Abstract
Cytoplasmic polyadenylation element-binding protein 2 (CPEB2) is an mRNA-binding protein that regulates the cytoplasmic polyadenylation of mRNA and is required for tight junction (TJ) assembly in the trophectoderm epithelium during porcine preimplantation development. However, the regulatory mechanism underlying TJ assembly by CPEB2 has not been examined. The aim of this study was to elucidate how Cpeb2 regulates the subcellular localisation and stabilisation of Tjp1 mRNA for TJ biogenesis during mouse preimplantation. CPEB2 was detected in nuclei during the early stages of development and was localised at apical cell membranes from the morula stage onwards. In the Cpeb2 knockdown (KD), we observed reduced blastocyst formation with impaired TJs, defective inner cell mass development in the blastocyst outgrowth assay, and loss of pregnancy after embryo transfer. More importantly, Tjp1 mRNA was localised apically in the outer cells of control morulae but not in the Cpeb2 KD embryos, indicating that CPEB2 mediated the translocalisation of Tjp1 mRNA from the nuclei. Finally, in the control embryos, the length of the Tjp1 mRNA poly (A) tail was varied, while only a single peak was detected in the Cpeb2 KD embryos. These findings suggest that the binding of CPEB2 to the cytoplasmic polyadenylation element in the 3'-UTR can confer stability on Tjp1 mRNA and translational regulation. In summary, we demonstrated for the first time that CPEB2 mediates Tjp1 mRNA stabilisation and subcellular localisation for TJ assembly during mouse blastocyst formation.
Introduction
The most striking morphological feature during the early stages of embryonic development is the formation of a fluid-filled blastocyst consisting of two distinct cell lineages, the inner cell mass (ICM) and an outer trophectoderm (TE) epithelial layer. The fluid-filled cavity is formed as a consequence of ion gradients generated by trans-trophectoderm Na/K-ATPase and aquaporin water channels across the epithelium. The blastocoel cavity is maintained and expanded by tight junctions (TJs) that form a permeability seal between TE cells (Watson & Barcroft 2001, Cockburn & Rossant 2010).
Tight junctions contain tetra/single-span transmembrane cytoplasmic plaque and other TJ-associated cytoskeleton proteins (Balda & Matter 2008). Many studies have examined to identify genes involved in TJ biogenesis and to elucidate the regulatory mechanisms underlying the assembly of TJs (Eckert & Fleming 2008, González-Mariscal et al. 2014). Loss-of-function experiments, including knockout (KO) and knockdown (KD) approaches and selective inhibitor treatments, have demonstrated that TJ-associated transmembrane proteins (OCLN, CLDN4, CLDN6, and JAM1) and cytoplasmic adaptor proteins (PARD6B, TJP1, and TJP2) are required for blastocoel formation and expansion (Saitou et al. 2000, Moriwaki et al. 2007, Katsuno et al. 2008, Sheth et al. 2008, Alarcon 2010). Moreover, many TJ-associated genes are regulated by transcription factor AP-2 gamma (Tfap2c) during the morula-to-blastocyst transition in mouse and pig embryos (Choi et al. 2012, Lee et al. 2015). We also reported that CXADR and ADAM10 interact with other TJ components to establish TJ assembly during mouse and pig blastocyst formation (Kwon et al. 2016a,b, Jeong et al. 2019).
In particular, ZO-1 alpha plus (α+), an isoform of tight junction protein 1 (TJP1), assembles with other TJ-associated proteins such as RAB13 and PAR-3/PAR-6/aPKC complex at the apicolateral regions of compacted eight-cell embryos. Other peripheral membrane proteins, including cingulin and TJP2, assemble from the 16-cell to the morula stages. Finally, TJP1 alpha minus (α−) forms the TJ assembly and completes the TJ paracellular sealing in the mouse blastocyst (Eckert & Fleming 2008), indicating that TJP1 expression and subcellular localisation are important in the TJ biogenesis process.
A recent study detected cytoplasmic polyadenylation element-binding protein 2 (CPEB2), an mRNA-binding protein, during porcine preimplantation development. CPEB2 is localised to cell–cell contact sites from the morula stage onwards, and its depletion by dsRNA resulted in impaired TJ assembly without altered expression of TJ-associated genes such as TJP1, CXADR, and OCLN (Kwon et al. 2019). In particular, ZO-1 mRNA subcellular localisation mediated by CPEB is required for TJs assembly in mammary gland epithelial cells, kidney epithelial cells, and colorectal epithelial cells (Nagaoka et al. 2012). These findings suggest that CPEB2 affects mRNA stability or the subcellular localisation of TJP1, rather than its transcriptional expression regulating TJ-associated genes during the morula-to-blastocyst transition. However, the post-transcriptional regulation has not been elucidated. Here, we first examined Cpeb2 expression during mouse preimplantation development and its depletion effects on blastocyst formation and then investigated the post-transcriptional regulation of TJ assembly in terms of CPEB2-mediated Tjp1 mRNA stability and subcellular localisation.
Materials and methods
All animal studies were performed in accordance with the Institutional Animal Care and Use Committee guidelines of the Chungnam National University Animal Welfare and Ethical Review Body (license no. CNU-00702). All chemicals were purchased from Sigma–Aldrich unless otherwise stated.
Embryo culture, micromanipulation, and outgrowth assay
Embryo collection, culture, micromanipulation, and outgrowth were carried out as described previously (Jeong et al. 2019). Superovulation was induced in 68-week-old female mice (B6D2/F1; KOATECH, Pyeongtaek, Republic of Korea) via the i.p. injection of pregnant mare serum gonadotropin (5 IU) and human chorionic gonadotropin (5 IU) at an interval of 48 h, followed by mating with male mice (B6D2/F1). The resulting one-cell zygotes were retrieved from dissected oviducts in M2 medium and cultured in KSOM medium with one or two amino acids (EmbryoMax®; EMD Millipore) in mineral oil at 37°C under 5% O2, 5% CO2, and 90% N2. For KD experiments, 100 µM mouse Cpeb2 siRNA (siGENOME; Dharmacon) or 100 μM control non-target siRNA (Dharmacon) was injected into the cytoplasm of one-cell zygotes using a PLI-100A Pico-Injector (Harvard Apparatus, Holliston, MA, USA). The injected embryos were transferred to micro-drops of culture medium (20–30 embryos/drop) and incubated until they were required. For blastocyst outgrowth, the zona pellucidae of the embryos were removed with Tyrode acid, and tzona-free control (n = 15) and the KD (n = 15) blastocysts were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Life Technologies) supplemented with 15% foetal bovine serum (Gibco) and 1000 U/mL leukaemia inhibitory factor.
Quantification of gene expression using quantitative reverse transcription-polymerase chain reaction and poly tail assay
Pools of 10 embryos at 5 different stages (1-, 2-, and 4-cell, morula, and blastocyst) and pools of 20 control and Cpeb2 KD at the morula stage were placed in 10 μL of lysis buffer, respectively (PicoPure RNA isolation kit; Arcturus, Mountain View, CA, USA) and stored at −80°C. Total RNA was isolated from each pool of embryos using the PicoPure RNA isolation Kit, and cDNA was synthesised with SuperScript II reverse transcriptase (Invitrogen). Quantitative RT-PCR (qRT-PCR) was performed using a StepOne Plus real-time PCR system (Applied Biosystems) with gene-specific primers (Table 1). To determine the relative expression levels of target genes using the 2−∆∆Ct method, Ubtf was used as an endogenous control for an expression assay of control and KD embryos. To determine the expression patterns of Cpeb2, each sample was spiked with Gfp mRNA as an exogenous control before RNA isolation. The poly (A) tail length assay was performed using a USB® poly (A) tail length assay kit (Affymetrix, Inc) according to the manufacturer’s instructions. G/I tailing was performed with total RNA isolated from control and Cpeb2 KD morula embryos at 37°C for 60 min. Next, G/I-tailed RNA was reverse transcribed at 44°C for 60 min. Finally, three-step PCR amplification was performed with a programme of 40 cycles at 94°C for 10 s, 58°C for 30 s, and 72°C for 30 s using gene-specific primers (Table 1). The products were evaluated using a Qsep 100 Bio-Fragment Analyzer (BiOptic lnc., Taiwan). All experiments used at least three biological samples with two technical repeats.
Primers sequences for qRT-PCR.
| Gene | Forward sequences (5’–3’) | Reverse sequences (5’–3’) |
|---|---|---|
| Cpeb2 | CATTGGTGAAGGAAGGTGCT | GTAAGCCACATGCACCCTTT |
| Ocln | ACGTCGTGGACCGGTATC | AAAAACAGTGGTGGGGAAC |
| Tjp1 | TTTGGGCTGTGCATCTGA | TGCTTTATTGCTGCAGAGG |
| Pard6b | ACACCCTGATCAGGAAGAAGAA | ATGATGGATGACACGGGC |
| Ctnnb1 | GCAACCCTGAGGAAGAAGATG | CATCTAGCGTCTCAGGGAACAT |
| Cdh1 | GGATAGAGAAGCCATTGCCA | GATGGCAGCGTTGTAGGTGT |
| Pou5f1 | CTGGGCGTTCTCTTTGGA | AGCTGATTGGCGATGTGAGT |
| Cdx2 | GACTTCCTGTCCCTTCCCTCGTCT | CCTCCCGACTTCCCTTCACCATAC |
| Ubtf | CGCGCAGCATACAAAGAATACA | GTTTGGGCCTCGGAGCTT |
| GFP | AAGCTGACCCTGAAGTTCATCTGC | CTTGTAGTTGCCGTCGTCCTTGAA |
| Gapdh | AACAGCAACTCCCACTCTTC | Universal oligomer provided |
| Tjp1 | AGGGAGGGTCAAATGAAGA | Universal oligomer provided |
Immunocytochemistry and proximity ligation assay
Immunocytochemistry (ICC) and proximity ligation assays (PLA) were performed as described previously (Jeong et al. 2019). Briefly, embryos from the one-cell to the blastocyst stage were fixed in 3.7% paraformaldehyde (PFA), permeabilised with 0.1% Tween 20 in PBS, and incubated in blocking solution (0.1% BSA in PBS). The embryos were incubated with the anti-CPEB2 (Sigma–Aldrich HPA072513) and/or anti-TJP1 (ZO-1, Invitrogen #33-9100) primary antibody in blocking solution overnight at 4°C and then incubated with Alexa Fluor 488- and 594-labelled secondary antibodies (Molecular Probes; A32766, A11005). In vitro blastocyst outgrowth was treated with the anti-POU5F1 and anti-TFAP2C (Santa Cruz Biotechnology SC8977) primary antibodies, followed by Alexa Fluor 488- and 594-labelled secondary antibodies (Molecular Probes) for visualisation. For the PLA, late morula embryos were fixed and treated with a pair of primary antibodies, anti-CPEB2 and TJP1, and then incubated with PLA probes, followed by ligation and amplification according to the manufacturer’s instructions (Duolink® In situ Red Starter Kit; Sigma–Aldrich). The embryos were mounted in VECTASHIELD containing 4,DAPI (Vector Laboratories, Burlingame, CA, USA). Images were captured using a laser scanning confocal microscope (C2 plus; Nikon) and processed with NIS-Elements software (Nikon).
Fluorescein isothiocyanate–dextran uptake assay
To determine the effects of Cpeb2 depletion on TJ paracellular sealing, control (n = 60) and Cpeb2 KD (n = 46) blastocysts were incubated in culture medium supplemented with 4 kDa FITC–dextran (1 mg/mL) for 10 min. Following incubation, the embryos were immediately washed three times and placed in M2 medium to examine the diffusion of FITC–dextran into the blastocoel under an inverted epi-fluorescence microscope (Eclipse Ti-U, Nikon). To assess the accumulation of FITC–dextran for the permeability of TJs, the exposure time was adjusted to the fluorescence intensity (about 50 ms). We also checked the position of FITC in the bright-field mode to confirm its accumulation at cavities.
Embryo transfer
To determine the effects of Cpeb2 KD on implantation and pregnancy, and following the evaluation of permeability using FITC–dextran (Jeong & Choi 2019), control blastocysts (n = 10/uterus) were transferred to one uterine horn, and KD blastocysts (n = 10/uterus) were placed into the other horn of pseudopregnant recipients (8- to 10-week-old ICR mice; KOATECH) at 2.5 days post coitum. Three biological replicates were analysed for the control and KD groups. The body weight of the surrogates was measured after embryo transfer (ET) to assess the maintenance of pregnancy. The surrogate female mice were sacrificed when the body weight was reduced over 2 consecutive days.
RNA-fluorescence in situ hybridization assay
The RNA-fluorescence in situ hybridisation (FISH) assay was performed using a QuantiGene® ViewRNA FISH Cell Assay Kit (Affymetrix) according to the manufacturer’s instructions. Briefly, control- and Cpeb2 KD-compacted morula embryos were fixed in 4% PFA with 0.1% polyvinylpyrrolidone (PVP) for 20 min, washed in PBS containing 0.1% Triton X-100 and 0.1% PVP, and permeabilised with 1% Triton X-100 in PBS for 30 min. The embryos were then incubated for 10 min in detergent solution, followed by incubation for 5 min at room temperature with Q protease. After three washes, the treated embryos were incubated at 40°C for 3 h in a probe set (Tjp1)-containing solution for hybridisation. For signal amplification, sequential hybridisation with the pre-amplifier, amplifier, and fluorophore probes was performed at 40°C for 30 min each. Two different types of probe sets (TJP1-Alexa Fluor 546 and GAPDH-Alex Fluor 488) were used for co-hybridisation. Finally, the embryos were incubated for 15 min in RNase-free PBS with Hoechst and then carefully placed on glass slides for visualisation under a laser scanning confocal microscope (C2puls; Nikon).
Statistical analysis
The data were analysed using the Student’s t-test or ANOVA in GraphPad Prism (ver. 5.03; GraphPad Software) and are presented as the mean ± s.e.P-values <0.05 were considered to indicate significance unless otherwise stated.
Results
Effects of Cpeb2 depletion on mouse embryonic development
We first examined the expression patterns of mouse Cpeb2 during preimplantation development. In agreement with a previous porcine study (Kwon et al. 2019), we observed zygotic expression of Cpeb2 from the two-cell stage onwards and nuclear localisation of CPEB2 protein until the eight-cell stage. CPEB2 first showed up in the cytoplasm of eight-cell stage embryos, while CPEB2 was localised to the apical region of the outer cells in the morula and is clearly enriched at the cell–cell boundaries in the blastocyst (Fig. 1).
Expression patterns of mouse CPEB2 during preimplantation development. (A) Transcription levels of Cpeb2 were measured from the one-cell to the blastocyst stage. Expression levels were normalised to that of an exogenous control gene (Gfp). Different letters indicate statistically significant differences between groups, P < 0.05 (ANOVA). (B) Subcellular localisation of CPEB2 was analysed using immunocytochemistry. Merged images of confocal laser scanning microscope. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Expression patterns of mouse CPEB2 during preimplantation development. (A) Transcription levels of Cpeb2 were measured from the one-cell to the blastocyst stage. Expression levels were normalised to that of an exogenous control gene (Gfp). Different letters indicate statistically significant differences between groups, P < 0.05 (ANOVA). (B) Subcellular localisation of CPEB2 was analysed using immunocytochemistry. Merged images of confocal laser scanning microscope. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Expression patterns of mouse CPEB2 during preimplantation development. (A) Transcription levels of Cpeb2 were measured from the one-cell to the blastocyst stage. Expression levels were normalised to that of an exogenous control gene (Gfp). Different letters indicate statistically significant differences between groups, P < 0.05 (ANOVA). (B) Subcellular localisation of CPEB2 was analysed using immunocytochemistry. Merged images of confocal laser scanning microscope. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Next, we injected siRNA (100 μM) into one-cell zygotes to abolish Cpeb2 mRNA to investigate the effects of Cpeb2 KD on embryonic development. There were no differences in development between control and Cpeb2 KD embryos until the eight-cell stage, but the developmental competency of the KD embryos gradually decreased from the morula stage (93% vs 77%; Fig. 2A and B) and the arrested embryo did not reach the blastocyst in the extended culture, confirming the findings of a previous porcine study (Kwon et al. 2019). Interestingly, the qRT-PCR experiment using morula embryos showed that siRNA effectively depleted Cpeb2 mRNA (~90%) but did not alter the expression of other genes associated with compaction (Ctnnb1, Cdh1) or blastocyst formation (lineage-specific transcription factor Pou5fl and Cdx2; TJ components Ocln, Tjp1, and Pard6b) (Fig. 2C).
Effects of Cpeb2 knockdown (KD) on mouse embryonic development. (A) KD of Cpeb2 significantly reduced morula and blastocyst development. Different letters indicate statistically significant differences between groups. P < 0.05 (ANOVA). (B) Preimplantation development of control and Cpeb2 KD embryos. 8C-C8 (eight-cell to compacted eight-cell), Mo-EB (morula to early blastocyst) BL (blastocyst). (C) Transcriptional analysis of genes associated with blastocyst formation, including tight junctions (TJs) and cell lineage in Cpeb2 KD morula embryos. There were no alterations over two-fold. Data were normalised based on Ubtf and are reported as values relative to the control value. Scale bar = 100 μm. RQ, relative quantification. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effects of Cpeb2 knockdown (KD) on mouse embryonic development. (A) KD of Cpeb2 significantly reduced morula and blastocyst development. Different letters indicate statistically significant differences between groups. P < 0.05 (ANOVA). (B) Preimplantation development of control and Cpeb2 KD embryos. 8C-C8 (eight-cell to compacted eight-cell), Mo-EB (morula to early blastocyst) BL (blastocyst). (C) Transcriptional analysis of genes associated with blastocyst formation, including tight junctions (TJs) and cell lineage in Cpeb2 KD morula embryos. There were no alterations over two-fold. Data were normalised based on Ubtf and are reported as values relative to the control value. Scale bar = 100 μm. RQ, relative quantification. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effects of Cpeb2 knockdown (KD) on mouse embryonic development. (A) KD of Cpeb2 significantly reduced morula and blastocyst development. Different letters indicate statistically significant differences between groups. P < 0.05 (ANOVA). (B) Preimplantation development of control and Cpeb2 KD embryos. 8C-C8 (eight-cell to compacted eight-cell), Mo-EB (morula to early blastocyst) BL (blastocyst). (C) Transcriptional analysis of genes associated with blastocyst formation, including tight junctions (TJs) and cell lineage in Cpeb2 KD morula embryos. There were no alterations over two-fold. Data were normalised based on Ubtf and are reported as values relative to the control value. Scale bar = 100 μm. RQ, relative quantification. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Abolishing Cpeb2 leads to impaired TJ assembly via Tjp1
As reported in a porcine CPEB2 KD study (Kwon et al. 2019), Cpeb2 KD did not cause a significant change in TJ-associated gene expression, although the majority of mouse Cpeb2 KD embryos did not form a blastocoel. Next, we performed the blastocoel diffusion assay using FITC–dextran to examine the integrity of TJ assembly. The Cpeb2 KD blastocysts were more permeable to FITC–dextran diffusion than the control (52 ± 9% vs 13 ± 3%, Fig. 3A and B), suggesting that Cpeb2 KD may affect post-transcriptional or post-translational regulation of TJ-associated genes/proteins, subsequently leading to increased paracellular permeability. As demonstrated by the ICC assays, TJP1 was not seen clearly in the cell–cell contacts of the Cpeb2 KD late morula embryos. However, TJP1 and CPEB2 were co-localised in the apical region of outer cells in the control embryos (Fig. 3C). These findings support our assumption that the expression and localisation of Tjp1 mediated by CPEB2 are important for TJ assembly and integrity during preimplantation development.
Effect of Cpeb2 KD on TJs integrity. (A) Representative images of FITC–dextran diffusion into control and KD blastocysts. (B) Significant differences in FITC–dextran accumulation between the control and Cpeb2 KD blastocysts. *Statistically significant differences between groups. P < 0.05 (Student’s t-test), four biological replicates. (C) Aberrant subcellular expression of Tjp1 in Cpeb2 KD embryos in optically sectioned images. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effect of Cpeb2 KD on TJs integrity. (A) Representative images of FITC–dextran diffusion into control and KD blastocysts. (B) Significant differences in FITC–dextran accumulation between the control and Cpeb2 KD blastocysts. *Statistically significant differences between groups. P < 0.05 (Student’s t-test), four biological replicates. (C) Aberrant subcellular expression of Tjp1 in Cpeb2 KD embryos in optically sectioned images. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effect of Cpeb2 KD on TJs integrity. (A) Representative images of FITC–dextran diffusion into control and KD blastocysts. (B) Significant differences in FITC–dextran accumulation between the control and Cpeb2 KD blastocysts. *Statistically significant differences between groups. P < 0.05 (Student’s t-test), four biological replicates. (C) Aberrant subcellular expression of Tjp1 in Cpeb2 KD embryos in optically sectioned images. Scale bar = 50 μm. Error bars represent the mean ± s.e.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Impairment of TJ barrier integrity affects trophoblast development and embryonic lethality
Based on our previous studies in which the loss of genes involved in TJ assembly affected trophoblast development and the maintenance of pregnancy (Jeong & Choi 2019, Jeong et al. 2019), we assessed in vitro blastocyst outgrowth prior to in vivo ET. The adhesion rate was higher in the control (100%) than in Cpeb2 KD blastocysts (60%, P < 0.05). The ICM and TE areas were not clearly distinguishable in the KD group. Particularly, the ICM marker, POU5F1 (commonly known as OCT4) was not localised to a confined area in the KD group, although the trophoblast lineage-specific protein TFAP2C (also known as AP-2 gamma) was well expressed in the primary trophoblast giant cells (Fig. 4A). Next, to examine the effects of Cpeb2 KD on in vivo development, we transferred the control and Cpeb2 KD blastocysts into the left and right uterine horns, respectively, of pseudopregnant recipient mice. To assess the implantation outcomes and the maintenance of pregnancy, the recipients were weighed daily after ET, until the animals were sacrificed on day 9 after ET. No surrogate weight loss was observed in either group up to 7 days after ET. However, in uteri that received Cpeb2 KD blastocysts, we observed a decrease in viable fetuses (55 ± 7%) and a reduction in the isolated decidua weight (0.344 ± 0.002 g), compared to the uteri that received control blastocysts at 9 days after ET (75 ± 7% and 0.553 ± 0.02 g, respectively; Fig. 4B, C, D, and E).
Effects of Cpeb2 KD on blastocyst outgrowth and post-implantation development. (A) Representative images of control and Cpeb2 KD outgrowth. Zona-free control and Cpeb2KD blastocysts were cultured in an outgrowth medium. The TE-specific protein Tfap2C and the ICM-specific protein Pou5f1 were used for the evaluation of in vitro trophoblast development. (B) Representative images of a uterus from a sacrificed mouse into which control and Cpeb2 KD blastocysts were transferred. (C) Isolated decidua from the uterus (D). Decidua weights in control and Cpeb2 KD groups. (E) Maintenance of pregnancy at 9 days after embryo transfer. Control (n = 30) and Cpeb2 KD (n = 30) blastocysts were transferred into two uterine tubes of pseudopregnant mice. Maintenance of pregnancy was examined at 2 weeks after embryo transfer. *Statistically significant differences between groups. P < 0.05 (Student’s t-test).
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effects of Cpeb2 KD on blastocyst outgrowth and post-implantation development. (A) Representative images of control and Cpeb2 KD outgrowth. Zona-free control and Cpeb2KD blastocysts were cultured in an outgrowth medium. The TE-specific protein Tfap2C and the ICM-specific protein Pou5f1 were used for the evaluation of in vitro trophoblast development. (B) Representative images of a uterus from a sacrificed mouse into which control and Cpeb2 KD blastocysts were transferred. (C) Isolated decidua from the uterus (D). Decidua weights in control and Cpeb2 KD groups. (E) Maintenance of pregnancy at 9 days after embryo transfer. Control (n = 30) and Cpeb2 KD (n = 30) blastocysts were transferred into two uterine tubes of pseudopregnant mice. Maintenance of pregnancy was examined at 2 weeks after embryo transfer. *Statistically significant differences between groups. P < 0.05 (Student’s t-test).
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Effects of Cpeb2 KD on blastocyst outgrowth and post-implantation development. (A) Representative images of control and Cpeb2 KD outgrowth. Zona-free control and Cpeb2KD blastocysts were cultured in an outgrowth medium. The TE-specific protein Tfap2C and the ICM-specific protein Pou5f1 were used for the evaluation of in vitro trophoblast development. (B) Representative images of a uterus from a sacrificed mouse into which control and Cpeb2 KD blastocysts were transferred. (C) Isolated decidua from the uterus (D). Decidua weights in control and Cpeb2 KD groups. (E) Maintenance of pregnancy at 9 days after embryo transfer. Control (n = 30) and Cpeb2 KD (n = 30) blastocysts were transferred into two uterine tubes of pseudopregnant mice. Maintenance of pregnancy was examined at 2 weeks after embryo transfer. *Statistically significant differences between groups. P < 0.05 (Student’s t-test).
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
CPEB2 mediates the subcellular localisation of Tjp1 mRNA and affects its stability
Studies have demonstrated that CPEB depletion disrupts the apical localization of Tjp1 mRNA and TJ assembly in mammary epithelial cells and porcine TE cells (Nagaoka et al. 2012, Kwon et al. 2019). To determine whether the subcellular localisation of Tjp1 is mediated by interaction with CPEB2 in mouse embryos, we performed an RNA-FISH assay and PLA on morula embryos. We detected fluorescent signals of Tjp1 mRNA localised apically in the outer cells of the control morula. However, Cpeb2 KD embryos had strong signals in the nuclei but not at apical regions (Fig. 5A). As seen in Fig. 3B, two distinct continuous lines (CPEB2 and TJP1) were detected in the control but not in the KD embryos. Hence, we examined the interaction between CPEB2 and TJP1 using a PLA in terms of TJ assembly. We detected signals from the apical regions of the blastomeres, implying that CPEB2 interacts with TJ proteins for TJ assembly (Fig. 5B). Finally, we examined whether the binding of CPEB2 to the cytoplasmic polyadenylation element (CPE) in the 3'-UTR affects the stability of Tjp1 mRNA in morula embryos using the poly (A) tail length assay. There were no differences in poly(A) tail length/patterns of Gapdh mRNA between the control and Cpeb2 KD embryos. As seen in Fig. 5C, the tail lengths (amplicons) extended from 267 to about 500 bp including three major peaks at 267, 280, and 300 bp. By contrast, the poly (A) tailing patterns of Tjp1 differed. The length of the Tjp1 mRNA poly(A) tail varied from 281 to 378 bp (with a total of 11 different base-pair lengths) in the control embryos, while only a single peak was detected in the Cpeb2 KD embryos, suggesting that CPEB2 may confer stability on Tjp1 mRNA for translational regulation and apical localisation (Fig. 5C).
CPEB2 mediates the subcellular localisation and stability of Tjp1 mRNA. (A) Subcellular localisation of Cpeb2 mRNA of embryos using RNA-FISH. The white arrows indicate Tjp1 mRNA localisation at the apical region. Gapdh mRNA was used as a control. (B) Representative PLA images of control and Cpeb2 KD morula embryos. Red dots indicate that Cpeb2 interacts with Tjp1 at the cell–cell contact sites. Scale bar = 50 μm. An optically sectioned image was captured for RNA-FISH and PLA. (C) The poly (A) tail length assay. In the Cpeb2 KD embryos, only a single peak was detected, but the length of the Tjp1 mRNA poly (A) tail varied in the control embryos. Dashed boxes in lower panels represent the area of magnification in upper panels.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
CPEB2 mediates the subcellular localisation and stability of Tjp1 mRNA. (A) Subcellular localisation of Cpeb2 mRNA of embryos using RNA-FISH. The white arrows indicate Tjp1 mRNA localisation at the apical region. Gapdh mRNA was used as a control. (B) Representative PLA images of control and Cpeb2 KD morula embryos. Red dots indicate that Cpeb2 interacts with Tjp1 at the cell–cell contact sites. Scale bar = 50 μm. An optically sectioned image was captured for RNA-FISH and PLA. (C) The poly (A) tail length assay. In the Cpeb2 KD embryos, only a single peak was detected, but the length of the Tjp1 mRNA poly (A) tail varied in the control embryos. Dashed boxes in lower panels represent the area of magnification in upper panels.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
CPEB2 mediates the subcellular localisation and stability of Tjp1 mRNA. (A) Subcellular localisation of Cpeb2 mRNA of embryos using RNA-FISH. The white arrows indicate Tjp1 mRNA localisation at the apical region. Gapdh mRNA was used as a control. (B) Representative PLA images of control and Cpeb2 KD morula embryos. Red dots indicate that Cpeb2 interacts with Tjp1 at the cell–cell contact sites. Scale bar = 50 μm. An optically sectioned image was captured for RNA-FISH and PLA. (C) The poly (A) tail length assay. In the Cpeb2 KD embryos, only a single peak was detected, but the length of the Tjp1 mRNA poly (A) tail varied in the control embryos. Dashed boxes in lower panels represent the area of magnification in upper panels.
Citation: Reproduction 163, 4; 10.1530/REP-21-0227
Discussion
We confirmed the functional conservation of CPEB2 for TJ assembly during mouse blastocyst formation and showed the apical localisation of Tjp1mRNA via CPEB2. Furthermore, we used a mouse model to expand on previous porcine studies limited to preimplantation embryonic development. Specifically, the blastocyst outgrowth assay and ET showed that CPEB2 depletion affected peri/post-implantation development (Prochazkova et al. 2018, Kwon et al. 2019). Here, we demonstrated that the temporal and spatial expression patterns of CPEB2, as well as its biological role in TJ assembly, are conserved across mammalian species. In agreement with a porcine study by Kwon et al. (2019), we observed the upregulation of Cpeb2expression and translocation of CPEB2 into the apical region of blastomeres from morula stages. We also found retarded/delayed embryonic development, impaired TJ assembly, and no aberrant expression of genes associated with adherens junctions/TJs in Cpeb2 KD embryos during the morula-to-blastocyst transition.
Previous studies reported that mouse blastocyst embryos with incomplete TJ barrier integrity exhibited improper trophoblast development and that miscarriage occurred in the second trimester after embryo transfer (Jeong & Choi 2019, Jeong et al. 2019); we postulated that Cpeb2 KD affects the maintenance of pregnancy and fetal development via incomplete TJ assembly. Our observation of abnormal expression of an ICM marker (POU5F1) in the blastocyst outgrowth assay and relatively small Cpeb2 KD decidua retrieved from sacrificed recipient surrogates suggested that the failure of embryonic development is due to defective ICM outgrowth (Dodge et al. 2004, Yuan et al. 2009).
Based on ICC of late morula embryos in which TJP1 and CPEB2 were co-localised at cell–cell boundaries (Fig. 3C), we performed in situ PLA as an alternative to co-immunoprecipitation due to limited cell numbers (Fredriksson et al. 2002) and found close interactions between TJP1 and CPEB2 during TJ assembly (Fig. 5B). These results suggest that CPEB2 is necessary for the establishment of TJs assembly.
More importantly, CPEB is reported to be essential for the polarity of mammalian epithelial cells via the binding of Tjp1 mRNA (Nagaoka et al. 2012). We demonstrated CPEB2-mediated Tjp1 mRNA localisation to the apicolateral regions of cell–cell contact of late morula embryos using RNA-FISH assays (Eckert & Fleming 2008), which indicates that CPEB2 binds to CPE in the 3’-UTR of Tjp1 and transfers the transcripts to the cytoplasm (Richter 2007, Nagaoka et al. 2012). Tjp1 transcript levels were not altered in the Cpeb2 KD embryos, and their proteins were not enriched at the cell–cell contacts, indicating that Cpeb2 affects post-transcriptional regulation and the subcellular localisation of TJP1.
Our findings suggest that CPEB2 mediates poly(A) tail stabilisation and the translational regulation of Tjp1. In other words, the CPE of nuclear Tjp1 pre-mRNA binds to CPEB2, and the transcript is then stabilized during the RNA processing. Here, we used poly(A) tailing and fragment analysis using capillary electrophoresis rather than conventional gel electrophoresis due to the small amount of transcripts with poly(A) tails after PCR and the sensitivity of gel images. We used Gapdh as a control because it is not affected by CPEB2. The multiple peaks of Tjp1 in the control imply that CPEB2 binds to Tjp1 mRNA and confers stabilisation on the transcript. Moreover, the relatively high level of relative fluorescence units in the control Tjp1 mRNA poly (A) tailing assay supports our previous findings of reduced relative levels of TJP1 transcripts bearing the 3'-UTR were noted because the region might be not protected and is easily degraded without CPEB2 in pig morula embryos. In this context, Tjp1 mRNA can be properly translated and assembled into TJs during the transition from the morula to the blastocyst stage in the presence of CPEB2.
In summary, we demonstrated that the biological function of CPEB2 is conserved during preimplantation development and that the depletion of CPEB2 impairs TJ assembly and reduces the developmental competency of mouse embryos during the preimplantation period. We also found defective outgrowth of the Cpeb2 KD blastocyst and miscarriages in surrogates receiving the KD blastocysts. More importantly, the results from the RNA-FISH and poly(A) tail length assays provide insight into the post-transcriptional regulation of Tjp1 mRNA mediated by CPEB2 in TJ biogenesis during early embryonic development.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by grants to I C from the National Research Foundation of Korea funded by the Ministry of Education (NRF-2019R1D1A3A03017765).
Author contribution statement
I C conceived and designed the study. Y J and S L performed animal and molecular experiments. I C prepared the manuscript with input from co-authors. All authors read and approved the final manuscript.
References
Alarcon VB 2010 Cell polarity regulator PARD6B is essential for trophectoderm formation in the preimplantation mouse Embryo1. Biology of Reproduction 83 347–358. (https://doi.org/10.1095/biolreprod.110.084400)
Balda MS & Matter K 2008 Tight junctions at a glance. Journal of Cell Science 121 3677–3682. (https://doi.org/10.1242/jcs.023887)
Choi I, Carey TS, Wilson CA & Knott JG 2012 Transcription factor AP-2γ is a core regulator of tight junction biogenesis and cavity formation during mouse early embryogenesis. Development 139 4623–4632. (https://doi.org/10.1242/dev.086645)
Cockburn K & Rossant J 2010 Making the blastocyst: lessons from the mouse. Journal of Clinical Investigation 120 995–1003. (https://doi.org/10.1172/JCI41229)
Dodge JE, Kang YK, Beppu H, Lei H & Li E 2004 Histone H3-K9 methyltransferase ESET is essential for early development. Molecular and Cellular Biology 24 2478–2486. (https://doi.org/10.1128/MCB.24.6.2478-2486.2004)
Eckert JJ & Fleming TP 2008 Tight junction biogenesis during early development. Biochimica et Biophysica Acta 1778 717–728. (https://doi.org/10.1016/j.bbamem.2007.09.031)
Fredriksson S, Gullberg M, Jarvius J, Olsson C, Pietras K, Gústafsdóttir SM, Østman A & Landegren U 2002 Protein detection using proximity-dependent DNA ligation assays. Nature Biotechnology 20 473–477. (https://doi.org/10.1038/nbt0502-473)
González-Mariscal L, Domínguez-Calderón A, Raya-Sandino A, Ortega-Olvera JM, Vargas-Sierra O & Martínez-Revollar G 2014 Tight junctions and the regulation of gene expression. Seminars in Cell and Developmental Biology 36 213–223. (https://doi.org/10.1016/j.semcdb.2014.08.009)
Jeong Y & Choi I 2019 Tight junction assembly ensures maintenance of pregnancy during embryogenesis in a mouse model. Journal of Animal Reproduction and Biotechnology 34 318–321. (https://doi.org/10.12750/JARB.34.4.318)
Jeong Y, Ock SA, Yoo JG, Yu DY & Choi I 2019 The Cxadr–Adam10 complex plays pivotal roles in tight junction integrity and early trophoblast development in mice. Molecular Reproduction and Development 86 1628–1638. (https://doi.org/10.1002/mrd.23250)
Katsuno T, Umeda K, Matsui T, Hata M, Tamura A, Itoh M, Takeuchi K, Fujimori T, Nabeshima Y & Noda T et al.2008 Deficiency of zonula occludens-1 causes embryonic lethal phenotype associated with defected yolk sac angiogenesis and apoptosis of embryonic cells. Molecular Biology of the Cell 19 2465–2475. (https://doi.org/10.1091/mbc.e07-12-1215)
Kwon J, Jeong SM, Choi I & Kim NH 2016a ADAM10 is involved in cell junction assembly in early porcine embryo development. PLoS ONE 11 e0152921. (https://doi.org/10.1371/journal.pone.0152921)
Kwon JW, Kim NH & Choi I 2016b CXADR is required for AJ and TJ assembly during porcine blastocyst formation. Reproduction 151 297–304. (https://doi.org/10.1530/REP-15-0397)
Kwon J, Park S, Seong MJ, Choi I & Kim NH 2019 Cytoplasmic polyadenylation element binding protein 2 (CPEB2) is required for tight-junction assembly for establishment of porcine trophectoderm epithelium. Reproduction, Fertility, and Development 31 412–419. (https://doi.org/10.1071/RD18098)
Lee SH, Kwon JW, Choi I & Kim NH 2015 Expression and function of transcription factor AP-2γ in early embryonic development of porcine parthenotes. Reproduction, Fertility, and Development 28 1197–1205. (https://doi.org/10.1071/RD14198)
Moriwaki K, Tsukita S & Furuse M 2007 Tight junctions containing claudin 4 and 6 are essential for blastocyst formation in preimplantation mouse embryos. Developmental Biology 312 509–522. (https://doi.org/10.1016/j.ydbio.2007.09.049)
Nagaoka K, Udagawa T & Richter JD 2012 CPEB-mediated ZO-1 mRNA localization is required for epithelial tight-junction assembly and cell polarity. Nature Communications 3 675. (https://doi.org/10.1038/ncomms1678)
Prochazkova B, Komrskova P & Kubelka M 2018 CPEB2 is necessary for proper porcine meiotic maturation and embryonic development. International Journal of Molecular Sciences 19 3138. (https://doi.org/10.3390/ijms19103138)
Richter JD 2007 CPEB: a life in translation. Trends in Biochemical Sciences 32 279–285. (https://doi.org/10.1016/j.tibs.2007.04.004)
Saitou M, Furuse M, Sasaki H, Schulzke JD, Fromm M, Takano H, Noda T & Tsukita S 2000 Complex phenotype of mice lacking occludin, a component of tight junction strands. Molecular Biology of the Cell 11 4131–4142. (https://doi.org/10.1091/mbc.11.12.4131)
Sheth B, Nowak RL, Anderson R, Kwong WY, Papenbrock T & Fleming TP 2008 Tight junction protein ZO-2 expression and relative function of ZO-1 and ZO-2 during mouse blastocyst formation. Experimental Cell Research 314 3356–3368. (https://doi.org/10.1016/j.yexcr.2008.08.021)
Watson AJ & Barcroft LC 2001 Regulation of blastocyst formation. Frontiers in Bioscience 6 D708–D730. (https://doi.org/10.2741/watson)
Yuan P, Han J, Guo G, Orlov YL, Huss M, Loh YH, Yaw LP, Robson P, Lim B & Ng HH 2009 Eset partners with Oct4 to restrict extraembryonic trophoblast lineage potential in embryonic stem cells. Genes and Development 23 2507–2520. (https://doi.org/10.1101/gad.1831909)
