GDF-8 stimulates trophoblast cell invasion by inducing ALK5-SMAD2/3-mediated MMP2 expression

in Reproduction
Authors:
Lanlan FangCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Lanlan Fang in
Current site
Google Scholar
PubMed
Close
,
Zhen WangCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Zhen Wang in
Current site
Google Scholar
PubMed
Close
,
Ze WuCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Ze Wu in
Current site
Google Scholar
PubMed
Close
,
Yang YanCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Yang Yan in
Current site
Google Scholar
PubMed
Close
,
Yibo GaoCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Yibo Gao in
Current site
Google Scholar
PubMed
Close
,
Yuxi LiCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Yuxi Li in
Current site
Google Scholar
PubMed
Close
,
Jung-Chien ChengCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Jung-Chien Cheng in
Current site
Google Scholar
PubMed
Close
, and
Ying-Pu SunCenter for Reproductive Medicine, Henan Key Laboratory of Reproduction and Genetics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Ying-Pu Sun in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to J-C Cheng or Y-P Sun; Email: jungchien.cheng@gmail.com or syp2008@vip.sina.com

*(L Fang and Z Wang contributed equally to this work)

Free access

Matrix metalloproteinases (MMPs) play a pivotal role in the regulation of cell invasion. Placental trophoblast cell invasion is a precisely regulated event. Dysregulation of MMPs has been linked to various placental diseases. Growth differentiation factor-8 (GDF-8), also known as myostatin, is a member of the transforming growth factor-beta (TGF-β) superfamily. GDF-8 and its putative receptors are expressed in human extravillous cytotrophoblast cells (EVTs). Although the pro-invasive effect of GDF-8 in human EVT cells has been recently reported, the underlying molecular mechanism remains largely unknown. In this study, we investigate the effects of GDF-8 on the expression of the two most important MMPs, MMP2 and MMP9, in the HTR-8/SVneo human EVT cell line. Our results show that GDF-8 significantly upregulates the expression of MMP2. The expression of MMP9 is not affected by GDF-8. Using a siRNA-mediated knockdown approach, we reveal that the stimulatory effect of GDF-8 on MMP2 expression is mediated by the ALK5-SMAD2/3 signaling pathway. Additionally, the knockdown of MMP2 attenuates the GDF-8-induced cell invasiveness. These findings deepen our understanding of the biological roles of GDF-8 in the regulation of human trophoblast cell invasion.

Abstract

Matrix metalloproteinases (MMPs) play a pivotal role in the regulation of cell invasion. Placental trophoblast cell invasion is a precisely regulated event. Dysregulation of MMPs has been linked to various placental diseases. Growth differentiation factor-8 (GDF-8), also known as myostatin, is a member of the transforming growth factor-beta (TGF-β) superfamily. GDF-8 and its putative receptors are expressed in human extravillous cytotrophoblast cells (EVTs). Although the pro-invasive effect of GDF-8 in human EVT cells has been recently reported, the underlying molecular mechanism remains largely unknown. In this study, we investigate the effects of GDF-8 on the expression of the two most important MMPs, MMP2 and MMP9, in the HTR-8/SVneo human EVT cell line. Our results show that GDF-8 significantly upregulates the expression of MMP2. The expression of MMP9 is not affected by GDF-8. Using a siRNA-mediated knockdown approach, we reveal that the stimulatory effect of GDF-8 on MMP2 expression is mediated by the ALK5-SMAD2/3 signaling pathway. Additionally, the knockdown of MMP2 attenuates the GDF-8-induced cell invasiveness. These findings deepen our understanding of the biological roles of GDF-8 in the regulation of human trophoblast cell invasion.

Introduction

The placenta is a unique organ in eutherian mammals and plays a critical role in reproduction. In humans, during implantation, the trophoblast cells that are derived from the trophectoderm of the blastocyst start to proliferate, differentiate, and invade the underlying endometrial stroma to form chorionic villi. The chorionic villi are composed of two cell layers, the inner cytotrophoblast layer and the outer syncytiotrophoblast layer (Malassine & Cronier 2002). At the tips of the villi, cytotrophoblast proliferation forms cell columns. The highly invasive extravillous cytotrophoblast cells (EVTs) extended from cell columns invade the underlying maternal decidua and vasculature, thereby ensuring a continuous blood supply to the developing fetus throughout pregnancy (Aplin 1991). Trophoblast invasion is a tightly controlled process. Insufficient trophoblast cell invasion is associated with miscarriage, preeclampsia (PE), and intrauterine growth restriction (IUGR). In contrast, uncontrolled trophoblast cell invasion can lead to choriocarcinoma and hydatidiform moles (Lim et al. 1997, Knoeller et al. 2003).

The process of cell invasion involves not only the regulation of cellular adhesion and motility but also the remodeling and degradation of the extracellular matrix (ECM). Matrix metalloproteinases (MMPs) are calcium-dependent zinc-containing endopeptidases that mainly mediate ECM degradation and tissue remodeling. They also participate in the shedding of cell surface receptors and the processing of various signaling molecules (Page-McCaw et al. 2007). In humans, to date, 23 MMPs have been identified. Among the MMP family, MMP2 (gelatinase-A) and MMP9 (gelatinase-B) are two members that have been widely studied. It is known that MMPs-mediated ECM degradation is a necessary event for the trophoblast cell invasion (Nagase & Woessner 1999, Cohen et al. 2006). The spatiotemporal expression patterns of MMP2 and MMP9 in the human placenta suggest the important functions for MMP2 and MMP9 in placental development (Xu et al. 2002, Cohen et al. 2006). Aberrant expressions of MMP2 or MMP9 contribute to various placental diseases such as hydatidiform mole, choriocarcinoma, and recurrent spontaneous abortion (Rahat et al. 2016, Yan et al. 2021).

The transforming growth factor-beta (TGF-β) superfamily consists of many structurally related members that regulate various biological functions. Few TGF-β members such as TGF-β1-3, activin A, Nodal, bone morphogenetic protein (BMP)-2, and BMP-4 are expressed in the placenta and regulate placental functions (Chuva de Sousa Lopes et al. 2020). Growth differentiation factor-8 (GDF-8), a member of the TGF-β superfamily, was first identified in 1997 and named as myostatin because GDF-8 knockout mice exhibit a dramatic increase in muscle mass (McPherron et al. 1997). Although GDF-8 is mainly synthesized by skeletal muscle cells, GDF-8 has been reported to be expressed in the human placenta and its expression is localized to cytotrophoblast cells, syncytiotrophoblast cells, and EVTs (Peiris & Mitchell 2012, Peiris et al. 2014). Different TGF-β superfamily members bind to characteristic combinations of TGF-β type-I (TβRI) and type-II (TβRII) receptors. In humans, there are seven TβRI, known as activin receptor-like kinase 1–7 (ALK1-7) (Schmierer & Hill 2007). It has been shown that GDF-8 signals through ALK4 and ALK5 TβRI and activin type-II receptor (ActRII) TβRII (Rebbapragada et al. 2003). Generally, upon binding to its receptors, GDF-8 activates SMAD2 and SMAD3 signaling pathways (Heldin & Moustakas 2016). Activated SMAD2 or SMAD3 forms a heterocomplex with the co-SMAD, SMAD4, and then translocates into the nucleus where it regulates the expression of target genes by binding to the SMAD-specific binding element in cooperation with other co-factors (Heldin et al. 1997).

It has been shown that GDF-8 expression levels are upregulated in the placentae of PE and IUGR when compared to that in age-matched normal placentae (Guo et al. 2012, Peiris et al. 2015). Although the aberrant expressions of GDF-8 in placental diseases have been reported, thus far, little is known of the function of GDF-8 in normal placental function. A very recent study has demonstrated that GDF-8 stimulates cell invasiveness in a human EVT cell line, HTR-8SV/neo (Xie et al. 2020). However, the mechanisms that mediate this process remain largely unknown. Given the role of MMP2/9 in the regulation of cell invasion and the upregulations of their expression in placentae of PE (Jin et al. 2017, Zhang et al. 2019, Suo et al. 2020), the present study aims to examine the effect of GDF-8 on MMP2/9 expression in human EVT cells and explore the underlying mechanisms.

Materials and methods

Cell culture and treatments

The HTR-8/SVneo cell line was obtained from American Type Culture Collection through an official distributor in China (Beijing Zhongyuan Limited). HTR-8/SVneo is an SV40 large T antigen immortalized first-trimester short-lived EVT cell line (Graham et al. 1993). Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 Ham medium (DMEM/F-12; Gibco) supplemented with 10% charcoal/dextran-treated FBS (HyClone), 100 U/mL penicillin, and 100 μg/mL streptomycin sulfate (Boster) was used for cell culture. Cells were cultured in a humidified atmosphere containing 5% CO2 and 21% O2 (standard culture condition) at 37°C (Peiris et al. 2015). It has been shown that the plasma concentrations of GDF-8 in normal women and PE patients can reach 40 ng/mL and 60 ng/mL, respectively (Peiris et al. 2015). Therefore, 30 ng/mL GDF-8 was used in the present study. For GDF-8 treatments, HTR-8/SVneo cells were cultured in 6-well plates with 2 mL of culture medium. Cells were grown to 80% confluence and serum-starved in a medium without FBS for 24 h to induce quiescence before treatments. All treatments for cells were performed in a medium without FBS. The recombinant human GDF-8 (R&D systems) was solubilized in PBS. The SB431542 (Sigma) was dissolved in DMSO. All groups in each experiment were exposed to all the relevant vehicles for that experiment.

Reverse transcription quantitative real-time PCR (RT-qPCR)

Total RNA was extracted with the RNeasy Plus Mini Kit (QIAGEN) according to the manufacturer’s instructions. RNA (1 μg) was reverse-transcribed into first-strand cDNA with the iScript RT Kit (Bio-Rad Laboratories). Each 20 μL qPCR reaction contained 1× SYBR Green PCR Master Mix (Applied Biosystems), 60 ng of cDNA, and 250 nM of each specific primer. The primer sequences used for the present study are presented in Table 1. qPCR was performed on an Applied Biosystems QuantStudio 12K Flex system equipped with 96-well optical reaction plates. The specificity of each assay was validated by melting curve analysis and agarose gel electrophoresis of the PCR products. All of the RT-qPCR experiments were run in triplicate, and a mean value was used to determine the mRNA levels. Water and mRNA without RT were used as negative controls. Relative quantification of the mRNA levels was performed using the comparative Ct method with GAPDH as the reference gene and using the formula 2−ΔΔCt (Livak & Schmittgen 2001, Schmittgen & Livak 2008).

Table 1

Primer sequences.

Name of gene Forward Reverse
MMP2 TACACCAAGAACTTCCGTCTGT AATGTCAGGAGAGGCCCCAT
MMP9 TTGACAGCGACAAGAAGTGG CCCTCAGTGAAGCGGTACAT
ALK4 TCTCTCCACCTCAGGGTCTG GCCATACTTCCCCAAACCGA
ALK5 GTTAAGGCCAAATATCCCAAACA ATAATTTTAGCCATTACTCTCAAGG
SMAD2 CCGAAATGCCACGGTAGAAA GGGCTCTGCACAAAGATTGC
SMAD3 CCCCAGCACATAATAACTTGG AGGAGATGGAGCACCAGAAG
SMAD4 TCCACAGGACAGAAGCCATT GTCACTAAGGCACCTGACCC
GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG

Western blot

Cells were lysed in cell lysis buffer (Cell Signaling Technology) supplemented with a protease inhibitor cocktail (Sigma). The protein concentration was analyzed by the BCA protein assay kit (Pierce, Thermo Scientific). Equal amounts (50 µg) of protein were separated by SDS-PAGE and transferred onto PVDF membranes. After 1 h of blocking with 5% nonfat dry milk in Tris-buffered saline (TBS), the membranes were incubated overnight at 4°C with primary antibodies diluted in 5% nonfat milk/TBS. The sources and dilutions for antibodies were: MMP2 (1000×, Cell Signaling Technology, #40994), MMP9 (1000×, Cell Signaling Technology, #13667), phospho-SMAD2 (1000×, Cell Signaling Technology, #3108), phospho-SMAD3 (1000×, Cell Signaling Technology, #9520), SMAD2 (1000×, Cell Signaling Technology, #3103), SMAD3 (1000×, Cell Signaling Technology, #9523), and SMAD4 (1000×, Cell Signaling Technology, #38454), and α-tubulin antibody (5000×, Santa Cruz Biotechnology, #sc-23948). Following primary antibody incubation, the membranes were incubated with appropriate HRP-conjugated secondary antibodies (Bio-Rad Laboratories). Immunoreactive bands were detected using an enhanced chemiluminescent substrate (Bio-Rad Laboratories) and imaged with a ChemiDoc MP Imager (Bio-Rad Laboratories). Band intensities were quantified using the Scion Image software and normalized to α-tubulin.

Small interfering RNA (siRNA) transfection

To knock down endogenous ALK4 (#L-004925-00-0020), ALK5 (#L-003929-00-0020), SMAD2 (#L-003561-00-0020), SMAD3 (#L-020067-00-0020), SMAD4 (#L-003902-00-0020), or MMP2 (#L-005959-00-0005), HTR-8/SVneo cells were cultured in 6-well plates and grown to 70–80% confluence. Cells were transfected with 50 nM ON-TARGETplus SMARTpool siRNA targeting a specific gene (Dharmacon) using Lipofectamine RNAiMAX (Invitrogen) as per the manufacturer’s instructions in culture medium supplemented with 10% FBS for 24 h. On the next day, cells were serum-starved in a medium without FBS for 24 h to induce quiescence before treatments. The 50 nM ON-TARGETplus siCONTROL NON-TARGETING pool siRNA (#D-001810-10-50, Dharmacon) was used as the transfection control. The knockdown efficiency of specific siRNA was examined by RT-qPCR or Western blot.

Invasion assay

Invasion assays were performed according to a previously published method, with minor modifications (Woo et al. 2007). Transwell cell culture inserts (8 µm pore size, 24-wells, BD Biosciences) were coated with 50 µL of 1 mg/mL growth factor-reduced Matrigel (BD Biosciences). Cells (1 × 105 cells/insert) in DMEM/F-12 medium supplemented with 0.1% FBS were incubated for 48 h against a gradient of 10% FBS. Non-invasive cells were removed with a cotton swab from the upper side of the membrane. Cells that penetrated the membrane were fixed with cold methanol, stained with crystal violet (0.5%, Sigma) for 30 min, and subsequently washed thoroughly with non-sterile tap water. Each experiment was performed with triplicate inserts. In each insert, five microscopic fields were photographed under an optical microscope, and the cell number was counted manually.

Statistical analysis

At least three independent experiments performed on separate cell passages were conducted to achieve the biological replicates. Results from a minimum of three independent experiments were pooled and presented as the mean ± s.e.m. All statistical analyses were analyzed by PRISM software. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. A significant difference was defined as P < 0.05. One of the most popular ways to present pairwise treatment comparisons is by a letter display, in which bars are topped by letters allowing the reader to infer at a glance whether two treatment means are significantly different or not (Piepho 2018). Therefore, in our results, values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Results

GDF-8 stimulates MMP2, but not MMP9, expression in human EVT cells

To examine the effects of GDF-8 on MMP2 and MMP9 expression, a human EVT cell line, HTR-8/SVneo, was used as an experimental model. HTR-8/SVneo cells were treated with 30 ng/mL of recombinant GDF-8 for 1, 3, 6, 12, and 24 h (Fang et al. 2015, Xie et al. 2020). As shown in Fig. 1A, GDF-8 significantly upregulated MMP2 mRNA levels after 6 h of treatment (P = 0.0034). The most significant effect was observed after 24 h of GDF-8 treatment (P < 0.0001). Interestingly, treatment with GDF-8 for any period of time did not affect the mRNA levels of MMP9. Western blot results showed that the protein levels of MMP2, but not that of MMP9, were significantly upregulated after 12 h (P = 0.009) and 24 h (P < 0.0001) of GDF-8 treatments (Fig. 1B). These results suggest that MMP2, but not MMP9, may mediate the pro-invasive effect of GDF-8 in human EVT cells.

Figure 1
Figure 1

GDF-8 stimulates MMP2, but not MMP9, expression in HTR-8/SVneo cells. (A) Cells were treated with GDF-8 (G8) for different periods of time, and the mRNA levels of MMP2 and MMP9 were examined by RT-qPCR. The RT-qPCR results are normalized to the 1 h-untreated control and expressed as mean ± s.e.m. of four independent experiments. (B) Cells were treated with GDF-8 (G8) for 6, 12, and 24 h. The protein levels of MMP2 and MMP9 were examined by Western blot. The Western blot results are normalized to the 6 h-untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Citation: Reproduction 162, 5; 10.1530/REP-21-0197

ALK5, but not ALK4, mediates GDF-8-induced MMP2 expression

To define the involvement of ALK4 and ALK5 in GDF-8-induced MMP2 expression, a potent ALK4/5/7 inhibitor, SB431542, was employed to block the function of ALK4 and ALK5 (Inman et al. 2002). As shown in Fig. 2A, pretreatment with 10 µM SB431542 for 1 h abolished the stimulatory effect of 30 ng/mL GDF-8 on MMP2 mRNA levels (P < 0.0001). Similar results for the MMP2 protein levels were observed by Western blot analysis (P < 0.0001) (Fig. 2B). Since SB431542 blocks both ALK4 and ALK5, to further distinguish their involvement in GDF-8-induced MMP2 expression, siRNA-mediated knockdown of ALK4 or ALK5 was applied. As shown in Fig. 2C, transfection of HTR-8/SVneo cells with ALK4 siRNA significantly downregulated endogenous ALK4 mRNA levels (P < 0.0001) without affecting the mRNA levels of ALK5 and vice versa for ALK5 siRNA. Interestingly, knockdown of ALK4 did not affect the stimulatory effect of GDF-8 on MMP2 mRNA levels. The GDF-8-induced MMP2 mRNA levels were blocked by the knockdown of ALK5 (P < 0.0001). Western blot results showed the same effects that GDF-8-induced MMP2 protein expression was blocked by the knockdown of ALK5, but not by the ALK4 knockdown (P < 0.0001) (Fig. 2D).

Figure 2
Figure 2

The stimulatory effect of GDF-8 on MMP2 expression is mediated by ALK5. (A and B) Cells were pretreated with vehicle control (DMSO) or 10 µM SB431542 for 1 h and then treated with GDF-8 (G8) for 24 h. The mRNA (A) and protein (B) levels of MMP2 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the DMSO-treated control and expressed as mean ± s.e.m. of three independent experiments. (C and D) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl), ALK4 siRNA (si-ALK4), or ALK5 siRNA (si-ALK5) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (C) and protein (D) levels of MMP2 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Citation: Reproduction 162, 5; 10.1530/REP-21-0197

Both SMAD2 and SMAD3 are required for GDF-8-induced MMP2 expression

As expected, treatment with 30 ng/mL GDF-8 for 30 and 60 min induced phosphorylation of SMAD2 and SMAD3 indicating their activations (Fig. 3A) (Xie et al. 2020). To examine the involvement of the SMAD signaling pathway in GDF-8-induced MMP2 expression, specific siRNA was used to knock down the expression of the common SMAD4. As shown in Fig. 3B and C, SMAD4 siRNA significantly downregulated SMAD4 mRNA and protein levels (P < 0.0001). In addition, knockdown of SMAD4 abolished the stimulatory effect of GDF-8 on MMP2 mRNA (P < 0.0001) and protein levels (P < 0.0001) (Fig. 3B and C). Although SMAD2 and SMAD3 are highly homologous, they can mediate TGF-β-regulated cellular functions redundantly and differentially in a context-dependent manner (Brown et al. 2007). Therefore, we examined whether SMAD2 and SMAD3 play the same role in mediating GDF-8-induced MMP2 expression in HTR-8/SVneo cells. As shown in Fig. 4A, transfected cells with SMAD2 siRNA downregulated endogenous SMAD2 mRNA levels (P < 0.0001) without affecting the mRNA levels of SMAD3 and vice versa for SMAD3 siRNA. The GDF-8-induced MMP2 mRNA levels were attenuated by knockdown of SMAD2 (P < 0.0001) or knockdown of SMAD3 (P < 0.0001) (Fig. 4A). Interestingly, knockdown of SMAD2 exhibited a greater inhibitory effect on GDF-8-induced MMP2 mRNA levels compared with knockdown of SMAD3. Similar results were observed for the MMP2 protein levels by Western blot analysis (Fig. 4B).

Figure 3
Figure 3

Activation of the SMAD signaling pathway is required for GDF-8-induced MMP2 expression. (A) HTR-8/SVneo cells were treated with GDF-8 (G8) for 10, 30, and 60 min. The levels of phosphorylated and total forms of SMAD2 and SMAD3 were determined by Western blot. (B and C) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or SMAD4 siRNA (si-SMAD4) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (B) and protein (C) levels of MMP2 and SMAD4 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Citation: Reproduction 162, 5; 10.1530/REP-21-0197

Figure 4
Figure 4

Both SMAD2 and SMAD3 are involved in GDF-8-induced MMP2 expression. (A and B) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl), SMAD2 siRNA (si-SMAD2), or SMAD3 siRNA (si-SMAD3) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (A) and protein (B) levels of MMP2, SMAD2, and SMAD3 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Citation: Reproduction 162, 5; 10.1530/REP-21-0197

MMP2 is required for GDF-8-stimulated human EVT cell invasion

To examine the involvement of MMP2 in GDF-8-stimulated cell invasion, a siRNA-mediated knockdown approach was used to block the expression of MMP2. As shown in Fig. 5A, the levels of basal endogenous MMP2 were downregulated by transfecting cells with MMP2 siRNA (P < 0.0001). In addition, MMP2 siRNA abolished the 30 ng/mL GDF-8-induced MMP2 protein levels (P < 0.0001). A matrigel transwell invasion assay showed that treatment with 30 ng/mL GDF-8 stimulated HTR-8/SVneo cell invasion (P = 0.0024) which was consistent with the results reported by a recent study (Xie et al. 2020). Importantly, the GDF-8-stimulated cell invasiveness was attenuated by the knockdown of MMP2 (P = 0.0045) (Fig. 5B). Taken together, these results indicate that the induction of MMP2 expression is required for the GDF-8-stimulated human EVT cell invasion.

Figure 5
Figure 5

MMP2 mediates GDF-8-stimulated cell invasiveness. (A) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or MMP2 siRNA (si-MMP2) for 48 h and then treated with GDF-8 (G8) for 24 h. The protein levels of MMP2 were examined by Western blot. The Western blot results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. (B) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or MMP2 siRNA (si-MMP2) for 48 h and then treated with GDF-8 (G8). After treatment, the levels of cell invasiveness were measured by the matrigel transwell invasion assay. The top panel shows representative photos of the invasion assay. Original magnification: 100×. The scale bar represents 50 μm. The bottom panels show summarized quantitative results. The invasion assay results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as the mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

Citation: Reproduction 162, 5; 10.1530/REP-21-0197

Discussion

MMPs play a critical role in human trophoblast invasion into the uterine wall. In addition, MMPs are required for transforming the spiral vessels and create an optimum environment for embryonic development (Pollheimer et al. 2014). MMP2 and MMP9 are abundantly expressed in invading human EVT cells and the expression levels of these two enzymes are highly associated with the invasiveness of EVT cells (Isaka et al. 2003, Suman & Gupta 2012). It has been shown that the expression of MMP2 is increased at 6 to 8 weeks of gestation age and then declines, whereas the expression of MMP9 elevates from 8 to 11 weeks of gestation age (Staun-Ram et al. 2004). These specific temporal expression patterns of MMP2 and MMP9 indicate that MMP2 and MMP9 have different functional roles during the early stage of gestation. It is known that human placental tissues express GDF-8 throughout gestation and the expression of GDF-8 decreases with gestational age (Mitchell et al. 2006). In the present study, our results showed that treatment with GDF-8 upregulated MMP2, but not MMP9, in human EVT cells. Taken together, these results suggest that GDF-8 may play a more important role in the regulation of EVT invasion in the early stage of gestation by inducing MMP2 expression.

It has been shown that inhibition of MMP2 and MMP9 activities or siRNA-mediated knockdown of their expressions suppresses the basal invasiveness in human EVT cells (Peng et al. 2016). These findings indicate that both MMP2 and MMP9 are required for the EVT cell invasion. In the present study, we showed that knockdown of MMP2 decreased 40% of the basal invasiveness in HTR-8/SVneo cells although the statistical significance was not reached. Importantly, MMP2 knockdown attenuated GDF-8-stimulated cell invasiveness which reveals the involvement of MMP2 in the pro-invasive effect of GDF-8 on EVT cells. However, since the knockdown of MMP2 did not completely block the pro-invasive effect of GDF-8 on HTR-8/SVneo cells, the involvement of other cellular factors seems plausible. Therefore, more studies will be needed to delineate the molecular mechanisms that mediate the stimulatory effect of GDF-8 on human EVT cell invasion.

PE is a serious complication of pregnancy defined by high blood pressure and proteinuria. Insufficient trophoblast cell invasion has been considered as a major factor that contributes to the pathogenesis of PE (Lim et al. 1997, Steegers et al. 2010). Previous studies have shown that the expression levels of both MMP2 and MMP9 are downregulated in the placentae of patients with PE when compared to those in placentae of normal women with similar gestation age (Jin et al. 2017, Zhang et al. 2019, Suo et al. 2020). Interestingly, upregulation of GDF-8 levels in placentae is observed in women with PE (Guo et al. 2012, Peiris et al. 2015). Given the stimulatory effect of GDF-8 on MMP2 expression reported by the present study, these findings collectively suggest that the upregulation of GDF-8 in the placentae of PE could be a compensatory effect against the insufficient trophoblast cell invasion.

In a context-dependent manner, the biological function of GDF-8 is mediated by ALK4 and/or ALK5. We have shown that GDF-8 downregulates the expression of steroidogenic acute regulatory (StAR) protein and pentraxin 3 through ALK5, but not ALK4, in human ovarian granulosa cells (Chang et al. 2015, Fang et al. 2015). Both ALK4 and ALK5 are involved in GDF-8-induced downregulation of E-cadherin expression in human ovarian cancer cells (Zhao et al. 2016). A recent study shows that GDF-8 stimulates the expression of follistatin-like protein 3 through only ALK5 in HTR-8/SVneo cells (Xie et al. 2020). Our result showed that the stimulatory effect of GDF-8 on MMP2 expression in HTR-8/SVneo cells was mediated by ALK5, but not ALK4. Collectively, these results agreed with a previous study showing that the biological function of GDF-8 in myogenic cells is mainly mediated by ALK4, while ALK5 mediates GDF-8 function in non-myogenic cells (Kemaladewi et al. 2012). Several cis-elements have been identified in promoters of different MMP genes and that together with corresponding trans-activators mediate either activation or repression of gene expression. MMP2 promoter does not harbor TATA boxes and proximal AP-1 site which makes the transcription of MMP2 start at multiple sites at the promoters (Yan & Boyd 2007). To the best of our knowledge, thus far, the effect of GDF-8 on MMPs expression in human EVT cells has not been examined. TGF-β1 has been shown to stimulate MMP2 expression in different types of cancer cells (Santibanez et al. 2018). However, most studies focus on the involvement of non-SMAD signaling pathways (Santibanez et al. 2018). In the present study, using the siRNA-mediated SMAD4 knockdown approach, we demonstrated that activation of the SMAD signaling pathway is required for GDF-8-stimulated MMP2 expression in human EVT cells. SMAD2 and SMAD3 are two sequence-similar proteins and might mediate different cellular responses and actions in a context-dependent manner (Brown et al. 2007). We have shown that SMAD3, but not SMAD2, is required for the GDF-8-induced downregulation of StAR protein expression and progesterone production in human ovarian granulosa cells (Fang et al. 2015). In the same cells, both SMAD2 and SMAD3 are required for the GDF-8-induced connective tissue growth factor expression (Chang et al. 2016). Using SMAD2-KO or SMAD3-KO mouse fibroblast cells, a previous study shows that TGF-β1-stimulated MMP2 expression depends on SMAD2 but not SMAD3 (Piek et al. 2001). In this study, we showed that the stimulatory effect of GDF-8 on MMP2 expression was attenuated by the knockdown of SMAD2 and knockdown of SMAD3. These results indicate that activations of both SMAD2 and SMAD3 signaling pathways are involved in the stimulatory action of GDF-8 on the MMP2 expression in human EVT cells. Various transcription factors participate in the regulation of MMPs by interacting with SMAD2/3. However, the transcription machinery that mediates the GDF-8-stimulated MMP2 expression remains largely unknown and needs further investigation.

The HTR-8/SVneo cell line was generated using first-trimester EVT cells infected with simian virus 40 large T antigen (Graham et al. 1993). To date, the HTR-8/SVneo cell line remains the most commonly used cell model to study the biological functions of human EVT cells. However, a previous microarray study has shown that primary EVT cells and HTR-8/SVneo cells are distinguishable based on their gene expression profiles (Bilban et al. 2010). In addition, another study using immunofluorescence, RT-qPCR, and Western blot analyses unveils the presence of a heterogeneous population of trophoblast and stromal cells within the HTR-8/SVneo cell line (Abou-Kheir et al. 2017). We are aware that the results of the present study were derived solely from the HTR-8/SVneo cell line. Therefore, the stimulatory effect of GDF-8 on MMP2 expression and underlying mechanisms need to be further confirmed in human primary EVT cells.

In summary, the current study demonstrates that MMP2 is upregulated by GDF-8 and mediates cell invasion in the HTR-8/SVneo cell line, which is a model of human EVT cells. In addition, we reveal that GDF-8 stimulates MMP2 expression by activating ALK5-mediated SMAD2 and SMAD3 signaling pathways. These results demonstrate the physiological role of GDF-8 in the regulation of MMP2 expression in human EVT cells and might help develop new strategies for the treatment of placental diseases.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the operating grant from the National Natural Science Foundation of China (32070848), the Key R&D Program of Henan Province (202102310062), Henan Province Medical Science and Technique R&D Program (SBGJ202002052), and Special Fund for Young Teachers from the Zhengzhou University (JC202054006) to Lanlan Fang as well as by the Research Fund for International Young Scientists from the National Natural Science Foundation of China (32050410302) and Henan Province Medical Science and Technique R&D Program (SBGJ202002046) to Jung-Chien Cheng. This work was also supported by the National Natural Science Foundation of China for the National Key R&D Program of China (2019YFA 0110900) and the International (Regional) Cooperation and Exchange Projects (81820108016) to Ying-Pu Sun.

Author contribution statement

L F, J C C, and Y P S contributed to the study design, analysis, and interpretation of data. J C C and Y P S contributed to the manuscript drafting. L F, Z W, Z W, Y Y, Y G, and Y L performed the experiments and prepared figures.

Acknowledgement

The authors thank the staff in the Center for Reproductive Medicine at the First Affiliated Hospital of Zhengzhou University for their assistance.

References

  • Abou-Kheir W, Barrak J, Hadadeh O & Daoud G 2017 HTR-8/SVneo cell line contains a mixed population of cells. Placenta 50 17. (https://doi.org/10.1016/j.placenta.2016.12.007)

    • Search Google Scholar
    • Export Citation
  • Aplin JD 1991 Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. Journal of Cell Science 99 681692. (https://doi.org/10.1242/jcs.99.4.681)

    • Search Google Scholar
    • Export Citation
  • Bilban M, Tauber S, Haslinger P, Pollheimer J, Saleh L, Pehamberger H, Wagner O & Knofler M 2010 Trophoblast invasion: assessment of cellular models using gene expression signatures. Placenta 31 989996. (https://doi.org/10.1016/j.placenta.2010.08.011)

    • Search Google Scholar
    • Export Citation
  • Brown KA, Pietenpol JA & Moses HL 2007 A tale of two proteins: differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling. Journal of Cellular Biochemistry 101 933. (https://doi.org/10.1002/jcb.21255)

    • Search Google Scholar
    • Export Citation
  • Chang HM, Fang L, Cheng JC, Klausen C, Sun YP & Leung PC 2015 Growth differentiation factor 8 down-regulates PENTRAXIN 3 in human granulosa cells. Molecular and Cellular Endocrinology 404 8290. (https://doi.org/10.1016/j.mce.2015.01.036)

    • Search Google Scholar
    • Export Citation
  • Chang HM, Fang Y, Liu PP, Cheng JC, Yang X & Leung PC 2016 Connective tissue growth factor mediates growth differentiation factor 8-induced increase of lysyl oxidase activity in human granulosa-lutein cells. Molecular and Cellular Endocrinology 434 186198. (https://doi.org/10.1016/j.mce.2016.07.007)

    • Search Google Scholar
    • Export Citation
  • Chuva de Sousa Lopes SM, Alexdottir MS & Valdimarsdottir G 2020 The TGFbeta family in human placental development at the fetal-maternal interface. Biomolecules 10 453. (https://doi.org/10.3390/biom10030453)

    • Search Google Scholar
    • Export Citation
  • Cohen M, Meisser A & Bischof P 2006 Metalloproteinases and human placental invasiveness. Placenta 27 783793. (https://doi.org/10.1016/j.placenta.2005.08.006)

    • Search Google Scholar
    • Export Citation
  • Fang L, Chang HM, Cheng JC, Yu Y, Leung PC & Sun YP 2015 Growth differentiation factor-8 decreases StAR expression through ALK5-mediated Smad3 and ERK1/2 signaling pathways in luteinized human granulosa cells. Endocrinology 156 46844694. (https://doi.org/10.1210/en.2015-1461)

    • Search Google Scholar
    • Export Citation
  • Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N & Lala PK 1993 Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Experimental Cell Research 206 204211. (https://doi.org/10.1006/excr.1993.1139)

    • Search Google Scholar
    • Export Citation
  • Guo J, Tian T, Lu D, Xia G, Wang H & Dong M 2012 Alterations of maternal serum and placental follistatin-like 3 and myostatin in pre-eclampsia. Journal of Obstetrics and Gynaecology Research 38 988996. (https://doi.org/10.1111/j.1447-0756.2011.01823.x)

    • Search Google Scholar
    • Export Citation
  • Heldin CH & Moustakas A 2016 Signaling receptors for TGF-beta family members. Cold Spring Harbor Perspectives in Biology 8 a022053. (https://doi.org/10.1101/cshperspect.a022053)

    • Search Google Scholar
    • Export Citation
  • Heldin CH, Miyazono K & ten Dijke P 1997 TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390 465471. (https://doi.org/10.1038/37284)

    • Search Google Scholar
    • Export Citation
  • Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, Laping NJ & Hill CS 2002 SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Molecular Pharmacology 62 6574. (https://doi.org/10.1124/mol.62.1.65)

    • Search Google Scholar
    • Export Citation
  • Isaka K, Usuda S, Ito H, Sagawa Y, Nakamura H, Nishi H, Suzuki Y, Li YF & Takayama M 2003 Expression and activity of matrix metalloproteinase 2 and 9 in human trophoblasts. Placenta 24 5364. (https://doi.org/10.1053/plac.2002.0867)

    • Search Google Scholar
    • Export Citation
  • Jin M, Li H, Xu H, Huo G & Yao Y 2017 MicroRNA-20b inhibits trophoblast cell migration and invasion by targeting MMP-2. International Journal of Clinical and Experimental Pathology 10 1090110909. (https://doi.org/10)

    • Search Google Scholar
    • Export Citation
  • Kemaladewi DU, de Gorter DJ, Aartsma-Rus A, van Ommen GJ, ten Dijke P, ‘t Hoen PAC & Hoogaars WM 2012 Cell-type specific regulation of myostatin signaling. FASEB Journal 26 14621472. (https://doi.org/10.1096/fj.11-191189)

    • Search Google Scholar
    • Export Citation
  • Knoeller S, Lim E, Aleta L, Hertwig K, Dudenhausen JW & Arck PC 2003 Distribution of immunocompetent cells in decidua of controlled and uncontrolled (choriocarcinoma/hydatidiform mole) trophoblast invasion. American Journal of Reproductive Immunology 50 4147. (https://doi.org/10.1034/j.1600-0897.2003.00046.x)

    • Search Google Scholar
    • Export Citation
  • Lim KH, Zhou Y, Janatpour M, McMaster M, Bass K, Chun SH & Fisher SJ 1997 Human cytotrophoblast differentiation/invasion is abnormal in pre-eclampsia. American Journal of Pathology 151 18091818.

    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 402408. (https://doi.org/10.1006/meth.2001.1262)

    • Search Google Scholar
    • Export Citation
  • Malassine A & Cronier L 2002 Hormones and human trophoblast differentiation: a review. Endocrine 19 311. (https://doi.org/10.1385/ENDO:19:1:3)

    • Search Google Scholar
    • Export Citation
  • McPherron AC, Lawler AM & Lee SJ 1997 Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387 8390. (https://doi.org/10.1038/387083a0)

    • Search Google Scholar
    • Export Citation
  • Mitchell MD, Osepchook CC, Leung KC, McMahon CD & Bass JJ 2006 Myostatin is a human placental product that regulates glucose uptake. Journal of Clinical Endocrinology and Metabolism 91 14341437. (https://doi.org/10.1210/jc.2005-2361)

    • Search Google Scholar
    • Export Citation
  • Nagase H & Woessner Jr JF 1999 Matrix metalloproteinases. Journal of Biological Chemistry 274 2149121494. (https://doi.org/10.1074/jbc.274.31.21491)

    • Search Google Scholar
    • Export Citation
  • Page-McCaw A, Ewald AJ & Werb Z 2007 Matrix metalloproteinases and the regulation of tissue remodelling. Nature Reviews: Molecular Cell Biology 8 221233. (https://doi.org/10.1038/nrm2125)

    • Search Google Scholar
    • Export Citation
  • Peiris HN & Mitchell MD 2012 The expression and potential functions of placental myostatin. Placenta 33 902907. (https://doi.org/10.1016/j.placenta.2012.06.021)

    • Search Google Scholar
    • Export Citation
  • Peiris HN, Salomon C, Payton D, Ashman K, Vaswani K, Chan A, Rice GE & Mitchell MD 2014 Myostatin is localized in extravillous trophoblast and up-regulates migration. Journal of Clinical Endocrinology and Metabolism 99 E2288E2297. (https://doi.org/10.1210/jc.2014-2615)

    • Search Google Scholar
    • Export Citation
  • Peiris HN, Georgiou H, Lappas M, Kaitu’u-Lino T, Salomon C, Vaswani K, Rice GE & Mitchell MD 2015 Expression of myostatin in intrauterine growth restriction and preeclampsia complicated pregnancies and alterations to cytokine production by first-trimester placental explants following myostatin treatment. Reproductive Sciences 22 12021211. (https://doi.org/10.1177/1933719115572482)

    • Search Google Scholar
    • Export Citation
  • Peng B, Zhu H, Klausen C, Ma L, Wang YL & Leung PC 2016 GnRH regulates trophoblast invasion via RUNX2-mediated MMP2/9 expression. Molecular Human Reproduction 22 119129. (https://doi.org/10.1093/molehr/gav070)

    • Search Google Scholar
    • Export Citation
  • Piek E, Ju WJ, Heyer J, Escalante-Alcalde D, Stewart CL, Weinstein M, Deng C, Kucherlapati R, Bottinger EP & Roberts AB 2001 Functional characterization of transforming growth factor beta signaling in Smad2- and Smad3-deficient fibroblasts. Journal of Biological Chemistry 276 1994519953. (https://doi.org/10.1074/jbc.M102382200)

    • Search Google Scholar
    • Export Citation
  • Piepho H-P 2018 Letters in mean comparisons: what they do and don’t mean. Agronomy Journal 110 431434. (https://doi.org/10.2134/agronj2017.10.0580)

    • Search Google Scholar
    • Export Citation
  • Pollheimer J, Fock V & Knofler M 2014 Review: the ADAM metalloproteinases – novel regulators of trophoblast invasion? Placenta 35 (Supplement) S57S63. (https://doi.org/10.1016/j.placenta.2013.10.012)

    • Search Google Scholar
    • Export Citation
  • Rahat B, Sharma R, Bagga R, Hamid A & Kaur J 2016 Imbalance between matrix metalloproteinases and their tissue inhibitors in preeclampsia and gestational trophoblastic diseases. Reproduction 152 1122. (https://doi.org/10.1530/REP-16-0060)

    • Search Google Scholar
    • Export Citation
  • Rebbapragada A, Benchabane H, Wrana JL, Celeste AJ & Attisano L 2003 Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Molecular and Cellular Biology 23 72307242. (https://doi.org/10.1128/MCB.23.20.7230-7242.2003)

    • Search Google Scholar
    • Export Citation
  • Santibanez JF, Obradovic H, Kukolj T & Krstic J 2018 Transforming growth factor-beta, matrix metalloproteinases, and urokinase-type plasminogen activator interaction in the cancer epithelial to mesenchymal transition. Developmental Dynamics 247 382395. (https://doi.org/10.1002/dvdy.24554)

    • Search Google Scholar
    • Export Citation
  • Schmierer B & Hill CS 2007 TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nature Reviews: Molecular Cell Biology 8 970982. (https://doi.org/10.1038/nrm2297)

    • Search Google Scholar
    • Export Citation
  • Schmittgen TD & Livak KJ 2008 Analyzing real-time PCR data by the comparative C(T) method. Nature Protocols 3 11011108. (https://doi.org/10.1038/nprot.2008.73)

    • Search Google Scholar
    • Export Citation
  • Staun-Ram E, Goldman S, Gabarin D & Shalev E 2004 Expression and importance of matrix metalloproteinase 2 and 9 (MMP-2 and -9) in human trophoblast invasion. Reproductive Biology and Endocrinology 2 59. (https://doi.org/10.1186/1477-7827-2-59)

    • Search Google Scholar
    • Export Citation
  • Steegers EA, von Dadelszen P, Duvekot JJ & Pijnenborg R 2010 Pre-eclampsia. Lancet 376 631644. (https://doi.org/10.1016/S0140-6736(1060279-6)

  • Suman P & Gupta SK 2012 Comparative analysis of the invasion-associated genes expression pattern in first trimester trophoblastic (HTR-8/SVneo) and JEG-3 choriocarcinoma cells. Placenta 33 874877. (https://doi.org/10.1016/j.placenta.2012.06.017)

    • Search Google Scholar
    • Export Citation
  • Suo M, Sun Y, Yang H, Ji J, He Y, Dong L, Wang Y, Zhang Y, Zhang Y & Hao M 2020 miR-183-5p suppressed the invasion and migration of HTR-8/SVneo trophoblast cells partly via targeting MMP-9 in preeclampsia. Bioscience Reports 40 BSR20192575. (https://doi.org/10.1042/BSR20192575)

    • Search Google Scholar
    • Export Citation
  • Woo MM, Salamanca CM, Minor A & Auersperg N 2007 An improved assay to quantitate the invasiveness of cells in modified Boyden chambers. In Vitro Cellular and Developmental Biology: Animal 43 79. (https://doi.org/10.1007/s11626-006-9002-4)

    • Search Google Scholar
    • Export Citation
  • Xie J, Zhu H, Chang HM, Klausen C, Dong M & Leung PCK 2020 GDF8 promotes the cell invasiveness in human trophoblasts by upregulating the expression of follistatin-like 3 through the ALK5-SMAD2/3 signaling pathway. Frontiers in Cell and Developmental Biology 8 573781. (https://doi.org/10.3389/fcell.2020.573781)

    • Search Google Scholar
    • Export Citation
  • Xu P, Alfaidy N & Challis JR 2002 Expression of matrix metalloproteinase (MMP)-2 and MMP-9 in human placenta and fetal membranes in relation to preterm and term labor. Journal of Clinical Endocrinology and Metabolism 87 13531361. (https://doi.org/10.1210/jcem.87.3.8320)

    • Search Google Scholar
    • Export Citation
  • Yan C & Boyd DD 2007 Regulation of matrix metalloproteinase gene expression. Journal of Cellular Physiology 211 1926. (https://doi.org/10.1002/jcp.20948)

    • Search Google Scholar
    • Export Citation
  • Yan Y, Fang L, Li Y, Yu Y, Li Y, Cheng JC & Sun YP 2021 Association of MMP2 and MMP9 gene polymorphisms with the recurrent spontaneous abortion: a meta-analysis. Gene 767 145173. (https://doi.org/10.1016/j.gene.2020.145173)

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Li P, Guo Y, Liu X & Zhang Y 2019 MMP-9 and TIMP-1 in placenta of hypertensive disorder complicating pregnancy. Experimental and Therapeutic Medicine 18 637641. (https://doi.org/10.3892/etm.2019.7591)

    • Search Google Scholar
    • Export Citation
  • Zhao J, Klausen C, Xiong S, Cheng JC, Chang HM & Leung PC 2016 Growth differentiation factor 8 induces SKOV3 ovarian cancer cell migration and E-cadherin down-regulation. Cellular Signalling 28 16151622. (https://doi.org/10.1016/j.cellsig.2016.07.013)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    GDF-8 stimulates MMP2, but not MMP9, expression in HTR-8/SVneo cells. (A) Cells were treated with GDF-8 (G8) for different periods of time, and the mRNA levels of MMP2 and MMP9 were examined by RT-qPCR. The RT-qPCR results are normalized to the 1 h-untreated control and expressed as mean ± s.e.m. of four independent experiments. (B) Cells were treated with GDF-8 (G8) for 6, 12, and 24 h. The protein levels of MMP2 and MMP9 were examined by Western blot. The Western blot results are normalized to the 6 h-untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

  • View in gallery
    Figure 2

    The stimulatory effect of GDF-8 on MMP2 expression is mediated by ALK5. (A and B) Cells were pretreated with vehicle control (DMSO) or 10 µM SB431542 for 1 h and then treated with GDF-8 (G8) for 24 h. The mRNA (A) and protein (B) levels of MMP2 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the DMSO-treated control and expressed as mean ± s.e.m. of three independent experiments. (C and D) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl), ALK4 siRNA (si-ALK4), or ALK5 siRNA (si-ALK5) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (C) and protein (D) levels of MMP2 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

  • View in gallery
    Figure 3

    Activation of the SMAD signaling pathway is required for GDF-8-induced MMP2 expression. (A) HTR-8/SVneo cells were treated with GDF-8 (G8) for 10, 30, and 60 min. The levels of phosphorylated and total forms of SMAD2 and SMAD3 were determined by Western blot. (B and C) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or SMAD4 siRNA (si-SMAD4) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (B) and protein (C) levels of MMP2 and SMAD4 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

  • View in gallery
    Figure 4

    Both SMAD2 and SMAD3 are involved in GDF-8-induced MMP2 expression. (A and B) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl), SMAD2 siRNA (si-SMAD2), or SMAD3 siRNA (si-SMAD3) for 48 h and then treated with GDF-8 (G8) for 24 h. The mRNA (A) and protein (B) levels of MMP2, SMAD2, and SMAD3 were examined by RT-qPCR and Western blot, respectively. The RT-qPCR and Western blots results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

  • View in gallery
    Figure 5

    MMP2 mediates GDF-8-stimulated cell invasiveness. (A) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or MMP2 siRNA (si-MMP2) for 48 h and then treated with GDF-8 (G8) for 24 h. The protein levels of MMP2 were examined by Western blot. The Western blot results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as mean ± s.e.m. of three independent experiments. (B) HTR-8/SVneo cells were transfected with control siRNA (si-Ctrl) or MMP2 siRNA (si-MMP2) for 48 h and then treated with GDF-8 (G8). After treatment, the levels of cell invasiveness were measured by the matrigel transwell invasion assay. The top panel shows representative photos of the invasion assay. Original magnification: 100×. The scale bar represents 50 μm. The bottom panels show summarized quantitative results. The invasion assay results are normalized to the control siRNA (si-Ctrl)-transfected untreated control and expressed as the mean ± s.e.m. of three independent experiments. Multiple comparisons were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. The values with any common letter are not significantly different.

  • Abou-Kheir W, Barrak J, Hadadeh O & Daoud G 2017 HTR-8/SVneo cell line contains a mixed population of cells. Placenta 50 17. (https://doi.org/10.1016/j.placenta.2016.12.007)

    • Search Google Scholar
    • Export Citation
  • Aplin JD 1991 Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. Journal of Cell Science 99 681692. (https://doi.org/10.1242/jcs.99.4.681)

    • Search Google Scholar
    • Export Citation
  • Bilban M, Tauber S, Haslinger P, Pollheimer J, Saleh L, Pehamberger H, Wagner O & Knofler M 2010 Trophoblast invasion: assessment of cellular models using gene expression signatures. Placenta 31 989996. (https://doi.org/10.1016/j.placenta.2010.08.011)

    • Search Google Scholar
    • Export Citation
  • Brown KA, Pietenpol JA & Moses HL 2007 A tale of two proteins: differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling. Journal of Cellular Biochemistry 101 933. (https://doi.org/10.1002/jcb.21255)

    • Search Google Scholar
    • Export Citation
  • Chang HM, Fang L, Cheng JC, Klausen C, Sun YP & Leung PC 2015 Growth differentiation factor 8 down-regulates PENTRAXIN 3 in human granulosa cells. Molecular and Cellular Endocrinology 404 8290. (https://doi.org/10.1016/j.mce.2015.01.036)

    • Search Google Scholar
    • Export Citation
  • Chang HM, Fang Y, Liu PP, Cheng JC, Yang X & Leung PC 2016 Connective tissue growth factor mediates growth differentiation factor 8-induced increase of lysyl oxidase activity in human granulosa-lutein cells. Molecular and Cellular Endocrinology 434 186198. (https://doi.org/10.1016/j.mce.2016.07.007)

    • Search Google Scholar
    • Export Citation
  • Chuva de Sousa Lopes SM, Alexdottir MS & Valdimarsdottir G 2020 The TGFbeta family in human placental development at the fetal-maternal interface. Biomolecules 10 453. (https://doi.org/10.3390/biom10030453)

    • Search Google Scholar
    • Export Citation
  • Cohen M, Meisser A & Bischof P 2006 Metalloproteinases and human placental invasiveness. Placenta 27 783793. (https://doi.org/10.1016/j.placenta.2005.08.006)

    • Search Google Scholar
    • Export Citation
  • Fang L, Chang HM, Cheng JC, Yu Y, Leung PC & Sun YP 2015 Growth differentiation factor-8 decreases StAR expression through ALK5-mediated Smad3 and ERK1/2 signaling pathways in luteinized human granulosa cells. Endocrinology 156 46844694. (https://doi.org/10.1210/en.2015-1461)

    • Search Google Scholar
    • Export Citation
  • Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N & Lala PK 1993 Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Experimental Cell Research 206 204211. (https://doi.org/10.1006/excr.1993.1139)

    • Search Google Scholar
    • Export Citation
  • Guo J, Tian T, Lu D, Xia G, Wang H & Dong M 2012 Alterations of maternal serum and placental follistatin-like 3 and myostatin in pre-eclampsia. Journal of Obstetrics and Gynaecology Research 38 988996. (https://doi.org/10.1111/j.1447-0756.2011.01823.x)

    • Search Google Scholar
    • Export Citation
  • Heldin CH & Moustakas A 2016 Signaling receptors for TGF-beta family members. Cold Spring Harbor Perspectives in Biology 8 a022053. (https://doi.org/10.1101/cshperspect.a022053)

    • Search Google Scholar
    • Export Citation
  • Heldin CH, Miyazono K & ten Dijke P 1997 TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390 465471. (https://doi.org/10.1038/37284)

    • Search Google Scholar
    • Export Citation
  • Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, Laping NJ & Hill CS 2002 SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Molecular Pharmacology 62 6574. (https://doi.org/10.1124/mol.62.1.65)

    • Search Google Scholar
    • Export Citation
  • Isaka K, Usuda S, Ito H, Sagawa Y, Nakamura H, Nishi H, Suzuki Y, Li YF & Takayama M 2003 Expression and activity of matrix metalloproteinase 2 and 9 in human trophoblasts. Placenta 24 5364. (https://doi.org/10.1053/plac.2002.0867)

    • Search Google Scholar
    • Export Citation
  • Jin M, Li H, Xu H, Huo G & Yao Y 2017 MicroRNA-20b inhibits trophoblast cell migration and invasion by targeting MMP-2. International Journal of Clinical and Experimental Pathology 10 1090110909. (https://doi.org/10)

    • Search Google Scholar
    • Export Citation
  • Kemaladewi DU, de Gorter DJ, Aartsma-Rus A, van Ommen GJ, ten Dijke P, ‘t Hoen PAC & Hoogaars WM 2012 Cell-type specific regulation of myostatin signaling. FASEB Journal 26 14621472. (https://doi.org/10.1096/fj.11-191189)

    • Search Google Scholar
    • Export Citation
  • Knoeller S, Lim E, Aleta L, Hertwig K, Dudenhausen JW & Arck PC 2003 Distribution of immunocompetent cells in decidua of controlled and uncontrolled (choriocarcinoma/hydatidiform mole) trophoblast invasion. American Journal of Reproductive Immunology 50 4147. (https://doi.org/10.1034/j.1600-0897.2003.00046.x)

    • Search Google Scholar
    • Export Citation
  • Lim KH, Zhou Y, Janatpour M, McMaster M, Bass K, Chun SH & Fisher SJ 1997 Human cytotrophoblast differentiation/invasion is abnormal in pre-eclampsia. American Journal of Pathology 151 18091818.

    • Search Google Scholar
    • Export Citation
  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 402408. (https://doi.org/10.1006/meth.2001.1262)

    • Search Google Scholar
    • Export Citation
  • Malassine A & Cronier L 2002 Hormones and human trophoblast differentiation: a review. Endocrine 19 311. (https://doi.org/10.1385/ENDO:19:1:3)

    • Search Google Scholar
    • Export Citation
  • McPherron AC, Lawler AM & Lee SJ 1997 Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387 8390. (https://doi.org/10.1038/387083a0)

    • Search Google Scholar
    • Export Citation
  • Mitchell MD, Osepchook CC, Leung KC, McMahon CD & Bass JJ 2006 Myostatin is a human placental product that regulates glucose uptake. Journal of Clinical Endocrinology and Metabolism 91 14341437. (https://doi.org/10.1210/jc.2005-2361)

    • Search Google Scholar
    • Export Citation
  • Nagase H & Woessner Jr JF 1999 Matrix metalloproteinases. Journal of Biological Chemistry 274 2149121494. (https://doi.org/10.1074/jbc.274.31.21491)

    • Search Google Scholar
    • Export Citation
  • Page-McCaw A, Ewald AJ & Werb Z 2007 Matrix metalloproteinases and the regulation of tissue remodelling. Nature Reviews: Molecular Cell Biology 8 221233. (https://doi.org/10.1038/nrm2125)

    • Search Google Scholar
    • Export Citation
  • Peiris HN & Mitchell MD 2012 The expression and potential functions of placental myostatin. Placenta 33 902907. (https://doi.org/10.1016/j.placenta.2012.06.021)

    • Search Google Scholar
    • Export Citation
  • Peiris HN, Salomon C, Payton D, Ashman K, Vaswani K, Chan A, Rice GE & Mitchell MD 2014 Myostatin is localized in extravillous trophoblast and up-regulates migration. Journal of Clinical Endocrinology and Metabolism 99 E2288E2297. (https://doi.org/10.1210/jc.2014-2615)

    • Search Google Scholar
    • Export Citation
  • Peiris HN, Georgiou H, Lappas M, Kaitu’u-Lino T, Salomon C, Vaswani K, Rice GE & Mitchell MD 2015 Expression of myostatin in intrauterine growth restriction and preeclampsia complicated pregnancies and alterations to cytokine production by first-trimester placental explants following myostatin treatment. Reproductive Sciences 22 12021211. (https://doi.org/10.1177/1933719115572482)

    • Search Google Scholar
    • Export Citation
  • Peng B, Zhu H, Klausen C, Ma L, Wang YL & Leung PC 2016 GnRH regulates trophoblast invasion via RUNX2-mediated MMP2/9 expression. Molecular Human Reproduction 22 119129. (https://doi.org/10.1093/molehr/gav070)

    • Search Google Scholar
    • Export Citation
  • Piek E, Ju WJ, Heyer J, Escalante-Alcalde D, Stewart CL, Weinstein M, Deng C, Kucherlapati R, Bottinger EP & Roberts AB 2001 Functional characterization of transforming growth factor beta signaling in Smad2- and Smad3-deficient fibroblasts. Journal of Biological Chemistry 276 1994519953. (https://doi.org/10.1074/jbc.M102382200)

    • Search Google Scholar
    • Export Citation
  • Piepho H-P 2018 Letters in mean comparisons: what they do and don’t mean. Agronomy Journal 110 431434. (https://doi.org/10.2134/agronj2017.10.0580)

    • Search Google Scholar
    • Export Citation
  • Pollheimer J, Fock V & Knofler M 2014 Review: the ADAM metalloproteinases – novel regulators of trophoblast invasion? Placenta 35 (Supplement) S57S63. (https://doi.org/10.1016/j.placenta.2013.10.012)

    • Search Google Scholar
    • Export Citation
  • Rahat B, Sharma R, Bagga R, Hamid A & Kaur J 2016 Imbalance between matrix metalloproteinases and their tissue inhibitors in preeclampsia and gestational trophoblastic diseases. Reproduction 152 1122. (https://doi.org/10.1530/REP-16-0060)

    • Search Google Scholar
    • Export Citation
  • Rebbapragada A, Benchabane H, Wrana JL, Celeste AJ & Attisano L 2003 Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Molecular and Cellular Biology 23 72307242. (https://doi.org/10.1128/MCB.23.20.7230-7242.2003)

    • Search Google Scholar
    • Export Citation
  • Santibanez JF, Obradovic H, Kukolj T & Krstic J 2018 Transforming growth factor-beta, matrix metalloproteinases, and urokinase-type plasminogen activator interaction in the cancer epithelial to mesenchymal transition. Developmental Dynamics 247 382395. (https://doi.org/10.1002/dvdy.24554)

    • Search Google Scholar
    • Export Citation
  • Schmierer B & Hill CS 2007 TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nature Reviews: Molecular Cell Biology 8 970982. (https://doi.org/10.1038/nrm2297)

    • Search Google Scholar
    • Export Citation
  • Schmittgen TD & Livak KJ 2008 Analyzing real-time PCR data by the comparative C(T) method. Nature Protocols 3 11011108. (https://doi.org/10.1038/nprot.2008.73)

    • Search Google Scholar
    • Export Citation
  • Staun-Ram E, Goldman S, Gabarin D & Shalev E 2004 Expression and importance of matrix metalloproteinase 2 and 9 (MMP-2 and -9) in human trophoblast invasion. Reproductive Biology and Endocrinology 2 59. (https://doi.org/10.1186/1477-7827-2-59)

    • Search Google Scholar
    • Export Citation
  • Steegers EA, von Dadelszen P, Duvekot JJ & Pijnenborg R 2010 Pre-eclampsia. Lancet 376 631644. (https://doi.org/10.1016/S0140-6736(1060279-6)

  • Suman P & Gupta SK 2012 Comparative analysis of the invasion-associated genes expression pattern in first trimester trophoblastic (HTR-8/SVneo) and JEG-3 choriocarcinoma cells. Placenta 33 874877. (https://doi.org/10.1016/j.placenta.2012.06.017)

    • Search Google Scholar
    • Export Citation
  • Suo M, Sun Y, Yang H, Ji J, He Y, Dong L, Wang Y, Zhang Y, Zhang Y & Hao M 2020 miR-183-5p suppressed the invasion and migration of HTR-8/SVneo trophoblast cells partly via targeting MMP-9 in preeclampsia. Bioscience Reports 40 BSR20192575. (https://doi.org/10.1042/BSR20192575)

    • Search Google Scholar
    • Export Citation
  • Woo MM, Salamanca CM, Minor A & Auersperg N 2007 An improved assay to quantitate the invasiveness of cells in modified Boyden chambers. In Vitro Cellular and Developmental Biology: Animal 43 79. (https://doi.org/10.1007/s11626-006-9002-4)

    • Search Google Scholar
    • Export Citation
  • Xie J, Zhu H, Chang HM, Klausen C, Dong M & Leung PCK 2020 GDF8 promotes the cell invasiveness in human trophoblasts by upregulating the expression of follistatin-like 3 through the ALK5-SMAD2/3 signaling pathway. Frontiers in Cell and Developmental Biology 8 573781. (https://doi.org/10.3389/fcell.2020.573781)

    • Search Google Scholar
    • Export Citation
  • Xu P, Alfaidy N & Challis JR 2002 Expression of matrix metalloproteinase (MMP)-2 and MMP-9 in human placenta and fetal membranes in relation to preterm and term labor. Journal of Clinical Endocrinology and Metabolism 87 13531361. (https://doi.org/10.1210/jcem.87.3.8320)

    • Search Google Scholar
    • Export Citation
  • Yan C & Boyd DD 2007 Regulation of matrix metalloproteinase gene expression. Journal of Cellular Physiology 211 1926. (https://doi.org/10.1002/jcp.20948)

    • Search Google Scholar
    • Export Citation
  • Yan Y, Fang L, Li Y, Yu Y, Li Y, Cheng JC & Sun YP 2021 Association of MMP2 and MMP9 gene polymorphisms with the recurrent spontaneous abortion: a meta-analysis. Gene 767 145173. (https://doi.org/10.1016/j.gene.2020.145173)

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Li P, Guo Y, Liu X & Zhang Y 2019 MMP-9 and TIMP-1 in placenta of hypertensive disorder complicating pregnancy. Experimental and Therapeutic Medicine 18 637641. (https://doi.org/10.3892/etm.2019.7591)

    • Search Google Scholar
    • Export Citation
  • Zhao J, Klausen C, Xiong S, Cheng JC, Chang HM & Leung PC 2016 Growth differentiation factor 8 induces SKOV3 ovarian cancer cell migration and E-cadherin down-regulation. Cellular Signalling 28 16151622. (https://doi.org/10.1016/j.cellsig.2016.07.013)

    • Search Google Scholar
    • Export Citation