Abstract
Heme oxygenase 1 (HO-1, encoded by the HMOX1 gene) is the rate-limiting enzyme that catalyzes heme degradation, and it has been reported to exert antioxidative effects. Recently, decidualization has been reported to confer resistance to environmental stress signals, protecting against oxidative stress. However, the effects and regulatory mechanism of HO-1 in decidual stromal cells (DSCs) during early pregnancy remain unknown. Here, we verified that the levels of HO-1 and heme in DSCs are increased compared with those in endometrial stromal cells. Additionally, the upregulation of HIF1A expression led to increased HMOX1 expression in DSCs possibly via nuclear factor erythroid 2-related factor (encoded by the NFE2L2 gene). However, addition of the competitive HO-1 inhibitor zinc protoporphyrin IX resulted in an increase in HIF1A expression. Hydrogen peroxide (H2O2) induced the production of reactive oxygen species (ROS), decreased the cell viability of DSCs in vitro, and upregulated the level of heme. As an HO-1 inducer, cobalt protoporphyrin IX decreased ROS production and significantly reversed the inhibitory effect of H2O2 on cell viability. More importantly, patients with unexplained spontaneous abortion had low levels of HO-1 that were insufficient to protect against oxidative stress. This study suggests that the upregulation of HO-1 expression via HIF1A protects DSCs against excessive heme-mediated oxidative stress. Furthermore, the excessive oxidative stress injury and impaired viability of DSCs associated with decreased HO-1 expression should be associated with the occurrence and/or development of spontaneous abortion.
Introduction
Uterine decidualization denotes the ovarian hormone-driven transition of the endometrium to the decidua, and this process involves extensive proliferation and differentiation of stromal cells. This process is essential for successful pregnancy, and its impairment leads to a variety of pregnancy disorders, including spontaneous abortion (Lu et al. 2021, Lv et al. 2021) and preeclampsia (Garrido-Gomez et al. 2020).
The heme oxygenase (HO) system has long been known to be a crucial component of the cellular stress response. Three isoforms of HO have been identified: HO-1, HO-2 and HO-3 (Montellano 2000). HO-1 expression is readily inducible by multiple factors including UV radiation (Keyse & Tyrrell 1989), oxidative stress (Applegate et al. 1991) and hypoxia (Maines et al. 1993). Considering the large amount of hemoglobin (Hb) at the feto-maternal interface, large amounts of free heme accumulate when ruptured erythrocytes release Hb. At this time, HO-1 is required to degrade heme into equimolar amounts of carbon monoxide (CO), iron and biliverdin (Immenschuh 2010), which can be reutilized for erythropoiesis and avoid the toxic accumulation of free heme (Vijayan et al. 2018). Otherwise, free heme released from Hb, myoglobin or other intracellular hemoproteins can cause lipid peroxidation, DNA damage, oxidative damage and inflammation (Wijayanti et al. 2004, Chiabrando et al. 2018), which are harmful to normal pregnancy.
A plethora of preclinical and clinical studies have also associated defects in HO expression with pregnancy-related pathological conditions, especially spontaneous abortion (Denschlag et al. 2004) and preeclampsia (Eide et al. 2008). Oxidative stress is present at the maternal–fetal interface from the beginning of pregnancy but resolves as the placental tissues adapt to their new oxygen environment by upregulating antioxidant enzyme expression (Jauniaux et al. 2000, Toy et al. 2010). Overwhelming oxidative stress in unexplained spontaneous abortion causes widespread destruction of the trophoblast, which is incompatible with an ongoing pregnancy, and manifests as increased lipid peroxide expression in villous and decidual tissues (Sugino et al. 2000, Biri et al. 2006). Thus, insufficiency of the enzymes that detoxify reactive oxygen species (ROS) is believed to be linked to an increased risk of abortion (Tempfer et al. 2001, Burton & Jauniaux 2011). However, the role of HO in decidual stromal cell (DSC) and spontaneous abortion has not been well appreciated.
The aim of the present study was to evaluate HO-1 expression and heme concentration in endometrial stromal cells (ESCs) and DSCs and to further evaluate the potential role of HO-1 in DSC oxidative stress and spontaneous abortion during early pregnancy.
Materials and methods
Tissue collection and cell isolation
All samples used in this study were approved by the Ethical Committee of the Obstetrics and Gynecology Hospital, Fudan University. Every patient signed written informed consent forms. The decidual tissues were obtained from 48 women with clinically normal pregnancies (age: 28.19 ± 5.01 years; gestational age: 48.19 ± 7.81 days (mean ± s.e.m.)); termination for nonmedical reasons). Decidual tissues from unexplained spontaneous abortions were collected from six patients who experienced embryonic gestation (age: 33.14 ± 4.02 years; gestational age: 49.03 ± 7.24 days (mean ± s.e.m.)), whose ultrasound results showed an intrauterine embryo without cardiac activity at more than 7.5–8 weeks of gestation. Uterine curettage was performed when the pregnancy was confirmed to be nonviable. All cases were confirmed histologically according to established criteria. All women were confirmed to be pregnant by ultrasound and blood tests, and women with spontaneous miscarriage due to endocrine, anatomical, and genetic abnormalities, as well as infection were excluded.
Endometrial tissues were collected from 20 patients with regular ovulatory cycles (age: 32.05 ± 5.83 years (mean ± s.e.m.); secretory phase, cycle dsay 15–23), who were diagnosed by curettage or who were undergoing hysteroscopy for endometrial polyps. None of these patients had taken hormone medication for at least 3 months before surgery. All samples were evaluated by a pathologist to ensure that the samples were collected during the secretory phase and to exclude endometrial lesions. DSCs and ESCs were isolated as previously described (Li et al. 2010, Liu et al. 2018). Ultimately, 98% vimentin-positive and cytokeratin-negative DSCs (Li et al. 2010) and 96% vimentin-positive and cytokeratin-negative ESCs were obtained (Liu et al. 2018).
Culture conditions
DSCs and ESCs were cultured in DMEM/F12 medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (Gibco) and 1% penicillin–streptomycin (HyClone, Utah, USA) at 37°C in an atmosphere of 5% CO2 and 95% air. To induce or inhibit the activity of HO-1, hemin (MCE, USA), cobalt protoporphyrin IX (CoPP, an HO-1 inducer) (Santa Cruz Biotechnology) or zinc protoporphyrin IX (ZnPP, an HO-1 inhibitor) (Sigma–Aldrich) was added after the cells were seeded in six-well Costar plates (Corning) for 24 h.
For hypoxia stimulation, primary DSCs/ESCs were seeded in six-well plates at a density of 5 × 105 cells/mL. After the cells attached to the well, they were divided into a hypoxia group and a normoxic group. The hypoxia group was cultured under 1% O2 and 5% CO2 in a 37°C humidified incubator (ESCO CCL-050, Singapore). The normoxic group was cultured under 21% O2 and 5% CO2 in a 37°C humidified incubator (Heal Force HF-90, China).
Cell viability analysis
DSCs were seeded in a 96-well plate at 20,000 cells/well and treated with different concentrations of hemin, hydrogen peroxide (H2O2) or their combination. Cell viability was assessed by a Cell Counting Kit-8 (CCK-8) assay (Dojindo, Tokyo, Japan) according to the manufacturer’s instructions. Briefly, after treatment, fresh culture medium was added to each well with CCK-8 solution and incubated at 37°C for 1-4 h. The absorbance was read at 450 nm with a microplate reader (Bio–Rad Laboratories). Cell viability was calculated by the following formula: (experimental group absorbance value − blank group absorbance)/(control group absorbance value − blank group absorbance).
Immunohistochemistry
The decidual and endometrial tissues were fixed and embedded in paraffin, sectioned to a thickness of 5 µm and rehydrated through a consecutive ethanol series (Merck). To block endogenous peroxidase activity and nonspecific antibody binding, tissues were treated with 3% H2O2 for 30 min and incubated with 10% normal goat serum (Gibco) diluted in TBS for 30 min at room temperature. Subsequently, the sections were incubated overnight at 4°C with rabbit monoclonal to HO-1 (ab52947, 1:2000; Abcam) or rabbit IgG isotype antibody. The sections were then washed with TBS for three times and stained with the secondary antibody at 37°C for 60 min. Finally, the sections were developed with 3,3-diaminobiphenylamine (Sigma) and counterstained with hematoxylin. An Olympus BX51 fluorescence microscope was used to obtain images of the stained sections.
RT–PCR
The gene expression levels of ACTB, HIF1A, HMOX1 and NFE2L2 in ESCs/DSCs were verified by RT–PCR according to the manufacturer’s protocols (RR036A and RR820A; Takara). The fold change in gene expression was calculated using the change in cycle threshold value method (ΔΔCt). All the values obtained were normalized to the values obtained for β-actin (ACTB). The PCR efficiency with all amplification was 90–100%, and all determinations were repeated a minimum of three times. The gene-specific primers are listed in Table 1.
The sequences of primers used for qRT-PCR.
| Gene | Forward primer (5’–3’) | Reverse primer (5’–3’) |
|---|---|---|
| ACTB | CTACCTCATGAAGATCCTCACC | AGTTGAAGGTAGTTTCGTGGAT |
| HIF1A | TGAGTTCGCATCTTGATAAGGC | ACAAAACCATCCAAGGCTTTCA |
| HMOX1 | ACTGCGTTCCTGCTCAACAT | CAGCATGCCTGCATTCACAT |
| NFE2L2 | ACGGTATGCAACAGGACATTGAGC | TTGGCTTCTGGACTTGGAACCATG |
Measurement of heme concentration
The heme concentration was measured by the Heme Assay Kit (MAK316, Sigma). A total of 250 µL distilled water was added to the blank well, while the standard well contained 50 µL heme calibrator and 200 µL distilled water. Fifty microliters of cell sample supernatant were mixed with 200 µL of reagent. On the first day after tissue collection, cells isolated from primary decidual and endometrial tissues were cultured in six-well plates (2 mL DMEM/F12 medium), and their supernatants were collected on the second day for heme detection. The absorbance of well contents was measured at 400 nm after incubation at room temperature for 5 minutes. All the samples and standards were examined in triplicate. The total heme concentration of a sample was calculated with the following formula: (ODsample − ODblank)/ (ODcalibrator − ODblank) × 62.5 (μmol/L).
Reactive oxygen species (ROS) determination
DSCs/ESCs were seeded at a density of 1 × 105/well in 24-well cell culture plates. Following hemin, H2O2, CoPP, ZnPP pretreatment at 37 °C, total intracellular ROS levels were detected using a Reactive Oxygen Species Assay kit (Dojindo Molecular Technologies, Gaithersburg, MD, USA) according to the manufacturer’s protocol. After treatment, the cell culture medium was removed and the cells were incubated with 10 μmol/L dichlorodihydrofluorescein diacetate (DCFH-DA) for 30 min at 37°C in the dark. After washing three times with Hanks Balanced Salt Solutions (HBSS; Solarbio) to completely remove DCFH-DA from the cells, ROS production was observed by inverted fluorescence microscopy (Olympus Corporation). After the cells were seeded in 96-well cell culture plates at a density of 3 × 104/well, ROS production in each sample was quantified by measuring the cellular fluorescence intensities.
Statistical analysis
The data from this study were presented as the mean ± S.E.M. Normality of the data was tested with the Shapiro–Wilk’s test, and the differences were statistically analyzed by Student’s t-test or one-way ANOVA using SPSS version 25.0 (IBM). A P value of <0.05 was considered to indicate a statistically significant result. All experiments were repeated at least three times.
Results
Increased levels of HO-1 and heme in DSCs
HO-1 represents the stress-responsive HO isoform and is encoded by the HMOX1 gene. To evaluate the expression of HO-1 in ESCs and DSCs, endometrium from the secretory phase and decidua from normal pregnancies were collected and analyzed by immunohistochemical (IHC)staining. As shown in Fig. 1A, HO-1 expression was higher in DSCs than in ESCs. In particular, low expression of HO-1 was found in endometrial epithelial cells (Fig. 1A) while in decidual epithelial cells, it was highly expressed. Similarly, DSCs expressed a high level of HMOX1 (Fig. 1B). Additionally, the heme concentration in the supernatant of DSCs was higher than that in the supernatant of ESCs (Fig. 1C). These data suggest that DSCs have a high concentration of heme and active heme metabolism.
Increased expression of HO-1 in DSCs. (A) Representative immunostaining of HO-1 in the endometrium (n = 3) and decidual tissues (n = 3) from patients with normal pregnancies. Endometrial epithelium cells are marked with black arrows while stromal cells are marked with black arrows. (B) Relative mRNA expression of HO-1 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6) was detected by RT-PCR. (C) The concentration of heme in six-well culture supernatants of primary DSCs (n = 12) and ESCs (n = 12). The results were highly reproducible in three independent experiments performed in triplicate. The data are the mean ± S.E.M. *P < 0.05; **P < 0.01.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Increased expression of HO-1 in DSCs. (A) Representative immunostaining of HO-1 in the endometrium (n = 3) and decidual tissues (n = 3) from patients with normal pregnancies. Endometrial epithelium cells are marked with black arrows while stromal cells are marked with black arrows. (B) Relative mRNA expression of HO-1 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6) was detected by RT-PCR. (C) The concentration of heme in six-well culture supernatants of primary DSCs (n = 12) and ESCs (n = 12). The results were highly reproducible in three independent experiments performed in triplicate. The data are the mean ± S.E.M. *P < 0.05; **P < 0.01.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Increased expression of HO-1 in DSCs. (A) Representative immunostaining of HO-1 in the endometrium (n = 3) and decidual tissues (n = 3) from patients with normal pregnancies. Endometrial epithelium cells are marked with black arrows while stromal cells are marked with black arrows. (B) Relative mRNA expression of HO-1 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6) was detected by RT-PCR. (C) The concentration of heme in six-well culture supernatants of primary DSCs (n = 12) and ESCs (n = 12). The results were highly reproducible in three independent experiments performed in triplicate. The data are the mean ± S.E.M. *P < 0.05; **P < 0.01.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Hypoxia-inducible factor 1 alpha (HIF1A) upregulates the expression of HO-1 in DSCs
The endometrium is exposed to hypoxic periods specifically upon menstruation as well as during placentation, and HIF1A is abundant in the glandular and stromal cells of the functional layer during the late secretory and menstrual phases (Chen et al. 2015, Maybin et al. 2018, Rytkonen et al. 2020). HO-1 expression is known to be upregulated by nuclear factor erythroid 2-related factor (Nrf2, encoded by the NFE2L2 gene), a major regulator of the antioxidant response that translocates to the nucleus and upregulates the expression of antioxidant genes (including HO-1) (Leinonen et al. 2014). To test whether HO-1 is associated with HIF1A, we first generated prediction-related networks of differential genes and conducted bioinformatics analysis by STRING (available online: http://string-db.org). According to the predicted network, HIF1A was predicted to regulate HO-1 expression directly or indirectly (Fig. 2A). Moreover, Nrf2 was predicted to be an important regulatory molecule that responds to hypoxia by regulating HO-1 expression. During decidualization, HIF1A and NFE2L2 expression was upregulated significantly (Fig. 2B). Compared to normoxic conditions, HIF1A, NFE2L2 and HMOX1 expression was considerably elevated in DSCs under hypoxic conditions (1% O2) (Fig. 2C). In addition, KC7F2, an inhibitor of HIF1A protein translation, led to significant decreases in HIF1A, NFE2L2 and HMOX1 expression in DSCs (Fig. 2D), indicating that HIF1A is involved in the upregulation of HO-1 expression during decidualization. Interestingly, the competitive HO-1 inhibitor ZnPP resulted in an increase in HIF1A expression (Fig. 2E). These results indicate that HIF1A increases the expression of HO-1 in DSCs, in turn, HO-1 participates in the negative feedback regulation of HIF1A expression.
HIF-1α upregulates HO-1 expression in DSCs. (A) The predicted networks obtained from the STRING database (https://string-db.org) are shown. (B) Relative mRNA expression of HIF1A and Nrf2 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). (C) Relative mRNA expression of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) hypoxia (1% O2) for 24 h. (D) The transcriptional levels of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) HIF1A inhibitor (KC7F2, 20 μmol/L, 24 h) were determined by RT-PCR. (E) Relative mRNA expression of HIF1A in primary DSCs treated with (n = 6) and without (n = 6) HO-1 inhibitor (ZnPP, 5 μmol/L, 24 h). Data are mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HIF-1α upregulates HO-1 expression in DSCs. (A) The predicted networks obtained from the STRING database (https://string-db.org) are shown. (B) Relative mRNA expression of HIF1A and Nrf2 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). (C) Relative mRNA expression of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) hypoxia (1% O2) for 24 h. (D) The transcriptional levels of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) HIF1A inhibitor (KC7F2, 20 μmol/L, 24 h) were determined by RT-PCR. (E) Relative mRNA expression of HIF1A in primary DSCs treated with (n = 6) and without (n = 6) HO-1 inhibitor (ZnPP, 5 μmol/L, 24 h). Data are mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HIF-1α upregulates HO-1 expression in DSCs. (A) The predicted networks obtained from the STRING database (https://string-db.org) are shown. (B) Relative mRNA expression of HIF1A and Nrf2 in primary endometrial stromal cells (ESCs) (n = 6) and decidual stromal cells (DSCs) (n = 6). (C) Relative mRNA expression of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) hypoxia (1% O2) for 24 h. (D) The transcriptional levels of HIF1A, Nrf2 and HO-1 in primary DSCs treated with (n = 6) and without (n = 6) HIF1A inhibitor (KC7F2, 20 μmol/L, 24 h) were determined by RT-PCR. (E) Relative mRNA expression of HIF1A in primary DSCs treated with (n = 6) and without (n = 6) HO-1 inhibitor (ZnPP, 5 μmol/L, 24 h). Data are mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Free heme exerts a dual effect on the viability of DSCs
To elucidate the potential role of heme/HO-1 in the viability of DSCs in vitro, DSCs were treated with different concentrations of heme. As shown, appropriate stimulus with low concentrations of hemin (<20 μmol/L) enhanced the viability of DSCs (Fig. 3A), especially at a concentration of 20 μmol/L (Fig. 3A and B). However, high concentrations of hemin (>100 μmol/L) and ZnPP (5 μmol/L) decreased cell viability (Fig. 3A and B). Of note, the total heme concentration was approximately 42 μmol/L in ESCs and 32 μmol/L in DSCs after treatment with 20 μmol/L heme (Fig. 3C), suggesting that DSCs with elevated HO-1 expression are better able to cope with the exogenous increase in heme. Additionally, ZnPP increased the heme level in ESCs/DSCs (Fig. 3C). Hemin is both a potent inducer of and substrate for the inducible isoform of HO-1. As expected, 20 μmol/L heme and the HO-1 inducer CoPP (20 μmol/L, a positive control) significantly upregulated the expression of HMOX1 in DSCs (Fig. 3D). These data suggest that heme at certain concentrations can promote cell viability, and this effect should be dependent on HO-1. However, excessive heme levels contribute to negative effects on DSC viability.
Free heme exerts a dual effect on the survival of DSCs. (A) The results of the CCK-8 assay in DSCs treated with different concentrations of hemin for 24 h (0–500 μmol/L) (n = 3 in each concentration). The experiment was performed in triplicate. (B) The cell viability of primary DSCs treated with or without hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h) (n = 3, respectively). The experiment was performed in triplicate. (C) The concentration of heme in six-well culture supernatant of primary ESCs (n = 6) or DSCs (n = 6) that were treated separately with hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h). (D) The mRNA expression of HO-1 in primary DSCs treated with hemin (n = 6) (20 μmol/L, 24 h) or CoPP (n = 6) (20 μmol/L, 24 h) was detected by RT-PCR. Data are the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, ****P < 0.0001. CoPP, cobalt protoporphyrin IX; HO-1, heme oxygenase-1; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Free heme exerts a dual effect on the survival of DSCs. (A) The results of the CCK-8 assay in DSCs treated with different concentrations of hemin for 24 h (0–500 μmol/L) (n = 3 in each concentration). The experiment was performed in triplicate. (B) The cell viability of primary DSCs treated with or without hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h) (n = 3, respectively). The experiment was performed in triplicate. (C) The concentration of heme in six-well culture supernatant of primary ESCs (n = 6) or DSCs (n = 6) that were treated separately with hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h). (D) The mRNA expression of HO-1 in primary DSCs treated with hemin (n = 6) (20 μmol/L, 24 h) or CoPP (n = 6) (20 μmol/L, 24 h) was detected by RT-PCR. Data are the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, ****P < 0.0001. CoPP, cobalt protoporphyrin IX; HO-1, heme oxygenase-1; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Free heme exerts a dual effect on the survival of DSCs. (A) The results of the CCK-8 assay in DSCs treated with different concentrations of hemin for 24 h (0–500 μmol/L) (n = 3 in each concentration). The experiment was performed in triplicate. (B) The cell viability of primary DSCs treated with or without hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h) (n = 3, respectively). The experiment was performed in triplicate. (C) The concentration of heme in six-well culture supernatant of primary ESCs (n = 6) or DSCs (n = 6) that were treated separately with hemin (20 μmol/L, 24 h) or ZnPP (5 μmol/L, 24 h). (D) The mRNA expression of HO-1 in primary DSCs treated with hemin (n = 6) (20 μmol/L, 24 h) or CoPP (n = 6) (20 μmol/L, 24 h) was detected by RT-PCR. Data are the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, ****P < 0.0001. CoPP, cobalt protoporphyrin IX; HO-1, heme oxygenase-1; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 protects DSCs from oxidative stress by catabolizing free heme
Decidualization is considered to be an inflammatory process characterized by an influx of immune cells, extensive remodeling and vascular changes (Gellersen et al. 2007). ROS are produced during inflammatory processes, and their levels are even more pronounced at the maternal–fetal interface due to profound fluctuations in oxygen tension associated with the onset of placental perfusion in the first trimester of pregnancy (Jauniaux et al. 2000). The generation of oxidative stress has been proven to induce HO-1 expression (Applegate et al. 1991). Additionally, oxidative stress induces the apoptosis of stromal cells and reduces the number of implantation sites, impairing decidualization (Shahin et al. 2013). Excess ROS levels are also related to a spectrum of female reproductive disorders including spontaneous abortion, endometriosis and preeclampsia (Ruder et al. 2008). To investigate whether HO-1 is involved in antioxidative stress, DSCs and ESCs were first exposed to H2O2 (an oxidative injury model) for 24 h (Shi et al. 2021), and ROS production was detected using an ROS-sensitive dye (DCFH-DA). As shown, treatment with H2O2 led to strong DCFH-DA staining in both DSCs (Fig. 4A) and ESCs (Fig. 4B). Further analysis showed that the addition of hemin or ZnPP increased ROS production, whereas CoPP-treated DSCs had relatively low DCFH-DA staining (Fig. 4C). Notably, HO-1 and Nrf2 mRNA levels were significantly elevated in the H2O2-treated group (Fig. 5A), which was accompanied by an increase in heme concentration (Fig. 5B) and impaired DSC viability (Fig. 5C). Interestingly, the ROS level stimulated by H2O2 could be partly restored by treatment of DSCs with CoPP (Fig. 5D). Consistently, CoPP recovered the decreased cell viability caused by H2O2-mediated oxidative stress (Fig. 5E). These data suggest that the activation of HO-1 attenuates the production of ROS and oxidative stress in DSCs in vitro.
HO-1 decreases the ROS production of DSCs. (A) Cells were exposed to H2O2 (125 μmol/L) for 24 h, and ROS production in primary DSCs (n = 3) was measured by a microplate reader. (B) ROS fluorescence in primary ESCs (n = 3) treated with or without H2O2 (125 μmol/L, 24 h) was photographed. (C) Representative fluorescent images of nuclei and ROS in primary DSCs treated with hemin (20 μmol/L, 24 h), ZnPP (5 μmol/L, 24 h) and CoPP (20 μmol/L, 24 h) in primary DSCs (n = 3, respectively). Data are the mean ± S.E.M. ****P < 0.0001. CoPP, cobalt protoporphyrin IX; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 decreases the ROS production of DSCs. (A) Cells were exposed to H2O2 (125 μmol/L) for 24 h, and ROS production in primary DSCs (n = 3) was measured by a microplate reader. (B) ROS fluorescence in primary ESCs (n = 3) treated with or without H2O2 (125 μmol/L, 24 h) was photographed. (C) Representative fluorescent images of nuclei and ROS in primary DSCs treated with hemin (20 μmol/L, 24 h), ZnPP (5 μmol/L, 24 h) and CoPP (20 μmol/L, 24 h) in primary DSCs (n = 3, respectively). Data are the mean ± S.E.M. ****P < 0.0001. CoPP, cobalt protoporphyrin IX; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 decreases the ROS production of DSCs. (A) Cells were exposed to H2O2 (125 μmol/L) for 24 h, and ROS production in primary DSCs (n = 3) was measured by a microplate reader. (B) ROS fluorescence in primary ESCs (n = 3) treated with or without H2O2 (125 μmol/L, 24 h) was photographed. (C) Representative fluorescent images of nuclei and ROS in primary DSCs treated with hemin (20 μmol/L, 24 h), ZnPP (5 μmol/L, 24 h) and CoPP (20 μmol/L, 24 h) in primary DSCs (n = 3, respectively). Data are the mean ± S.E.M. ****P < 0.0001. CoPP, cobalt protoporphyrin IX; ZnPP, zinc protoporphyrin IX.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 protects DSCs against oxidative stress. (A) Relative mRNA expression of Nrf2 and HO-1 in primary DSCs treated with or without H2O2 (125 μmol/L, 24 h) (n = 6, respectively). (B) The concentration of heme in six-well culture supernatants of primary DSCs treated with (n = 6) or without (n = 6) H2O2 (125 μmol/L, 24 h). (C) The cell viability of primary DSCs treated with (n = 3) or without (n = 3) H2O2 (125 μmol/L, 24 h). (D) ROS measurement by the DCFH-DA assay and DCF fluorescence intensity in human primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. (E) The cell viability of primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. The results are shown as the normalized mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001. HO-1, heme oxygenase-1; CoPP, cobalt protoporphyrin IX; H2O2, hydrogen peroxide.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 protects DSCs against oxidative stress. (A) Relative mRNA expression of Nrf2 and HO-1 in primary DSCs treated with or without H2O2 (125 μmol/L, 24 h) (n = 6, respectively). (B) The concentration of heme in six-well culture supernatants of primary DSCs treated with (n = 6) or without (n = 6) H2O2 (125 μmol/L, 24 h). (C) The cell viability of primary DSCs treated with (n = 3) or without (n = 3) H2O2 (125 μmol/L, 24 h). (D) ROS measurement by the DCFH-DA assay and DCF fluorescence intensity in human primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. (E) The cell viability of primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. The results are shown as the normalized mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001. HO-1, heme oxygenase-1; CoPP, cobalt protoporphyrin IX; H2O2, hydrogen peroxide.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 protects DSCs against oxidative stress. (A) Relative mRNA expression of Nrf2 and HO-1 in primary DSCs treated with or without H2O2 (125 μmol/L, 24 h) (n = 6, respectively). (B) The concentration of heme in six-well culture supernatants of primary DSCs treated with (n = 6) or without (n = 6) H2O2 (125 μmol/L, 24 h). (C) The cell viability of primary DSCs treated with (n = 3) or without (n = 3) H2O2 (125 μmol/L, 24 h). (D) ROS measurement by the DCFH-DA assay and DCF fluorescence intensity in human primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. (E) The cell viability of primary DSCs (n = 6, respectively) treated with H2O2 (125 μmol/L, 24 h), CoPP (20 μmol/L, 24 h) or their combination. The results are shown as the normalized mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001, **** P < 0.0001. HO-1, heme oxygenase-1; CoPP, cobalt protoporphyrin IX; H2O2, hydrogen peroxide.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
HO-1 levels were decreased and heme and ROS levels were increased in DSCs from patients with unexplained spontaneous abortion
To further evaluate the relationship between the heme/HO-1 metabolism-oxidative stress axis and spontaneous abortion, decidua from patients with normal pregnancy and patients with unexplained spontaneous abortion were collected. As shown, the expression of HO-1 was significantly decreased in DSCs from patients with unexplained spontaneous abortion (Fig. 6A). In contrast, there were high levels of heme and ROS in DSCs from unexplained spontaneous abortion patients (Fig. 6B and C). Further analysis showed that women with spontaneous abortion exhibited increased expression of HIF1A (Fig. 6D) and of NFE2L2 compared with normal pregnant women (Fig. 6E). This might be the result of insufficient negative feedback of the descending HO-1 to HIF1A. The increased level of NFE2L2 expression in spontaneous abortion also proves that there are other mechanisms that regulate HO-1 expression. Collectively, these results show that the reduced HO-1 level may fail to degrade free heme and relieve oxidative stress damage, contributing to the initiation and development of unexplained spontaneous abortion.
Reduced HO-1 levels in the decidua from patients with unexplained spontaneous abortion. (A) Representative immunostaining of HO-1 in decidual tissue from women with normal pregnancy (n =3) and patients with spontaneous abortion SA (n = 3). Black arrow indicates specific brown staining of the HO-1 antigen in endometrial epithelium cells while red arrows indicate specific brown staining of the HO-1 antigen in stromal cells. (B) The concentration of heme in six-well culture supernatants of primary decidual stromal cells (DSCs) isolated from patients with normal pregnancies (n = 6) or SA (n =6). (C) ROS production in primary DSCs isolated from patients with normal pregnancies (n =6) or SA (n =6) was measured by a microplate reader. (D) Relative mRNA expression of HIF1A in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). (E) Relative mRNA expression of Nrf2 in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). The data represent the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001. **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Reduced HO-1 levels in the decidua from patients with unexplained spontaneous abortion. (A) Representative immunostaining of HO-1 in decidual tissue from women with normal pregnancy (n =3) and patients with spontaneous abortion SA (n = 3). Black arrow indicates specific brown staining of the HO-1 antigen in endometrial epithelium cells while red arrows indicate specific brown staining of the HO-1 antigen in stromal cells. (B) The concentration of heme in six-well culture supernatants of primary decidual stromal cells (DSCs) isolated from patients with normal pregnancies (n = 6) or SA (n =6). (C) ROS production in primary DSCs isolated from patients with normal pregnancies (n =6) or SA (n =6) was measured by a microplate reader. (D) Relative mRNA expression of HIF1A in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). (E) Relative mRNA expression of Nrf2 in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). The data represent the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001. **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Reduced HO-1 levels in the decidua from patients with unexplained spontaneous abortion. (A) Representative immunostaining of HO-1 in decidual tissue from women with normal pregnancy (n =3) and patients with spontaneous abortion SA (n = 3). Black arrow indicates specific brown staining of the HO-1 antigen in endometrial epithelium cells while red arrows indicate specific brown staining of the HO-1 antigen in stromal cells. (B) The concentration of heme in six-well culture supernatants of primary decidual stromal cells (DSCs) isolated from patients with normal pregnancies (n = 6) or SA (n =6). (C) ROS production in primary DSCs isolated from patients with normal pregnancies (n =6) or SA (n =6) was measured by a microplate reader. (D) Relative mRNA expression of HIF1A in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). (E) Relative mRNA expression of Nrf2 in primary DSCs isolated from patients with normal pregnancies (n = 6) or SA (n = 6). The data represent the mean ± S.E.M. *P < 0.05; **P < 0.01; ***P < 0.001. **** P < 0.0001.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Discussion
The HO system plays a critical role in the establishment and maintenance of healthy pregnancy (Garrido-Gomez et al. 2020). The present study described more strongly positive IHC staining of the HO-1 protein and higher HMOX1 expression in the decidua than in the endometrium. Similar immunohistochemical staining patterns were reported in the decidua of normal pregnant patients compared to that of patients with unexplained spontaneous abortion, which is consistent with previous studies (Sollwedel et al. 2005, Zenclussen et al. 2005). In this study, elevated HO-1 expression was observed during decidualization to protect cells from the oxidative stress-mediated damage caused by increased levels of heme. However, insufficient HO-1 expression is unable to degrade heme in spontaneous abortion, so the increased oxidative stress caused by accumulated heme in the endometrium may not be not conducive to embryo implantation or survival.
Decidualization not only refers to a transition of ESCs to DSCs but also creates a suitable microenvironment for embryo implantation and involves transformation of spiral arteries, supplementation of local immune cells and changes in extracellular stromal composition (Mendes et al. 2019). Thus, more oxygen is required during decidualization. Given that the endometrium is exposed to hypoxic periods specifically upon menstruation as well as in the first trimester (Pringle et al. 2010, Maybin & Critchley 2015), we verified that the gene expression of HIF1A, NFE2L2 and HMOX1 in DSCs was higher than that in ESCs. In addition, hypoxia induces increases in HIF1A, NFE2L2 and HMOX1 expression in DSCs. Bioinformatics analysis also shows that HO-1 expression is associated with HIF1A expression. More importantly, treatment with a HIF1A inhibitor resulted in an obvious decrease in the expression of these molecules. Interestingly, when suppressing the activity of HO-1, the expression of HIF1A was upregulated, suggesting that HO-1 exerts a negative feedback effect on HIF1A expression. Briefly, HIF1A mediated the upregulation of HO-1 expression, and in turn, its expression was subject to the negative feedback regulation by HO-1 in DSCs.
Previous studies demonstrated the HO-1 expression in trophoblasts (Lyall et al. 2000) and the placenta (McLean et al. 2000, Watanabe et al. 2004). It can be highly induced during pregnancy, being a factor supporting pregnancy and decreasing the risk of abortion (Zenclussen et al. 2014). HO-1 deficiency results in inadequate remodeling of spiral arteries and suboptimal placentation followed by intrauterine growth restriction as well as embryonic death (Zenclussen et al. 2014). Our study also suggests that HO-1 plays an important role in the survival and homeostasis of DSCs by degrading heme.
Additionally, many studies have shown that heme may modulate gene expression at almost all levels by regulating transcription, mRNA stability, mRNA splicing, protein synthesis and protein posttranslational modification (Ponka 1999, Zhu et al. 1999). Incredibly, the expression of the genes that encode globins, heme biosynthetic enzymes, HO-1, ferroportin, cytochromes, myeloperoxidase and transferrin receptor is regulated by heme (Chiabrando et al. 2014). On the other hand, heme is pro-oxidant and cytotoxic by catalyzing ROS, resulting in oxidative stress. Additionally, as a source of iron, heme overload leads to the intracellular accumulation of iron, with further ROS generation (Chiabrando et al. 2014). This may explain why heme promoted DSC proliferation at low concentrations but inhibited DSC proliferation at high concentrations. Additionally, we found that hemin treatment also induced stronger ROS production than the control treatment. Therefore, DSCs can adapt to increased ROS by upregulating HO-1 expression.
The protective effects of HO-1 on placentation and fetal growth have been widely reported (Sollwedel et al. 2005). The mechanism can be multifaceted, ranging from immune regulation to bioactive metabolites. CoPP treatment prevented fetal rejection by upregulating the expression of tissue protective molecules, including Bag-1, and activating T regulatory cells, whereas ZnPP application promoted abortion (Sollwedel et al. 2005). Moreover, HO-1 metabolic byproducts exhibited effective therapeutic effects. CO significantly reduced the levels of free heme in circulation and prevented fetal death in a clinically relevant model of intrauterine growth retardation (Zenclussen et al. 2011). Moreover, CO not only suppresses the expression of proinflammatory cytokines but also controls the activity of several heme proteins and promotes vasodilation (Ndisang et al. 2003, Beckman et al. 2009). Bilirubin was found to scavenge peroxyl radicals efficiently, decreasing lipid peroxidation and attenuating heme-induced oxidative stress (Kawamura et al. 2005). Substantial evidence has shown that HO-1 induction and CO and bilirubin administration can independently suppress hypoxia-induced soluble Flt-1 (sFlt-1) release from both cultured cells and placental explants (Cudmore et al. 2007, 2012, George et al. 2012, Levytska et al. 2013). Our study found that HO-1 protected DSCs from oxidative stress, suggesting that upregulation of HO-1 expression protects tissues from oxidative injury (Poss & Tonegawa 1997). Undoubtedly, there must be other mechanisms that involve the upregulation of HO-1 expression and the protective effects of HO-1 are manifold and need further study. In addition, the limitation of this study is the lack of verification in animal experiments, which needs further research.
In conclusion, this study demonstrates elevated HO-1 levels in the decidua (Fig. 7). Specifically, excessive levels of heme damage DSCs by inducing ROS production and oxidative stress injury. To protect cells from oxidative stress, HIF1A induces the expression of HO-1, which can degrade heme and promote the survival of DSCs. However, HO-1 deficiency fails to protect the endometrium/decidua against the oxidative injury induced by heme, which is likely involved in the pathogenesis of spontaneous abortion.
Schematic of the role of HIF1A-regulated HO-1 expression in DSCs during normal pregnancy and spontaneous abortion. With the establishment of maternal circulation, profound fluctuations in oxygen tension are likely to cause heme to be released from hemoglobin and a burst of oxidative stress. In the first trimester, DSCs respond to hypoxia by upregulating HIF1A expression, which activates the Nrf2/HO-1 axis. HO-1, as the rate-limiting enzyme that catalyzes heme degradation, removes accumulated heme to exert its antioxidative activity during decidualization, ensuring the maintenance of DSC function. Heme decomposition products are also reported to have a cell protective effect, further enhancing the antioxidative stress effect of HO-1. However, low levels and dysfunction of HO-1 likely lead to excess heme-mediated oxidative stress in the decidua, contributing to the initiation and development of unexplained spontaneous abortion. In addition, the absence of negative feedback of HO-1 results in an increased level of HIF1A in DSCs from spontaneous abortion patients.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Schematic of the role of HIF1A-regulated HO-1 expression in DSCs during normal pregnancy and spontaneous abortion. With the establishment of maternal circulation, profound fluctuations in oxygen tension are likely to cause heme to be released from hemoglobin and a burst of oxidative stress. In the first trimester, DSCs respond to hypoxia by upregulating HIF1A expression, which activates the Nrf2/HO-1 axis. HO-1, as the rate-limiting enzyme that catalyzes heme degradation, removes accumulated heme to exert its antioxidative activity during decidualization, ensuring the maintenance of DSC function. Heme decomposition products are also reported to have a cell protective effect, further enhancing the antioxidative stress effect of HO-1. However, low levels and dysfunction of HO-1 likely lead to excess heme-mediated oxidative stress in the decidua, contributing to the initiation and development of unexplained spontaneous abortion. In addition, the absence of negative feedback of HO-1 results in an increased level of HIF1A in DSCs from spontaneous abortion patients.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Schematic of the role of HIF1A-regulated HO-1 expression in DSCs during normal pregnancy and spontaneous abortion. With the establishment of maternal circulation, profound fluctuations in oxygen tension are likely to cause heme to be released from hemoglobin and a burst of oxidative stress. In the first trimester, DSCs respond to hypoxia by upregulating HIF1A expression, which activates the Nrf2/HO-1 axis. HO-1, as the rate-limiting enzyme that catalyzes heme degradation, removes accumulated heme to exert its antioxidative activity during decidualization, ensuring the maintenance of DSC function. Heme decomposition products are also reported to have a cell protective effect, further enhancing the antioxidative stress effect of HO-1. However, low levels and dysfunction of HO-1 likely lead to excess heme-mediated oxidative stress in the decidua, contributing to the initiation and development of unexplained spontaneous abortion. In addition, the absence of negative feedback of HO-1 results in an increased level of HIF1A in DSCs from spontaneous abortion patients.
Citation: Reproduction 163, 1; 10.1530/REP-21-0314
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by the Major Research Program of National Natural Science Foundation of China (NSFC) (Nos. 92057119, 31970798, 82072872), the Program for Zhuoxue of Fudan University (JIF157602), the Support Project for Original Personalized Research of Fudan University (IDF157014/002), and the Clinical Research Project of Shanghai Municipal Health Commission (20194Y0305).
Author contribution statement
H H S collected the clinical samples, conducted all the experiments and prepared the figures and the manuscript. C J W, X Y Z, Y R S, S L Y, Z M Z, J L S helped for the clinical samples collection. M Q L, F X and X M Q designed, initiated and supervised the project and edited the manuscript. All the authors were involved in writing the manuscript.
References
Applegate LA, Luscher P & Tyrrell RM 1991 Induction of heme oxygenase: a general response to oxidant stress in cultured mammalian cells. Cancer Research 51 974–978.
Beckman JD, Belcher JD, Vineyard JV, Chen C, Nguyen J, Nwaneri MO, O’Sullivan MG, Gulbahce E, Hebbel RP & Vercellotti GM 2009 Inhaled carbon monoxide reduces leukocytosis in a murine model of sickle cell disease. American Journal of Physiology: Heart and Circulatory Physiology 297 H1243–H1253. (https://doi.org/10.1152/ajpheart.00327.2009)
Biri A, Kavutcu M, Bozkurt N, Devrim E, Nurlu N & Durak I 2006 Investigation of free radical scavenging enzyme activities and lipid peroxidation in human placental tissues with miscarriage. Journal of the Society for Gynecologic Investigation 13 384–388. (https://doi.org/10.1016/j.jsgi.2006.04.003)
Burton GJ & Jauniaux E 2011 Oxidative stress. Best Practice and Research: Clinical Obstetrics and Gynaecology 25 287–299. (https://doi.org/10.1016/j.bpobgyn.2010.10.016)
Chen X, Liu J, He B, Li Y, Liu S, Wu B, Wang S, Zhang S, Xu X & Wang J 2015 Vascular endothelial growth factor (VEGF) regulation by hypoxia inducible factor-1 alpha (HIF1A) starts and peaks during endometrial breakdown, not repair, in a mouse menstrual-like model. Human Reproduction 30 2160–2170. (https://doi.org/10.1093/humrep/dev156)
Chiabrando D, Vinchi F, Fiorito V, Mercurio S & Tolosano E 2014 Heme in pathophysiology: a matter of scavenging, metabolism and trafficking across cell membranes. Frontiers in Pharmacology 5 61. (https://doi.org/10.3389/fphar.2014.00061)
Chiabrando D, Fiorito V, Petrillo S & Tolosano E 2018 Unraveling the role of heme in neurodegeneration. Frontiers in Neuroscience 12 712. (https://doi.org/10.3389/fnins.2018.00712)
Cudmore M, Ahmad S, Al-Ani B, Fujisawa T, Coxall H, Chudasama K, Devey LR, Wigmore SJ, Abbas A & Hewett PW et al.2007 Negative regulation of soluble Flt-1 and soluble endoglin release by heme oxygenase-1. Circulation 115 1789–1797. (https://doi.org/10.1161/CIRCULATIONAHA.106.660134)
Cudmore MJ, Ramma W, Cai M, Fujisawa T, Ahmad S, Al-Ani B & Ahmed A 2012 Resveratrol inhibits the release of soluble fms-like tyrosine kinase (sFlt-1) from human placenta. American Journal of Obstetrics and Gynecology 206 253.e10–253.e15. (https://doi.org/10.1016/j.ajog.2011.11.010)
Denschlag D, Marculescu R, Unfried G, Hefler LA, Exner M, Hashemi A, Riener EK, Keck C, Tempfer CB & Wagner O 2004 The size of a microsatellite polymorphism of the haem oxygenase 1 gene is associated with idiopathic recurrent miscarriage. Molecular Human Reproduction 10 211–214. (https://doi.org/10.1093/molehr/gah024)
Eide IP, Isaksen CV, Salvesen KA, Langaas M, Schonberg SA & Austgulen R 2008 Decidual expression and maternal serum levels of heme oxygenase 1 are increased in pre-eclampsia. Acta Obstetricia et Gynecologica Scandinavica 87 272–279. (https://doi.org/10.1080/00016340701763015)
Garrido-Gomez T, Castillo-Marco N, Cordero T & Simon C 2020 Decidualization resistance in the origin of preeclampsia. American Journal of Obstetrics and Gynecology In press. (https://doi.org/10.1016/j.ajog.2020.09.039)
Gellersen B, Brosens IA & Brosens JJ 2007 Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Seminars in Reproductive Medicine 25 445–453. (https://doi.org/10.1055/s-2007-991042)
George EM, Colson D, Dixon J, Palei AC & Granger JP 2012 Heme oxygenase-1 attenuates hypoxia-induced sFlt-1 and oxidative stress in placental villi through its metabolic products CO and bilirubin. International Journal of Hypertension 2012 486053. (https://doi.org/10.1155/2012/486053)
Immenschuh S 2010 Therapeutic applications of the heme oxygenase system. Current Drug Targets 11 1483–1484. (https://doi.org/10.2174/1389450111009011483)
Jauniaux E, Watson AL, Hempstock J, Bao YP, Skepper JN & Burton GJ 2000 Onset of maternal arterial blood flow and placental oxidative stress. A possible factor in human early pregnancy failure. American Journal of Pathology 157 2111–2122. (https://doi.org/10.1016/S0002-9440(1064849-3)
Kawamura K, Ishikawa K, Wada Y, Kimura S, Matsumoto H, Kohro T, Itabe H, Kodama T & Maruyama Y 2005 Bilirubin from heme oxygenase-1 attenuates vascular endothelial activation and dysfunction. Arteriosclerosis, Thrombosis, and Vascular Biology 25 155–160. (https://doi.org/10.1161/01.ATV.0000148405.18071.6a)
Keyse SM & Tyrrell RM 1989 Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. PNAS 86 99–103. (https://doi.org/10.1073/pnas.86.1.99)
Leinonen HM, Kansanen E, Polonen P, Heinaniemi M & Levonen AL 2014 Role of the Keap1-Nrf2 pathway in cancer. Advances in Cancer Research 122 281–320. (https://doi.org/10.1016/B978-0-12-420117-0.00008-6)
Levytska K, Kingdom J, Baczyk D & Drewlo S 2013 Heme oxygenase-1 in placental development and pathology. Placenta 34 291–298. (https://doi.org/10.1016/j.placenta.2013.01.004)
Li MQ, Hou XF, Shao J, Tang CL & Li DJ 2010 The DSCs-expressed CD82 controls the invasiveness of trophoblast cells via integrinbeta1/MAPK/MAPK3/1 signaling pathway in human first-trimester pregnancy. Biology of Reproduction 82 968–979. (https://doi.org/10.1095/biolreprod.109.080739)
Liu XT, Sun HT, Zhang ZF, Shi RX, Liu LB, Yu JJ, Zhou WJ, Gu CJ, Yang SL & Liu YK et al.2018 Indoleamine 2,3-dioxygenase suppresses the cytotoxicity of 1 NK cells in response to ectopic endometrial stromal cells in endometriosis. Reproduction 156 397–404. (https://doi.org/10.1530/REP-18-0112)
Lu H, Yang HL, Zhou WJ, Lai ZZ, Qiu XM, Fu Q, Zhao JY, Wang J, Li DJ & Li MQ 2021 Rapamycin prevents spontaneous abortion by triggering decidual stromal cell autophagy-mediated NK cell residence. Autophagy 17 2511–2527. (https://doi.org/10.1080/15548627.2020.1833515)
Lv S, Liu M, Xu L & Zhang C 2021 Downregulation of decidual SKP2 is associated with human recurrent miscarriage. Reproductive Biology and Endocrinology 19 88. (https://doi.org/10.1186/s12958-021-00775-4)
Lyall F, Barber A, Myatt L, Bulmer JN & Robson SC 2000 Hemeoxygenase expression in human placenta and placental bed implies a role in regulation of trophoblast invasion and placental function. FASEB Journal 14 208–219. (https://doi.org/10.1096/fasebj.14.1.208)
Maines MD, Mayer RD, Ewing JF & McCoubrey Jr WK 1993 Induction of kidney heme oxygenase-1 (HSP32) mRNA and protein by ischemia/reperfusion: possible role of heme as both promotor of tissue damage and regulator of HSP32. Journal of Pharmacology and Experimental Therapeutics 264 457–462.
Maybin JA & Critchley HO 2015 Menstrual physiology: implications for endometrial pathology and beyond. Human Reproduction Update 21 748–761. (https://doi.org/10.1093/humupd/dmv038)
Maybin JA, Murray AA, Saunders PTK, Hirani N, Carmeliet P & Critchley HOD 2018 Hypoxia and hypoxia inducible factor-1alpha are required for normal endometrial repair during menstruation. Nature Communications 9 295. (https://doi.org/10.1038/s41467-017-02375-6)
McLean M, Bowman M, Clifton V, Smith R & Grossman AB 2000 Expression of the heme oxygenase-carbon monoxide signalling system in human placenta. Journal of Clinical Endocrinology and Metabolism 85 2345–2349. (https://doi.org/10.1210/jcem.85.6.6705)
Mendes S, Timoteo-Ferreira F, Almeida H & Silva E 2019 New insights into the process of placentation and the role of oxidative uterine microenvironment. Oxidative Medicine and Cellular Longevity 2019 9174521. (https://doi.org/10.1155/2019/9174521)
Montellano PR 2000 The mechanism of heme oxygenase. Current Opinion in Chemical Biology 4 221–227. (https://doi.org/10.1016/s1367-5931(9900079-4)
Ndisang JF, Wu L, Zhao W & Wang R 2003 Induction of heme oxygenase-1 and stimulation of cGMP production by hemin in aortic tissues from hypertensive rats. Blood 101 3893–3900. (https://doi.org/10.1182/blood-2002-08-2608)
Ponka P 1999 Cell biology of heme. American Journal of the Medical Sciences 318 241–256. (https://doi.org/10.1097/00000441-199910000-00004)
Poss KD & Tonegawa S 1997 Reduced stress defense in heme oxygenase 1-deficient cells. PNAS 94 10925–10930. (https://doi.org/10.1073/pnas.94.20.10925)
Pringle KG, Kind KL, Sferruzzi-Perri AN, Thompson JG & Roberts CT 2010 Beyond oxygen: complex regulation and activity of hypoxia inducible factors in pregnancy. Human Reproduction Update 16 415–431. (https://doi.org/10.1093/humupd/dmp046)
Ruder EH, Hartman TJ, Blumberg J & Goldman MB 2008 Oxidative stress and antioxidants: exposure and impact on female fertility. Human Reproduction Update 14 345–357. (https://doi.org/10.1093/humupd/dmn011)
Rytkonen KT, Heinosalo T, Mahmoudian M, Ma X, Perheentupa A, Elo LL, Poutanen M & Wagner GP 2020 Transcriptomic responses to hypoxia in endometrial and decidual stromal cells. Reproduction 160 39–51. (https://doi.org/10.1530/REP-19-0615)
Shahin S, Singh VP, Shukla RK, Dhawan A, Gangwar RK, Singh SP & Chaturvedi CM 2013 2.45 GHz microwave irradiation-induced oxidative stress affects implantation or pregnancy in mice, Mus musculus. Applied Biochemistry and Biotechnology 169 1727–1751. (https://doi.org/10.1007/s12010-012-0079-9)
Shi JW, Yang HL, Lai ZZ, Shen HH, Ruan LY, Wang Y, Qiu XM, Xie F & Li MQ 2021 Aspirin enhances the protective effect of progesterone on trophoblast cell from oxidative stress and apoptosis. Reproductive and Developmental Medicine 5 1–8. (https://doi.org/10.4103/2096-2924.313686)
Sollwedel A, Bertoja AZ, Zenclussen ML, Gerlof K, Lisewski U, Wafula P, Sawitzki B, Woiciechowsky C, Volk HD & Zenclussen AC 2005 Protection from abortion by heme oxygenase-1 up-regulation is associated with increased levels of Bag-1 and neuropilin-1 at the fetal-maternal interface. Journal of Immunology 175 4875–4885. (https://doi.org/10.4049/jimmunol.175.8.4875)
Sugino N, Nakata M, Kashida S, Karube A, Takiguchi S & Kato H 2000 Decreased superoxide dismutase expression and increased concentrations of lipid peroxide and prostaglandin F(2alpha) in the decidua of failed pregnancy. Molecular Human Reproduction 6 642–647. (https://doi.org/10.1093/molehr/6.7.642)
Tempfer C, Unfried G, Zeillinger R, Hefler L, Nagele F & Huber JC 2001 Endothelial nitric oxide synthase gene polymorphism in women with idiopathic recurrent miscarriage. Human Reproduction 16 1644–1647. (https://doi.org/10.1093/humrep/16.8.1644)
Toy H, Camuzcuoglu H, Camuzcuoglu A, Celik H & Aksoy N 2010 Decreased serum prolidase activity and increased oxidative stress in early pregnancy loss. Gynecologic and Obstetric Investigation 69 122–127. (https://doi.org/10.1159/000262608)
Vijayan V, Wagener FADTG & Immenschuh S 2018 The macrophage heme-heme oxygenase-1 system and its role in inflammation. Biochemical Pharmacology 153 159–167. (https://doi.org/10.1016/j.bcp.2018.02.010)
Watanabe S, Akagi R, Mori M, Tsuchiya T & Sassa S 2004 Marked developmental changes in heme oxygenase-1 (HO-1) expression in the mouse placenta: correlation between HO-1 expression and placental development. Placenta 25 387–395. (https://doi.org/10.1016/j.placenta.2003.10.012)
Wijayanti N, Katz N & Immenschuh S 2004 Biology of heme in health and disease. Current Medicinal Chemistry 11 981–986. (https://doi.org/10.2174/0929867043455521)
Zenclussen AC, Sollwedel A, Bertoja AZ, Gerlof K, Zenclussen ML, Woiciechowsky C & Volk HD 2005 Heme oxygenase as a therapeutic target in immunological pregnancy complications. International Immunopharmacology 5 41–51. (https://doi.org/10.1016/j.intimp.2004.09.011)
Zenclussen ML, Casalis PA, El-Mousleh T, Rebelo S, Langwisch S, Linzke N, Volk HD, Fest S, Soares MP & Zenclussen AC 2011 Haem oxygenase-1 dictates intrauterine fetal survival in mice via carbon monoxide. Journal of Pathology 225 293–304. (https://doi.org/10.1002/path.2946)
Zenclussen ML, Linzke N, Schumacher A, Fest S, Meyer N, Casalis PA & Zenclussen AC 2014 Heme oxygenase-1 is critically involved in placentation, spiral artery remodeling, and blood pressure regulation during murine pregnancy. Frontiers in Pharmacology 5 291. (https://doi.org/10.3389/fphar.2014.00291)
Zhu Y, Hon T & Zhang L 1999 Heme initiates changes in the expression of a wide array of genes during the early erythroid differentiation stage. Biochemical and Biophysical Research Communications 258 87–93. (https://doi.org/10.1006/bbrc.1999.0586)
