Follistatin-like I promotes endometriosis by increasing proinflammatory factors and promoting angiogenesis

in Reproduction
Authors:
Sha-Ting LeiDepartment of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China
Tongji University School of Medicine, Shanghai, People’s Republic of China
NHC Key Lab of Reproduction Regulation (Shanghai Institute of Planned Parenthood Research), Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China
Laboratory for Reproductive Immunology, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China
Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China

Search for other papers by Sha-Ting Lei in
Current site
Google Scholar
PubMed
Close
,
Ming-Qing LiNHC Key Lab of Reproduction Regulation (Shanghai Institute of Planned Parenthood Research), Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China
Laboratory for Reproductive Immunology, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China
Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai, People’s Republic of China

Search for other papers by Ming-Qing Li in
Current site
Google Scholar
PubMed
Close
,
Yan-Ling CaoDepartment of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China

Search for other papers by Yan-Ling Cao in
Current site
Google Scholar
PubMed
Close
,
Shu-Hui HouDepartment of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China
Tongji University School of Medicine, Shanghai, People’s Republic of China

Search for other papers by Shu-Hui Hou in
Current site
Google Scholar
PubMed
Close
,
Hai-Yan PengDepartment of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China
Tongji University School of Medicine, Shanghai, People’s Republic of China

Search for other papers by Hai-Yan Peng in
Current site
Google Scholar
PubMed
Close
,
Dong ZhaoDepartment of Obstetrics and Gynecology, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, People’s Republic of China

Search for other papers by Dong Zhao in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-2118-2910
, and
Jing SunDepartment of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China

Search for other papers by Jing Sun in
Current site
Google Scholar
PubMed
Close
View More View Less

Correspondence should be addressed to D Zhao or J Sun; Email: hendryz@gmail.com or sunjing61867@126.com
Free access

Endometriosis (EMS) is a chronic benign inflammatory disease characterized by the growth of endometrial-like tissue in aberrant locations outside of the uterine cavity. Angiogenesis and abnormal immune responses are the fundamental requirements of endometriotic lesion survival in the peritoneal cavity. Follistatin-like I (FSTL1) is a secreted glycoprotein that exhibits varied expression levels in cardiovascular disease, cancer and arthritis. However, the role of FSTL1 in the development of EMS remains to be fully elucidated. Results of the present study demonstrated that the expression of FSTL1 was significantly increased in ectopic endometrial stromal cells (ESCs) and peritoneal fluid from patients with EMS, compared to the control group. Both conditions of hypoxia and estrogen treatment induced human ESCs to produce increased levels of FSTL1 and disco-interacting protein 2 homolog A (DIP2A). Furthermore, the expression levels of DIP2A, IL8 and IL1β were increased in FSTL1 overexpressed HESCs. Additionally, FSTL1 treatment increased the proliferation of HUVECs in a dose-dependent manner in vitro and markedly increased the tube formation of HUVECs. Moreover, treatment with FSTL1 facilitated M1 polarization of macrophages, increased the secretion of proinflammatory factors and inhibited the expression of scavenger receptor CD36. Results of the present study suggested that the elevated expression of FSTL1 may play a key role in accelerating the development of EMS via enhancing the secretion of proinflammatory factors and promoting angiogenesis.

Abstract

Endometriosis (EMS) is a chronic benign inflammatory disease characterized by the growth of endometrial-like tissue in aberrant locations outside of the uterine cavity. Angiogenesis and abnormal immune responses are the fundamental requirements of endometriotic lesion survival in the peritoneal cavity. Follistatin-like I (FSTL1) is a secreted glycoprotein that exhibits varied expression levels in cardiovascular disease, cancer and arthritis. However, the role of FSTL1 in the development of EMS remains to be fully elucidated. Results of the present study demonstrated that the expression of FSTL1 was significantly increased in ectopic endometrial stromal cells (ESCs) and peritoneal fluid from patients with EMS, compared to the control group. Both conditions of hypoxia and estrogen treatment induced human ESCs to produce increased levels of FSTL1 and disco-interacting protein 2 homolog A (DIP2A). Furthermore, the expression levels of DIP2A, IL8 and IL1β were increased in FSTL1 overexpressed HESCs. Additionally, FSTL1 treatment increased the proliferation of HUVECs in a dose-dependent manner in vitro and markedly increased the tube formation of HUVECs. Moreover, treatment with FSTL1 facilitated M1 polarization of macrophages, increased the secretion of proinflammatory factors and inhibited the expression of scavenger receptor CD36. Results of the present study suggested that the elevated expression of FSTL1 may play a key role in accelerating the development of EMS via enhancing the secretion of proinflammatory factors and promoting angiogenesis.

Introduction

Endometriosis (EMS) is characterized by extra-uterine endometrial-like tissues that react to an ovary-derived estrogen stimulus. EMS affects ~10% of reproductive-aged women (Giudice & Kao 2004). The main symptoms of EMS include pelvic pain, dysmenorrhea, dyspareunia, infertility and menstrual irregularities (Nap et al. 2004). Although it is a benign chronic inflammatory disease, EMS exhibits characteristics of upregulated proliferative capacity and invasiveness, defective apoptosis, angiogenesis and recurrence (Vigano et al. 2004). Results of a previous study highlighted that the retrograde menstruation hypothesis is the most widely accepted theory of pathogenesis; however, the exact mechanisms underlying the pathogenesis of this enigmatic disease remain to be fully elucidated (Bulun 2009). Accumulating evidence indicated that the formation and persistence of ectopic lesions in the peritoneal microenvironment of EMS were associated with the intrinsic abnormalities in the endometrium of affected women, the imbalance of pro- and anti-inflammatory factors, and the dysfunction of the immune system (Osuga et al. 2011, Capobianco & Rovere-Querini 2013, Lei et al. 2018, Zhou et al. 2019). Thus, an increased understanding of the pathogenesis of EMS is required for the development of precision medicine.

Follistatin-like 1 (FSTL1), also referred to as follistatin-related protein or TGFB-stimulated clone 36, is a secreted extracellular glycoprotein belonging to the secreted protein acidic rich in cysteine (SPARC) protein family (Sylva et al. 2013). Like other SPARC protein family members, FSTL1 possesses extracellular calcium-binding E-F hand motif and follistatin-like domain. However, FSTL1 has low protein sequence homology to follistatin (16%) (Ouchi et al. 2010), the activin-A binding protein. Furthermore, FSTL1 does not function through binding partners of TGFB superfamily proteins like follistatin or FSTL3. DIP2A (disco-interacting protein 2 homolog A), a cell-surface receptor of FSTL1, combines with FSTL1 and involves in vascularization and regulation of immune response (Ouchi et al. 2010, Mattiotti et al. 2018). FSTL1 is ubiquitously expressed in mammalian cells of mesenchymal lineage, and it participates in regulation of multiple biological and pathological processes, such as embryonic development, cardiac and lung dysfunction and repair, tumorigenesis, vascularization and immune response (van Rooij 2016, Cheng et al. 2017, Liu et al. 2017b, Tania et al. 2017, Yang et al. 2017d, Zheng et al. 2017, Kudo-Saito et al. 2018, Mattiotti et al. 2018). Expression of FSTL1 is upregulated during heart failure and ischemic injury. Moreover, FSTL1 increases cardiomyocyte survival and stimulates angiogenesis to enhance cardiac regeneration and repair by phosphorylation of AKT (Oshima et al. 2008, Wei et al. 2015, van Rooij 2016). The role of FSTL1 in tumorigenesis remains controversial, as decreased expression levels of FSTL1 were associated with poor prognosis of numerous cancer types, such as ovarian and endometrial cancer, prostate malignancy, renal clear cell carcinoma and lung adenocarcinoma (Meehan et al. 2002, Chan et al. 2009, Liu et al. 2016, Chiou et al. 2017). On the other hand, upregulated expression levels of FSTL1 were observed in colon cancer, hepatocellular carcinomas, glioblastoma and esophageal squamous cell carcinoma (Reddy et al. 2008, Torres et al. 2013, Lau et al. 2017, Yang et al. 2017c). These differing expression levels of FSTL1 may be due to heterogeneity in different cancers, and multiple mechanisms underlying the processes involved in tumor development (Mattiotti et al. 2018). FSTL1 plays a key role in diverse and cell type-specific functions in the regulation of cell survival, metabolism, cell differentiation and migration (Lee et al. 2017, Liu et al. 2017b). Additionally, FSTL1 is an important mediator in the pathogenesis of immune disease and exhibits a dual function in inflammatory processes. For example, in the acute phase of inflammation, FSTL1 acts as an anti-inflammatory factor. However, during long-term and chronic inflammatory disease, FSTL1 plays a proinflammatory role (Mattiotti et al. 2018). Thus, increasing evidence demonstrates that FSTL1 acts as a mediator between cells in dynamic cytokine environments during inflammatory diseases (Wang et al. 2016, Cheng et al. 2017).

As the specific role of FSTL1 in EMS as a persistent disease with chronic inflammation is yet to be fully established, the present study aimed to investigate the role of FSTL1 in EMS development. In the present pilot study, the expression levels of FSTL1 were examined in ectopic endometrial stromal cells (ESCs) and the peritoneal fluid of patients with EMS. Subsequently, the effects of FSTL1 on the biological behavior of HESCs, HUVECs and macrophages were examined. The results of the present study suggested that FSTL1 plays a key role in EMS and may act as a novel therapeutic target for the treatment of EMS.

Materials and methods

Subjects and sample collection

Participants (age, 20–45 years) were recruited from Shanghai First Maternity and Infant Hospital. Prior to sample collection, all subjects signed a written consent form. The research protocol was approved by the Medical and Life Science Ethics Committee of Tongji University. EMS peritoneal fluid (n = 18) or ectopic endometrial tissues (n = 7) were obtained from 25 patients undergoing laparoscopic excision of ovarian endometrioma. One sample of EMS peritoneal fluid contaminated with blood was excluded. The control group was selected according to previous studies (Chang et al. 2017, Yang et al. 2017b). Control endometrial tissues (n = 6) and control peritoneal fluid (n = 9) were obtained from 15 women who underwent hysterectomy for leiomyoma but did not have EMS or adenomyosis. All samples were collected during the proliferative phase of the cycle. None of the included patients had received any hormonal therapy within 6 months before the surgical procedure, and none had experienced pelvic inflammatory disease. The diagnosis of EMS was confirmed according to laparoscopic and histopathological evaluation. According to the revised American Fertility Society classification of EMS, patients with EMS were divided into two groups: Stage I–II and stage III–IV. The endometrial tissues were collected under sterile conditions and transported to the laboratory on ice in DMEM/F-12 (Hyclone; Cytiva), and subsequently used for isolating and culturing ESCs. Peritoneal fluids were centrifuged at 453 g at 4°C for 10 min, and the supernatant was stored at −80°C.

Cell isolation and culture

Normal ESCs and ectopic ESCs were isolated and cultured according to the previously reported method (Yu et al. 2016). Endometrial tissues or ovarian endometrioma tissues were minced into small pieces (1–2 mm3) and then digested by Collagenase type IV (0.1%, Sigma-Aldrich; Merck KGaA) in a 37°C shaker for 40–60 min, and subsequently filtered through 100-µm nylon mesh and 40-um nylon mesh (Falcon cell strainers; Thermo Fisher Scientific, Inc.) to remove cell debris. The ESCs were cultured in DMEM/F-12 containing 10% FBS (ScienCell Research Laboratories, Inc.), ampicillin (100 IU/mL) and streptomycin (100 IU/mL). The immortalized human endometrial stromal cell line (HESC; cat. no. CRL-4003™) was obtained from the American Type Culture Collection, and HESCs were maintained in DMEM/F-12. HUVECs were purchased from Shanghai Zhong Qiao XinZhou Biotechnology Co., Ltd. and cultured in endothelial cell medium (ECM) (Hyclone; Cytiva) supplemented with 10% FBS, 100 IU/mL ampicillin and 100 IU/mL streptomycin. Human THP-1 cells were purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences and cultured in RPMI 1640 medium (Hyclone; Cytiva) with 10% FBS, 100 IU/mL ampicillin and 100 IU/mL streptomycin. All cells were cultured in a humidified atmosphere at 37°C with 5% CO2. To explore the impacts of FSTL1 on macrophages, PMA (100 ng/mL, MCE) was used to induce THP-1 cells into M0 cells for 48 h. And then, M0 cells were administrated with PBS or rhFSTL1 (200 ng/mL) for 36 h.

RT-qPCR

Total RNA of NESCs, EESCs, FSTL1 overexpressed HESCs and rhFSTL1 treated M0 cells was extracted using TRIzol® reagent (Takara Bio, Inc.) according to the manufacturer’s protocol. Total RNA was reversed transcribed into cDNA using a Prime Script RT Master Mix (Takara Bio, Inc.). Expression levels of FSTL1 mRNA were detected using TB Green Ex TaqTM II (Takara Bio, Inc.) with specific primers (sequences of primers listed in Table 1) according to the manufacturer’s protocol. qPCR was performed by Applied Biosystem StepOneTM RT-PCR System (Applied Biosystem; Thermo Fisher Scientific, Inc.). A three-step PCR was performed for 40 cycles. The samples were denaturized at 95°C for 30 s, annealed at 95°C for 5 s and extended at 60°C for 30 s. Analysis of relative gene expression data using the 2−ΔΔCT method. For each sample, the relative mRNA level was normalized to the internal reference gene GAPDH. All experiments were carried out in triplicate.

Table 1

The sequences of primers used for RT-qPCR.

Gene Forward primer (5’–3’) Reverse primer (5’–3’)
FSTL1 TGGCAGTAATGGCAAGACCT GATAGCAAACAACTGGGCTGG
DIP2A TCTGTCCTTGTGCATTCGTCTGTG GGAGCGGAGTGGAGGTGAGTC
BECN1 GGAGCTGCCGTTATACTGTTCTGG TGCCTCCTGTGTCTTCAATCTTGC
MAP1LC3B CCGACTTATTCGAGAGCAGCATCC GTCCGTTCACCAACAGGAAGAAGG
SQSTM1 CCGTCTACAGGTGAACTCCAGTCC AGCCAGCCGCCTTCATCAGAG
COX2 GCCATGGGGTGGACTTAAATCAT CCTGAGTATCTTTGACTGTGGGA
TNFA TCCCCAGGGACCTCTCTCTAA AGCTTGAGGGTTTGCTACAACAT
IL1B TGAGCTCGCCAGTGAAATGA AGGAGCACTTCATCTGTTTAGGG
IL8 CACTGCGCCAACACAGAAAT TCTCAGCCCTCTTCAAAAACTTC
IL6 AGTCCTGATCCAGTTCCTGC CTACATTTGCCGAAGAGCCC
CD86 ACGACGTTTCCATCAGCTTGT CCGCGTCTTGTCAGTTTCCA
CD206 TTGGACGGATGGACGAGGAGTC CGGATCGTGTCTGGCATATGTAGC
CD14 GAACTCCCTCAATCTGTCGTTC GTCCAGTGTCAGGTTATCCAC
TLR4 AAGCCGAAAGGTGATTGTTG CTGAGCAGGGTCTTCTCCAC
CD36 CAGAGGCTGACAACTTCACAG AGGGTACGGAACCAAACTCAA
GAPDH TGGTGAAGGTCGGTGTGAAC GCTCCTGGAAGATGGTGATGG

ELISA

The peritoneal fluid was collected as previously mentioned and then centrifuged at 453 g at 4°C for 10 min to remove cellular debris. Peritoneal fluid contaminated with blood was excluded. The levels of FSTL1 in peritoneal fluid were measured using a human FSTL1 ELISA kit (cat. no. KOA0509; Rochland) according to the manufacturer’s protocol. The sensitivity of this assay product is 10 pg/mL with a range of 312–20,000 pg/mL. Each sample was repeated in duplicate.

Hypoxia and estradiol treatment

Hypoxia was induced in a hypoxia incubator at 2% O2. HESCs were treated in hypoxia condition for 0, 24, 48 and 72 h, respectively, after that the total protein level of FSTL1 was analyzed by Western blotting. To explore the joint effect of hypoxia and estradiol treatment on the expression of FSTL1 in HESCs, HESCs were administrated with different concentration (0, 10−8 and 10−7 mol/L) of 17β-estradiol (Sigma-Aldrich; Merck KGaA) + normal oxygen (21% O2) and different concentration (0, 10−8 and 10−7 mol/L) of 17β-estradiol + hypoxia condition (2% O2) for 48 h. The total protein level of FSTL1 and DIP2A were analyzed by Western blotting. The integrated density (IntDen) was calculated by ImageJ software. IntDen ratio of each FSTL1 and DIP2A band relative to GAPDH band was used to normalize band intensities.

Western blot analysis

HESCs treated by hypoxia and estradiol were washed twice with ice-cold PBS and lysed with RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China). A BCA Protein Assay kit (Beyotime Institute of Biotechnology) was used to determine total protein concentration. Equal amounts of proteins (20 μg/lane) were separated by SDS-PAGE on a 10% gel and subsequently transferred onto PVDF membranes (Bio-Rad Laboratories, Inc.). The membranes were blocked with 5% non-fat dry milk at room temperature for 1 h and incubated with the following primary antibodies: Rabbit anti-human disco-interacting protein 2 homolog A (DIP2A) antibody (1:1,000; cat. no. PA5-49457; Thermo Fisher Scientific, Inc.), rabbit anti-human FSTL1 antibody (1:500; cat. no. ab71548; Abcam), rabbit anti-human GAPDH antibody (1:1,000; cat. no. 5174; Cell Signaling Technology, Inc.) at 4°C overnight. Following primary incubation, membranes were washed three times in TBS-Tween-20 and subsequently incubated with HRP-linked anti-rabbit IgG (1:3,000; cat. no. 7074; Cell Signaling Technology, Inc.) at room temperature for 60 min. Protein bands were visualized using ECL reagent (Millipore, Sigma) and exposed using an imaging analysis system (Bio-Rad Laboratories, Inc.).

FSTL1 overexpression plasmid transfection

FSTL1 overexpression plasmids (24906-3, Lot 133C76F) and control plasmids (CON083, Lot P17060100) were purchased from Shanghai GeneChem Co., Ltd. Plasmids were transfected into HESCs using Attractene Transfection Reagent (Qiagen GmbH) according to the manufacturer’s protocol. The overexpression efficiency was confirmed using RT-q PCR.

Matrigel invasion assay

The invasion of ESCs was evaluated using a Matrigel invasion assay according to a previously reported method (Li et al. 2012, Shao et al. 2016). Cell inserts (pore size, 8 μm pore size; diameter, 6.5 mm; Corning, Inc.) were coated with 60 μL of eight-fold diluted Matrigel (BD Biosciences, CA, USA). A total of 2 × 104 normal primary ESCs in 200 μL DMEM/F12 medium supplemented with 10% FBS were seeded into the upper chamber. PBS or rhFSTL1 (10 ng/mL) was also placed in the upper chamber. A total of 800 μL DMEM/F12 medium supplemented with 10% FBS was plated in the lower chamber. Following 48 h of incubation at 37°C, the Matrigel and uninvaded cells were removed from the upper surface of the inserts using a cotton bud. The invaded cells were fixed with 100% methanol at room temperature for 10 min and subsequently stained with crystal violet at room temperature for 20 min. Images of invaded cells were captured using an Olympus BX51+DP70 light microscope (Olympus Corporation).

Tubular formation assay

HUVECs were pretreated with PBS or rhFSTL1 (200 ng/mL) at 37°C for 24 h. Matrigel was thawed at 4°C, and 50 μL Matrigel was evenly spread in each well of a 96-well plate. Following solidification in 5% CO2 at 37°C for 1 h, the pretreated HUVECs were digested and the density was adjusted to 8.0 × 104 cells/mL. A total of 100 μL cell suspension was added to each well, and the plate was subsequently cultured in 5% CO2 at 37°C for 9 h. In order to trace tubular formation, Calcein-AM (Shanghai Yeasen Biotechnology Co., Ltd., Shanghai, China) was used to stain living HUVECs at 37°C for 30 min. We took general pictures for each well (96-well plate) at 100× magnification. And for quantification of tubular formation effect, we took pictures from five randomly selected 400× fields. Capillary-like tubular formation was quantified by counting the number of junctions, nodes, branches and total length using ImageJ software (Version 1.43, National Institutes of Health).

Cell Counting Kit-8 (CCK-8) assay

The viability of HUVECs was measured using a CCK-8 assay (Dojindo Laboratories, Inc., Tokyo, Japan) according to the manufacturer’s protocol. Cells were seeded in 96-well plates at a density of 1 × 104/well and treated with different concentrations (0, 10, 50, 100 ng/mL) of rhFSTL1 (PeproTech, Inc., Cranbury, NJ, USA) for 48 h. Subsequently, 100 μL of ten-fold diluted CCK-8 primary solution was added into each well and incubated for 1 h in the dark at 37°C. The absorbance was detected at a wavelength of 450 nm using a DigiScan Microplate Reader (ASYS Hitech GmbH). Each group was tested in duplicate using six wells. Each experiment was repeated three times.

Statistical analysis

All statistical analyses were carried out using GraphPad Prism 6.0 software (GraphPad Software Inc.). Data are presented as the mean ± s.e.m. from three independent experiments. Differences between two groups were analyzed using paired t-tests, unpaired t-tests or Mann–Whitney test. Comparisons among ≥3 groups were analyzed using one-way ANOVA followed with Bonferroni’s multiple comparisons test. P < 0.05 was considered to indicate a statistically significant difference.

Results

FSTL1 is highly expressed in ectopic ESCs and peritoneal fluid of patients with EMS

To investigate the expression levels of FSTL1 in normal ESCs and ectopic ESCs, RT-qPCR analysis was performed. The results demonstrated that the relative mRNA expression of FSTL1 was significantly upregulated in ectopic ESCs, compared with normal ESCs (Fig. 1A). Moreover, protein expression levels of FSTL1 were also increased in the peritoneal fluid of patients with EMS, compared with the control group (Fig. 1B). We further analyzed the relationship between FSTL1 expression level and the clinical severity of EMS. The expression of FSTL1 increased as the severity of EMS worsened (Fig. 1C). FSTL1 in peritoneal fluid from ESM(III–IV) group was dramatically increased compared with FSTL1 in the control group (P  = 0.0185) (Fig. 1C). However, there was no statistical difference between the control group and ESM(I–II) group. Also, ESM(I–II) group and ESM(III–IV) group did not show statistical difference even though the level of FSTL1 increased significantly (Fig. 1C).

Figure 1
Figure 1

FSTL1 is highly expressed in ectopic ESCs and peritoneal fluid of patients with EMS. (A) mRNA expression levels of FSTL1 in normal and ectopic ESCs were examined using RT-quantitative PCR (unpaired t-test). (B) Levels of secreted FSTL1 in the peritoneal fluid of patients with or without EMS were analyzed using ELISA (Mann–Whitney test). (C) The EMS group was further divided into EMS(I–II) and EMS(III–IV) two groups according to the severity of EMS, and the FSTL1 level in these groups was analyzed (one-way ANOVA followed with Bonferroni’s multiple comparisons test). NESCs, ESCs isolated form normal endometrium (n = 6); EESCs, ESCs isolated from ectopic lesions (n = 7); CTRL-PF, peritoneal fluid from women without EMS (n = 9); EMS-PF, peritoneal fluid from women with EMS (n = 17); EMS(I–II)-PF, peritoneal fluid from women with EMS in early stages (stage I and stage II; n  = 8); EMS(III–IV)-PF, peritoneal fluid from women with EMS in advanced stages (stage III and stage IV; n  = 9). Data are expressed as the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001; NS, no statistical difference; FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; EMS, endometriosis.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

Hypoxia and estrogen increase the expression of FSTL1 in ESCs

To explore if hypoxia and estrogen exhibit an effect on the expression of FSTL1, HESCs were treated with different concentrations (0, 10−8 and 10−7mol/L) of 17β-estradiol and cultured at varying durations (0, 24, 48, 72 h) of hypoxic conditions (2% O2). Western blotting was performed to detect the expression levels of FSTL1. Results of the present study demonstrated that conditions of hypoxia for 24 h and 48 h significantly increased the expression of FSTL1 compare with normal oxygen (21% O2) (Fig. 2A). However, 72 h of hypoxia treatment exhibited a suppression effect (Fig. 2A). Moreover, treatment with high concentrations (10^−7mol/L) of 17β-estradiol increased the expression levels of FSTL1 and DIP2A, a functional receptor specific to FSTL1 in HESCs (Fig. 2B) (Ouchi et al. 2010). Furthermore, conditions of hypoxia for 48 h combine with estrogen treatment seems to have stronger stimulatory effect than estrogen alone (Fig. 2B). The expression of FSTL1 and DIP2A in HESCs significantly augmented under hypoxia condition for 48h (Fig. 2B).

Figure 2
Figure 2

Hypoxia and estrogen conditions increase the expression of FSTL1 in ESCs. (A) HESCs were cultured in conditions of hypoxia (2% O2) for 0, 24, 48 and 72 h, and the total protein levels of FSTL1 were subsequently analyzed using Western blotting. (B) HESCs were co-treated with different concentrations of 17β-estradiol (0, 10−8 and 10−7 mol/L) and either normal oxygen (21% O2) or hypoxic conditions (2% O2) for 48 h. The total protein expression levels of FSTL1 and DIP2A were analyzed using Western blotting. The integrated density (IntDen) was calculated by ImageJ software, IntDen ratio of each FSTL1 and DIP2A band relative to GAPDH band was presented at the bottom of the Western blotting panel. FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; HESCs, human endometrial stromal cells; DIP2A, disco-interacting protein 2 homolog A.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

FSTL1 promotes the secretion of inflammatory cytokines and the invasion of ESCs

To further investigate the function of FSTL1 in ESCs, HESCs were transfected with FSTL1 overexpression plasmids, and the efficiency of overexpression was verified using RT-qPCR analysis. Results of the present study demonstrated that the relative mRNA expression of FSTL1 in the overexpression group was increased by 214-fold, compared with the control group (Fig. 3A). Moreover, results of the RT-qPCR analysis demonstrated that overexpression of FSTL1 in HESCs promoted the expression of DIP2A (Fig. 3B). Additionally, inflammatory cytokines IL8 and IL1B were markedly upregulated in HESCs, compared with the control group (Fig. 3C). However, no significant difference was observed for the levels of autophagy gene (BECN1, MAP1LC3B and SQSTM1) in FSTL1 overexpressed HESCs, compared with the negative control group (Fig. 3D). Meanwhile, rhFSTL1 (10 ng/mL) treatment increased the expression of IL8 and IL1B in HESCs dramatically compared with control group (Supplementary Fig. 1A and B, see section on supplementary materials given at the end of this article). However, there was no statistical difference in the expression of DIP2A (Supplementary Fig. 1C). Furthermore, the role of FSTL1 in the regulation of HESCs biological behavior was investigated, and results of the present study demonstrated that treatment with rhFSTL1 (10 ng/mL) significantly increased the invasiveness of ESCs, compared with the non-treated group (Fig. 3E and F).

Figure 3
Figure 3

FSTL1 promotes the secretion of inflammatory cytokines and the invasion of ESCs. (A) Transfection efficiency of FSTL1 overexpression plasmids was confirmed using RT-qPCR (unpaired t-tests). (B, C and D) mRNA levels of DIP2A, IL8, IL1B, BECN1, MAP1LC3B and SQSTM1 were detected using RT-qPCR (unpaired t-tests or Mann–Whitney test). (E) HESCs were treated with PBS or rhFSTL1 (10 ng/mL) and the invasion of HESCs was detected. Five fields of vision were randomly selected and transmembrane cells were counted. (F) Statistical analysis of invaded HESCs (unpaired t-test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001. NS, not significant; NC, negative control; OE, overexpression; FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; RT-qPCR, RT-quantitative PCR; DIP2A, disco-interacting protein 2 homolog A; SQSTM1, sequestosome-1; HESCs, human endometrial stromal cells.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

FSTL1 stimulates endothelial cell survival and the formation of vascular-like structures

To further explore the effects of FLST1 on angiogenesis, HUVECs were treated with PBS or rhFSTL1 (200 ng/mL) for 24 h, and tubular formation assays were conducted.

Results of the present study suggested that FSLT1 treatment stimulated the formation of network structures by HUVECs (Fig. 4A). According to the statistical analysis, the number of junctions, nodes, branches and total length were markedly increased in the rhFSTL1 treated group, compared with the non-treated group (Fig. 4B). Furthermore, rhFSTL1 treatment increased the viability of HUVECs in a concentration-dependent manner (Fig. 4C). These findings suggested that FSTL1 in endometriotic milieu may stimulate angiogenesis and promote EMS.

Figure 4
Figure 4

FSTL1 promotes endothelial cell survival and formation of vascular-like structures. (A) HUVECs were pretreated with PBS or rhFSTL1 (200 ng/mL) for 24 h. Tubular formation assays were conducted and Calcein-AM was used to stain living HUVECs. Images were captured after 9 h of tubular formation. (B) Number of junctions, nodes, branches and total length of capillary-like tubular formations were counted using ImageJ software (unpaired t-tests or Mann–Whitney test). (C) Cell viability of HUVECs following treatment with different concentrations of FSTL1 was detected using a Cell Counting Kit-8 assay (one-way ANOVA followed with Bonferroni’s multiple comparisons test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001. NS, not significant; FSTL1, Follistatin-like I; HUVECs, human umbilical vein endothelial cells.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

FSTL1 regulates proinflammatory cytokine secretion and the polarization of macrophages

To investigate the potential effects of FSTL1 on the endometriotic immune microenvironment, the role of FSTL1 in the regulation of macrophage differentiation and function was investigated, as macrophages are the most abundant immune cells in endometriotic milieu (Halme et al. 1987, Kubicka et al. 1996, Berbic et al. 2009). Results of the present study demonstrated that the expression of inflammatory cytokines, such as COX2, IL6, IL8, TNFA and IL1B, in M0 cells were significantly upregulated by rhFSTL1, compared with the control group (Fig. 5A). Moreover, the expression of DIP2A was also increased in rhFSTL1 treated group (Fig. 5A). Notably, the expression of CD86 in M0 cells was markedly increased, and the expression of CD206 was reduced in the FSTL1 treated group, compared with the control group (Fig. 5B). These findings indicated that FSTL1 polarized macrophages toward an M1 phenotype. However, no significant difference was observed in the expression levels of TLR4 and CD14 (Fig. 5C). Notably, CD36, a phagocytic biomarker of macrophages, was decreased in rhFSTL1 treated group, compared with the control group (Fig. 5D), indicating that FSTL1 suppresses the phagocytosis of macrophages.

Figure 5
Figure 5

FSTL1 regulates the secretion of proinflammatory cytokines and the polarization of macrophages. (A, B, C, D, E and F) THP-1 cells were transformed into M0 macrophages following treatment with PMA (100 ng/mL) for 48 h. M0 cells were subsequently treated with PBS or rhFSTL1 (200 ng/mL) for 36 h, and the relative mRNA expression of COX2, IL6, IL8, TNFA, IL1B, DIP2A, CD86, CD206, TLR4, CD14 and CD36 was analyzed using RT-quantitative PCR (unpaired t-tests or Mann–Whitney test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001; NS, no statistical difference; FSTL1, Follistatin-like I; PMA, phorbol 12-myristate 13-acetate.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

Discussion

EMS is an estrogen-dependent, chronic inflammatory disease that typically affects women of reproductive age. The natural state of the endometrium, immune system and peritoneal microenvironment are altered in women with EMS (Bulun 2009, de Ziegler et al. 2010, Capobianco & Rovere-Querini 2013, Donnez et al. 2016, Izumi et al. 2018). According to the results of previous studies, FSTL1 modulates immune response and exhibits both pro- and anti-inflammatory effects (Chaly et al. 2014). Additionally, results of previous studies have revealed that FSTL1 is crucial in the pathogenesis of rheumatoid arthritis, obesity and other chronic inflammatory diseases (Wilson et al. 2010, Chaly et al. 2012, Fan et al. 2013). However, the role of FSTL1 in ESM is yet to be fully elucidated.

Results of the present study demonstrated an increased expression of FSTL1 in ectopic ESCs and the peritoneal fluid of patients with EMS. These findings suggested an association between FSLT1 and the mechanisms underlying EMS. Hypoxia is essential for the microenvironment of the ectopic lesion implants (Kim et al. 2015, Dai et al. 2019), thus, the effects of hypoxia on FSTL1 expression were explored in HESCs. Results of the present study demonstrated that the protein expression levels of FLST1 in HESCs were increased under conditions of hypoxia, and protein expression levels were highest following 48 h of incubation under hypoxic conditions. Consistent with the results of the present study, results of previous studies demonstrated that FSTL1 protein expression was markedly upregulated in primary human trophoblasts cells under hypoxic conditions (Mouillet et al. 2015). Moreover, the present study revealed that treatment with estrogen promoted the synthesis of FSTL1 in HESCs. In addition, the expression of DIP2A was also increased under conditions of hypoxia and following treatment with estrogen. Consistent with the results of the present study, results of previous studies demonstrated that the expression of FSTL1 was upregulated by estrogen and tamoxifen in osteoblastic cells, highlighting that FSTL1 may be an estrogen-regulated gene (Ohashi et al. 1997).

Communication among cells of the endometrial tissue, blood vessels and the immune system is required during the development of endometriotic lesions. In order to examine the role of FSLT1 secreted by ectopic ESCs in the development of EMS, FSTL1 overexpression plasmids and rhFSTL1 were used to mimic the expression of FSTL1 in ectopic milieu. Results of the present study demonstrated that transfection with FSTL1 overexpression plasmids in HESCs led to the upregulation of DIP2A and proinflammatory cytokines IL8 and IL1B. Moreover, treatment with rhFSTL1 in vitro markedly increased the levels of pro-inflammatory cytokines secreted by macrophages, including COX2, IL6, IL8, TNFA and IL1B. These findings were consistent with those of a previous study, highlighting that FSTL1 was highly expressed in arthritis, and overexpression of FSTL1 in macrophages and fibroblasts resulted in the upregulation of proinflammatory factors (Miyamae et al. 2006). Moreover, Fan et al. revealed that FSTL1 enhanced the synthesis of IL6 and TNFA in macrophages during obesity (Fan et al. 2013). These proinflammatory cytokines allow ectopic tissue to escape from immune surveillance, increase the levels of invasiveness and promote angiogenesis (Sacco et al. 2012, Zhang et al. 2018, Lai et al. 2019). According to the results of ELISA in this study, the level of FSTL1 in peritoneal fluid was approximately 2–15 ng/mL, so we treated the HESCs with 10 ng/mL rhFSTL1 in vitro. And, rhFSTL1 promoted the invasion of HESCs significantly. Also, the expression of IL8 and IL1B was increased markedly in rhFSTL1 treated group. However, when we used the same concentration of rhFSTL1 (10 ng/mL) to treat HUVECs or macrophages, there was no statistical function change. So, we increased the concentration of rhFSTL1 according to previous research (Liu et al. 2017c, Li et al. 2020, Xi et al. 2021). In a study by Yi Liu et al., the serum level of FSTL1 in the control group was 5.301 ± 0.779 ng/mL, which is similar to our results. And Yi Liu et al. used 100–250 ng/mL concentration of rhFSTL1 to perform in vitro experiments (Liu et al. 2017c). The specific reason still needs to be explored. According to the results of a previous study, the levels of autophagy were reduced in ectopic tissues, compared with normal endometrium (Yang et al. 2017a). Moreover, FSTL1 promoted airway remodeling by activating autophagy in asthma (Liu et al. 2017a). Nevertheless, results of the present study demonstrated that FSTL1 did not change the autophagy level of ESCs; however, further studies are required for verification.

Angiogenesis is crucial during the formation of tridimensional cysts as they transport oxygen and nutrients to endometrial tissues. However, novel vessels are not sufficient during the formation of ectopic lesions. Results of the present study demonstrated that treatment with rhFSTL1 promoted endothelial cell survival and the formation of vascular-like structures. These findings are consistent with those of a previous study, highlighting that treatment with FSTL1 increased revascularization in the ischemic limbs of mice. Furthermore, transduction of an adenoviral vector expressing FSTL1 into HUVECs stimulated the migration and differentiation into network structures by activating the phosphorylation of AKT-endothelial nitric oxide synthase signaling under ischemic conditions (Ouchi et al. 2008).

In the peritoneal microenvironment, macrophages comprise a major population of immune cells. This study highlighted that FSTL1 stimulates M0 cells to synthesize and secrete various inflammatory cytokines, such as COX2, IL6, IL8, TNFA and IL1B, which may facilitate the adhesion, invasion or proliferation of ESCs and the progression of EMS (Wu et al. 2002, Khan et al. 2005, Richter et al. 2005, Sikora et al. 2017). Recent studies revealed that the number of activated macrophages increased in peritoneal fluid of patients with EMS. And both M1 macrophages (classically activated phenotype) and M2 macrophages (alternatively activated phenotype) have been identified in the microenvironment of peritoneal fluid from patients with EMS (Beste et al. 2014). M1 macrophages, which produce pro-inflammatory effect, promote tissue damage and worsen inflammatory disease progression (Berbic et al. 2009). However, M2 macrophages are involved in tissue repair and remodeling, and suppress inflammatory responses (Miller et al. 2020). Our present study demonstrated that FSTL1 played a role in modulating macrophage polarization and phagocytosis. Treatment with rhFSTL1 facilitated the M1 proinflammatory phenotype, and suppressed the anti-inflammatory M2 polarization of macrophages by upregulating the expression of CD86 and inhibiting the expression of CD206. Consistent with the results of the present study, results of a previous study demonstrated that FSTL1 increased the migrative property of macrophages and favored the M1 phenotype compared with the M2 phenotype (Li et al. 2020). Macrophages play an important role in the development of EMS by removing cell debris, antigen presentation and so on. However, the phagocytosis ability of peritoneal macrophages declined in line with the severity of EMS (Dmowski et al. 1998). The reason why the phagocytosis ability of peritoneal macrophages from patients with EMS decreased remains unclear. Previous studies reported that downregulation of CD36, a class B scavenger receptor of macrophages (Chuang et al. 2009, 2010), results in the reduced phagocytic ability of peritoneal macrophages of patients with EMS (Chuang et al. 2009, 2010). In our present study, we demonstrated that CD36 was inhibited by FSTL1 in vitro, suggesting that FSTL1 may promote the development of EMS via suppressing the phagocytic ability of macrophages in ectopic milieu.

The overall understanding of the associations between FSTL1 and the development of EMS remains limited. Therefore, future in-depth exploration of the interactive modes and mechanisms underlying FSTL1in EMS are required to further verify the results of the present study.

Collectively, FSLT1 contributes to the development of endometriosis by stimulating proinflammatory cytokines and angiogenesis (Fig. 6). In the endometriotic milieu, FSTL1 expression levels were increased by ectopic ESCs under conditions of hypoxia and treatment with estrogens. The elevated FSTL1 levels may increase the invasiveness of ESCs and promote the synthesis of IL8 and IL1B. On the other hand, elevated levels of FSTL1 may play a key role in the communication between ESCs, macrophages and endothelial cells. Moreover, FSTL1 promoted the survival of endothelial cells and neovascularization. FSTL1 also facilitated M1 polarization of macrophages, promoted the secretion of proinflammatory factors and inhibited the expression of scavenger receptor CD36. Collectively, these findings revealed the role of FSTL1 in the modulation of EMS via an increase in proinflammatory factors and the promotion of angiogenesis, which may provide novel insights into the pathogenesis of EMS. These findings may also aid in the development of therapeutic interventions against EMS.

Figure 6
Figure 6

FSLT1 contributes to the development of endometriosis by stimulating proinflammatory cytokines and angiogenesis. In endometriotic milieu, secretion of FSTL1 by ectopic ESCs was increased under conditions of hypoxia and treatment with estrogen. FSTL1 stimulates endothelial cell survival and neovascularization. FSTL1 facilitates M1 polarization of macrophages, promotes the secretion of proinflammatory factors and inhibits the expression of scavenger receptor CD36. FSLT1, Follistatin-like I; ESCs, endometrial stromal cells; HUVECs, human umbilical vein endothelial cells; DIP2A, disco-interacting protein 2 homolog A.

Citation: Reproduction 163, 1; 10.1530/REP-21-0094

Supplementary materials

This is linked to the online version of the paper at https://doi.org/10.1530/REP-21-0094

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

The present study was supported by grants from the National Natural Science Foundation of China (grant nos. NSFC81771548 and NSFC 82071615) awarded to Dong Zhao, and a grant from the Shanghai Hospital Development Center (grant no. SHDC12019113) awarded to Jing Sun.

Author contribution statement

Sha-Ting Lei performed all experiments, analyzed the data and wrote the manuscript. Ming-Qing Li provided experimental guidance and edited the manuscript. Yan-Ling Cao, Shu-Hui Hou and Hai-Yan Peng collected the samples and performed the experiments. Dong Zhao and Jing Sun conceived the study and supervised the experiments. All authors read and approved the final manuscript.

References

  • Berbic M, Schulke L, Markham R, Tokushige N, Russell P & Fraser IS 2009 Macrophage expression in endometrium of women with and without endometriosis. Human Reproduction 24 325332. (https://doi.org/10.1093/humrep/den393)

    • Search Google Scholar
    • Export Citation
  • Beste MT, Pfäffle-Doyle N, Prentice EA, Morris SN, Lauffenburger DA, Isaacson KB & Griffith LG 2014 Molecular network analysis of endometriosis reveals a role for c-Jun-regulated macrophage activation. Science Translational Medicine 6 222ra16. (https://doi.org/10.1126/scitranslmed.3007988)

    • Search Google Scholar
    • Export Citation
  • Bulun SE 2009 Endometriosis. New England Journal of Medicine 360 268279. (https://doi.org/10.1056/NEJMra0804690)

  • Capobianco A & Rovere-Querini P 2013 Endometriosis, a disease of the macrophage. Frontiers in Immunology 4 9. (https://doi.org/10.3389/fimmu.2013.00009)

    • Search Google Scholar
    • Export Citation
  • Chaly Y, Marinov AD, Oxburgh L, Bushnell DS & Hirsch R 2012 FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression. Arthritis and Rheumatism 64 10821088. (https://doi.org/10.1002/art.33422)

    • Search Google Scholar
    • Export Citation
  • Chaly Y, Hostager B, Smith S & Hirsch R 2014 Follistatin-like protein 1 and its role in inflammation and inflammatory diseases. Immunologic Research 59 266272. (https://doi.org/10.1007/s12026-014-8526-z)

    • Search Google Scholar
    • Export Citation
  • Chan QK, Ngan HY, Ip PP, Liu VW, Xue WC & Cheung AN 2009 Tumor suppressor effect of follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and functional analysis. Carcinogenesis 30 114121. (https://doi.org/10.1093/carcin/bgn215)

    • Search Google Scholar
    • Export Citation
  • Chang KK, Liu LB, Jin LP, Zhang B, Mei J, Li H, Wei CY, Zhou WJ, Zhu XY & Shao J et al.2017 IL-27 triggers IL-10 production in Th17 cells via a c-Maf/RORgammat/Blimp-1 signal to promote the progression of endometriosis. Cell Death and Disease 8 e2666. (https://doi.org/10.1038/cddis.2017.95)

    • Search Google Scholar
    • Export Citation
  • Cheng KY, Liu Y, Han YG, Li JK, Jia JL, Chen B, Yao ZX, Nie L & Cheng L 2017 Follistatin-like protein 1 suppressed pro-inflammatory cytokines expression during neuroinflammation induced by lipopolysaccharide. Journal of Molecular Histology 48 6372. (https://doi.org/10.1007/s10735-016-9706-z)

    • Search Google Scholar
    • Export Citation
  • Chiou J, Su CY, Jan YH, Yang CJ, Huang MS, Yu YL & Hsiao M 2017 Decrease of FSTL1-BMP4-Smad signaling predicts poor prognosis in lung adenocarcinoma but not in squamous cell carcinoma. Scientific Reports 7 9830. (https://doi.org/10.1038/s41598-017-10366-2)

    • Search Google Scholar
    • Export Citation
  • Chuang PC, Wu MH, Shoji Y & Tsai SJ 2009 Downregulation of CD36 results in reduced phagocytic ability of peritoneal macrophages of women with endometriosis. Journal of Pathology 219 232241. (https://doi.org/10.1002/path.2588)

    • Search Google Scholar
    • Export Citation
  • Chuang PC, Lin YJ, Wu MH, Wing LY, Shoji Y & Tsai SJ 2010 Inhibition of CD36-dependent phagocytosis by prostaglandin E2 contributes to the development of endometriosis. American Journal of Pathology 176 850860. (https://doi.org/10.2353/ajpath.2010.090551)

    • Search Google Scholar
    • Export Citation
  • Dai Y, Lin X, Xu W, Lin X, Huang Q, Shi L, Pan Y, Zhang Y, Zhu Y & Li C et al.2019 MiR-210-3p protects endometriotic cells from oxidative stress-induced cell cycle arrest by targeting BARD1. Cell Death and Disease 10 144144. (https://doi.org/10.1038/s41419-019-1395-6)

    • Search Google Scholar
    • Export Citation
  • de Ziegler D, Borghese B & Chapron C 2010 Endometriosis and infertility: pathophysiology and management. Lancet 376 730738. (https://doi.org/10.1016/S0140-6736(1060490-4)

    • Search Google Scholar
    • Export Citation
  • Dmowski WP, Gebel H & Braun DP 1998 Decreased apoptosis and sensitivity to macrophage mediated cytolysis of endometrial cells in endometriosis. Human Reproduction Update 4 696701. (https://doi.org/10.1093/humupd/4.5.696)

    • Search Google Scholar
    • Export Citation
  • Donnez J, Binda MM, Donnez O & Dolmans MM 2016 Oxidative stress in the pelvic cavity and its role in the pathogenesis of endometriosis. Fertility and Sterility 106 10111017. (https://doi.org/10.1016/j.fertnstert.2016.07.1075)

    • Search Google Scholar
    • Export Citation
  • Fan N, Sun H, Wang Y, Wang Y, Zhang L, Xia Z, Peng L, Hou Y, Shen W & Liu R et al.2013 Follistatin-like 1: a potential mediator of inflammation in obesity. Mediators of Inflammation 2013 752519. (https://doi.org/10.1155/2013/752519)

    • Search Google Scholar
    • Export Citation
  • Giudice LC & Kao LC 2004 Endometriosis. Lancet 364 17891799. (https://doi.org/10.1016/S0140-6736(0417403-5)

  • Halme J, Becker S & Haskill S 1987 Altered maturation and function of peritoneal macrophages: possible role in pathogenesis of endometriosis. American Journal of Obstetrics and Gynecology 156 783789. (https://doi.org/10.1016/0002-9378(8790333-4)

    • Search Google Scholar
    • Export Citation
  • Izumi G, Koga K, Takamura M, Makabe T, Satake E, Takeuchi A, Taguchi A, Urata Y, Fujii T & Osuga Y 2018 Involvement of immune cells in the pathogenesis of endometriosis. Journal of Obstetrics and Gynaecology Research 44 191198. (https://doi.org/10.1111/jog.13559)

    • Search Google Scholar
    • Export Citation
  • Khan KN, Masuzaki H, Fujishita A, Kitajima M, Hiraki K, Sekine I, Matsuyama T & Ishimaru T 2005 Interleukin-6- and tumour necrosis factor alpha-mediated expression of hepatocyte growth factor by stromal cells and its involvement in the growth of endometriosis. Human Reproduction 20 27152723. (https://doi.org/10.1093/humrep/dei156)

    • Search Google Scholar
    • Export Citation
  • Kim BG, Yoo JY, Kim TH, Shin JH, Langenheim JF, Ferguson SD, Fazleabas AT, Young SL, Lessey BA & Jeong JW 2015 Aberrant activation of signal transducer and activator of transcription-3 (STAT3) signaling in endometriosis. Human Reproduction 30 10691078. (https://doi.org/10.1093/humrep/dev050)

    • Search Google Scholar
    • Export Citation
  • Kubicka U, Olszewski WL, Tarnowski W, Bielecki K, Ziółkowska A & Wierzbicki Z 1996 Normal human immune peritoneal cells: subpopulations and functional characteristics. Scandinavian Journal of Immunology 44 157163. (https://doi.org/10.1046/j.1365-3083.1996.d01-297.x)

    • Search Google Scholar
    • Export Citation
  • Kudo-Saito C, Ishida A, Shouya Y, Teramoto K, Igarashi T, Kon R, Saito K, Awada C, Ogiwara Y & Toyoura M 2018 Blocking the FSTL1-DIP2A axis improves anti-tumor immunity. Cell Reports 24 17901801. (https://doi.org/10.1016/j.celrep.2018.07.043)

    • Search Google Scholar
    • Export Citation
  • Lai ZZ, Yang HL, Ha SY, Chang KK, Mei J, Zhou WJ, Qiu XM, Wang XQ, Zhu R & Li DJ et al.2019 Cyclooxygenase-2 in endometriosis. International Journal of Biological Sciences 15 27832797. (https://doi.org/10.7150/ijbs.35128)

    • Search Google Scholar
    • Export Citation
  • Lau MC, Ng KY, Wong TL, Tong M, Lee TK, Ming XY, Law S, Lee NP, Cheung AL & Qin YR et al.2017 FSTL1 promotes metastasis and chemoresistance in esophageal squamous cell carcinoma through NFκB-BMP signaling cross-talk. Cancer Research 77 58865899. (https://doi.org/10.1158/0008-5472.CAN-17-1411)

    • Search Google Scholar
    • Export Citation
  • Lee HJ, Lee JO, Lee YW, Kim SA, Park SH & Kim HS 2017 Kalirin, a GEF for Rac1, plays an important role in FSTL-1-mediated glucose uptake in skeletal muscle cells. Cellular Signalling 29 150157. (https://doi.org/10.1016/j.cellsig.2016.10.013)

    • Search Google Scholar
    • Export Citation
  • Lei S, Cao Y, Sun J, Li M & Zhao D 2018 H2S promotes proliferation of endometrial stromal cells via activating the NF-kappaB pathway in endometriosis. American Journal of Translational Research 10 42474257.

    • Search Google Scholar
    • Export Citation
  • Li MQ, Li HP, Meng YH, Wang XQ, Zhu XY, Mei J & Li DJ 2012 Chemokine CCL2 enhances survival and invasiveness of endometrial stromal cells in an autocrine manner by activating Akt and MAPK/Erk1/2 signal pathway. Fertility and Sterility 97 919929. (https://doi.org/10.1016/j.fertnstert.2011.12.049)

    • Search Google Scholar
    • Export Citation
  • Li G, Ren H, Wu X, Hu Q, Hong Z, Wang G, Gu G, Ren J & Li J 2020 Follistatin like protein-1 modulates macrophage polarization and aggravates dextran sodium sulfate-induced colitis. International Immunopharmacology 83 106456. (https://doi.org/10.1016/j.intimp.2020.106456)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Han X, Yu Y, Ding Y, Ni C, Liu W, Hou X, Li Z, Hou J & Shen D et al.2016 A genetic polymorphism affects the risk and prognosis of renal cell carcinoma: association with follistatin-like protein 1 expression. Scientific Reports 6 26689. (https://doi.org/10.1038/srep26689)

    • Search Google Scholar
    • Export Citation
  • Liu T, Liu Y, Miller M, Cao L, Zhao J, Wu J, Wang J, Liu L, Li S & Zou M et al.2017a Autophagy plays a role in FSTL1-induced EMT and airway remodeling in asthma. American Journal of Physiology: Lung Cellular and Molecular Physiology 313 L27L40. (https://doi.org/10.1152/ajplung.00510.2016)

    • Search Google Scholar
    • Export Citation
  • Liu X, Liu Y, Li X, Zhao J, Geng Y & Ning W 2017b Follistatin like-1 (Fstl1) is required for the normal formation of lung airway and vascular smooth muscle at birth. PLoS One 12 e0177899. (https://doi.org/10.1371/journal.pone.0177899)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Wei J, Zhao Y, Zhang Y, Han Y, Chen B, Cheng K, Jia J, Nie L & Cheng L 2017c Follistatin-like protein 1 promotes inflammatory reactions in nucleus pulposus cells by interacting with the MAPK and NFkappaB signaling pathways. Oncotarget 8 4302343034. (https://doi.org/10.18632/oncotarget.17400)

    • Search Google Scholar
    • Export Citation
  • Mattiotti A, Prakash S, Barnett P & Van Den Hoff MJB 2018 Follistatin-like 1 in development and human diseases. Cellular and Molecular Life Sciences 75 23392354. (https://doi.org/10.1007/s00018-018-2805-0)

    • Search Google Scholar
    • Export Citation
  • Meehan KL, Holland JW & Dawkins HJ 2002 Proteomic analysis of normal and malignant prostate tissue to identify novel proteins lost in cancer. Prostate 50 5463. (https://doi.org/10.1002/pros.10032)

    • Search Google Scholar
    • Export Citation
  • Miller JE, Ahn SH, Marks RM, Monsanto SP, Fazleabas AT, Koti M & Tayade C 2020 IL-17A modulates peritoneal macrophage recruitment and M2 polarization in endometriosis. Frontiers in Immunology 11 108108. (https://doi.org/10.3389/fimmu.2020.00108)

    • Search Google Scholar
    • Export Citation
  • Miyamae T, Marinov AD, Sowders D, Wilson DC, Devlin J, Boudreau R, Robbins P & Hirsch R 2006 Follistatin-like protein-1 is a novel proinflammatory molecule. Journal of Immunology 177 47584762. (https://doi.org/10.4049/jimmunol.177.7.4758)

    • Search Google Scholar
    • Export Citation
  • Mouillet JF, Mishima T, Paffaro AM, Parks TW, Ziegler JA, Chu T & Sadovsky Y 2015 The expression and post-transcriptional regulation of FSTL1 transcripts in placental trophoblasts. Placenta 36 12311238. (https://doi.org/10.1016/j.placenta.2015.09.005)

    • Search Google Scholar
    • Export Citation
  • Nap AW, Groothuis PG, Demir AY, Evers JLH & Dunselman GAJ 2004 Pathogenesis of endometriosis. Best Practice and Research: Clinical Obstetrics and Gynaecology 18 233244. (https://doi.org/10.1016/j.bpobgyn.2004.01.005)

    • Search Google Scholar
    • Export Citation
  • Ohashi T, Sato S, Yoshiki A & Kusakabe M 1997 TSC-36 (follistatin-related polypeptide) gene expression in estrogen receptor positive osteoblastic cell line, CDO7F. Calcified Tissue International 61 400403. (https://doi.org/10.1007/s002239900355)

    • Search Google Scholar
    • Export Citation
  • Oshima Y, Ouchi N, Sato K, Izumiya Y, Pimentel DR & Walsh K 2008 Follistatin-like 1 is an Akt-regulated cardioprotective factor that is secreted by the heart. Circulation 117 30993108. (https://doi.org/10.1161/CIRCULATIONAHA.108.767673)

    • Search Google Scholar
    • Export Citation
  • Osuga Y, Koga K, Hirota Y, Hirata T, Yoshino O & Taketani Y 2011 Lymphocytes in endometriosis. American Journal of Reproductive Immunology 65 110. (https://doi.org/10.1111/j.1600-0897.2010.00887.x)

    • Search Google Scholar
    • Export Citation
  • Ouchi N, Oshima Y, Ohashi K, Higuchi A, Ikegami C, Izumiya Y & Walsh K 2008 Follistatin-like 1, a secreted muscle protein, promotes endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-dependent mechanism. Journal of Biological Chemistry 283 3280232811. (https://doi.org/10.1074/jbc.M803440200)

    • Search Google Scholar
    • Export Citation
  • Ouchi N, Asaumi Y, Ohashi K, Higuchi A, Sono-Romanelli S, Oshima Y & Walsh K 2010 DIP2A functions as a FSTL1 receptor. Journal of Biological Chemistry 285 71277134. (https://doi.org/10.1074/jbc.M109.069468)

    • Search Google Scholar
    • Export Citation
  • Reddy SP, Britto R, Vinnakota K, Aparna H, Sreepathi HK, Thota B, Kumari A, Shilpa BM, Vrinda M & Umesh S et al.2008 Novel glioblastoma markers with diagnostic and prognostic value identified through transcriptome analysis. Clinical Cancer Research 14 29782987. (https://doi.org/10.1158/1078-0432.CCR-07-4821)

    • Search Google Scholar
    • Export Citation
  • Richter ON, Dorn C, Rosing B, Flaskamp C & Ulrich U 2005 Tumor necrosis factor alpha secretion by peritoneal macrophages in patients with endometriosis. Archives of Gynecology and Obstetrics 271 143147. (https://doi.org/10.1007/s00404-003-0591-9)

    • Search Google Scholar
    • Export Citation
  • Sacco K, Portelli M, Pollacco J, Schembri-Wismayer P & Calleja-Agius J 2012 The role of prostaglandin E2 in endometriosis. Gynecological Endocrinology 28 134138. (https://doi.org/10.3109/09513590.2011.588753)

    • Search Google Scholar
    • Export Citation
  • Shao J, Zhang B, Yu JJ, Wei CY, Zhou WJ, Chang KK, Yang HL, Jin LP, Zhu XY & Li MQ 2016 Macrophages promote the growth and invasion of endometrial stromal cells by downregulating IL-24 in endometriosis. Reproduction 152 673682. (https://doi.org/10.1530/REP-16-0278)

    • Search Google Scholar
    • Export Citation
  • Sikora J, Smycz-Kubanska M, Mielczarek-Palacz A & Kondera-Anasz Z 2017 Abnormal peritoneal regulation of chemokine activation – the role of IL-8 in pathogenesis of endometriosis. American Journal of Reproductive Immunology 77 e12622. (https://doi.org/10.1111/aji.12622)

    • Search Google Scholar
    • Export Citation
  • Sylva M, Moorman AF & Van Den Hoff MJ 2013 Follistatin-like 1 in vertebrate development. Birth Defects Research: Part C, Embryo Today: Reviews 99 6169. (https://doi.org/10.1002/bdrc.21030)

    • Search Google Scholar
    • Export Citation
  • Tania NP, Maarsingh H, T Bos IS, Mattiotti A, Prakash S, Timens W, Gunst QD, Jimenez-Borreguero LJ, Schmidt M & van den Hoff MJB et al.2017 Endothelial follistatin-like-1 regulates the postnatal development of the pulmonary vasculature by modulating BMP/Smad signaling. Pulmonary Circulation 7 219231. (https://doi.org/10.1177/2045893217702340)

    • Search Google Scholar
    • Export Citation
  • Torres S, Bartolom RA, Mendes M, Barderas R, Fernandez-Ace Ero MJ, Peláez-García A, Peña C, Lopez-Lucendo M, Villar-Vázquez R & de Herreros AG et al.2013 Proteome profiling of cancer-associated fibroblasts identifies novel proinflammatory signatures and prognostic markers for colorectal cancer. Clinical Cancer Research 19 60066019.

    • Search Google Scholar
    • Export Citation
  • van Rooij E 2016 Cardiac repair after myocardial infarction. New England Journal of Medicine 374 8587. (https://doi.org/10.1056/NEJMcibr1512011)

    • Search Google Scholar
    • Export Citation
  • Vigano P, Parazzini F, Somigliana E & Vercellini P 2004 Endometriosis: epidemiology and aetiological factors. Best Practice and Research: Clinical Obstetrics and Gynaecology 18 177200. (https://doi.org/10.1016/j.bpobgyn.2004.01.007)

    • Search Google Scholar
    • Export Citation
  • Wang H, Wu S, Huang S, Yin S, Zou G, Huang K, Zhang Z, Tang A & Wen W 2016 Follistatin-like protein 1 contributes to dendritic cell and T-lymphocyte activation in nasopharyngeal carcinoma patients by altering nuclear factor kappaB and Jun N-terminal kinase expression. Cell Biochemistry and Function 34 554562. (https://doi.org/10.1002/cbf.3227)

    • Search Google Scholar
    • Export Citation
  • Wei K, Serpooshan V, Hurtado C, Diez-Cunado M, Zhao M, Maruyama S, Zhu W, Fajardo G, Noseda M & Nakamura K et al.2015 Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature 525 479485. (https://doi.org/10.1038/nature15372)

    • Search Google Scholar
    • Export Citation
  • Wilson DC, Marinov AD, Blair HC, Bushnell DS, Thompson SD, Chaly Y & Hirsch R 2010 Follistatin-like protein 1 is a mesenchyme-derived inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid arthritis. Arthritis and Rheumatism 62 25102516. (https://doi.org/10.1002/art.27485)

    • Search Google Scholar
    • Export Citation
  • Wu MH, Sun HS, Lin CC, Hsiao KY, Chuang PC, Pan HA & Tsai SJ 2002 Distinct mechanisms regulate cyclooxygenase-1 and -2 in peritoneal macrophages of women with and without endometriosis. Molecular Human Reproduction 8 11031110. (https://doi.org/10.1093/molehr/8.12.1103)

    • Search Google Scholar
    • Export Citation
  • Xi Y, Hao M, Liang Q, Li Y, Gong DW & Tian Z 2021 Dynamic resistance exercise increases skeletal muscle-derived FSTL1 inducing cardiac angiogenesis via DIP2A-Smad2/3 in rats following myocardial infarction. Journal of Sport and Health Science 10 594603. (https://doi.org/10.1016/j.jshs.2020.11.010)

    • Search Google Scholar
    • Export Citation
  • Yang HL, Mei J, Chang KK, Zhou WJ, Huang LQ & Li MQ 2017a Autophagy in endometriosis. American Journal of Translational Research 9 47074725.

  • Yang HL, Zhou WJ, Chang KK, Mei J, Huang LQ, Wang MY, Meng Y, Ha SY, Li DJ & Li MQ 2017b The crosstalk between endometrial stromal cells and macrophages impairs cytotoxicity of NK cells in endometriosis by secreting IL-10 and TGF-β. Reproduction 154 815825. (https://doi.org/10.1530/REP-17-0342)

    • Search Google Scholar
    • Export Citation
  • Yang W, Wu Y, Wang C, Liu Z, Xu M & Zheng X 2017c FSTL1 contributes to tumor progression via attenuating apoptosis in a AKT/GSK-3beta – dependent manner in hepatocellular carcinoma. Cancer Biomarkers: Section A of Disease Markers 20 7585. (https://doi.org/10.3233/CBM-170132)

    • Search Google Scholar
    • Export Citation
  • Yang Y, Mu T, Li T, Xie S, Zhou J, Liu M & Li D 2017d Effects of FSTL1 on the proliferation and motility of breast cancer cells and vascular endothelial cells. Thoracic Cancer 8 606612. (https://doi.org/10.1111/1759-7714.12491)

    • Search Google Scholar
    • Export Citation
  • Yu JJ, Sun HT, Zhang ZF, Shi RX, Liu LB, Shang WQ, Wei CY, Chang KK, Shao J & Wang MY et al.2016 IL15 promotes growth and invasion of endometrial stromal cells and inhibits killing activity of NK cells in endometriosis. Reproduction 152 151160. (https://doi.org/10.1530/REP-16-0089)

    • Search Google Scholar
    • Export Citation
  • Zhang T, De Carolis C, Man GCW & Wang CC 2018 The link between immunity, autoimmunity and endometriosis: a literature update. Autoimmunity Reviews 17 945955. (https://doi.org/10.1016/j.autrev.2018.03.017)

    • Search Google Scholar
    • Export Citation
  • Zheng X, Qi C, Zhang S, Fang Y & Ning W 2017 TGF-beta1 induces Fstl1 via the Smad3-c-Jun pathway in lung fibroblasts. American Journal of Physiology: Lung Cellular and Molecular Physiology 313 L240L251. (https://doi.org/10.1152/ajplung.00523.2016)

    • Search Google Scholar
    • Export Citation
  • Zhou WJ, Yang HL, Shao J, Mei J, Chang KK, Zhu R & Li MQ 2019 Anti-inflammatory cytokines in endometriosis. Cellular and Molecular Life Sciences 76 21112132. (https://doi.org/10.1007/s00018-019-03056-x)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • View in gallery
    Figure 1

    FSTL1 is highly expressed in ectopic ESCs and peritoneal fluid of patients with EMS. (A) mRNA expression levels of FSTL1 in normal and ectopic ESCs were examined using RT-quantitative PCR (unpaired t-test). (B) Levels of secreted FSTL1 in the peritoneal fluid of patients with or without EMS were analyzed using ELISA (Mann–Whitney test). (C) The EMS group was further divided into EMS(I–II) and EMS(III–IV) two groups according to the severity of EMS, and the FSTL1 level in these groups was analyzed (one-way ANOVA followed with Bonferroni’s multiple comparisons test). NESCs, ESCs isolated form normal endometrium (n = 6); EESCs, ESCs isolated from ectopic lesions (n = 7); CTRL-PF, peritoneal fluid from women without EMS (n = 9); EMS-PF, peritoneal fluid from women with EMS (n = 17); EMS(I–II)-PF, peritoneal fluid from women with EMS in early stages (stage I and stage II; n  = 8); EMS(III–IV)-PF, peritoneal fluid from women with EMS in advanced stages (stage III and stage IV; n  = 9). Data are expressed as the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001; NS, no statistical difference; FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; EMS, endometriosis.

  • View in gallery
    Figure 2

    Hypoxia and estrogen conditions increase the expression of FSTL1 in ESCs. (A) HESCs were cultured in conditions of hypoxia (2% O2) for 0, 24, 48 and 72 h, and the total protein levels of FSTL1 were subsequently analyzed using Western blotting. (B) HESCs were co-treated with different concentrations of 17β-estradiol (0, 10−8 and 10−7 mol/L) and either normal oxygen (21% O2) or hypoxic conditions (2% O2) for 48 h. The total protein expression levels of FSTL1 and DIP2A were analyzed using Western blotting. The integrated density (IntDen) was calculated by ImageJ software, IntDen ratio of each FSTL1 and DIP2A band relative to GAPDH band was presented at the bottom of the Western blotting panel. FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; HESCs, human endometrial stromal cells; DIP2A, disco-interacting protein 2 homolog A.

  • View in gallery
    Figure 3

    FSTL1 promotes the secretion of inflammatory cytokines and the invasion of ESCs. (A) Transfection efficiency of FSTL1 overexpression plasmids was confirmed using RT-qPCR (unpaired t-tests). (B, C and D) mRNA levels of DIP2A, IL8, IL1B, BECN1, MAP1LC3B and SQSTM1 were detected using RT-qPCR (unpaired t-tests or Mann–Whitney test). (E) HESCs were treated with PBS or rhFSTL1 (10 ng/mL) and the invasion of HESCs was detected. Five fields of vision were randomly selected and transmembrane cells were counted. (F) Statistical analysis of invaded HESCs (unpaired t-test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001. NS, not significant; NC, negative control; OE, overexpression; FSTL1, Follistatin-like I; ESCs, endometrial stromal cells; RT-qPCR, RT-quantitative PCR; DIP2A, disco-interacting protein 2 homolog A; SQSTM1, sequestosome-1; HESCs, human endometrial stromal cells.

  • View in gallery
    Figure 4

    FSTL1 promotes endothelial cell survival and formation of vascular-like structures. (A) HUVECs were pretreated with PBS or rhFSTL1 (200 ng/mL) for 24 h. Tubular formation assays were conducted and Calcein-AM was used to stain living HUVECs. Images were captured after 9 h of tubular formation. (B) Number of junctions, nodes, branches and total length of capillary-like tubular formations were counted using ImageJ software (unpaired t-tests or Mann–Whitney test). (C) Cell viability of HUVECs following treatment with different concentrations of FSTL1 was detected using a Cell Counting Kit-8 assay (one-way ANOVA followed with Bonferroni’s multiple comparisons test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001. NS, not significant; FSTL1, Follistatin-like I; HUVECs, human umbilical vein endothelial cells.

  • View in gallery
    Figure 5

    FSTL1 regulates the secretion of proinflammatory cytokines and the polarization of macrophages. (A, B, C, D, E and F) THP-1 cells were transformed into M0 macrophages following treatment with PMA (100 ng/mL) for 48 h. M0 cells were subsequently treated with PBS or rhFSTL1 (200 ng/mL) for 36 h, and the relative mRNA expression of COX2, IL6, IL8, TNFA, IL1B, DIP2A, CD86, CD206, TLR4, CD14 and CD36 was analyzed using RT-quantitative PCR (unpaired t-tests or Mann–Whitney test). Data are expressed as the mean ± s.e.m.*P < 0.05, **P < 0.01, ***P < 0.001; NS, no statistical difference; FSTL1, Follistatin-like I; PMA, phorbol 12-myristate 13-acetate.

  • View in gallery
    Figure 6

    FSLT1 contributes to the development of endometriosis by stimulating proinflammatory cytokines and angiogenesis. In endometriotic milieu, secretion of FSTL1 by ectopic ESCs was increased under conditions of hypoxia and treatment with estrogen. FSTL1 stimulates endothelial cell survival and neovascularization. FSTL1 facilitates M1 polarization of macrophages, promotes the secretion of proinflammatory factors and inhibits the expression of scavenger receptor CD36. FSLT1, Follistatin-like I; ESCs, endometrial stromal cells; HUVECs, human umbilical vein endothelial cells; DIP2A, disco-interacting protein 2 homolog A.

  • Berbic M, Schulke L, Markham R, Tokushige N, Russell P & Fraser IS 2009 Macrophage expression in endometrium of women with and without endometriosis. Human Reproduction 24 325332. (https://doi.org/10.1093/humrep/den393)

    • Search Google Scholar
    • Export Citation
  • Beste MT, Pfäffle-Doyle N, Prentice EA, Morris SN, Lauffenburger DA, Isaacson KB & Griffith LG 2014 Molecular network analysis of endometriosis reveals a role for c-Jun-regulated macrophage activation. Science Translational Medicine 6 222ra16. (https://doi.org/10.1126/scitranslmed.3007988)

    • Search Google Scholar
    • Export Citation
  • Bulun SE 2009 Endometriosis. New England Journal of Medicine 360 268279. (https://doi.org/10.1056/NEJMra0804690)

  • Capobianco A & Rovere-Querini P 2013 Endometriosis, a disease of the macrophage. Frontiers in Immunology 4 9. (https://doi.org/10.3389/fimmu.2013.00009)

    • Search Google Scholar
    • Export Citation
  • Chaly Y, Marinov AD, Oxburgh L, Bushnell DS & Hirsch R 2012 FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression. Arthritis and Rheumatism 64 10821088. (https://doi.org/10.1002/art.33422)

    • Search Google Scholar
    • Export Citation
  • Chaly Y, Hostager B, Smith S & Hirsch R 2014 Follistatin-like protein 1 and its role in inflammation and inflammatory diseases. Immunologic Research 59 266272. (https://doi.org/10.1007/s12026-014-8526-z)

    • Search Google Scholar
    • Export Citation
  • Chan QK, Ngan HY, Ip PP, Liu VW, Xue WC & Cheung AN 2009 Tumor suppressor effect of follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and functional analysis. Carcinogenesis 30 114121. (https://doi.org/10.1093/carcin/bgn215)

    • Search Google Scholar
    • Export Citation
  • Chang KK, Liu LB, Jin LP, Zhang B, Mei J, Li H, Wei CY, Zhou WJ, Zhu XY & Shao J et al.2017 IL-27 triggers IL-10 production in Th17 cells via a c-Maf/RORgammat/Blimp-1 signal to promote the progression of endometriosis. Cell Death and Disease 8 e2666. (https://doi.org/10.1038/cddis.2017.95)

    • Search Google Scholar
    • Export Citation
  • Cheng KY, Liu Y, Han YG, Li JK, Jia JL, Chen B, Yao ZX, Nie L & Cheng L 2017 Follistatin-like protein 1 suppressed pro-inflammatory cytokines expression during neuroinflammation induced by lipopolysaccharide. Journal of Molecular Histology 48 6372. (https://doi.org/10.1007/s10735-016-9706-z)

    • Search Google Scholar
    • Export Citation
  • Chiou J, Su CY, Jan YH, Yang CJ, Huang MS, Yu YL & Hsiao M 2017 Decrease of FSTL1-BMP4-Smad signaling predicts poor prognosis in lung adenocarcinoma but not in squamous cell carcinoma. Scientific Reports 7 9830. (https://doi.org/10.1038/s41598-017-10366-2)

    • Search Google Scholar
    • Export Citation
  • Chuang PC, Wu MH, Shoji Y & Tsai SJ 2009 Downregulation of CD36 results in reduced phagocytic ability of peritoneal macrophages of women with endometriosis. Journal of Pathology 219 232241. (https://doi.org/10.1002/path.2588)

    • Search Google Scholar
    • Export Citation
  • Chuang PC, Lin YJ, Wu MH, Wing LY, Shoji Y & Tsai SJ 2010 Inhibition of CD36-dependent phagocytosis by prostaglandin E2 contributes to the development of endometriosis. American Journal of Pathology 176 850860. (https://doi.org/10.2353/ajpath.2010.090551)

    • Search Google Scholar
    • Export Citation
  • Dai Y, Lin X, Xu W, Lin X, Huang Q, Shi L, Pan Y, Zhang Y, Zhu Y & Li C et al.2019 MiR-210-3p protects endometriotic cells from oxidative stress-induced cell cycle arrest by targeting BARD1. Cell Death and Disease 10 144144. (https://doi.org/10.1038/s41419-019-1395-6)

    • Search Google Scholar
    • Export Citation
  • de Ziegler D, Borghese B & Chapron C 2010 Endometriosis and infertility: pathophysiology and management. Lancet 376 730738. (https://doi.org/10.1016/S0140-6736(1060490-4)

    • Search Google Scholar
    • Export Citation
  • Dmowski WP, Gebel H & Braun DP 1998 Decreased apoptosis and sensitivity to macrophage mediated cytolysis of endometrial cells in endometriosis. Human Reproduction Update 4 696701. (https://doi.org/10.1093/humupd/4.5.696)

    • Search Google Scholar
    • Export Citation
  • Donnez J, Binda MM, Donnez O & Dolmans MM 2016 Oxidative stress in the pelvic cavity and its role in the pathogenesis of endometriosis. Fertility and Sterility 106 10111017. (https://doi.org/10.1016/j.fertnstert.2016.07.1075)

    • Search Google Scholar
    • Export Citation
  • Fan N, Sun H, Wang Y, Wang Y, Zhang L, Xia Z, Peng L, Hou Y, Shen W & Liu R et al.2013 Follistatin-like 1: a potential mediator of inflammation in obesity. Mediators of Inflammation 2013 752519. (https://doi.org/10.1155/2013/752519)

    • Search Google Scholar
    • Export Citation
  • Giudice LC & Kao LC 2004 Endometriosis. Lancet 364 17891799. (https://doi.org/10.1016/S0140-6736(0417403-5)

  • Halme J, Becker S & Haskill S 1987 Altered maturation and function of peritoneal macrophages: possible role in pathogenesis of endometriosis. American Journal of Obstetrics and Gynecology 156 783789. (https://doi.org/10.1016/0002-9378(8790333-4)

    • Search Google Scholar
    • Export Citation
  • Izumi G, Koga K, Takamura M, Makabe T, Satake E, Takeuchi A, Taguchi A, Urata Y, Fujii T & Osuga Y 2018 Involvement of immune cells in the pathogenesis of endometriosis. Journal of Obstetrics and Gynaecology Research 44 191198. (https://doi.org/10.1111/jog.13559)

    • Search Google Scholar
    • Export Citation
  • Khan KN, Masuzaki H, Fujishita A, Kitajima M, Hiraki K, Sekine I, Matsuyama T & Ishimaru T 2005 Interleukin-6- and tumour necrosis factor alpha-mediated expression of hepatocyte growth factor by stromal cells and its involvement in the growth of endometriosis. Human Reproduction 20 27152723. (https://doi.org/10.1093/humrep/dei156)

    • Search Google Scholar
    • Export Citation
  • Kim BG, Yoo JY, Kim TH, Shin JH, Langenheim JF, Ferguson SD, Fazleabas AT, Young SL, Lessey BA & Jeong JW 2015 Aberrant activation of signal transducer and activator of transcription-3 (STAT3) signaling in endometriosis. Human Reproduction 30 10691078. (https://doi.org/10.1093/humrep/dev050)

    • Search Google Scholar
    • Export Citation
  • Kubicka U, Olszewski WL, Tarnowski W, Bielecki K, Ziółkowska A & Wierzbicki Z 1996 Normal human immune peritoneal cells: subpopulations and functional characteristics. Scandinavian Journal of Immunology 44 157163. (https://doi.org/10.1046/j.1365-3083.1996.d01-297.x)

    • Search Google Scholar
    • Export Citation
  • Kudo-Saito C, Ishida A, Shouya Y, Teramoto K, Igarashi T, Kon R, Saito K, Awada C, Ogiwara Y & Toyoura M 2018 Blocking the FSTL1-DIP2A axis improves anti-tumor immunity. Cell Reports 24 17901801. (https://doi.org/10.1016/j.celrep.2018.07.043)

    • Search Google Scholar
    • Export Citation
  • Lai ZZ, Yang HL, Ha SY, Chang KK, Mei J, Zhou WJ, Qiu XM, Wang XQ, Zhu R & Li DJ et al.2019 Cyclooxygenase-2 in endometriosis. International Journal of Biological Sciences 15 27832797. (https://doi.org/10.7150/ijbs.35128)

    • Search Google Scholar
    • Export Citation
  • Lau MC, Ng KY, Wong TL, Tong M, Lee TK, Ming XY, Law S, Lee NP, Cheung AL & Qin YR et al.2017 FSTL1 promotes metastasis and chemoresistance in esophageal squamous cell carcinoma through NFκB-BMP signaling cross-talk. Cancer Research 77 58865899. (https://doi.org/10.1158/0008-5472.CAN-17-1411)

    • Search Google Scholar
    • Export Citation
  • Lee HJ, Lee JO, Lee YW, Kim SA, Park SH & Kim HS 2017 Kalirin, a GEF for Rac1, plays an important role in FSTL-1-mediated glucose uptake in skeletal muscle cells. Cellular Signalling 29 150157. (https://doi.org/10.1016/j.cellsig.2016.10.013)

    • Search Google Scholar
    • Export Citation
  • Lei S, Cao Y, Sun J, Li M & Zhao D 2018 H2S promotes proliferation of endometrial stromal cells via activating the NF-kappaB pathway in endometriosis. American Journal of Translational Research 10 42474257.

    • Search Google Scholar
    • Export Citation
  • Li MQ, Li HP, Meng YH, Wang XQ, Zhu XY, Mei J & Li DJ 2012 Chemokine CCL2 enhances survival and invasiveness of endometrial stromal cells in an autocrine manner by activating Akt and MAPK/Erk1/2 signal pathway. Fertility and Sterility 97 919929. (https://doi.org/10.1016/j.fertnstert.2011.12.049)

    • Search Google Scholar
    • Export Citation
  • Li G, Ren H, Wu X, Hu Q, Hong Z, Wang G, Gu G, Ren J & Li J 2020 Follistatin like protein-1 modulates macrophage polarization and aggravates dextran sodium sulfate-induced colitis. International Immunopharmacology 83 106456. (https://doi.org/10.1016/j.intimp.2020.106456)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Han X, Yu Y, Ding Y, Ni C, Liu W, Hou X, Li Z, Hou J & Shen D et al.2016 A genetic polymorphism affects the risk and prognosis of renal cell carcinoma: association with follistatin-like protein 1 expression. Scientific Reports 6 26689. (https://doi.org/10.1038/srep26689)

    • Search Google Scholar
    • Export Citation
  • Liu T, Liu Y, Miller M, Cao L, Zhao J, Wu J, Wang J, Liu L, Li S & Zou M et al.2017a Autophagy plays a role in FSTL1-induced EMT and airway remodeling in asthma. American Journal of Physiology: Lung Cellular and Molecular Physiology 313 L27L40. (https://doi.org/10.1152/ajplung.00510.2016)

    • Search Google Scholar
    • Export Citation
  • Liu X, Liu Y, Li X, Zhao J, Geng Y & Ning W 2017b Follistatin like-1 (Fstl1) is required for the normal formation of lung airway and vascular smooth muscle at birth. PLoS One 12 e0177899. (https://doi.org/10.1371/journal.pone.0177899)

    • Search Google Scholar
    • Export Citation
  • Liu Y, Wei J, Zhao Y, Zhang Y, Han Y, Chen B, Cheng K, Jia J, Nie L & Cheng L 2017c Follistatin-like protein 1 promotes inflammatory reactions in nucleus pulposus cells by interacting with the MAPK and NFkappaB signaling pathways. Oncotarget 8 4302343034. (https://doi.org/10.18632/oncotarget.17400)

    • Search Google Scholar
    • Export Citation
  • Mattiotti A, Prakash S, Barnett P & Van Den Hoff MJB 2018 Follistatin-like 1 in development and human diseases. Cellular and Molecular Life Sciences 75 23392354. (https://doi.org/10.1007/s00018-018-2805-0)

    • Search Google Scholar
    • Export Citation
  • Meehan KL, Holland JW & Dawkins HJ 2002 Proteomic analysis of normal and malignant prostate tissue to identify novel proteins lost in cancer. Prostate 50 5463. (https://doi.org/10.1002/pros.10032)

    • Search Google Scholar
    • Export Citation
  • Miller JE, Ahn SH, Marks RM, Monsanto SP, Fazleabas AT, Koti M & Tayade C 2020 IL-17A modulates peritoneal macrophage recruitment and M2 polarization in endometriosis. Frontiers in Immunology 11 108108. (https://doi.org/10.3389/fimmu.2020.00108)

    • Search Google Scholar
    • Export Citation
  • Miyamae T, Marinov AD, Sowders D, Wilson DC, Devlin J, Boudreau R, Robbins P & Hirsch R 2006 Follistatin-like protein-1 is a novel proinflammatory molecule. Journal of Immunology 177 47584762. (https://doi.org/10.4049/jimmunol.177.7.4758)

    • Search Google Scholar
    • Export Citation
  • Mouillet JF, Mishima T, Paffaro AM, Parks TW, Ziegler JA, Chu T & Sadovsky Y 2015 The expression and post-transcriptional regulation of FSTL1 transcripts in placental trophoblasts. Placenta 36 12311238. (https://doi.org/10.1016/j.placenta.2015.09.005)

    • Search Google Scholar
    • Export Citation
  • Nap AW, Groothuis PG, Demir AY, Evers JLH & Dunselman GAJ 2004 Pathogenesis of endometriosis. Best Practice and Research: Clinical Obstetrics and Gynaecology 18 233244. (https://doi.org/10.1016/j.bpobgyn.2004.01.005)

    • Search Google Scholar
    • Export Citation
  • Ohashi T, Sato S, Yoshiki A & Kusakabe M 1997 TSC-36 (follistatin-related polypeptide) gene expression in estrogen receptor positive osteoblastic cell line, CDO7F. Calcified Tissue International 61 400403. (https://doi.org/10.1007/s002239900355)

    • Search Google Scholar
    • Export Citation
  • Oshima Y, Ouchi N, Sato K, Izumiya Y, Pimentel DR & Walsh K 2008 Follistatin-like 1 is an Akt-regulated cardioprotective factor that is secreted by the heart. Circulation 117 30993108. (https://doi.org/10.1161/CIRCULATIONAHA.108.767673)

    • Search Google Scholar
    • Export Citation
  • Osuga Y, Koga K, Hirota Y, Hirata T, Yoshino O & Taketani Y 2011 Lymphocytes in endometriosis. American Journal of Reproductive Immunology 65 110. (https://doi.org/10.1111/j.1600-0897.2010.00887.x)

    • Search Google Scholar
    • Export Citation
  • Ouchi N, Oshima Y, Ohashi K, Higuchi A, Ikegami C, Izumiya Y & Walsh K 2008 Follistatin-like 1, a secreted muscle protein, promotes endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-dependent mechanism. Journal of Biological Chemistry 283 3280232811. (https://doi.org/10.1074/jbc.M803440200)

    • Search Google Scholar
    • Export Citation
  • Ouchi N, Asaumi Y, Ohashi K, Higuchi A, Sono-Romanelli S, Oshima Y & Walsh K 2010 DIP2A functions as a FSTL1 receptor. Journal of Biological Chemistry 285 71277134. (https://doi.org/10.1074/jbc.M109.069468)

    • Search Google Scholar
    • Export Citation
  • Reddy SP, Britto R, Vinnakota K, Aparna H, Sreepathi HK, Thota B, Kumari A, Shilpa BM, Vrinda M & Umesh S et al.2008 Novel glioblastoma markers with diagnostic and prognostic value identified through transcriptome analysis. Clinical Cancer Research 14 29782987. (https://doi.org/10.1158/1078-0432.CCR-07-4821)

    • Search Google Scholar
    • Export Citation
  • Richter ON, Dorn C, Rosing B, Flaskamp C & Ulrich U 2005 Tumor necrosis factor alpha secretion by peritoneal macrophages in patients with endometriosis. Archives of Gynecology and Obstetrics 271 143147. (https://doi.org/10.1007/s00404-003-0591-9)

    • Search Google Scholar
    • Export Citation
  • Sacco K, Portelli M, Pollacco J, Schembri-Wismayer P & Calleja-Agius J 2012 The role of prostaglandin E2 in endometriosis. Gynecological Endocrinology 28 134138. (https://doi.org/10.3109/09513590.2011.588753)

    • Search Google Scholar
    • Export Citation
  • Shao J, Zhang B, Yu JJ, Wei CY, Zhou WJ, Chang KK, Yang HL, Jin LP, Zhu XY & Li MQ 2016 Macrophages promote the growth and invasion of endometrial stromal cells by downregulating IL-24 in endometriosis. Reproduction 152 673682. (https://doi.org/10.1530/REP-16-0278)

    • Search Google Scholar
    • Export Citation
  • Sikora J, Smycz-Kubanska M, Mielczarek-Palacz A & Kondera-Anasz Z 2017 Abnormal peritoneal regulation of chemokine activation – the role of IL-8 in pathogenesis of endometriosis. American Journal of Reproductive Immunology 77 e12622. (https://doi.org/10.1111/aji.12622)

    • Search Google Scholar
    • Export Citation
  • Sylva M, Moorman AF & Van Den Hoff MJ 2013 Follistatin-like 1 in vertebrate development. Birth Defects Research: Part C, Embryo Today: Reviews 99 6169. (https://doi.org/10.1002/bdrc.21030)

    • Search Google Scholar
    • Export Citation
  • Tania NP, Maarsingh H, T Bos IS, Mattiotti A, Prakash S, Timens W, Gunst QD, Jimenez-Borreguero LJ, Schmidt M & van den Hoff MJB et al.2017 Endothelial follistatin-like-1 regulates the postnatal development of the pulmonary vasculature by modulating BMP/Smad signaling. Pulmonary Circulation 7 219231. (https://doi.org/10.1177/2045893217702340)

    • Search Google Scholar
    • Export Citation
  • Torres S, Bartolom RA, Mendes M, Barderas R, Fernandez-Ace Ero MJ, Peláez-García A, Peña C, Lopez-Lucendo M, Villar-Vázquez R & de Herreros AG et al.2013 Proteome profiling of cancer-associated fibroblasts identifies novel proinflammatory signatures and prognostic markers for colorectal cancer. Clinical Cancer Research 19 60066019.

    • Search Google Scholar
    • Export Citation
  • van Rooij E 2016 Cardiac repair after myocardial infarction. New England Journal of Medicine 374 8587. (https://doi.org/10.1056/NEJMcibr1512011)

    • Search Google Scholar
    • Export Citation
  • Vigano P, Parazzini F, Somigliana E & Vercellini P 2004 Endometriosis: epidemiology and aetiological factors. Best Practice and Research: Clinical Obstetrics and Gynaecology 18 177200. (https://doi.org/10.1016/j.bpobgyn.2004.01.007)

    • Search Google Scholar
    • Export Citation
  • Wang H, Wu S, Huang S, Yin S, Zou G, Huang K, Zhang Z, Tang A & Wen W 2016 Follistatin-like protein 1 contributes to dendritic cell and T-lymphocyte activation in nasopharyngeal carcinoma patients by altering nuclear factor kappaB and Jun N-terminal kinase expression. Cell Biochemistry and Function 34 554562. (https://doi.org/10.1002/cbf.3227)

    • Search Google Scholar
    • Export Citation
  • Wei K, Serpooshan V, Hurtado C, Diez-Cunado M, Zhao M, Maruyama S, Zhu W, Fajardo G, Noseda M & Nakamura K et al.2015 Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature 525 479485. (https://doi.org/10.1038/nature15372)

    • Search Google Scholar
    • Export Citation
  • Wilson DC, Marinov AD, Blair HC, Bushnell DS, Thompson SD, Chaly Y & Hirsch R 2010 Follistatin-like protein 1 is a mesenchyme-derived inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid arthritis. Arthritis and Rheumatism 62 25102516. (https://doi.org/10.1002/art.27485)

    • Search Google Scholar
    • Export Citation
  • Wu MH, Sun HS, Lin CC, Hsiao KY, Chuang PC, Pan HA & Tsai SJ 2002 Distinct mechanisms regulate cyclooxygenase-1 and -2 in peritoneal macrophages of women with and without endometriosis. Molecular Human Reproduction 8 11031110. (https://doi.org/10.1093/molehr/8.12.1103)

    • Search Google Scholar
    • Export Citation
  • Xi Y, Hao M, Liang Q, Li Y, Gong DW & Tian Z 2021 Dynamic resistance exercise increases skeletal muscle-derived FSTL1 inducing cardiac angiogenesis via DIP2A-Smad2/3 in rats following myocardial infarction. Journal of Sport and Health Science 10 594603. (https://doi.org/10.1016/j.jshs.2020.11.010)

    • Search Google Scholar
    • Export Citation
  • Yang HL, Mei J, Chang KK, Zhou WJ, Huang LQ & Li MQ 2017a Autophagy in endometriosis. American Journal of Translational Research 9 47074725.

  • Yang HL, Zhou WJ, Chang KK, Mei J, Huang LQ, Wang MY, Meng Y, Ha SY, Li DJ & Li MQ 2017b The crosstalk between endometrial stromal cells and macrophages impairs cytotoxicity of NK cells in endometriosis by secreting IL-10 and TGF-β. Reproduction 154 815825. (https://doi.org/10.1530/REP-17-0342)

    • Search Google Scholar
    • Export Citation
  • Yang W, Wu Y, Wang C, Liu Z, Xu M & Zheng X 2017c FSTL1 contributes to tumor progression via attenuating apoptosis in a AKT/GSK-3beta – dependent manner in hepatocellular carcinoma. Cancer Biomarkers: Section A of Disease Markers 20 7585. (https://doi.org/10.3233/CBM-170132)

    • Search Google Scholar
    • Export Citation
  • Yang Y, Mu T, Li T, Xie S, Zhou J, Liu M & Li D 2017d Effects of FSTL1 on the proliferation and motility of breast cancer cells and vascular endothelial cells. Thoracic Cancer 8 606612. (https://doi.org/10.1111/1759-7714.12491)

    • Search Google Scholar
    • Export Citation
  • Yu JJ, Sun HT, Zhang ZF, Shi RX, Liu LB, Shang WQ, Wei CY, Chang KK, Shao J & Wang MY et al.2016 IL15 promotes growth and invasion of endometrial stromal cells and inhibits killing activity of NK cells in endometriosis. Reproduction 152 151160. (https://doi.org/10.1530/REP-16-0089)

    • Search Google Scholar
    • Export Citation
  • Zhang T, De Carolis C, Man GCW & Wang CC 2018 The link between immunity, autoimmunity and endometriosis: a literature update. Autoimmunity Reviews 17 945955. (https://doi.org/10.1016/j.autrev.2018.03.017)

    • Search Google Scholar
    • Export Citation
  • Zheng X, Qi C, Zhang S, Fang Y & Ning W 2017 TGF-beta1 induces Fstl1 via the Smad3-c-Jun pathway in lung fibroblasts. American Journal of Physiology: Lung Cellular and Molecular Physiology 313 L240L251. (https://doi.org/10.1152/ajplung.00523.2016)

    • Search Google Scholar
    • Export Citation
  • Zhou WJ, Yang HL, Shao J, Mei J, Chang KK, Zhu R & Li MQ 2019 Anti-inflammatory cytokines in endometriosis. Cellular and Molecular Life Sciences 76 21112132. (https://doi.org/10.1007/s00018-019-03056-x)

    • Search Google Scholar
    • Export Citation