Regulation of dual specificity phosphatases by fibroblast growth factor signaling pathways in bovine granulosa cells

in Reproduction
Authors:
Lauriane RelavCentre de Recherche en Reproduction et Fertilité, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, Quebec, Canada

Search for other papers by Lauriane Relav in
Current site
Google Scholar
PubMed
Close
and
Christopher A PriceCentre de Recherche en Reproduction et Fertilité, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, Quebec, Canada

Search for other papers by Christopher A Price in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to C A Price; Email: christopher.price@umontreal.ca

(L Relav is now at Institut de Pharmacologie Moléculaire et Cellulaire, CNRS UMR7275, Sophia Antipolis, Valbonne, France)

Free access

Controling the duration and amplitude of mitogen-activated protein kinase (MAPK) signaling is an important element in deciding cell fate. One group of intracellular negative regulators of MAPK activity is a subfamily of the dual specificity phosphatase (DUSP) superfamily, of which up to 16 members have been described in the ovarian granulosa cells. Growth factors stimulate proliferation of granulosa cells through MAPK, protein kinase C (PKC), and AKT pathways, although it is not known which pathways control DUSP expression in these cells. The aim of the present study was to identify which pathways were involved in the regulation of DUSP expression using a well-established serum-free culture system for bovine granulosa cells. Stimulation of cells with FGF2 increased DUSP1, DUSP5, and DUSP6 mRNA abundance in a time- and dose-dependent manner, and increased DUSP5 and DUSP6 protein accumulation. None of the other eleven DUSP measured were regulated by FGF2. Pharmacological inhibition of MAPK3/1 signaling decreased FGF2-stimulated DUSP1, DUSP5, and DUSP6 mRNA levels (P  < 0.05), whereas inhibition of PKC did not affect the expression of these three DUSPs. Abundance of FGF2-dependent DUSP6 mRNA was reduced by inhibition of phospholipase C (PLC) or by chelating calcium, but DUSP5 mRNA abundance was not affected. Abundance of basal DUSP1 and DUSP6, but not DUSP5 mRNA was increased by the addition of the calcium ionophore A23187. We conclude that FGF2 stimulation of DUSP5 abundance requires MAPK3/1 whereas DUSP6 mRNA accumulation is dependent on calcium signaling as well as MAPK3/1 activation, suggesting complex regulation of physiologically important DUSPs in the follicle.

Abstract

Controling the duration and amplitude of mitogen-activated protein kinase (MAPK) signaling is an important element in deciding cell fate. One group of intracellular negative regulators of MAPK activity is a subfamily of the dual specificity phosphatase (DUSP) superfamily, of which up to 16 members have been described in the ovarian granulosa cells. Growth factors stimulate proliferation of granulosa cells through MAPK, protein kinase C (PKC), and AKT pathways, although it is not known which pathways control DUSP expression in these cells. The aim of the present study was to identify which pathways were involved in the regulation of DUSP expression using a well-established serum-free culture system for bovine granulosa cells. Stimulation of cells with FGF2 increased DUSP1, DUSP5, and DUSP6 mRNA abundance in a time- and dose-dependent manner, and increased DUSP5 and DUSP6 protein accumulation. None of the other eleven DUSP measured were regulated by FGF2. Pharmacological inhibition of MAPK3/1 signaling decreased FGF2-stimulated DUSP1, DUSP5, and DUSP6 mRNA levels (P  < 0.05), whereas inhibition of PKC did not affect the expression of these three DUSPs. Abundance of FGF2-dependent DUSP6 mRNA was reduced by inhibition of phospholipase C (PLC) or by chelating calcium, but DUSP5 mRNA abundance was not affected. Abundance of basal DUSP1 and DUSP6, but not DUSP5 mRNA was increased by the addition of the calcium ionophore A23187. We conclude that FGF2 stimulation of DUSP5 abundance requires MAPK3/1 whereas DUSP6 mRNA accumulation is dependent on calcium signaling as well as MAPK3/1 activation, suggesting complex regulation of physiologically important DUSPs in the follicle.

Introduction

Optimal fertility depends on the health of growing ovarian follicles, which is determined largely by the health of granulosa cells (Yang & Rajamahendran 2000, Irving-Rodgerset al. 2001). Many locally produced growth factors direct granulosa cell fate, including members of the fibroblast growth factor (FGF) and transforming growth factor-β (TGFβ) families (Chaves et al. 2012, Matsuda et al. 2012), and while many of these stimulate proliferation, others such as FGF18 and anti-Mullerian hormone are pro-apoptotic (Price & Estienne 2018). One well-known regulator of folliculogenesis that promotes granulosa cell proliferation is FGF2, which acts principally through the mitogen-activated protein kinase (MAPK) pathway, although protein kinase C (PKC), and AKT pathways are also activated (Peluso et al. 2001, Miyoshi et al. 2010, Jiang et al. 2011).

The MAPK pathway is generally mitotic but can stimulate apoptosis. Signaling consists of a phosphorylation cascade in which multiple MAPK kinases result in the phosphorylation of MAPK3/1 (ERK1/2), MAPK14 (p38), or MAPK8 (c-jun N-terminal kinase, JNK). A rapid and transient increase in MAPK3/1 phosphorylation is mitogenic whereas a sustained increase leads to apoptosis (Marshall 1995, Ebisuya et al. 2005). Both MAPK14 and MAPK8 have been reported to increase apoptosis, most notably in cancer cells (Gilmore et al. 2003) but also in normal ovarian cells; for example, inhibition of MAPK8 decreased apoptosis in pig (Liu et al. 2019, 2020) and mouse granulosa cells (Weng et al. 2016), and in the KGN human granulosa cell line (Huang et al. 2021).

The duration and amplitude of MAPK activity is regulated by intracellular negative feedback loops involving primarily the Sprouty (SPRY) and dual specificity phosphatase (DUSP) families of proteins. Regulation of SPRY1, SPRY2, and SPRY4 mRNA abundance by FGFs has been demonstrated in bovine granulosa cells (Jiang et al. 2011, 2013, Han et al. 2017), and SPRY proteins have a large spectrum of action downstream of the growth factor receptor and upstream of MAPK activation (Mason et al. 2006, Cabrita & Christofori 2008). Many members of the DUSP family are expressed in the ovary, although few appear to be under hormone or growth factor control; abundance of DUSP1, DUSP5, and DUSP6 is stimulated by FSH or growth factors in bovine, sheep, and hen cumulus/granulosa cells (Woods & Johnson 2006, Sen et al. 2008, Khan et al. 2015, Relav et al. 2021), whereas these three DUSPs were inhibited by FSH in rats (Donaubauer et al. 2016, Herndon et al. 2016).

The action of DUSPs is the direct control of MAPK phosphorylation (Camps et al. 2000), and studies in a variety of cell types show that DUSP1, DUSP5, and DUSP6 dephosphorylate MAPK3/1, MAPK8, and MAPK14 to different extents (Patterson et al. 2009, Kidger & Keyse 2016), and DUSP6 appears to target pro-apoptotic MAPK8 in sheep granulosa cells (Relav et al. 2021). This suggests that modification of the activity of specific DUSPs may alter cell fate, therefore understanding the mechanisms regulating DUSP expression may lead to strategies to improve ovarian function.

As growth factors activate several intracellular pathways in granulosa cells, we hypothesized that the abundance of specific DUSP mRNA/proteins is controled by distinct mechanisms to allow preferential dephosphorylation of MAPK targets. The specific aims of this study were to determine if FGF2 regulates DUSP protein and/or mRNA in bovine granulosa cells, and to identify which intracellular pathways were involved in controling DUSP mRNA abundance in response to FGF2.

Materials and methods

Cell culture

Bovine granulosa cells were cultured in well-established serum-free conditions that promoted estradiol secretion in response to physiological concentrations of FSH (Gutiérrez et al. 1997, Silva & Price 2000). All the reagents were from Invitrogen (Gibco) except where specified. Bovine ovaries were collected from a local slaughterhouse and transported to the laboratory in an insulated container. They were washed in 70% ethanol, rinsed with saline solution at 37°C and maintained in warm saline solution supplemented with penicillin/streptomycin until dissection of small antral follicles (2–5 mm). Follicles were placed in DMEM:F12 until granulosa cells were released by bisecting follicles in DMEM:F12 and filtered through a 150 mesh filter to remove cumulus–oocyte complexes (Sigma-Aldrich). The cell suspension was centrifuged at 980 g for 15 min, and the pellet was resuspended in culture medium composed of minimum essential medium (MEM) supplemented with 10 mmol/L sodium bicarbonate, 0.1% (w/v) BSA (Sigma-Aldrich), 4 ng/mL sodium selenite, 2.5 μg/mL apotransferrin, 1 μg/mL fungizone, 100 U/mL penicillin, 100 μg/mL streptomycin, 1.1 mmol/L nonessential amino acid solution, 10−6 M androstenedione, 25 mM HEPES, 10 ng/mL insulin, and 10 ng/mL ovine FSH (starting 2 days after the culture was started; AFP5346D; National Hormone and Peptide Program, Torrance, CA, USA). Cells were plated at a density of 1 × 106/mL/well in a 24-well plate (Corning Costar Fisher Scientific, Burlington, ON, Canada) and kept at 37°C in a humidified atmosphere of 5% CO2. Every 48 h, 70% of the spent culture medium was renewed.

Experimental design

All treatments were applied on day 5 of culture. To assess the activation of the MAPK3/1 pathway, the cells were stimulated with 10 ng/mL recombinant human FGF2 (PeproTech, Rocky Hill, NJ, USA; more than 97% similarity with bovine FGF2, NP_776481) for 0, 15, 30, 60, and 240 min and total cell protein was harvested for Western blotting. The ability of FGF2 to regulate abundance of mRNA encoding DUSPs was assessed in dose–response and time–course studies; cells were stimulated with 0, 1, 10, or 50 ng/mL FGF2 for 2 h, or treated with FGF2 at 10 ng/mL for 0, 1, 2, 4, or 8 h. To measure the effect of FGF2 on DUSP protein abundance, cells were stimulated with 10 ng/mL FGF2 for 4, 6, 12, and 24 h. These doses and time periods were based on our previous study with FGF2 in sheep granulosa cells (Relav et al. 2021).

To identify the major signaling pathways involved in the regulation of abundance of mRNA of those DUSPs regulated by FGF2, cells were pretreated for 1 h with commercially available inhibitors of ERK1/2 (PD98059, abbreviated PD, 50 µM), PLCγ (U73122, abbreviated U73, 5 µM), PKC (GF109203X, abbreviated GF, 3 µM, Sigma–Aldrich), and PI3K (LY294002, abbreviated LY, 20 µM) before stimulation with 10 ng/mL FGF2 for 2 h. To assess the role of calcium signaling, cells were pretreated with the calcium chelator BAPTA-AM (1,2-Bis-(2-aminophenoxy)-ethane-N,N,N0,N0-tetraacetic acid tetrakis-(acetoxy-methyl) ester, abbreviated BA, 10 µM) before stimulation with FGF2 for 2 h, and cells were treated with calcium ionophore (A23187 abbreviated A23, 10 µM) for 2 h in the absence of FGF2. All chemicals were dissolved in DMSO and further diluted in culture medium for treatments. At the end of culture, cells were harvested for RNA extraction.

Total RNA extraction and real-time qPCR

The treatments were stopped by discarding the culture medium and total RNA extraction was performed with Trizol (Invitrogen) according to the manufacturer’s instructions. Total RNA concentration and purity was assayed using a Nanodrop 1000. An amount of 400 ng of RNA was treated with 1U DNAse I, then reverse transcribed into cDNA using Omniscript RT kit (Qiagen). Briefly, DNAse-treated total RNA was part of a reaction comprising 0.5 mM/dNTP, 1 µM oligodT primer (Invitrogen), 10 U RNAse inhibitor (Invitrogen), 4 U Omniscript reverse transcriptase in a total volume of 20 µL, heated at 37°C for 1 h.

Quantitative PCR (qPCR) was performed on a CFX96 Touch thermocycler (Bio-rad) using 1× Sso Advanced Universal SYBR Green Supermix (Bio-rad) and 375 nM of each specific forward and reverse primer in a total reaction volume of 20 µL. Primers were designed to amplify 14 DUSP mRNA previously detected in sheep (Relav et al. 2021), and sequences are presented in Table 1. Common thermocycling conditions were used: 95°C for 3 min, 40 cycles of 95°C for 15 s, and 61°C for 30 s and 72°C for 30 s. Conditions for optimal amplification efficiency were determined with preliminary sample dilution curves. In each run, melting curve analysis was used to verify that a single product was amplified. Each reaction was performed in duplicate and the average threshold cycle (Ct) value was used to calculate relative mRNA abundance of target genes relative to the geometric mean of three housekeeping genes (RPL19, SDHA, and YWHAZ) with the 2−∆∆Ct method and correction for amplification efficiency (Pfaffl 2001).

Table 1

Forward (f) and reverse (r) primers used in real time-qualitative PCR (RT-qPCR).

Gene Sequence 5’ → 3’ Accession number
Forward Reverse
DUSP1 ACCATTTCGAGGGTCACTACCA AGCTTGACTCGGTTAGTCCTCA NM_001046452.2
DUSP2 CTCCAGGGCTCCCTCTTACG CCTCAAAGTGGTTGGGGCAG NM_001192179.1
DUSP3 CAGGCAGAACCGTGAGATCG CTGAGCAGGGTACACTGTGTTT NM_001076374.1
DUSP5 AGGGGGATATGAGACTTTCTACTCG GCACTGACTTCCCACACTGAC NM_001304282.2
DUSP6 CCCCCAACTTGCCGAATCTC GGCTGATGCCAGCTAAGCAA NM_001046195.1
DUSP7 GGGCGAGTTCACCTACAAGC GACAAAGTCGTAGGCGTCGTT NM_001101294.2
DUSP8 AGCCTGGGTCCAGCCTTAG GGGGACACCTCCAGCATCT XM_024987617.1
DUSP10 GAATGAGGGCTGAATGTGCGA TGTCGTCTAAAGGAGACGGAGG NM_001034725.2
DUSP11 ACTACCTCCCAGTTGGACAGAG GGAAAAACATTCTTCTGGGGCAAG NM_001014875.1
DUSP12 TTTGCCCACAAGAGGATGACAG GGAGCACTGTTCACCATACCAG XM_002685847.6
DUSP14 TTTCCAGACCCAGGACTCCA ACTTGCATCGTTGGGAGCAA NM_001075308.1
DUSP15 CGGGCCGTCAGGGCA CAGGGGCGTCGGCCA XM_015474259.2
DUSP16 GTTTTCTCACTGTCCTCCTGGG GGGTGGACTTTCCTTCACAGAG XM_024992619.1
DUSP18 ATTGCTATGGAAACCGGAGCC AACTGAACTGGGAAGGCACAC NM_001034259.1
DUSP19 CAGGACCTTAGCTTGGACTTGAAA GAACAAGAACCACTCCATCCTTCA NM_001098878.1
RPL19 TATGGGTATAGGTAAGCGAAAG TGGCGGTCAATCTTCTTAG NM_001040516.2
YWHAZ ACCAACACATCCTATCAGAC CTCTCAGTAACTGCATTATTAGC NM_174814.2
SDHA GAATGGTCTGGAACACTGA AGTAATCGTACTCGTCAACC NM_174178.2

Western blotting

After treatments, the culture medium was replaced with RIPA buffer (1× phosphate buffered saline pH 7.4, 1% (v/v) NP-40, 0.5% sodium deoxycholate, 0.1% (v/v) SDS, and proteases and phosphatases inhibitor cocktails), and the lysate was centrifuged at 13,000 g for 10 min, to recover the supernatant used for the following steps. Protein concentration was determined by bicinchoninic acid assay following the manufacturer’s instructions (Thermo Fisher Scientific). Total proteins (20 µg) were resolved in 12% SDS-PAGE using a Tetra cell apparatus (Bio-rad). Proteins were then transferred to a LF-PVDF membrane in a semi-dry transfer system (TransBlot; Bio-rad) and cut to horizontal strips corresponding to the size of target proteins. The membranes were blocked in TTBS containing 5% (w/v) skim milk and incubated with anti-DUSP6 (1/1000 in TTBS, sc-377070 Santa Cruz) or β-actin (1/10,000 in TTBS; sc-47778 HRP Santa Cruz). To detect DUSP5, the membranes were blocked with TTBS containing 5% (w/v) BSA then incubated with anti-DUSP5 (1/2000 in TTBS, sc-393801 Santa Cruz). The secondary antibody used was anti-mouse HRP (1/20,000 in TTBS containing 5% (w/v) skim milk, 402334, Calbiochem). Attempts to measure DUSP1 protein with commercial antibodies (Biorbyt, orb317657; Invitrogen, PA5-17973) were unsuccessful in our hands. Each incubation was followed with three washes of 5 min each in TTBS (10 mM Tris–HCl, 150 mM NaCl, and 0.1% (v/v) Tween-20, pH 7.5). The signal was detected with ECL or ECL Max detection kits (Bio-rad), and densitometric analyses were performed with Image Lab software (Biorad) after background subtraction. For each protein, intensities were calibrated to a calibrator sample, and the calibrated intensity was normalized to the loading control β-actin.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.3 (San Diego, CA, USA). Data are presented as mean ± s.e.m. of at least three independent cell cultures. Two-way ANOVA Fisher’s least significant difference (LSD) was performed to compare DUSP mRNA abundance between treated groups. Differences were considered as significant when P  < 0.05.

Results

Transient MAPK3/1 phosphorylation and regulation of DUSPs by FGF2

First, we verified that FGF2 induced a transient increase in phosphorylation of MAPK3/1 (Fig. 1). We then determined the effect of FGF2 on abundance of mRNA encoding 14 DUSP members previously detected in sheep granulosa cells. After 2 h exposure, abundance of mRNA of three DUSPs, DUSP1, DUSP5, and DUSP6, was significantly increased in a dose-dependent manner (Fig. 2A), although with differing sensitivites to FGF2: DUSP6 mRNA abundance was increased by 1 ng/mL FGF2, whereas DUSP5 and DUSP1 mRNA abundance were increased by 10 and 50 ng/mL, respectively. A time–course experiment demonstrated significant increase in DUSP5 and DUSP6 mRNA abundance by 2 h of treatment, and of DUSP1 mRNA levels at a later time point (Fig. 2B). No change in abundance of mRNA encoding the other DUSPs was observed in response to FGF2 (not shown).

Figure 1
Figure 1

Transient activation of MAPK3/1 phosphorylation by FGF2. Bovine granulosa cells were cultured under serum-free conditions and stimulated on day 5 with 10 ng/mL of FGF2 for the times shown. Total cell protein was extracted for measurement of phospho-MAPK3/1 abundance by Western blot, and the representative blots show samples of one replicate in the same order as the graph. Data are expressed as the ratio of phosphorylated to total MAPK3/1 protein (both bands) and presented as means and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers least significant difference (LSD) test).

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

Figure 2
Figure 2

FGF2 stimulated DUSP1, DUSP5, and DUSP6 mRNA abundance. Bovine granulosa cells were cultured under serum-free conditions and were stimulated on day 5 of culture with 1, 10, or 50 ng/mL FGF2 for 2 h (A), or were stimulated with 10 ng/mL FGF2 for 0, 1, 2, 4, and 8 h (B). Relative mRNA abundance was measured by quantitative PCR (qPCR) and data are expressed as mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers LSD test).

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

We then focused on the regulation of abundance of proteins encoded by the three FGF2-regulated DUSPs. Abundance of DUSP6 protein was increased following FGF2 treatment at all time points measured from 4 to 24 h of treatment (Fig. 3B), whereas DUSP5 protein levels were increased by FGF2 after 6 h of treatment but not at later time points (P  < 0.05), which was confounded by an increase in DUSP protein levels in controls at the later time points (Fig. 3A). We were unable to detect DUSP1 protein by Western blotting.

Figure 3
Figure 3

Stimulation of DUSP5 and DUSP6 protein levels by FGF2. Bovine granulosa cells were cultured under serum-free conditions and were stimulated on day 5 of culture with or without 10 ng/mL FGF2 for 4, 6, 12, and 24 h. At the end of culture, total cell protein was harvested for measurement of (A) DUSP5 and (B) DUSP6 by immunoblotting and expressed relative to β-actin (ACTB). In the representative blots, membranes were cut horizontally to contain only bands of the expected size and the lanes correspond to the treatments shown immediately above in the graphs. Results are given as mean and s.e.m. of five independent cell cultures with individual data points plotted, and asterisks indicate significant differences between control and FGF2 treatment (P  < 0.05, Fishers LSD test).

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

Effect of pathway inhibition on DUSP mRNA abundance

We next determined which pathways activated by FGF signaling are involved in DUSP1, DUSP5, and DUSP6 upregulation. Inhibition of PKC with GF109203X did not alter abundance of mRNA encoding these DUSP proteins either under basal or FGF2-stimulated conditions (Fig. 4A). Inhibition of MAPK3/1 with PD98059 significantly decreased FGF2-stimulated DUSP5 and DUSP6 expression (Fig. 4B). Inhibition of PLCγ with U73122 significantly decreased FGF2-stimulated but not basal DUSP6 mRNA levels, whereas in contrast, the inhibitor increased basal DUSP5 mRNA to levels observed in the presence of FGF2; cotreatment with FGF2 and U73122 did not increase DUSP5 mRNA abundance above levels observed with either treatment alone. Addition of U73122 also increased basal DUSP1 mRNA abundance that was not further increased by the addition of FGF2 (Fig. 4C). These data suggest an involvement of PLCγ and MAPK3/1 signaling in the regulation of DUSP6 mRNA levels, but only MAPK3/1 signaling appears important for DUSP5 mRNA abundance.

Figure 4
Figure 4

Regulation of DUSP1, DUSP5, and DUSP6 mRNA abundance by mitogen-activated protein kinase (MAPK) and phospholipase C (PLC), but not PKC, intracellular pathways. Bovine granulosa cells were cultured under serum-free conditions and on day 5 of culture, cells were exposed to inhibitors of (A) PKC (GF; 3 µM), (B) MAPK (PD; 50 µM) or (C) PLC (U73; 5 µM) pathways for 1 h, and then stimulated with FGF2 (10 ng/mL) for a further 2 h. The control (Ct) was treated with the vehicle, DMSO. Relative mRNA abundance is expressed as mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers LSD test).

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

Lastly, we disturbed calcium signaling using the calcium chelator BAPTA-AM or the calcium ionophore A23187, and the three DUSPs measured were differently affected by these treatments. Lowering the calcium levels did not alter basal DUSP6 mRNA levels but completely suppressed FGF2 stimulation of DUSP6 mRNA abundance, and treatment with the ionophore increased DUSP6 mRNA abundance. Lowering calcium levels increased basal DUSP5 mRNA levels and had no further effect on FGF2-stimulated DUSP5 mRNA abundance, and increasing Ca2+ levels did not alter DUSP5 mRNA levels. Abundance of DUSP1 mRNA was not altered by the calcium chelator but increasing intracellular calcium resulted in a 6-fold increase in DUSP1 mRNA abundance (Fig. 5).

Figure 5
Figure 5

Differential regulation of DUSP5 and DUSP6 mRNA levels by calcium signaling. Bovine granulosa cells were cultured under serum-free conditions and on day 5 of culture were exposed to the calcium chelator BAPTA-AM (BA; 10 µM) for 1 h before stimulation with FGF2 (10 ng/mL) for a further 2 h, or were treated with the calcium ionophore A23187 (10 µM) for 2 h in the absence of FGF2. Controls (Ct) were treated with vehicle (DMSO). Relative mRNA abundance represents mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different; asterisks denote significantly different from controls (P  < 0.05, Fishers LSD test).

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

Discussion

As differential regulation of various MAPKs may determine cell fate, it is important to gain a better understanding of the mechanisms regulating the negative feedback control of MAPK phosphorylation. In the present study, we investigated the intracellular pathways controling abundance of mRNA encoding three FGF-inducible DUSPs. The main finding of the study is that while MAPK3/1 signaling is critical for stimulating abundance of mRNA encoding both DUSP5 and DUSP6, we found that DUSP6 mRNA abundance is also regulated through a PLC-calcium pathway (Fig. 6). These data suggest distinct fine control of DUSP family members by at least some growth factors.

Figure 6
Figure 6

Major intracellular pathways regulating DUSP5 and DUSP6 mRNA abundance. FGF2 activates its receptors (FGFR) and initiates a phosphorylation cascade through MAPK/ERK kinase (MEK) and MAPK3/1 kinases to induce expression of DUSP5 and DUSP6 in bovine granulosa cells, likely through the transcription factor EGR1. In addition, FGF2 also activates PLC and calcium mobilisation to stimulate DUSP6 but not DUSP5 mRNA accumulation. Sites of action of the pathway inhibitors PD98059 (PD) and U73122 (U73), and the calcium chelator (BA) are shown in red.

Citation: Reproduction 162, 5; 10.1530/REP-21-0270

This study demonstrates that DUSP5 and DUSP6 are the principal DUSPs regulated by FGF2 in bovine granulosa cells, as we have recently shown also in sheep (Relav et al. 2021) and as previously described in hens in response to transforming growth factor alpha (TGFα) (Woods & Johnson 2006). Approximately 11 other DUSP members are expressed in the granulosa cells in rats, sheep, and cattle (Herndon et al. 2016, Relav et al. 2021, present study), and they appear not to be under acute hormonal regulation. Although the pattern of expression of these DUSPs are similar between sheep and cattle, there appears to be subtle differences between species or cell models: in sheep, DUSP5 mRNA abundance was transiently increased by FGF2, returning to control levels by 8 h (Relav et al. 2021), whereas in the present study abundance of mRNA was numerically highest at 8 h. A difference was also noted for DUSP1, for which the FGF2-stimulated increase in mRNA abundance returned to control levels within 2 h in sheep (Relav et al. 2021) but was elevated between 4 and 8 h in cattle (present study). The same dose of FGF2 was used in these studies and the culture models are very similar, suggesting a potential, if minor, species difference. The FGF2-stimulated increase in DUSP6 mRNA abundance is a late event in both sheep and cattle, and DUSP6 was the only target for which a robust increase in protein levels was observed, suggesting a physiological importance of this particular DUSP.

FGF signaling involves activation of several intracellular pathways (Peluso et al. 2001, Miyoshi et al. 2010, Jiang et al. 2011) and the present data suggest that distinct mechanisms regulate individual DUSP gene products. Increased abundance of DUSP1, DUSP5, and DUSP6 mRNA all required MAPK3/1 signaling, in agreement with studies on TGFα-stimulated DUSP5 and DUSP6 mRNA abundance in hen granulosa cells (Sen et al. 2008) and FSH-stimulated DUSP5 mRNA in bovine granulosa cells (Woods & Johnson 2006), and with studies in other cell types (Ekerot et al. 2008, Kucharska et al. 2009, Zhang et al. 2010). In a similar vein, none of these DUSP mRNAs were impacted by inhibiting PKC, which was also observed for FSH-stimulated DUSP5 mRNA abundance in bovine granulosa cells (Sen et al. 2008).

There is also an important role of the PLC-calcium signaling in regulating FGF target gene expression. Accumulation of DUSP6 mRNA is dependent on PLC-calcium, as inhibition of PLC decreased mRNA abundance and increasing intracellular calcium with an ionophore increased mRNA abundance, which is consistent with the regulation of other FGF target genes including SPRY1 and SPRY4 (Jiang et al. 2011). However, in contrast to DUSP6, FGF-stimulated DUSP5 mRNA accumulation is independent of the PLC-calcium pathway as it was not altered by the inhibition of PLC or the chelation of calcium.

Interestingly, ‘basal’ accumulation of DUSP5 message appeared to require a decrease in PLC and calcum signaling, whereas paradoxically, basal DUSP1 mRNA accumulation required a decrease in PLC signaling but increased intracellular calcium levels. The role of calcium in stimulating Dusp1 protein levels has been reported in a rat neuronal-like cell line (Durham & Russo 2000) and fibroblasts (Scimeca et al. 1997), and the present data suggest that the PLC and calcium signaling pathways are operating independently in granulosa cells to control FGF-independent expression of DUSP1. It should be noted that these ‘basal’ conditions include insulin and FSH, and FSH was shown to stimulate DUSP1 and DUSP5 mRNA abundance in bovine cumulus cells (Khan et al. 2015), therefore implying a role for PLC and/or calcium in the FSH/insulin control of DUSP expression.

In summary, we have determined the major intracellular pathways involved in the regulation of DUSP1, DUSP5, and DUSP6 mRNA abundance by FGF2 in bovine granulosa cells. Activation of MAPK3/1 phosphorylation is critical for the expression of the three DUSPs studied, and a PLC-calcium pathway appears to be important for FGF2-stimulated DUSP6 mRNA abundance; as DUSP6 has been implicated in the regulation of pro-apoptotic MAPK8 in granulosa cells, these data offer insights into mechanisms controling follicle health.

Declaration of interest

Christopher Price is the co-Editor-in-Chief of Reproduction. He was not involved in the review or editorial process for this paper, on which he is listed as an author.

Funding

This study was supported by FRQ-NT, Québec Canada, and R L received a scholarship from Collectivité Territoriale de Martinique.

Author contribution statement

R L performed the experiments, analysed data, and wrote the manuscript. C A P conceived the study, analysed data, and revised the manuscript.

Acknowledgements

The authors thank Dr Parlow for the availability of highly purified FSH.

References

  • Cabrita MA & Christofori G 2008 Sprouty proteins, masterminds of receptor tyrosine kinase signaling. Angiogenesis 11 5362. (https://doi.org/10.1007/s10456-008-9089-1)

    • Search Google Scholar
    • Export Citation
  • Camps M, Nichols A & Arkinstall S 2000 Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB Journal 14 616. (https://doi.org/10.1096/fasebj.14.1.6)

    • Search Google Scholar
    • Export Citation
  • Chaves RN, de Matos MH, Buratini J & de Figueiredo JR 2012 The fibroblast growth factor family: involvement in the regulation of folliculogenesis. Reproduction, Fertility, and Development 24 905–915. (https://doi.org/10.1071/RD11318)

    • Search Google Scholar
    • Export Citation
  • Damon DH, Lange DL & Hattler BG 1997 In vitro and in vivo vascular actions of basic fibroblast growth factor (bFGF) in normotensive and spontaneously hypertensive rats. Journal of Cardiovascular Pharmacology 30 278284. (https://doi.org/10.1097/00005344-199709000-00002)

    • Search Google Scholar
    • Export Citation
  • Donaubauer EM, Law NC & Hunzicker-Dunn ME 2016 Follicle-stimulating hormone (FSH)-dependent regulation of extracellular regulated kinase (ERK) phosphorylation by the mitogen-activated protein (MAP) kinase phosphatase MKP3. Journal of Biological Chemistry 291 1970119712. (https://doi.org/10.1074/jbc.M116.733972)

    • Search Google Scholar
    • Export Citation
  • Durham PL & Russo AF 2000 Differential regulation of mitogen-activated protein kinase-responsive genes by the duration of a calcium signal. Molecular Endocrinology 14 15701582. (https://doi.org/10.1210/mend.14.10.0529)

    • Search Google Scholar
    • Export Citation
  • Ebisuya M, Kondoh K & Nishida E 2005 The duration, magnitude and compartmentalization of ERK MAP kinase activity: mechanisms for providing signaling specificity. Journal of Cell Science 118 29973002. (https://doi.org/10.1242/jcs.02505)

    • Search Google Scholar
    • Export Citation
  • Ehrengruber MU, Muhlebach SG, Söhrman S, Leutenegger CM, Lester HA & Davidson N 2000 Modulation of early growth response (EGR) transcription factor-dependent gene expression by using recombinant adenovirus. Gene 258 6369. (https://doi.org/10.1016/s0378-1119(0000445-5)

    • Search Google Scholar
    • Export Citation
  • Ekerot M, Stavridis MP, Delavaine L, Mitchell MP, Staples C, Owens DM, Keenan ID, Dickinson RJ, Storey KG & Keyse SM 2008 Negative-feedback regulation of FGF signalling by DUSP6/MKP-3 is driven by ERK1/2 and mediated by Ets factor binding to a conserved site within the DUSP6/MKP-3 gene promoter. Biochemical Journal 412 287298. (https://doi.org/10.1042/BJ20071512)

    • Search Google Scholar
    • Export Citation
  • Gilmore PM, Quinn JE, Mullan PB, Andrews HN, McCabe N, Carty M, Kennedy RD & Harkin DP 2003 Role played by BRCA1 in regulating the cellular response to stress. Biochemical Society Transactions 31 257262. (https://doi.org/10.1042/bst0310257)

    • Search Google Scholar
    • Export Citation
  • Gutiérrez CG, Campbell BK & Webb R 1997 Development of a long-term bovine granulosa cell culture system: induction and maintenance of estradiol production, response to follicle-stimulating hormone, and morphological characteristics. Biology of Reproduction 56 608616. (https://doi.org/10.1095/biolreprod56.3.608)

    • Search Google Scholar
    • Export Citation
  • Han P, Guerrero-Netro H, Estienne A, Cao B & Price CA 2017 Regulation and action of early growth response 1 in bovine granulosa cells. Reproduction 154 547557. (https://doi.org/10.1530/REP-17-0243)

    • Search Google Scholar
    • Export Citation
  • Han P, Relav L & Price CA 2020 Regulation of the early growth response-1 binding protein NAB2 in bovine granulosa cells and effect on connective tissue growth factor expression. Molecular and Cellular Endocrinology 518 111041. (https://doi.org/10.1016/j.mce.2020.111041)

    • Search Google Scholar
    • Export Citation
  • Herndon MK, Law NC, Donaubauer EM, Kyriss B & Hunzicker-Dunn M 2016 Forkhead box O member FOXO1 regulates the majority of follicle-stimulating hormone responsive genes in ovarian granulosa cells. Molecular and Cellular Endocrinology 434 116126. (https://doi.org/10.1016/j.mce.2016.06.020)

    • Search Google Scholar
    • Export Citation
  • Huang M, Li X, Jia S, Liu S, Fu L, Jiang X & Yang M 2021 Bisphenol AF induces apoptosis via estrogen receptor beta (ERβ) and ROS-ASK1-JNK MAPK pathway in human granulosa cell line KGN. Environmental Pollution 270 116051. (https://doi.org/10.1016/j.envpol.2020.116051)

    • Search Google Scholar
    • Export Citation
  • Irving-Rodgers HF, van Wezel IL, Mussard ML, Kinder JE & Rodgers RJ 2001 Atresia revisited: two basic patterns of atresia of bovine antral follicles. Reproduction 761775.(https://doi.org/10.1530/rep.0.1220761)

    • Search Google Scholar
    • Export Citation
  • Jiang ZL, Ripamonte P, Buratini J, Portela VM & Price CA 2011 Fibroblast growth factor-2 regulation of Sprouty and NR4A genes in bovine ovarian granulosa cells. Journal of Cellular Physiology 226 18201827. (https://doi.org/10.1002/jcp.22509)

    • Search Google Scholar
    • Export Citation
  • Jiang Z, Guerrero-Netro HM, Juengel JL & Price CA 2013 Divergence of intracellular signaling pathways and early response genes of two closely related fibroblast growth factors, FGF8 and FGF18, in bovine ovarian granulosa cells. Molecular and Cellular Endocrinology 375 97105. (https://doi.org/10.1016/j.mce.2013.05.017)

    • Search Google Scholar
    • Export Citation
  • Khan DR, Guillemette C, Sirard MA & Richard FJ 2015 Characterization of FSH signalling networks in bovine cumulus cells: a perspective on oocyte competence acquisition. Molecular Human Reproduction 21 688701. (https://doi.org/10.1093/molehr/gav032)

    • Search Google Scholar
    • Export Citation
  • Kidger AM & Keyse SM 2016 The regulation of oncogenic Ras/ERK signalling by dual-specificity mitogen activated protein kinase phosphatases (MKPs). Seminars in Cell and Developmental Biology 50 125132. (https://doi.org/10.1016/j.semcdb.2016.01.009)

    • Search Google Scholar
    • Export Citation
  • Kubosaki A, Tomaru Y, Tagami M, Arner E, Miura H, Suzuki T, Suzuki M, Suzuki H & Hayashizaki Y 2009 Genome-wide investigation of in vivo EGR-1 binding sites in monocytic differentiation. Genome Biology 10 R41. (https://doi.org/10.1186/gb-2009-10-4-r41)

    • Search Google Scholar
    • Export Citation
  • Kucharska A, Rushworth LK, Staples C, Morrice NA & Keyse SM 2009 Regulation of the inducible nuclear dual-specificity phosphatase DUSP5 by ERK MAPK. Cellular Signalling 21 17941805. (https://doi.org/10.1016/j.cellsig.2009.07.015)

    • Search Google Scholar
    • Export Citation
  • Liu S, Shen M, Li C, Wei Y, Meng X, Li R, Cao Y, Wu W & Liu H 2019 PKCδ contributes to oxidative stress-induced apoptosis in porcine ovarian granulosa cells via activating JNK. Theriogenology 131 8995. (https://doi.org/10.1016/j.theriogenology.2019.03.023)

    • Search Google Scholar
    • Export Citation
  • Liu Z, Li C, Wu G, Li W, Zhang X, Zhou J, Zhang L, Tao J, Shen M & Liu H 2020 Involvement of JNK/FOXO1 pathway in apoptosis induced by severe hypoxia in porcine granulosa cells. Theriogenology 154 120127. (https://doi.org/10.1016/j.theriogenology.2020.05.019)

    • Search Google Scholar
    • Export Citation
  • Lo LW, Cheng JJ, Chiu JJ, Wung BS, Liu YC & Wang DL 2001 Endothelial exposure to hypoxia induces Egr-1 expression involving PKCα-mediated Ras/Raf-1/ERK1/2 pathway. Journal of Cellular Physiology 188 304312. (https://doi.org/10.1002/jcp.1124)

    • Search Google Scholar
    • Export Citation
  • Marshall CJ 1995 Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80 179185. (https://doi.org/10.1016/0092-8674(9590401-8)

    • Search Google Scholar
    • Export Citation
  • Mason JM, Morrison DJ, Basson MA & Licht JD 2006 Sprouty proteins: multifaceted negative-feedback regulators of receptor tyrosine kinase signaling. Trends in Cell Biology 16 4554. (https://doi.org/10.1016/j.tcb.2005.11.004)

    • Search Google Scholar
    • Export Citation
  • Matsuda F, Inoue N, Manabe N & Ohkura S 2012 Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. Journal of Reproduction and Development 58 4450. (https://doi.org/10.1262/jrd.2011-012)

    • Search Google Scholar
    • Export Citation
  • Miyoshi T, Otsuka F, Yamashita M, Inagaki K, Nakamura E, Tsukamoto N, Takeda M, Suzuki J & Makino H 2010 Functional relationship between fibroblast growth factor-8 and bone morphogenetic proteins in regulating steroidogenesis by rat granulosa cells. Molecular and Cellular Endocrinology 325 8492. (https://doi.org/10.1016/j.mce.2010.04.012)

    • Search Google Scholar
    • Export Citation
  • Patterson KI, Brummer T, O’Brien PM & Daly RJ 2009 Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochemical Journal 418 475489. (https://doi.org/10.1042/bj20082234)

    • Search Google Scholar
    • Export Citation
  • Peluso JJ, Pappalardo A & Fernandez G 2001 Basic fibroblast growth factor maintains calcium homeostasis and granulosa cell viability by stimulating calcium efflux via a PKCδ-dependent pathway. Endocrinology 142 42034211. (https://doi.org/10.1210/endo.142.10.8460)

    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45. (https://doi.org/10.1093/nar/29.9.e45)

    • Search Google Scholar
    • Export Citation
  • Price CA & Estienne A 2018 The life and death of the dominant follicle. Animal Reproduction 15 680690. (https://doi.org/10.21451/1984-3143-AR2018-0030)

    • Search Google Scholar
    • Export Citation
  • Relav L, Estienne A & Price CA 2021 Dual-specificity phosphatase 6 (DUSP6) mRNA and protein abundance is regulated by fibroblast growth factor 2 in sheep granulosa cells and inhibits c-Jun N-terminal kinase (MAPK8) phosphorylation. Molecular and Cellular Endocrinology 531 111297. (https://doi.org/10.1016/j.mce.2021.111297)

    • Search Google Scholar
    • Export Citation
  • Scimeca JC, Servant MJ, Dyer JO & Meloche S 1997 Essential role of calcium in the regulation of MAP kinase phosphatase-1 expression. Oncogene 15 717725. (https://doi.org/10.1038/sj.onc.1201231)

    • Search Google Scholar
    • Export Citation
  • Sen A, Lv L, Bello N, Ireland JJ & Smith GW 2008 Cocaine- and amphetamine-regulated transcript accelerates termination of follicle-stimulating hormone-induced extracellularly regulated kinase 1/2 and Akt activation by regulating the expression and degradation of specific mitogen-activated protein kinase phosphatases in bovine granulosa cells. Molecular Endocrinology 22 26552676. (https://doi.org/10.1210/me.2008-0077)

    • Search Google Scholar
    • Export Citation
  • Silva JM & Price CA 2000 Effect of follicle-stimulating hormone on steroid secretion and messenger ribonucleic acids encoding cytochromes P450 aromatase and cholesterol side-chain cleavage in bovine granulosa cells in vitro. Biology of Reproduction 62 186191. (https://doi.org/10.1095/biolreprod62.1.186)

    • Search Google Scholar
    • Export Citation
  • Weng Q, Liu Z, Li B, Liu K, Wu W & Liu H 2016 Oxidative stress induces mouse follicular granulosa cells apoptosis via JNK/FoxO1 pathway. PLoS ONE 11 e0167869. (https://doi.org/10.1371/journal.pone.0167869)

    • Search Google Scholar
    • Export Citation
  • Woods DC & Johnson AL 2006 Phosphatase activation by epidermal growth factor family ligands regulates extracellular regulated kinase signaling in undifferentiated hen granulosa cells. Endocrinology 147 49314940. (https://doi.org/10.1210/en.2006-0194)

    • Search Google Scholar
    • Export Citation
  • Yang MY & Rajamahendran R 2000 Involvement of apoptosis in the atresia of nonovulatory dominant follicle during the bovine estrous cycle. Biology of Reproduction 63 13131321. (https://doi.org/10.1095/biolreprod63.5.1313)

    • Search Google Scholar
    • Export Citation
  • Zhang Z, Kobayashi S, Borczuk AC, Leidner RS, Laframboise T, Levine AD & Halmos B 2010 Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis 31 577586. (https://doi.org/10.1093/carcin/bgq020)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand

     An official journal of

    Society for Reproduction and Fertility

 

  • View in gallery
    Figure 1

    Transient activation of MAPK3/1 phosphorylation by FGF2. Bovine granulosa cells were cultured under serum-free conditions and stimulated on day 5 with 10 ng/mL of FGF2 for the times shown. Total cell protein was extracted for measurement of phospho-MAPK3/1 abundance by Western blot, and the representative blots show samples of one replicate in the same order as the graph. Data are expressed as the ratio of phosphorylated to total MAPK3/1 protein (both bands) and presented as means and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers least significant difference (LSD) test).

  • View in gallery
    Figure 2

    FGF2 stimulated DUSP1, DUSP5, and DUSP6 mRNA abundance. Bovine granulosa cells were cultured under serum-free conditions and were stimulated on day 5 of culture with 1, 10, or 50 ng/mL FGF2 for 2 h (A), or were stimulated with 10 ng/mL FGF2 for 0, 1, 2, 4, and 8 h (B). Relative mRNA abundance was measured by quantitative PCR (qPCR) and data are expressed as mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers LSD test).

  • View in gallery
    Figure 3

    Stimulation of DUSP5 and DUSP6 protein levels by FGF2. Bovine granulosa cells were cultured under serum-free conditions and were stimulated on day 5 of culture with or without 10 ng/mL FGF2 for 4, 6, 12, and 24 h. At the end of culture, total cell protein was harvested for measurement of (A) DUSP5 and (B) DUSP6 by immunoblotting and expressed relative to β-actin (ACTB). In the representative blots, membranes were cut horizontally to contain only bands of the expected size and the lanes correspond to the treatments shown immediately above in the graphs. Results are given as mean and s.e.m. of five independent cell cultures with individual data points plotted, and asterisks indicate significant differences between control and FGF2 treatment (P  < 0.05, Fishers LSD test).

  • View in gallery
    Figure 4

    Regulation of DUSP1, DUSP5, and DUSP6 mRNA abundance by mitogen-activated protein kinase (MAPK) and phospholipase C (PLC), but not PKC, intracellular pathways. Bovine granulosa cells were cultured under serum-free conditions and on day 5 of culture, cells were exposed to inhibitors of (A) PKC (GF; 3 µM), (B) MAPK (PD; 50 µM) or (C) PLC (U73; 5 µM) pathways for 1 h, and then stimulated with FGF2 (10 ng/mL) for a further 2 h. The control (Ct) was treated with the vehicle, DMSO. Relative mRNA abundance is expressed as mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different (P  < 0.05, Fishers LSD test).

  • View in gallery
    Figure 5

    Differential regulation of DUSP5 and DUSP6 mRNA levels by calcium signaling. Bovine granulosa cells were cultured under serum-free conditions and on day 5 of culture were exposed to the calcium chelator BAPTA-AM (BA; 10 µM) for 1 h before stimulation with FGF2 (10 ng/mL) for a further 2 h, or were treated with the calcium ionophore A23187 (10 µM) for 2 h in the absence of FGF2. Controls (Ct) were treated with vehicle (DMSO). Relative mRNA abundance represents mean and s.e.m. of three independent cell cultures with individual data points plotted. Bars with similar letters are not significantly different; asterisks denote significantly different from controls (P  < 0.05, Fishers LSD test).

  • View in gallery
    Figure 6

    Major intracellular pathways regulating DUSP5 and DUSP6 mRNA abundance. FGF2 activates its receptors (FGFR) and initiates a phosphorylation cascade through MAPK/ERK kinase (MEK) and MAPK3/1 kinases to induce expression of DUSP5 and DUSP6 in bovine granulosa cells, likely through the transcription factor EGR1. In addition, FGF2 also activates PLC and calcium mobilisation to stimulate DUSP6 but not DUSP5 mRNA accumulation. Sites of action of the pathway inhibitors PD98059 (PD) and U73122 (U73), and the calcium chelator (BA) are shown in red.

  • Cabrita MA & Christofori G 2008 Sprouty proteins, masterminds of receptor tyrosine kinase signaling. Angiogenesis 11 5362. (https://doi.org/10.1007/s10456-008-9089-1)

    • Search Google Scholar
    • Export Citation
  • Camps M, Nichols A & Arkinstall S 2000 Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB Journal 14 616. (https://doi.org/10.1096/fasebj.14.1.6)

    • Search Google Scholar
    • Export Citation
  • Chaves RN, de Matos MH, Buratini J & de Figueiredo JR 2012 The fibroblast growth factor family: involvement in the regulation of folliculogenesis. Reproduction, Fertility, and Development 24 905–915. (https://doi.org/10.1071/RD11318)

    • Search Google Scholar
    • Export Citation
  • Damon DH, Lange DL & Hattler BG 1997 In vitro and in vivo vascular actions of basic fibroblast growth factor (bFGF) in normotensive and spontaneously hypertensive rats. Journal of Cardiovascular Pharmacology 30 278284. (https://doi.org/10.1097/00005344-199709000-00002)

    • Search Google Scholar
    • Export Citation
  • Donaubauer EM, Law NC & Hunzicker-Dunn ME 2016 Follicle-stimulating hormone (FSH)-dependent regulation of extracellular regulated kinase (ERK) phosphorylation by the mitogen-activated protein (MAP) kinase phosphatase MKP3. Journal of Biological Chemistry 291 1970119712. (https://doi.org/10.1074/jbc.M116.733972)

    • Search Google Scholar
    • Export Citation
  • Durham PL & Russo AF 2000 Differential regulation of mitogen-activated protein kinase-responsive genes by the duration of a calcium signal. Molecular Endocrinology 14 15701582. (https://doi.org/10.1210/mend.14.10.0529)

    • Search Google Scholar
    • Export Citation
  • Ebisuya M, Kondoh K & Nishida E 2005 The duration, magnitude and compartmentalization of ERK MAP kinase activity: mechanisms for providing signaling specificity. Journal of Cell Science 118 29973002. (https://doi.org/10.1242/jcs.02505)

    • Search Google Scholar
    • Export Citation
  • Ehrengruber MU, Muhlebach SG, Söhrman S, Leutenegger CM, Lester HA & Davidson N 2000 Modulation of early growth response (EGR) transcription factor-dependent gene expression by using recombinant adenovirus. Gene 258 6369. (https://doi.org/10.1016/s0378-1119(0000445-5)

    • Search Google Scholar
    • Export Citation
  • Ekerot M, Stavridis MP, Delavaine L, Mitchell MP, Staples C, Owens DM, Keenan ID, Dickinson RJ, Storey KG & Keyse SM 2008 Negative-feedback regulation of FGF signalling by DUSP6/MKP-3 is driven by ERK1/2 and mediated by Ets factor binding to a conserved site within the DUSP6/MKP-3 gene promoter. Biochemical Journal 412 287298. (https://doi.org/10.1042/BJ20071512)

    • Search Google Scholar
    • Export Citation
  • Gilmore PM, Quinn JE, Mullan PB, Andrews HN, McCabe N, Carty M, Kennedy RD & Harkin DP 2003 Role played by BRCA1 in regulating the cellular response to stress. Biochemical Society Transactions 31 257262. (https://doi.org/10.1042/bst0310257)

    • Search Google Scholar
    • Export Citation
  • Gutiérrez CG, Campbell BK & Webb R 1997 Development of a long-term bovine granulosa cell culture system: induction and maintenance of estradiol production, response to follicle-stimulating hormone, and morphological characteristics. Biology of Reproduction 56 608616. (https://doi.org/10.1095/biolreprod56.3.608)

    • Search Google Scholar
    • Export Citation
  • Han P, Guerrero-Netro H, Estienne A, Cao B & Price CA 2017 Regulation and action of early growth response 1 in bovine granulosa cells. Reproduction 154 547557. (https://doi.org/10.1530/REP-17-0243)

    • Search Google Scholar
    • Export Citation
  • Han P, Relav L & Price CA 2020 Regulation of the early growth response-1 binding protein NAB2 in bovine granulosa cells and effect on connective tissue growth factor expression. Molecular and Cellular Endocrinology 518 111041. (https://doi.org/10.1016/j.mce.2020.111041)

    • Search Google Scholar
    • Export Citation
  • Herndon MK, Law NC, Donaubauer EM, Kyriss B & Hunzicker-Dunn M 2016 Forkhead box O member FOXO1 regulates the majority of follicle-stimulating hormone responsive genes in ovarian granulosa cells. Molecular and Cellular Endocrinology 434 116126. (https://doi.org/10.1016/j.mce.2016.06.020)

    • Search Google Scholar
    • Export Citation
  • Huang M, Li X, Jia S, Liu S, Fu L, Jiang X & Yang M 2021 Bisphenol AF induces apoptosis via estrogen receptor beta (ERβ) and ROS-ASK1-JNK MAPK pathway in human granulosa cell line KGN. Environmental Pollution 270 116051. (https://doi.org/10.1016/j.envpol.2020.116051)

    • Search Google Scholar
    • Export Citation
  • Irving-Rodgers HF, van Wezel IL, Mussard ML, Kinder JE & Rodgers RJ 2001 Atresia revisited: two basic patterns of atresia of bovine antral follicles. Reproduction 761775.(https://doi.org/10.1530/rep.0.1220761)

    • Search Google Scholar
    • Export Citation
  • Jiang ZL, Ripamonte P, Buratini J, Portela VM & Price CA 2011 Fibroblast growth factor-2 regulation of Sprouty and NR4A genes in bovine ovarian granulosa cells. Journal of Cellular Physiology 226 18201827. (https://doi.org/10.1002/jcp.22509)

    • Search Google Scholar
    • Export Citation
  • Jiang Z, Guerrero-Netro HM, Juengel JL & Price CA 2013 Divergence of intracellular signaling pathways and early response genes of two closely related fibroblast growth factors, FGF8 and FGF18, in bovine ovarian granulosa cells. Molecular and Cellular Endocrinology 375 97105. (https://doi.org/10.1016/j.mce.2013.05.017)

    • Search Google Scholar
    • Export Citation
  • Khan DR, Guillemette C, Sirard MA & Richard FJ 2015 Characterization of FSH signalling networks in bovine cumulus cells: a perspective on oocyte competence acquisition. Molecular Human Reproduction 21 688701. (https://doi.org/10.1093/molehr/gav032)

    • Search Google Scholar
    • Export Citation
  • Kidger AM & Keyse SM 2016 The regulation of oncogenic Ras/ERK signalling by dual-specificity mitogen activated protein kinase phosphatases (MKPs). Seminars in Cell and Developmental Biology 50 125132. (https://doi.org/10.1016/j.semcdb.2016.01.009)

    • Search Google Scholar
    • Export Citation
  • Kubosaki A, Tomaru Y, Tagami M, Arner E, Miura H, Suzuki T, Suzuki M, Suzuki H & Hayashizaki Y 2009 Genome-wide investigation of in vivo EGR-1 binding sites in monocytic differentiation. Genome Biology 10 R41. (https://doi.org/10.1186/gb-2009-10-4-r41)

    • Search Google Scholar
    • Export Citation
  • Kucharska A, Rushworth LK, Staples C, Morrice NA & Keyse SM 2009 Regulation of the inducible nuclear dual-specificity phosphatase DUSP5 by ERK MAPK. Cellular Signalling 21 17941805. (https://doi.org/10.1016/j.cellsig.2009.07.015)

    • Search Google Scholar
    • Export Citation
  • Liu S, Shen M, Li C, Wei Y, Meng X, Li R, Cao Y, Wu W & Liu H 2019 PKCδ contributes to oxidative stress-induced apoptosis in porcine ovarian granulosa cells via activating JNK. Theriogenology 131 8995. (https://doi.org/10.1016/j.theriogenology.2019.03.023)

    • Search Google Scholar
    • Export Citation
  • Liu Z, Li C, Wu G, Li W, Zhang X, Zhou J, Zhang L, Tao J, Shen M & Liu H 2020 Involvement of JNK/FOXO1 pathway in apoptosis induced by severe hypoxia in porcine granulosa cells. Theriogenology 154 120127. (https://doi.org/10.1016/j.theriogenology.2020.05.019)

    • Search Google Scholar
    • Export Citation
  • Lo LW, Cheng JJ, Chiu JJ, Wung BS, Liu YC & Wang DL 2001 Endothelial exposure to hypoxia induces Egr-1 expression involving PKCα-mediated Ras/Raf-1/ERK1/2 pathway. Journal of Cellular Physiology 188 304312. (https://doi.org/10.1002/jcp.1124)

    • Search Google Scholar
    • Export Citation
  • Marshall CJ 1995 Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80 179185. (https://doi.org/10.1016/0092-8674(9590401-8)

    • Search Google Scholar
    • Export Citation
  • Mason JM, Morrison DJ, Basson MA & Licht JD 2006 Sprouty proteins: multifaceted negative-feedback regulators of receptor tyrosine kinase signaling. Trends in Cell Biology 16 4554. (https://doi.org/10.1016/j.tcb.2005.11.004)

    • Search Google Scholar
    • Export Citation
  • Matsuda F, Inoue N, Manabe N & Ohkura S 2012 Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. Journal of Reproduction and Development 58 4450. (https://doi.org/10.1262/jrd.2011-012)

    • Search Google Scholar
    • Export Citation
  • Miyoshi T, Otsuka F, Yamashita M, Inagaki K, Nakamura E, Tsukamoto N, Takeda M, Suzuki J & Makino H 2010 Functional relationship between fibroblast growth factor-8 and bone morphogenetic proteins in regulating steroidogenesis by rat granulosa cells. Molecular and Cellular Endocrinology 325 8492. (https://doi.org/10.1016/j.mce.2010.04.012)

    • Search Google Scholar
    • Export Citation
  • Patterson KI, Brummer T, O’Brien PM & Daly RJ 2009 Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochemical Journal 418 475489. (https://doi.org/10.1042/bj20082234)

    • Search Google Scholar
    • Export Citation
  • Peluso JJ, Pappalardo A & Fernandez G 2001 Basic fibroblast growth factor maintains calcium homeostasis and granulosa cell viability by stimulating calcium efflux via a PKCδ-dependent pathway. Endocrinology 142 42034211. (https://doi.org/10.1210/endo.142.10.8460)

    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45. (https://doi.org/10.1093/nar/29.9.e45)

    • Search Google Scholar
    • Export Citation
  • Price CA & Estienne A 2018 The life and death of the dominant follicle. Animal Reproduction 15 680690. (https://doi.org/10.21451/1984-3143-AR2018-0030)

    • Search Google Scholar
    • Export Citation
  • Relav L, Estienne A & Price CA 2021 Dual-specificity phosphatase 6 (DUSP6) mRNA and protein abundance is regulated by fibroblast growth factor 2 in sheep granulosa cells and inhibits c-Jun N-terminal kinase (MAPK8) phosphorylation. Molecular and Cellular Endocrinology 531 111297. (https://doi.org/10.1016/j.mce.2021.111297)

    • Search Google Scholar
    • Export Citation
  • Scimeca JC, Servant MJ, Dyer JO & Meloche S 1997 Essential role of calcium in the regulation of MAP kinase phosphatase-1 expression. Oncogene 15 717725. (https://doi.org/10.1038/sj.onc.1201231)

    • Search Google Scholar
    • Export Citation
  • Sen A, Lv L, Bello N, Ireland JJ & Smith GW 2008 Cocaine- and amphetamine-regulated transcript accelerates termination of follicle-stimulating hormone-induced extracellularly regulated kinase 1/2 and Akt activation by regulating the expression and degradation of specific mitogen-activated protein kinase phosphatases in bovine granulosa cells. Molecular Endocrinology 22 26552676. (https://doi.org/10.1210/me.2008-0077)

    • Search Google Scholar
    • Export Citation
  • Silva JM & Price CA 2000 Effect of follicle-stimulating hormone on steroid secretion and messenger ribonucleic acids encoding cytochromes P450 aromatase and cholesterol side-chain cleavage in bovine granulosa cells in vitro. Biology of Reproduction 62 186191. (https://doi.org/10.1095/biolreprod62.1.186)

    • Search Google Scholar
    • Export Citation
  • Weng Q, Liu Z, Li B, Liu K, Wu W & Liu H 2016 Oxidative stress induces mouse follicular granulosa cells apoptosis via JNK/FoxO1 pathway. PLoS ONE 11 e0167869. (https://doi.org/10.1371/journal.pone.0167869)

    • Search Google Scholar
    • Export Citation
  • Woods DC & Johnson AL 2006 Phosphatase activation by epidermal growth factor family ligands regulates extracellular regulated kinase signaling in undifferentiated hen granulosa cells. Endocrinology 147 49314940. (https://doi.org/10.1210/en.2006-0194)

    • Search Google Scholar
    • Export Citation
  • Yang MY & Rajamahendran R 2000 Involvement of apoptosis in the atresia of nonovulatory dominant follicle during the bovine estrous cycle. Biology of Reproduction 63 13131321. (https://doi.org/10.1095/biolreprod63.5.1313)

    • Search Google Scholar
    • Export Citation
  • Zhang Z, Kobayashi S, Borczuk AC, Leidner RS, Laframboise T, Levine AD & Halmos B 2010 Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis 31 577586. (https://doi.org/10.1093/carcin/bgq020)

    • Search Google Scholar
    • Export Citation