ignored, as injury is common in premenopausal women, but only some of these women suffer from the disease. Furthermore, epithelial-to-mesenchymal transition (EMT), which involves the loss of apical polarity in epithelial cells and the adoption of a mesenchymal phenotype, which is a tumour characteristic, might be linked to the development of adenomyosis (Chen et al. 2010).

During embryogenesis, the endometrium originates from the intermediate mesoderm via a mesenchymal-to-epithelial transition (Hashimoto 2003). Epithelial cells of the endometrial glands may be at risk of returning to a mesenchymal state due to their mesenchymal origin. A distinctive feature of EMT is the loss of epithelial markers, such as cadherin 1 (CDH1) and cytokeratin, together with the increased expression of mesenchymal markers, such as cadherin 2 (CDH2) and vimentin (VIM), which lead to polarity conversion, migration and invasion of malignant cells (Dongre & Weinberg 2019, Chen et al. 2020). With respect to the regulation of EMT, the zinc-finger proteins snail family transcriptional repressor 1 (SNAI1) and snail family transcriptional repressor 2 (SNAI2) are transcription factors, and SNAI1 plays a role in promoting EMT (Dongre & Weinberg 2019). Wilms’ tumour 1 (WT1) binds directly to the endogenous SNAI1 and CDH1 promoters and inhibits CDH1 expression (Cano et al. 2000, Han et al. 2020). Hormonal aberrations as well as activated platelets and macrophages induce EMT signals and promote the migration of endometrial cells in adenomyosis (Bourdon et al. 2021). However, no consensus has been reached regarding the pathogenesis of EMT in adenomyosis.

WT1 has been identified as a key regulator in urogenital development involved in the early stage of condensation and epithelialization of kidney rudiments (Kreidberg et al. 1993). WT1 expression is found in coelomic cells that undergo EMT or the reverse mesenchymal to epithelial transition (Moore et al. 1998). Downregulation of WT1 mRNA expression during the midsecretory phase in endometrial stromal cells may be involved in progesterone regulation in endometriosis (Matsuzaki et al. 2006). WT1 expression remains constant during the proliferative and secretory phases of the menstrual cycle (Makrigiannakis et al. 2001). However, WT1 expression in the pathophysiology of adenomyosis remains a mystery.

The gene associated with retinoid-interferon-induced mortality-19 (GRIM19) is an accessory subunit of complex I induced by interferon and retinol administration (Angell et al. 2000, Fearnley et al. 2001). As a growth suppressor and an apoptosis promoter, GRIM19 is downregulated in various tumours (Nallar & Kalvakolanu 2017). Previously, our team reported the downregulation of GRIM19 in adenomyosis compared to controls, but there was no difference in GRIM19 expression between the proliferative and secretory phases (Wang et al. 2016). Furthermore, GRIM19 suppresses EMT in colorectal cancer (Zhang et al. 2019). However, the mechanism related to GRIM19 expression in adenomyosis remains unclear.

This study used adenomyosis and normal endometrial tissue, as well as the Ishikawa cell line and animal models, to determine whether GRIM19 is involved in EMT. Furthermore, we investigated the relationship between GRIM19 and WT1. Overall, we attempted to identify related pathophysiology and better characterize adenomyosis.

Materials and methods

Tissue sample collection

This study was approved by the Institutional Review Board of the Qilu Hospital Authority (KYLL-202008-186). Written informed consent was obtained from all human subjects. Samples were obtained through the Qilu Hospital of Shandong University.

To estimate the sample size, in the preliminary experiment (N1 = N2 = 3), we used two-sample t-tests in PASS 15.0.5 software (Fang et al. 2021) using the mean and s.d. of the two groups, and we achieved >80% power under a 5% significance level, so seven samples in each group were sufficient.

Seven women aged 36.86 ± 0.7997 (mean ± s.d.), ranging from 35 to 39 years old, were recruited in this study and were diagnosed with adenomyosis by clinical pathology. A total of seven adenomyotic tissues from adenomyosis patients were collected (n  = 3 during the proliferative stage of the menstrual cycle and n  = 4 during the secretory stage of the menstrual cycle). Normal endometrial tissues were collected from women who exhibited fallopian tube occlusion (n  = 7 during the proliferative stage of the menstrual cycle, 31.86 ± 2.659 years old, ranging from 21 to 42 years old) with no clinical evidence or history of adenomyosis or endometriosis for use as controls. No subject received hormone treatment within 3 months before surgery. None of the patients exhibited any surgical comorbidities. Tissues were excised using sharp scissors without cauterization by the surgeons. A portion of the same sample lesion was sent for adenomyosis confirmation by a pathologist. Each research sample was immediately separated into two parts. One part was snap-frozen, stored at −80°C and then used for Western blotting and quantitative real-time PCR (qRT-PCR). The remaining tissue was fixed in 10% (v/v) buffered formalin and processed for paraffin embedding.

Cell culture

The significant gene expression changes in Ishikawa cells resemble the physiological processes in normal endometrial glandular cells, and this cell line is often used as a model of reproductive system diseases, including adenomyosis (Tamm-Rosenstein et al. 2013). Many adenomyosis studies only use Ishikawa cells as the in vitro experimental model (Yoo et al. 2020). The Ishikawa cell line was a gift from Prof. Beihua Kong (Qilu Hospital, Jinan, Shandong, China). Cells were grown in Dulbecco’s modified Eagle's medium (DMEM, Gibco) supplemented with 10% (v/v) foetal bovine serum (FBS) (Sigma) and 1% (v/v) penicillin–streptomycin (Sigma–Aldrich) in a water-jacketed incubator (Thermo, Wilmington, DE, USA) with 5% (v/v) CO2 at 37°C. We digested cells (trypsin-EDTA solution, Solarbio, Beijing, China) and passaged them with new growth media at 36–60-h intervals until the cells reached 85–90% confluence.

siRNA transfection of GRIM19

To reduce the expression of GRIM19, we used transient siRNA in the Ishikawa cell line, which was passaged no less than three times in the logarithmic phase. The GRIM19 siRNA sense sequence was 5’-GGAUUGGAACCCUGAUCUATT-3’, and the negative control siRNA sense sequence was 5’-UUCUCCGAACGUGUCACGUTT-3’ (GenePharma). In total, 3 × 105 cells were seeded per well into six-well plates and were allowed to reach 70–90% confluence overnight and were then incubated in serum-free DMEM for 6 h. Using the Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s protocols, we prepared a mixture of 2500 ng siGRIM19 and 125 μL OPTI-MEM and mixed 7.5 μL Lipofectamine 2000 with 117.5 μL OPTI-MEM for each well in parallel. After a 5-min incubation at room temperature (RT), we added siRNAs to diluted Lipofectamine 2000 and incubated the mixture for 20 min at RT to allow siRNA-lipid complexes to form. Later, the cells were transfected with GRIM19 siRNA-lipid complexes as the GRIM19 siRNA group and with negative control siRNA-lipid complexes as the negative control group. After 24 h of incubation, cells were used for RNA extraction, and after 48 h of incubation, they were used for Western blotting and wound healing assays.

Wound healing assay

After transfection with GRIM19 siRNA-lipid complexes and the negative control siRNA-lipid complexes for 48 h when cells were greater than 95% confluent, we scratched the cell monolayers using a sterile 200 μL pipette tip to create a straight wound. PBS was used to wash off the removed cells, and the remaining cells were cultured in a serum-free medium for another 24 h. The width of the scratch was measured according to marked positions on the plate. Digital images were analysed using ImageJ software (National Institutes of Health, USA). Then, the two groups of cells were collected for Western blotting assays to identify whether the cells were successfully transfected with siRNAs.

Cell migration and invasion

Migration and invasion were assayed using 6.5 mm diameter Transwell inserts with an 8.0 μm pore size polycarbonate membrane filter (BD Corning, Corning NY, USA) in 24-well plates. For the migration assay, 24 h posttransfection, cells (1 × 105 cells/well) were seeded into the upper chambers in DMEM/F12 medium, and 10% (v/v) FBS-DMEM/F12 medium was added to the lower chambers. After 24 h of culture at 37°C in a 5% (v/v) CO2 incubator, nonmigratory cells were removed using a cotton swab, and the migrated cells on the underside of the filter were fixed in 4% (v/v) paraformaldehyde for 30 min at 4°C and stained with 1% (v/v) crystal violet (Solarbio) for 15 min at RT. Images were acquired using a light microscope (magnification, 100×).

The invasion ability of Ishikawa cells was determined using an invasion assay. Twenty-four hours posttransfection, cells (1 × 106 cells/well) in 100 μL of DMEM/F12 medium were placed into the upper chamber of Transwell plates (8 μm) with membranes precoated with 300 μg/mL Matrigel matrix (BD Corning). Then, 600 μL of 10% (v/v) FBS media was placed in the lower chambers for incubation at 37°C in a 5% (v/v) CO2 incubator for 20 h. Cell staining and quantification methods were the same as those in the migration assay.

Cell counting Kit-8 (CCK-8) assay

Twenty-four hours posttransfection, proliferation was evaluated by CCK-8 assay (Dojindo, Kumamoto, Japan). Ishikawa cells were seeded into 96-well plates at a density of 1 × 104 cells/well and cultured for 24 h. A total volume of 200 μL growth media containing 10% (v/v) FBS and 10% (v/v) CCK-8 were added to each well and incubated at 37°C for 1 h. Then, the absorbance of each well was measured at a wavelength of 450 nm using a microplate reader (Tanon, Guangdong, China).

Antibodies

Antibodies include polyclonal anti-CDH2 (ab76057, Abcam), monoclonal anti-CDH1 (ab76055, Abcam), polyclonal anti- SNAI1+SNAI2 (ab180714, Abcam), monoclonal anti-WT1 (ab89901, Abcam), monoclonal anti-keratin 8 (KRT8) (ab53280, Abcam) and monoclonal anti-GRIM19 (ab110240, Abcam). Antibodies were used for Western blotting and immunohistochemistry. Western blotting results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (TA-08, Zsbio, Beijing, China).

Immunohistochemistry (IHC)

Tissues were sufficiently fixed (4% (v/v) fixative solution, P1110, Solarbio) and paraffin-embedded before immunohistochemistry. Four-micrometre-thick sections were cut using a rotation microtome. Tissue sections were deparaffinized in xylene (2 × 15 min) and rehydrated in graded alcohol from 100 to 75% (5 min) (v/v). Slides were subjected to antigen retrieval in Tris/EDTA buffer pH 6.0 (15 min boiling in a microwave at the medium power setting). Endogenous peroxidase activity was blocked using a peroxidase inhibitor (sp9000, Zsbio) for 10 min at RT. For nonspecific antigen binding, the slides were incubated with normal goat serum (sp9000, Zsbio) for 15 min at RT. The primary antibody WT1 (1:500) was then added overnight at 4°C. For the negative controls, PBS was used instead of primary antibodies. Slides were incubated with biotin-labelled goat anti-mouse/rabbit IgG polymer (sp9000, Zsbio) for 15 min at RT. Immunohistochemical staining was conducted using a horseradish enzyme-labelled biotin streptavidin system (sp9000, Zsbio) and DAB kit (ZLI-9018, Zsbio ). All slides were counterstained with haematoxylin (Solarbio), dehydrated and mounted in glycerol gelatine (Solarbio ).

Scoring and immunohistochemistry analysis

For staining analysis, the same settings were used for all analysed tissues. Integrated optical density and size of the total area were measured using Image Pro-Plus 6.0 (Media Cybernetics, Inc, Bethesda, MD, USA), and the staining level was calculated by integrated optical density/size. The endometrial glands, stromata and myometria were identified by morphological characteristics (Tempest et al. 2018).

Protein extraction

Proteins were extracted from adenomyotic tissues, normal endometria and the Ishikawa cell line in lysis buffer (radioimmunoprecipitation assay (RIPA): PMSF, 100:1). After centrifugation at 13,858 g for 30 min at 4°C, the supernatant was collected, and protein concentration was determined using a BCA protein assay kit (Beyotime, Shanghai, China). All proteins were mixed with sodium dodecyl sulphate-PAGE (SDS-PAGE) loading buffer (Beyotime) and then heated for 5 min at 100°C. Some proteins were used for Western blotting, while the rest were stored at −20°C.

Western blotting

Equal amounts of protein from each sample were separated on 10–15% SDS-PAGE gels due to the different molecular masses of the proteins and then transferred to a polyvinylidene fluoride membrane. The membranes were blocked in 5% non-fat milk reconstituted in TBST (0.15 mol/L NaCl, 0.05% Tween 20, 10 mmol/L Tris-HCl (pH 8.0)) for 1 h at RT and subsequently incubated overnight at 4°C with the following primary antibodies: CDH2 (1:1000), CDH1 (1:1000), SNAI1+SNAI2 (1:1000), WT1 (1:1000), KRT8 (1:10,000), GRIM19 (1:1000) and GAPDH (1:1000). After the membranes were incubated with appropriate horseradish peroxidase-labelled secondary antibodies (goat anti-rabbit IgG (H+L) (1:2500); goat anti-mouse IgG (H+L) (1:2500), Zsbio) for 90 min at RT, band signals were detected using chemiluminescent substrate (Thermo Fisher Scientific Inc) and quantified using ImageJ software (National Institutes of Health). GAPDH bands were used for normalization.

Quantitative real-time polymerase chain reaction

Total RNA of tissues and cells was isolated using TRIzol reagent (Invitrogen Life Technologies). RNA (1 μg) was reverse transcribed into cDNA with a ReverTra Ace qPCR RT kit (Code No. FSQ-101, TOYOBO, Osaka Japan). Each 10 μL PCR mixture contained 1× SYBR Green PCR Master Mix (TOYOBO), 30 ng of cDNA and 300 nmol/L of each specific primer. The primers used for each gene are listed in Table 1. StepOne software was used to determine mRNA levels. Actin beta (ACTB) gene expression was used for normalization. Mean relative gene expression was determined using the 2−ΔΔCt method.

Table 1

The primer sequences (5’–3’) used in qRT-PCR.

Species/gene symbol Forward primer Reverse primer Product length
Human
ACTB GAAGAGCTACGAGCTGCCTGA CAGACAGCACTGTGTTGGCG 191
GRIM19 ATGAAGTGGAACCGTGAGCG TCCAGGTTCTCCCGAAGCAT 125
WT1 AGGCCAGGATATTTCCTAACG GTGACCGTGCTGTAACCCTG 88
SNAI1 CGGAAGCCTAACTACAGCGA GCCAGGACAGAGTCCCAGAT 155
SNAI2 TCGGACCCACACATTACCTTG AAAAGGCTTCTCCCCCGTGT 106
VIM AATGGCTCGTCACCTTCGTG CAGAGAAATCCTGCTCTCCTCG 115
CDH1 CTGCCAACTGGCTGGAGATT CTGGAGAACCATTGTCTGTAGC 135
KRT8 CCAGGAGCTGATGAACGTCAA CGAGCTCAGACCACCTGCATAG 154
CDH2 GATCCTACTGGACGGTTCGC GTCGATTGGTTTGACCACGG 78
Mouse
Actb GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT 154
Grim19 GGGGCCTTGATCTTTGGCTA AAGTCCTCAATCAGCAGGCG 74
Wt1 GCAGTTCCCCAACCATTCCT TGCATTCAAGCTGGGAGGTC 200
Snai1 ACCCTCATCTGGGACTCTCTC CAGCGAGGTCAGCTCTACG 102
Vim TCCAGAGAGAGGAAGCCGAA TTCAAGGTCAAGACGTGCCA 83
Cdh1 AACCCAAGCACGTATCAGGG GAGTGTTGGGGGCATCATCA 94
Krt8 CCTCCGGCAGATCCATGAAG TAGACAGCACCACAGACGTG 74
Cdh2 GGCAATCCCACTTATGGCCT TCCGTGACAGTTAGGTTGGC 155

Animals

To determine the influence of Grim19 in the endometrium in vivo, we used Grim19 knockdown mice for the detection of Wt1 levels and EMT markers. Wild type (WT) (n = 4) and Grim19+/−mice (n = 4) (8 to 10 weeks old on a C57BL/6 background) were housed under specific pathogen-free (SPF) conditions in this study. Grim19+/ mice were obtained from the Model Animal Research Centre of Nanjing University. The Grim19 knockout model was created using CRISPR/Cas9-mediated genome engineering. Transcript ENSMUST00000110167.4 has 5 exons, with the ATG start codon at exon 2 and TAG stop codon at exon 5. Specific gRNAs in introns 2–3 and 3–4 were designed, which directed Cas9 endonuclease cleavage of the Grim19 gene and created a double-strand break. The breaks were repaired by nonhomologous end joining, and the Grim19 gene was disrupted by deletion of exon 3 (cagagactgccctggggaagtggctgaggaagga---227bp---GGTGGTGAGC aggggttctgtgaggatgagggaactcctac). Agarose gel electrophoresis was performed to verify the genotype of mice. The following primer sequences were used: forward: 5’-CCACCCCCAAGTGTAAAACTATC-3’ and reverse: 5’-GCACAGGCAGGCAATAGCAG-3’.

Mice were killed at 8–10 weeks, and the uterus was removed and weighed. Tissues were used for Western blotting assays, qRT-PCR and immunohistochemistry. This research was approved by the Experimental Animal Ethics Committee of Qilu Hospital of Shandong University.

Statistical analysis

All experiments were independently repeated at least three times. Data were analysed using Student’s t-test. Data are shown as the mean ± s.d. Statistical significance was defined as P  < 0.05. All statistical analyses were performed using GraphPad Prism Version 7.0 (GraphPad Software).

Results

Lower levels of GRIM19 and WT1 are expressed in adenomyotic lesions than in normal endometria

GRIM19 expression was downregulated at the protein (P  = 0.0057) and mRNA (P  < 0.0001) levels in adenomyotic lesions (Fig. 1A, B and C). We next analysed WT1 levels in adenomyotic lesions and normal control tissues. WT1 protein (P  = 0.0043) and WT1 mRNA expression (P  = 0.0006) were significantly downregulated in adenomyotic lesions compared to the control group (Fig. 1A, D and E), suggesting a possible relationship between WT1 and the development of adenomyosis. We detected the expression of WT1 by IHC in adenomyotic lesions and normal endometria. WT1 staining of endometrial glands was significantly higher in adenomyotic lesions (P  = 0.0045), although WT1 expression remained low in the stroma of adenomyotic lesions (P  = 0.0009) and in all adenomyotic lesions (P  = 0.0024) (Fig. 1F,G, H, I and J). These seemingly contradictory results led us to investigate the potential role of WT1.

Figure 1
Figure 1

Downregulation of GRIM19 and WT1 occurs in adenomyotic lesions, while WT1 is increased in endometrial glands of adenomyotic lesions accompanied by EMT. (A) Representative Western blotting images of GRIM19, WT1, SNAI1+SNAI2, CDH1 and CDH2. GAPDH bands were used for normalization in each Western blotting assay. (B, C, D and E) Expression of GRIM19 and WT1 at the protein and mRNA levels. (F, G) WT1 immunohistochemical staining of adenomyosis lesions and the normal endometrium. Scale bar = 50 μm. (H, I and J) Mean optical density (OD) of WT1 protein expression in endometrial glands of adenomyotic lesions (H), stroma of adenomyotic lesions (I) and all adenomyotic lesions (J) was measured by integrated optical density/total area. (K) Expression of CDH2, KRT8, vimentin, CDH1, SNAI1 and SNAI2 at the mRNA level. (L) Expression of CDH1 and CDH2 and SNAI1+SNAI2 at the protein level. Adenomyotic lesions in patients with adenomyosis (n  = 7) and tissues from control participants (n  = 7) were assayed as above. Data of mRNA expression are normalized to ACTB. Data are shown as the mean ± s.d. ****P  < 0.0001, **P  < 0.01, *P  < 0.05, t-test.

Citation: Reproduction 162, 5; 10.1530/REP-21-0181

Epithelial-to-mesenchymal transition occurs in adenomyotic lesions

Because WT1 is involved in EMT, we detected Snail and EMT markers in human adenomyotic lesions. mRNA expression of SNAI1, SNAI2 and EMT markers, including CDH2, KRT8, VIM and CDH1, are shown in Fig. 1K. The Western blotting results of CDH1, CDH2 and SNAI1+SNAI2 in normal endometria and adenomyotic lesions are illustrated in Fig. 1A and L. As mesenchymal markers, CDH2 was significantly increased (P  = 0.0183), and VIM tended to increase at the mRNA level, while KRT8 mRNA (P  = 0.0044) and CDH1 protein (P  < 0.0001), mesenchymal markers, were significantly decreased in adenomyotic lesions compared to normal endometria. There were no significant differences in CDH2 protein expression or CDH1 mRNA expression. SNAI1 and SNAI2 expression at both the mRNA and protein levels tended to decrease.

GRIM19 regulates proliferation, migration and invasion in the Ishikawa cell line

Transfection of Ishikawa cells with GRIM19 siRNA significantly reduced GRIM19 expression, as shown by Western blotting (P  = 0.0257) (Fig. 2A and B). The CCK-8 assay revealed that GRIM19 knockdown increased Ishikawa cell proliferation (P  = 0.0449) (Fig. 2C). The wound healing assay was used to detect cell migration and GRIM19 knockdown for 24 h significantly increased the migration ability compared to the negative control group (P  = 0.0025) (Fig. 2D, E and F). The migration and invasion ability of Ishikawa cells after GRIM19 siRNA manipulation was estimated using the Transwell assay. As shown in Fig. 2G, H, I and J, migration (P  = 0.0257) and invasion (P  = 0.0368) were significantly increased in response to downregulation of GRIM19 compared to the negative control siRNA group.

Figure 2
Figure 2

Downregulation of GRIM19increases the proliferation, migration and invasion of Ishikawa cells. (A and B) The downregulation of GRIM19 in the Ishikawa cell line was verified by Western blotting. (C) Cell proliferation was measured using a CCK-8 assay in negative control siRNA cells and in GRIM19 siRNA cells for 24 h. (D and E) Representative results of a wound healing assay in cells treated with negative control siRNA and GRIM19 siRNA for 24 h. Scale bar = 500 μm. (F) The gap size percentage for 24 h. (G and H) Representative results of the Transwell assay in GRIM19 siRNA (right) and negative control siRNA (left) cells for migration (top) and invasion (bottom). Scale bar = 50 μm. (I) Cell number per field of migrating cells after 24 h of incubation. (J) Cell invasion after 24-h incubation. All experiments were independently performed three times. Data are shown as the mean ± s.d., t-test.

Citation: Reproduction 162, 5; 10.1530/REP-21-0181

WT1 expression is upregulated and EMT is induced in response to decreased expression of GRIM19 in Ishikawa cells

Transfection of GRIM19 siRNA in Ishikawa cells resulted in a significant reduction in GRIM19 expression as determined by qRT-PCR (P  = 0.0006) and Western blotting (P  = 0.0498). Downregulation of GRIM19 expression increased the expression of WT1 mRNA (P  = 0.0306) and WT1 protein (P  = 0.0258) in Ishikawa cells compared to control cells and decreased expression of KRT8 mRNA (P  = 0.0108) and protein (P  = 0.0174), suggesting induction of EMT. The mRNA expression of SNAI1 was significantly decreased (P  = 0.0009), while SNAI1 and SNAI2 protein expression exhibited no significant change. CDH2 was significantly increased in response to downregulation of GRIM19 compared to the controls (P  = 0.0325), while CDH2 mRNA expression showed no significant change. CDH1 protein was significantly decreased (P  = 0.0482), CDH1 mRNA tended to decrease with the downregulation of GRIM19, and VIM mRNA tended to increase (Fig. 3A, B and C).

Figure 3
Figure 3

Effects of GRIM19 on WT1 and Snail expression and EMT. (A) Relative mRNA expression by qRT-PCR. mRNA expression of GRIM19, WT1, SNAI1 and EMT markers KRT8, CDH2, CDH1 and vimentin in siRNA GRIM19-transfected Ishikawa cells compared to controls. Data are normalized to ACTB. (B and C) Representative Western blotting images and analysis of GRIM19, WT1, SNAI1+SNAI2, KRT8, CDH2 and CDH1. Protein expression is normalized to GAPDH. ***P  < 0.001; *P  < 0.05. Columns represent the mean ± s.d. of four independent determinations.

Citation: Reproduction 162, 5; 10.1530/REP-21-0181

Knockdown of Grim19 leads to increased expression of Wt1 and changes in EMT markers in Grim19+/− mice

C57BL/6 mice heterozygous for the targeted allele (Grim19+/) were obtained. The Grim19+/− mice were fertile with no obvious phenotypic abnormalities, and adenomyosis lesions were not observed. Knockdown of Grim19 was verified by qRT-PCR (P  = 0.0058) and Western blotting (P  = 0.0153) (Fig. 4A, B and C). To further assess the impact of Grim19 downregulation, qRT-PCR was performed to detect Wt1 and Snai1 expression (Fig. 4A). Wt1 mRNA (P  = 0.0247) and WT1 protein (P  = 0.0128) were significantly increased in the uterus of Grim19+/− mice. Furthermore, in contrast to WT mice, knockdown of Grim19 in C57BL/6 mice accelerated EMT, as epithelial markers, including Cdh1, were decreased at both the mRNA (P  = 0.0133) and protein levels (P  = 0.0352), and Krt8 was downregulated at the mRNA level (P  = 0.0142). Expression of Vim mRNA, Snai1 mRNA and SNAI1+SNAI2 protein tended to be high. Expression of Cdh2 mRNA tended to be low (Fig. 4A, B and C). Immunohistological analysis was performed to further characterize WT1 staining of the Grim19+/− uterus. WT1 protein levels in Grim19+/− endometrial glands were significantly increased (P  = 0.0113), and the Wt1 expression profile tended to be high in the stroma of adenomyotic lesions (Fig. 4D, E, F and G).

Figure 4
Figure 4

WT1, SNAIL and EMT changes in Grim19+/− mice. (A) Relative mRNA expression by qRT-PCR. mRNA expression of Grim19, Wt1 and Snai1 and EMT markers Cdh1, Krt8, Cdh2 and Vim in Grim19+/− mice compared to the control. Data are normalized to ACTB. (B and C) Representative Western blotting images and analysis of GRIM19, WT1, SNAI1+SNAI2 and CDH1 normalized to GAPDH. (D and E) Representative WT1 immunohistochemical staining photomicrographs of the uterus in WT mice and Grim19+/− mice. Scale bar = 50 μm. (F and G) Mean OD of WT1 protein expression in endometrial glands of WT mice uterus and Grim19+/− mice uterus (F), in stroma of WT mice uterus and Grim19+/− mice uterus (G). ** P  < 0.01 compared to control; *P  < 0.05, t-test. Columns represent the mean ± s.d. of four mice per group.

Citation: Reproduction 162, 5; 10.1530/REP-21-0181

Discussion

The salient findings from our study suggest that GRIM19 deficiency promotes EMT-like transition during the process of adenomyosis. We also found that WT1 was expressed at high levels in the endometrial glands of adenomyotic lesions but at low levels in a mixture of endometrial glands and stroma components by immunohistochemical staining. We previously focused on EMT in the epithelial cells of adenomyotic lesions and found that GRIM19 was expressed in the epithelial cells of adenomyotic lesions (Wang et al. 2016, 2020). We also found that WT1 staining was distributed in epithelial cells of adenomyotic lesions. Besides, in mice, downregulation of GRIM19 might mainly upregulate WT1 expression in epithelial cells, so meanwhile, WT1 was upregulated in the total lesion in Grim19 +/− mice uterus, which was supported by immunohistochemical staining in mice. Western blotting and qRT-PCR results from siGRIM19 Ishikawa cell line and Grim19+/− mice revealed that upregulation of WT1 is associated with decreased GRIM19 expression in epithelial cells.

Previous work from our group noted a decreased expression of GRIM19 in eutopic and ectopic adenomyosis in both the proliferative and secretory phases (Wang et al. 2016, 2020). GRIM19 suppresses cell invasion and EMT through the upregulation of CDH1 and the downregulation of VIM and CDH2 under hypoxic conditions in colorectal cancer cell lines (Zhang 2019). Deletion of GRIM19 induces EMT changes in hepatocellular carcinoma, revealing an important role for GRIM19 in EMT (Hao et al. 2012). In the present study, we observed changes in EMT markers consistent with EMT-related studies in adenomyosis (Liu et al. 2020). Although previous studies have focused on the relationship between GRIM19 and EMT in some types of cancer, the mechanism by which GRIM19 leads to EMT-like changes in adenomyosis is still unclear. We identified a relationship between the decrease in GRIM19 and the increased expression of WT1.

WT1 is located on chromosome 11p13 and is a suppressor in Wilms’ tumour and was first cloned in 1990 (Call et al. 1990). WT1 downregulation in the stromata of endometriosis patients was detected by IHC, and it remained unchanged in the proliferative and secretory phases of the menstrual cycle (Makrigiannakis et al. 2001, Matsuzaki et al. 2006). In our hands, we found that WT1 was downregulated in adenomyotic lesions by both qRT-PCR and Western blotting. Our IHC results revealed that WT1 appeared to be increased in the endometrial glands of adenomyotic lesions but decreased in the stromata. These seemingly contradictory results led us to investigate the potential role of WT1. In our study, we focused on the mechanism by which WT1 is upregulated in the endometrial glands of adenomyotic lesions. EMT and high levels of WT1 expression were induced in response to GRIM19 siRNA, endowing cells with migratory and invasive properties. Although it is acknowledged that WT1 directly binds CDH1 in regulating EMT in other diseases, the role of WT1 in binding CDH1 in adenomyosis needs to be verified in future research. In addition, the mechanism of WT1 downregulation in mesenchymal cells of adenomyotic lesions remains unknown.

Aberrant WT1 expression is related to EMT. WT1 expression is highly significant in some tumours, such as serous primary peritoneal carcinomas (Acs et al. 2004), acute leukaemia (Jeon et al. 2020) and primary breast tumours (Zhang et al. 2020). WT1 plays an important role in promoting growth and differentiation and repressing apoptosis (Li et al. 2019). WT1 directly represses CDH1 in epicardial cells and in the extracellular matrix (Martínez-Estrada et al. 2010, Park et al. 2019). In contrast, endometrial serous carcinoma with adenomyosis exhibits a lack of WT1 (Lu et al. 2016). Paradoxically, some studies have shown that WT1 upregulation serves the opposite function of EMT. CDH1 expression is upregulated in association with stable expression of WT1 in NIH-3T3 cells (Hosono et al. 2000). Loss of WT1 or WT1 overexpression leads to a more mesenchymal state (Artibani et al. 2017).

The WT1 protein is primarily localized in the nucleus of normal human endometrial stromal cells, while no obvious positive staining is observed in normal epithelial cells from the endometrial glands (Makrigiannakis et al. 2001). However, our IHC results showed that WT1 was increased in the cytoplasm of endometrial glands in adenomyotic lesions. WT1 shuttling between the nucleus and cytoplasm (Niksic et al. 2004) indicates a possible mechanism for the presence of WT1 in the cytoplasm. Therefore, in the future, studies concerning the WT1 shuttling are needed to further evaluate the relevant pathophysiology in adenomyosis.

We used the Ishikawa cell line and found that the downregulation of GRIM19 influenced the expression of WT1. However, we underestimated the potential complexity of WT1 itself. WT1, a transcription factor, binds to DNA targets through its four zinc fingers (Rauscher et al. 1990). Genetic studies have shown that its two isoforms, +KTS and –KTS, have different functions during the later stages of genitourinary development and in sensory organ differentiation (Hammes et al. 2001). Therefore, how GRIM19 affects WT1 and by what pathway WT1 affects EMT need to be further studied in adenomyosis. However, in gene knockdown mice, we did not observe adenomyosis lesions. Some rescue mechanisms in response to the repression of GRIM19 expression may occur in vivo, and further study is needed to explore this possibility.

This study is novel because it illustrates that WT1 upregulation is related to aberrant GRIM19 expression and that GRIM19 is involved in EMT in epithelial cells. In conclusion, our findings reveal that GRIM19 is downregulated in adenomyosis. Low expression of GRIM19 may increase the expression of WT1 and induce EMT in epithelial cells. These findings may help us better understand adenomyosis.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Natural Science Foundation of China (grant numbers 82071620, 81571511, 81701528 and 81370711) and the Shandong Provincial Key Research and Development Project (grant number 2019GSF107004).

Author contribution statement

C G and L C conceived and wrote the paper. C G performed the experiments and analysed the data. C G, H R L, Y Z, Y Y and L C reviewed and approved the draft. L C obtained ethical approval. C G and L C approved the final draft.

Acknowledgements

The authors thank the Key Laboratory of Gynecologic Oncology (Shandong Province, Jinan, China) and Shandong Engineering Laboratory for Urogynecology (Qilu Hospital of Shandong University, Jinan, Shandong, China) for providing laboratory equipment. The authors are sincerely grateful to all the patients participating in this study and thank all mice sacrificed in their study.

References

  • Acs G, Pasha T & Zhang PJ 2004 WT1 is differentially expressed in serous, endometrioid, clear cell, and mucinous carcinomas of the peritoneum, fallopian tube, ovary, and endometrium. International Journal of Gynecological Pathology 23 110118. (https://doi.org/10.1097/00004347-200404000-00004)

    • Search Google Scholar
    • Export Citation
  • Angell JE, Lindner DJ, Shapiro PS, Hofmann ER & Kalvakolanu DV 2000 Identification of GRIM-19, a novel cell death-regulatory gene induced by the interferon-beta and retinoic acid combination, using a genetic approach. Journal of Biological Chemistry 275 3341633426. (https://doi.org/10.1074/jbc.M003929200)

    • Search Google Scholar
    • Export Citation
  • Artibani M, Sims AH, Slight J, Aitken S, Thornburn A, Muir M, Brunton VG, Del-Pozo J, Morrison LR & Katz E et al.2017 WT1 expression in breast cancer disrupts the epithelial/mesenchymal balance of tumour cells and correlates with the metabolic response to docetaxel. Scientific Reports 7 45255. (https://doi.org/10.1038/srep45255)

    • Search Google Scholar
    • Export Citation
  • Benagiano G & Brosens I 1991 The history of endometriosis: identifying the disease. Human Reproduction 6 963968. (https://doi.org/10.1093/oxfordjournals.humrep.a137470)

    • Search Google Scholar
    • Export Citation
  • Bourdon M, Santulli P, Jeljeli M, Vannuccini S, Marcellin L, Doridot L, Petraglia F, Batteux F & Chapron C 2021 Immunological changes associated with adenomyosis: a systematic review. Human Reproduction Update 27 108129. (https://doi.org/10.1093/humupd/dmaa038)

    • Search Google Scholar
    • Export Citation
  • Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, Rose EA, Kral A, Yeger H & Lewis WH 1990 Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell 60 509520. (https://doi.org/10.1016/0092-8674(9090601-a)

    • Search Google Scholar
    • Export Citation
  • Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Search Google Scholar
    • Export Citation
  • Chen YJ, Li HY, Huang CH, Twu NF, Yen MS, Wang PH, Chou TY, Liu YN, Chao KC & Yang MH 2010 Oestrogen-induced epithelial-mesenchymal transition of endometrial epithelial cells contributes to the development of adenomyosis. Journal of Pathology 222 261270. (https://doi.org/10.1002/path.2761)

    • Search Google Scholar
    • Export Citation
  • Chen DY, Qiao H, Wang YT, Ling Z, Yin N, Fang LQ & Wang ZB 2020 Adenomyosis-derived extracellular vesicles endow endometrial epithelial cells with an invasive phenotype through epithelial-mesenchymal transition. Genes and Diseases 7 636648(https://doi.org/10.1016/j.gendis.2020.01.011)

    • Search Google Scholar
    • Export Citation
  • Critchley HOD, Babayev E, Bulun SE, Clark S, Garcia-Grau I, Gregersen PK, Kilcoyne A, Kim JJ, Lavender M & Marsh EE et al.2020 Menstruation: science and society. American Journal of Obstetrics and Gynecology 223 624664. (https://doi.org/10.1016/j.ajog.2020.06.004)

    • Search Google Scholar
    • Export Citation
  • Dongre A & Weinberg RA 2019 New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nature Reviews: Molecular Cell Biology 20 6984. (https://doi.org/10.1038/s41580-018-0080-4)

    • Search Google Scholar
    • Export Citation
  • Donnez J, Donnez O & Dolmans MM 2018 Introduction: uterine adenomyosis, another enigmatic disease of our time. Fertility and Sterility 109 369370. (https://doi.org/10.1016/j.fertnstert.2018.01.035)

    • Search Google Scholar
    • Export Citation
  • Fang Y, He W, Hu X & Wang H 2021 A method for sample size calculation via E-value in the planning of observational studies. Pharmaceutical Statistics 20 163174. (https://doi.org/10.1002/pst.2064)

    • Search Google Scholar
    • Export Citation
  • Fearnley IM, Carroll J, Shannon RJ, Runswick MJ, Walker JE & Hirst J 2001 GRIM-19, a cell death regulatory gene product, is a subunit of bovine mitochondrial NADH: ubiquinone oxidoreductase (complex I). Journal of Biological Chemistry 276 3834538348. (https://doi.org/10.1074/jbc.C100444200)

    • Search Google Scholar
    • Export Citation
  • Ferenczy A 1998 Pathophysiology of adenomyosis. Human Reproduction Update 4 312322. (https://doi.org/10.1093/humupd/4.4.312)

  • Gordts S, Grimbizis G & Campo R 2018 Symptoms and classification of uterine adenomyosis, including the place of hysteroscopy in diagnosis. Fertility and Sterility 109 380.e1–388. e1. (https://doi.org/10.1016/j.fertnstert.2018.01.006)

    • Search Google Scholar
    • Export Citation
  • Hammes A, Guo JK, Lutsch G, Leheste JR, Landrock D, Ziegler U, Gubler MC & Schedl A 2001 Two splice variants of the Wilms’ tumor 1 gene have distinct functions during sex determination and nephron formation. Cell 106 319329. (https://doi.org/10.1016/s0092-8674(0100453-6)

    • Search Google Scholar
    • Export Citation
  • Han Y, Song C, Zhang TT, Zhou QQ, Zhang XQ, Wang J, Xu BQ, Zhang XS, Liu XQ & Ying XY 2020 Wilms’ tumor 1 (WT1) promotes ovarian cancer progression by regulating E-cadherin and ERK1/2 signaling. Cell Cycle 19 26622675. (https://doi.org/10.1080/15384101.2020.1817666)

    • Search Google Scholar
    • Export Citation
  • Hao H, Liu J, Liu G, Guan D, Yang Y, Zhang X, Cao X & Liu Q 2012 Depletion of GRIM-19 accelerates hepatocellular carcinoma invasion via inducing EMT and loss of contact inhibition. Journal of Cellular Physiology 227 12121219. (https://doi.org/10.1002/jcp.24025)

    • Search Google Scholar
    • Export Citation
  • Hao M, Liu X & Guo SW 2020 Adenomyosis in mice resulting from mechanically or thermally induced endometrial-myometrial interface disruption and its possible prevention. Reproductive Biomedicine Online 41 925942. (https://doi.org/10.1016/j.rbmo.2020.07.023)

    • Search Google Scholar
    • Export Citation
  • Hashimoto R 2003 Development of the human Müllerian duct in the sexually undifferentiated stage. Anatomical Record: Part A, Discoveries in Molecular, Cellular, and Evolutionary Biology 272 514519. (https://doi.org/10.1002/ar.a.10061)

    • Search Google Scholar
    • Export Citation
  • Hosono S, Gross I, English MA, Hajra KM, Fearon ER & Licht JD 2000 E-cadherin is a WT1 target gene. Journal of Biological Chemistry 275 1094310953. (https://doi.org/10.1074/jbc.275.15.10943)

    • Search Google Scholar
    • Export Citation
  • Jeon JY, Buelow DR, Garrison DA, Niu M, Eisenmann ED, Huang KM, Zavorka Thomas ME, Weber RH, Whatcott CJ & Warner SL et al.2020 TP-0903 is active in models of drug-resistant acute myeloid leukemia. JCI Insight 5 e140169. (https://doi.org/10.1172/jci.insight.140169)

    • Search Google Scholar
    • Export Citation
  • Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D & Jaenisch R 1993 WT-1 is required for early kidney development. Cell 74 679691. (https://doi.org/10.1016/0092-8674(9390515-r)

    • Search Google Scholar
    • Export Citation
  • Li TS, Chen L, Wang SC, Yang YZ, Xu HJ, Gu HM, Zhao XJ, Dong P, Pan Y & Shang ZQ et al.2019 Magnesium isoglycyrrhizinate ameliorates fructose-induced podocyte apoptosis through downregulation of miR-193a to increase WT1. Biochemical Pharmacology 166 139152. (https://doi.org/10.1016/j.bcp.2019.05.016)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Wang X, Wan L, Liu X, Yu H, Zhang D, Sun Y, Shi Y, Zhang L & Zhou H et al.2020 TIPE2 inhibits the migration and invasion of endometrial cells by targeting β-catenin to reverse epithelial-mesenchymal transition. Human Reproduction 35 13771390. (https://doi.org/10.1093/humrep/deaa062)

    • Search Google Scholar
    • Export Citation
  • Lu B, Chen Q, Zhang X & Cheng L 2016 Serous carcinoma arising from uterine adenomyosis/adenomyotic cyst of the cervical stump: a report of 3 cases. Diagnostic Pathology 11 46. (https://doi.org/10.1186/s13000-016-0496-0)

    • Search Google Scholar
    • Export Citation
  • Makrigiannakis A, Coukos G, Mantani A, Prokopakis P, Trew G, Margara R, Winston R & White J 2001 Expression of Wilms’ tumor suppressor gene (WT1) in human endometrium: regulation through decidual differentiation. Journal of Clinical Endocrinology and Metabolism 86 59645972. (https://doi.org/10.1210/jcem.86.12.8074)

    • Search Google Scholar
    • Export Citation
  • Martínez-Estrada OM, Lettice LA, Essafi A, Guadix JA, Slight J, Velecela V, Hall E, Reichmann J, Devenney PS & Hohenstein P et al.2010 Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nature Genetics 42 8993. (https://doi.org/10.1038/ng.494)

    • Search Google Scholar
    • Export Citation
  • Matsuzaki S, Canis M, Darcha C, Déchelotte PJ, Pouly JL & Mage G 2006 Expression of WT1 is down-regulated in eutopic endometrium obtained during the midsecretory phase from patients with endometriosis. Fertility and Sterility 86 554558. (https://doi.org/10.1016/j.fertnstert.2006.02.101)

    • Search Google Scholar
    • Export Citation
  • Moore AW, Schedl A, McInnes L, Doyle M, Hecksher-Sorensen J & Hastie ND 1998 YAC transgenic analysis reveals Wilms’ tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mechanisms of Development 79 169184. (https://doi.org/10.1016/s0925-4773(9800188-9)

    • Search Google Scholar
    • Export Citation
  • Nallar SC & Kalvakolanu DV 2017 GRIM-19: a master regulator of cytokine induced tumor suppression, metastasis and energy metabolism. Cytokine and Growth Factor Reviews 33 118. (https://doi.org/10.1016/j.cytogfr.2016.09.001)

    • Search Google Scholar
    • Export Citation
  • Niksic M, Slight J, Sanford JR, Caceres JF & Hastie ND 2004 The Wilms’ tumour protein (WT1) shuttles between nucleus and cytoplasm and is present in functional polysomes. Human Molecular Genetics 13 463471. (https://doi.org/10.1093/hmg/ddh040)

    • Search Google Scholar
    • Export Citation
  • Park J, Kim DH, Shah SR, Kim HN, Kshitiz, Kim P, Quiñones-Hinojosa A & Levchenko A 2019 Switch-like enhancement of epithelial-mesenchymal transition by YAP through feedback regulation of WT1 and Rho-family GTPases. Nature Communications 10 2797. (https://doi.org/10.1038/s41467-019-10729-5)

    • Search Google Scholar
    • Export Citation
  • Rauscher 3rd FJ, Morris JF, Tournay OE, Cook DM & Curran T 1990 Binding of the Wilms’ tumor locus zinc finger protein to the EGR-1 consensus sequence. Science 250 12591262. (https://doi.org/10.1126/science.2244209)

    • Search Google Scholar
    • Export Citation
  • Tamm-Rosenstein K, Simm J, Suhorutshenko M, Salumets A & Metsis M 2013 Changes in the transcriptome of the human endometrial Ishikawa cancer cell line induced by estrogen, progesterone, tamoxifen, and mifepristone (RU486) as detected by RNA-sequencing. PLoS ONE 8 e68907. (https://doi.org/10.1371/journal.pone.0068907)

    • Search Google Scholar
    • Export Citation
  • Tempest N, Maclean A & Hapangama DK 2018 Endometrial stem cell markers: current concepts and unresolved questions. International Journal of Molecular Sciences 19 126. (https://doi.org/10.3390/ijms19103240)

    • Search Google Scholar
    • Export Citation
  • Wang J, Deng X, Yang Y, Yang X, Kong B & Chao L 2016 Expression of GRIM-19 in adenomyosis and its possible role in pathogenesis. Fertility and Sterility 105 10931101. (https://doi.org/10.1016/j.fertnstert.2015.12.019)

    • Search Google Scholar
    • Export Citation
  • Wang BY, Yang Y, Deng XH, Ban YL & Chao L 2020 Interaction of M2 macrophages and endometrial cells induces downregulation of GRIM-19 in endometria of adenomyosis. Reproductive Biomedicine Online 41 790800. (https://doi.org/10.1016/j.rbmo.2020.04.022)

    • Search Google Scholar
    • Export Citation
  • Yoo JY, Ku BJ, Kim TH, Il Ahn J, Ahn JY, Yang WS, Lim JM, Taketo MM, Shin JH & Jeong JW 2020 Beta-catenin activates TGF-beta-induced epithelial-mesenchymal transition in adenomyosis. Experimental and Molecular Medicine 52 17541765. (https://doi.org/10.1038/s12276-020-00514-6)

    • Search Google Scholar
    • Export Citation
  • Yu O, Schulze-Rath R, Grafton J, Hansen K, Scholes D & Reed SD 2020 Adenomyosis incidence, prevalence and treatment: United States population-based study 2006–2015. American Journal of Obstetrics and Gynecology 223 94.e194.e10. (https://doi.org/10.1016/j.ajog.2020.01.016)

    • Search Google Scholar
    • Export Citation
  • Zhang J, Chu D, Kawamura T, Tanaka K & He S 2019 GRIM-19 repressed hypoxia-induced invasion and EMT of colorectal cancer by repressing autophagy through inactivation of STAT3/HIF-1α signaling axis. Journal of Cellular Physiology 234 1280012808. (https://doi.org/10.1002/jcp.27914)

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Yan WT, Yang ZY, Li YL, Tan XN, Jiang J, Zhang Y & Qi XW 2020 The role of WT1 in breast cancer: clinical implications, biological effects and molecular mechanism. International Journal of Biological Sciences 16 14741480. (https://doi.org/10.7150/ijbs.39958)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    Downregulation of GRIM19 and WT1 occurs in adenomyotic lesions, while WT1 is increased in endometrial glands of adenomyotic lesions accompanied by EMT. (A) Representative Western blotting images of GRIM19, WT1, SNAI1+SNAI2, CDH1 and CDH2. GAPDH bands were used for normalization in each Western blotting assay. (B, C, D and E) Expression of GRIM19 and WT1 at the protein and mRNA levels. (F, G) WT1 immunohistochemical staining of adenomyosis lesions and the normal endometrium. Scale bar = 50 μm. (H, I and J) Mean optical density (OD) of WT1 protein expression in endometrial glands of adenomyotic lesions (H), stroma of adenomyotic lesions (I) and all adenomyotic lesions (J) was measured by integrated optical density/total area. (K) Expression of CDH2, KRT8, vimentin, CDH1, SNAI1 and SNAI2 at the mRNA level. (L) Expression of CDH1 and CDH2 and SNAI1+SNAI2 at the protein level. Adenomyotic lesions in patients with adenomyosis (n  = 7) and tissues from control participants (n  = 7) were assayed as above. Data of mRNA expression are normalized to ACTB. Data are shown as the mean ± s.d. ****P  < 0.0001, **P  < 0.01, *P  < 0.05, t-test.

  • View in gallery
    Figure 2

    Downregulation of GRIM19increases the proliferation, migration and invasion of Ishikawa cells. (A and B) The downregulation of GRIM19 in the Ishikawa cell line was verified by Western blotting. (C) Cell proliferation was measured using a CCK-8 assay in negative control siRNA cells and in GRIM19 siRNA cells for 24 h. (D and E) Representative results of a wound healing assay in cells treated with negative control siRNA and GRIM19 siRNA for 24 h. Scale bar = 500 μm. (F) The gap size percentage for 24 h. (G and H) Representative results of the Transwell assay in GRIM19 siRNA (right) and negative control siRNA (left) cells for migration (top) and invasion (bottom). Scale bar = 50 μm. (I) Cell number per field of migrating cells after 24 h of incubation. (J) Cell invasion after 24-h incubation. All experiments were independently performed three times. Data are shown as the mean ± s.d., t-test.

  • View in gallery
    Figure 3

    Effects of GRIM19 on WT1 and Snail expression and EMT. (A) Relative mRNA expression by qRT-PCR. mRNA expression of GRIM19, WT1, SNAI1 and EMT markers KRT8, CDH2, CDH1 and vimentin in siRNA GRIM19-transfected Ishikawa cells compared to controls. Data are normalized to ACTB. (B and C) Representative Western blotting images and analysis of GRIM19, WT1, SNAI1+SNAI2, KRT8, CDH2 and CDH1. Protein expression is normalized to GAPDH. ***P  < 0.001; *P  < 0.05. Columns represent the mean ± s.d. of four independent determinations.

  • View in gallery
    Figure 4

    WT1, SNAIL and EMT changes in Grim19+/− mice. (A) Relative mRNA expression by qRT-PCR. mRNA expression of Grim19, Wt1 and Snai1 and EMT markers Cdh1, Krt8, Cdh2 and Vim in Grim19+/− mice compared to the control. Data are normalized to ACTB. (B and C) Representative Western blotting images and analysis of GRIM19, WT1, SNAI1+SNAI2 and CDH1 normalized to GAPDH. (D and E) Representative WT1 immunohistochemical staining photomicrographs of the uterus in WT mice and Grim19+/− mice. Scale bar = 50 μm. (F and G) Mean OD of WT1 protein expression in endometrial glands of WT mice uterus and Grim19+/− mice uterus (F), in stroma of WT mice uterus and Grim19+/− mice uterus (G). ** P  < 0.01 compared to control; *P  < 0.05, t-test. Columns represent the mean ± s.d. of four mice per group.

  • Acs G, Pasha T & Zhang PJ 2004 WT1 is differentially expressed in serous, endometrioid, clear cell, and mucinous carcinomas of the peritoneum, fallopian tube, ovary, and endometrium. International Journal of Gynecological Pathology 23 110118. (https://doi.org/10.1097/00004347-200404000-00004)

    • Search Google Scholar
    • Export Citation
  • Angell JE, Lindner DJ, Shapiro PS, Hofmann ER & Kalvakolanu DV 2000 Identification of GRIM-19, a novel cell death-regulatory gene induced by the interferon-beta and retinoic acid combination, using a genetic approach. Journal of Biological Chemistry 275 3341633426. (https://doi.org/10.1074/jbc.M003929200)

    • Search Google Scholar
    • Export Citation
  • Artibani M, Sims AH, Slight J, Aitken S, Thornburn A, Muir M, Brunton VG, Del-Pozo J, Morrison LR & Katz E et al.2017 WT1 expression in breast cancer disrupts the epithelial/mesenchymal balance of tumour cells and correlates with the metabolic response to docetaxel. Scientific Reports 7 45255. (https://doi.org/10.1038/srep45255)

    • Search Google Scholar
    • Export Citation
  • Benagiano G & Brosens I 1991 The history of endometriosis: identifying the disease. Human Reproduction 6 963968. (https://doi.org/10.1093/oxfordjournals.humrep.a137470)

    • Search Google Scholar
    • Export Citation
  • Bourdon M, Santulli P, Jeljeli M, Vannuccini S, Marcellin L, Doridot L, Petraglia F, Batteux F & Chapron C 2021 Immunological changes associated with adenomyosis: a systematic review. Human Reproduction Update 27 108129. (https://doi.org/10.1093/humupd/dmaa038)

    • Search Google Scholar
    • Export Citation
  • Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, Rose EA, Kral A, Yeger H & Lewis WH 1990 Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell 60 509520. (https://doi.org/10.1016/0092-8674(9090601-a)

    • Search Google Scholar
    • Export Citation
  • Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Search Google Scholar
    • Export Citation
  • Chen YJ, Li HY, Huang CH, Twu NF, Yen MS, Wang PH, Chou TY, Liu YN, Chao KC & Yang MH 2010 Oestrogen-induced epithelial-mesenchymal transition of endometrial epithelial cells contributes to the development of adenomyosis. Journal of Pathology 222 261270. (https://doi.org/10.1002/path.2761)

    • Search Google Scholar
    • Export Citation
  • Chen DY, Qiao H, Wang YT, Ling Z, Yin N, Fang LQ & Wang ZB 2020 Adenomyosis-derived extracellular vesicles endow endometrial epithelial cells with an invasive phenotype through epithelial-mesenchymal transition. Genes and Diseases 7 636648(https://doi.org/10.1016/j.gendis.2020.01.011)

    • Search Google Scholar
    • Export Citation
  • Critchley HOD, Babayev E, Bulun SE, Clark S, Garcia-Grau I, Gregersen PK, Kilcoyne A, Kim JJ, Lavender M & Marsh EE et al.2020 Menstruation: science and society. American Journal of Obstetrics and Gynecology 223 624664. (https://doi.org/10.1016/j.ajog.2020.06.004)

    • Search Google Scholar
    • Export Citation
  • Dongre A & Weinberg RA 2019 New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nature Reviews: Molecular Cell Biology 20 6984. (https://doi.org/10.1038/s41580-018-0080-4)

    • Search Google Scholar
    • Export Citation
  • Donnez J, Donnez O & Dolmans MM 2018 Introduction: uterine adenomyosis, another enigmatic disease of our time. Fertility and Sterility 109 369370. (https://doi.org/10.1016/j.fertnstert.2018.01.035)

    • Search Google Scholar
    • Export Citation
  • Fang Y, He W, Hu X & Wang H 2021 A method for sample size calculation via E-value in the planning of observational studies. Pharmaceutical Statistics 20 163174. (https://doi.org/10.1002/pst.2064)

    • Search Google Scholar
    • Export Citation
  • Fearnley IM, Carroll J, Shannon RJ, Runswick MJ, Walker JE & Hirst J 2001 GRIM-19, a cell death regulatory gene product, is a subunit of bovine mitochondrial NADH: ubiquinone oxidoreductase (complex I). Journal of Biological Chemistry 276 3834538348. (https://doi.org/10.1074/jbc.C100444200)

    • Search Google Scholar
    • Export Citation
  • Ferenczy A 1998 Pathophysiology of adenomyosis. Human Reproduction Update 4 312322. (https://doi.org/10.1093/humupd/4.4.312)

  • Gordts S, Grimbizis G & Campo R 2018 Symptoms and classification of uterine adenomyosis, including the place of hysteroscopy in diagnosis. Fertility and Sterility 109 380.e1–388. e1. (https://doi.org/10.1016/j.fertnstert.2018.01.006)

    • Search Google Scholar
    • Export Citation
  • Hammes A, Guo JK, Lutsch G, Leheste JR, Landrock D, Ziegler U, Gubler MC & Schedl A 2001 Two splice variants of the Wilms’ tumor 1 gene have distinct functions during sex determination and nephron formation. Cell 106 319329. (https://doi.org/10.1016/s0092-8674(0100453-6)

    • Search Google Scholar
    • Export Citation
  • Han Y, Song C, Zhang TT, Zhou QQ, Zhang XQ, Wang J, Xu BQ, Zhang XS, Liu XQ & Ying XY 2020 Wilms’ tumor 1 (WT1) promotes ovarian cancer progression by regulating E-cadherin and ERK1/2 signaling. Cell Cycle 19 26622675. (https://doi.org/10.1080/15384101.2020.1817666)

    • Search Google Scholar
    • Export Citation
  • Hao H, Liu J, Liu G, Guan D, Yang Y, Zhang X, Cao X & Liu Q 2012 Depletion of GRIM-19 accelerates hepatocellular carcinoma invasion via inducing EMT and loss of contact inhibition. Journal of Cellular Physiology 227 12121219. (https://doi.org/10.1002/jcp.24025)

    • Search Google Scholar
    • Export Citation
  • Hao M, Liu X & Guo SW 2020 Adenomyosis in mice resulting from mechanically or thermally induced endometrial-myometrial interface disruption and its possible prevention. Reproductive Biomedicine Online 41 925942. (https://doi.org/10.1016/j.rbmo.2020.07.023)

    • Search Google Scholar
    • Export Citation
  • Hashimoto R 2003 Development of the human Müllerian duct in the sexually undifferentiated stage. Anatomical Record: Part A, Discoveries in Molecular, Cellular, and Evolutionary Biology 272 514519. (https://doi.org/10.1002/ar.a.10061)

    • Search Google Scholar
    • Export Citation
  • Hosono S, Gross I, English MA, Hajra KM, Fearon ER & Licht JD 2000 E-cadherin is a WT1 target gene. Journal of Biological Chemistry 275 1094310953. (https://doi.org/10.1074/jbc.275.15.10943)

    • Search Google Scholar
    • Export Citation
  • Jeon JY, Buelow DR, Garrison DA, Niu M, Eisenmann ED, Huang KM, Zavorka Thomas ME, Weber RH, Whatcott CJ & Warner SL et al.2020 TP-0903 is active in models of drug-resistant acute myeloid leukemia. JCI Insight 5 e140169. (https://doi.org/10.1172/jci.insight.140169)

    • Search Google Scholar
    • Export Citation
  • Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D & Jaenisch R 1993 WT-1 is required for early kidney development. Cell 74 679691. (https://doi.org/10.1016/0092-8674(9390515-r)

    • Search Google Scholar
    • Export Citation
  • Li TS, Chen L, Wang SC, Yang YZ, Xu HJ, Gu HM, Zhao XJ, Dong P, Pan Y & Shang ZQ et al.2019 Magnesium isoglycyrrhizinate ameliorates fructose-induced podocyte apoptosis through downregulation of miR-193a to increase WT1. Biochemical Pharmacology 166 139152. (https://doi.org/10.1016/j.bcp.2019.05.016)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Wang X, Wan L, Liu X, Yu H, Zhang D, Sun Y, Shi Y, Zhang L & Zhou H et al.2020 TIPE2 inhibits the migration and invasion of endometrial cells by targeting β-catenin to reverse epithelial-mesenchymal transition. Human Reproduction 35 13771390. (https://doi.org/10.1093/humrep/deaa062)

    • Search Google Scholar
    • Export Citation
  • Lu B, Chen Q, Zhang X & Cheng L 2016 Serous carcinoma arising from uterine adenomyosis/adenomyotic cyst of the cervical stump: a report of 3 cases. Diagnostic Pathology 11 46. (https://doi.org/10.1186/s13000-016-0496-0)

    • Search Google Scholar
    • Export Citation
  • Makrigiannakis A, Coukos G, Mantani A, Prokopakis P, Trew G, Margara R, Winston R & White J 2001 Expression of Wilms’ tumor suppressor gene (WT1) in human endometrium: regulation through decidual differentiation. Journal of Clinical Endocrinology and Metabolism 86 59645972. (https://doi.org/10.1210/jcem.86.12.8074)

    • Search Google Scholar
    • Export Citation
  • Martínez-Estrada OM, Lettice LA, Essafi A, Guadix JA, Slight J, Velecela V, Hall E, Reichmann J, Devenney PS & Hohenstein P et al.2010 Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nature Genetics 42 8993. (https://doi.org/10.1038/ng.494)

    • Search Google Scholar
    • Export Citation
  • Matsuzaki S, Canis M, Darcha C, Déchelotte PJ, Pouly JL & Mage G 2006 Expression of WT1 is down-regulated in eutopic endometrium obtained during the midsecretory phase from patients with endometriosis. Fertility and Sterility 86 554558. (https://doi.org/10.1016/j.fertnstert.2006.02.101)

    • Search Google Scholar
    • Export Citation
  • Moore AW, Schedl A, McInnes L, Doyle M, Hecksher-Sorensen J & Hastie ND 1998 YAC transgenic analysis reveals Wilms’ tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mechanisms of Development 79 169184. (https://doi.org/10.1016/s0925-4773(9800188-9)

    • Search Google Scholar
    • Export Citation
  • Nallar SC & Kalvakolanu DV 2017 GRIM-19: a master regulator of cytokine induced tumor suppression, metastasis and energy metabolism. Cytokine and Growth Factor Reviews 33 118. (https://doi.org/10.1016/j.cytogfr.2016.09.001)

    • Search Google Scholar
    • Export Citation
  • Niksic M, Slight J, Sanford JR, Caceres JF & Hastie ND 2004 The Wilms’ tumour protein (WT1) shuttles between nucleus and cytoplasm and is present in functional polysomes. Human Molecular Genetics 13 463471. (https://doi.org/10.1093/hmg/ddh040)

    • Search Google Scholar
    • Export Citation
  • Park J, Kim DH, Shah SR, Kim HN, Kshitiz, Kim P, Quiñones-Hinojosa A & Levchenko A 2019 Switch-like enhancement of epithelial-mesenchymal transition by YAP through feedback regulation of WT1 and Rho-family GTPases. Nature Communications 10 2797. (https://doi.org/10.1038/s41467-019-10729-5)

    • Search Google Scholar
    • Export Citation
  • Rauscher 3rd FJ, Morris JF, Tournay OE, Cook DM & Curran T 1990 Binding of the Wilms’ tumor locus zinc finger protein to the EGR-1 consensus sequence. Science 250 12591262. (https://doi.org/10.1126/science.2244209)

    • Search Google Scholar
    • Export Citation
  • Tamm-Rosenstein K, Simm J, Suhorutshenko M, Salumets A & Metsis M 2013 Changes in the transcriptome of the human endometrial Ishikawa cancer cell line induced by estrogen, progesterone, tamoxifen, and mifepristone (RU486) as detected by RNA-sequencing. PLoS ONE 8 e68907. (https://doi.org/10.1371/journal.pone.0068907)

    • Search Google Scholar
    • Export Citation
  • Tempest N, Maclean A & Hapangama DK 2018 Endometrial stem cell markers: current concepts and unresolved questions. International Journal of Molecular Sciences 19 126. (https://doi.org/10.3390/ijms19103240)

    • Search Google Scholar
    • Export Citation
  • Wang J, Deng X, Yang Y, Yang X, Kong B & Chao L 2016 Expression of GRIM-19 in adenomyosis and its possible role in pathogenesis. Fertility and Sterility 105 10931101. (https://doi.org/10.1016/j.fertnstert.2015.12.019)

    • Search Google Scholar
    • Export Citation
  • Wang BY, Yang Y, Deng XH, Ban YL & Chao L 2020 Interaction of M2 macrophages and endometrial cells induces downregulation of GRIM-19 in endometria of adenomyosis. Reproductive Biomedicine Online 41 790800. (https://doi.org/10.1016/j.rbmo.2020.04.022)

    • Search Google Scholar
    • Export Citation
  • Yoo JY, Ku BJ, Kim TH, Il Ahn J, Ahn JY, Yang WS, Lim JM, Taketo MM, Shin JH & Jeong JW 2020 Beta-catenin activates TGF-beta-induced epithelial-mesenchymal transition in adenomyosis. Experimental and Molecular Medicine 52 17541765. (https://doi.org/10.1038/s12276-020-00514-6)

    • Search Google Scholar
    • Export Citation
  • Yu O, Schulze-Rath R, Grafton J, Hansen K, Scholes D & Reed SD 2020 Adenomyosis incidence, prevalence and treatment: United States population-based study 2006–2015. American Journal of Obstetrics and Gynecology 223 94.e194.e10. (https://doi.org/10.1016/j.ajog.2020.01.016)

    • Search Google Scholar
    • Export Citation
  • Zhang J, Chu D, Kawamura T, Tanaka K & He S 2019 GRIM-19 repressed hypoxia-induced invasion and EMT of colorectal cancer by repressing autophagy through inactivation of STAT3/HIF-1α signaling axis. Journal of Cellular Physiology 234 1280012808. (https://doi.org/10.1002/jcp.27914)

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Yan WT, Yang ZY, Li YL, Tan XN, Jiang J, Zhang Y & Qi XW 2020 The role of WT1 in breast cancer: clinical implications, biological effects and molecular mechanism. International Journal of Biological Sciences 16 14741480. (https://doi.org/10.7150/ijbs.39958)

    • Search Google Scholar
    • Export Citation