Abstract
Desert hedgehog (DHH) signaling has been reported to be involved in spermatogenesis and the self-renewal of spermatogonial stem cells (SSCs). However, the role of DHH in proliferation of spermatogonia including SSCs remains to be elucidated. Here, we report that Dhh from medaka (Oryizas latipes) (named as OlDhh) could directly mediate the proliferation of spermatogonia via Smoothened (Smo) signaling. Oldhh is 1362 bp in length and encodes 453 amino acid (aa) residues with more than 50% identity with the homologs in other species. It has expression predominantly restricted to testis. The soluble and tag-free 176-aa mature OlDhh (named as mOlDhh) were successfully obtained by fusing with the N-terminal tag of cleavable 6-histidine and small ubiquitin-related modifier and then removing the tag. Notably, mOlDhh significantly promoted the proliferation of SG3 (a spermatogonial stem cell line from medaka testis) in a dose-dependent manner and spermatogonia in testicular organ culture. Furthermore, the proliferation of SG3 in the presence of mOlDhh could be inhibited by Smo antagonist (cyclopamine) resulting in apoptosis. Additionally, mOlDhh significantly upregulated the expression of smo as well as the pluripotent-related genes bcl6b and sall4. These data suggest that Smo is an indispensable downstream component in the Dhh signaling pathway. In conclusion, our findings unambiguously demonstrate that Dhh could directly mediate the proliferation of spermatogonia through Smo signaling. This study provides new knowledge about the proliferation regulation of spermatogonia.
Introduction
Spermatogonia are classified initially into undifferentiated spermatogonia and differentiated spermatogonia. Spermatogonial stem cells (SSCs) are undifferentiated spermatogonia which sustain fertility throughout adulthood with the ability of self-renewal and potential differentiation into spermatozoa (Tan & Wilkinson 2019, Ishikura et al. 2021). Proliferation of spermatogonia is important not only for the highly organized process of spermatogenesis but also for the self-renewal of SSCs (Yoshida 2008, Oatley & Brinster 2012). A large number of studies show that hedgehog (HH) is crucial in embryogenesis, organ development and stem cell maintenance (Huycke et al. 2019, Delgado et al. 2020, Gu et al. 2021, Paredes et al. 2021, Vercauteren Drubbel et al. 2021). In vertebrates, there are three HH homologs, that is, sonic hedgehog (SHH), Indian hedgehog (IHH) and desert hedgehog (DHH) (Chuang & McMahon 1999). The current studies mainly focus on SHH and IHH (Hopyan et al. 2002, Fuccillo et al. 2006, Bénazet et al. 2009, Büller et al. 2012), little is known about DHH, especially its roles in spermatogonia.
DHH is predominantly expressed in testis (Carpenter et al. 1998). In mice, DHH expression occurs in testis from 11.5 days post coitum to adulthood (Bitgood et al. 1996, Szczepny et al. 2006). DHH null male mice display a range of testicular defects, such as impaired Leydig cell development, disorganized Sertoli cells and arrested spermatogenesis (Bitgood et al. 1996, Clark et al. 2000). Furthermore, DHH signaling in Sertoli cells promotes the expression of glial cell-derived neurotrophic factor (GDNF) and bone morphogenetic protein (BMP), and then these factors indirectly regulate the self-renewal of SSCs (Meng et al. 2000, Inaba et al. 2016). In irradiated adult rat testes, SSCs express DHH signaling components such as DHH, PATCH (PTCH) 2 and glioma-associated oncogene homolog 1 (GLI1), and this expression disappeared after inducing SSCs differentiation, implying the potential for an autocrine DHH signaling loop to sustain the self-renewal of SSCs (Mäkelä et al. 2011, Sahin et al. 2014). In human, accumulative cases suggest that genetic variants in DHH cause 46, XY partial or complete gonadal dysgenesis with Leydig cell hypoplasia, streak gonads and gonadal cancer (Umehara et al. 2000, Werner et al. 2015). Taken together, these results suggest that DHH signaling is critical for spermatogenesis and may be involved in the self-renewal of SSCs. However, the role of DHH in proliferation of spermatogonia remains to be elucidated.
Medaka (Oryizas latipes) is an excellent fish model in germ cell research (Yi et al. 2009). Importantly, a spermatogonial stem cell line (SG3) derived from medaka mature testis has been successfully established in a feeder-free culture condition (Hong et al. 2004). It has the ability of stable and growth factor-dependent proliferation, and sperm production in culture, which is considered as an intrinsic property of SSCs (Hong et al. 2004). In this study, the Dhh homolog from medaka (named as OlDhh) was identified. Its effect on the proliferation of spermatogonia was investigated. Our study firstly suggests that Dhh can mediate the proliferation of spermatogonia through Smo signaling.
Materials and methods
Animals
Medakas were kept in recirculating freshwater tanks at 26°C under an artificial photoperiod of 12 h light:12 h darkness. Animal experiments were conducted in accordance with the regulations of the Guide for Care and Use of Laboratory Animals and were approved by the Committee of Laboratory Animal Experimentation at Southwest University (IACUC No. 20181015-12).
Complementary DNA (cDNA) cloning and reverse transcription-polymerase chain reaction (RT-PCR)
Total RNAs were extracted from adult medaka tissues and SG3 using RNAiso Plus (Takara, Japan) according to the manufacturer’s instructions. The quality of total RNAs was analyzed by agarose gel electrophoresis and optical density values at 260 and 280 nm. Subsequently, extracted RNAs were reverse transcribed into cDNAs using the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara). PCR primers specific for the open reading frame (ORF) of Oldhh were designed (Table 1). The PCR product was subjected to agarose gel electrophoresis separation, subcloning and sequencing verification. actinb was served as a loading control.
The information of the primers used in this study.
| Name | Forward primer (5’ → 3’) | Reverse primer (5’ → 3’) |
|---|---|---|
| Oldhh-1 | ATGAAGCAGTTCTGTTGGGC | TTAAGGATAGAATAAATTGG |
| Oldhh-2 | CCGCCTCATGACTAAGCGAT | TGCAACTGAAACCGAGACGA |
| Olptch1 | ACCACACAGGTTCTCCCCTT | ACCACACAGGTTCTCCCCTT |
| Olptch2 | GATACTTGCTCATGCTGGCCTA | GAAGGGAAGCACCTGTGTGG |
| Olsmo | GAGCCCTCATCCTCGGAAAC | CCGACAAAGCAGATCCCACT |
| Olgli1 | CTCTCATGGTTCAGGCCAGG | CTGGCAGAAGTTGTGATGCG |
| Olgli2 | AAGGACTGAGGCCATCCTCT | TTGGTTTCGTAGACCGCCTC |
| Olgli3 | GAGGGTGGAGACCATTGTGG | CTCCTCCTCTGCGTTTGAGG |
| Olbcl6b | AGCTCAGTTCAACCGACCAG | AGGTGGGCAACCTGAACAAA |
| Olsall4 | AGCACATCAACTCCGACGAG | TCGTCAAAGAACTCGGCACA |
| Olactinb | GGCATCACACCTTCTACAACGA | ACGCTCTGTCAGGATCTTCA |
Sequence analyses
OlDhh structure analysis was done using the PredictProtein program (www.predictprotein.org). The multiple sequence alignment was performed using the GENEDOC program. The identity between OlDhh and the homologs from the other indicated species was analyzed using BLAST Browser (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The phylogenetic tree was constructed using a neighbor-joining algorithm within MEGA 7.0. The chromosome synteny was performed using Ensembl Genome Browser (www.ensembl.org).
Production of the mature OlDhh (mOlDhh)
In mammals, the HH ligands are synthesized as precursors, which undergo a proteolytic process followed by lipid modifications of the N-terminal fragment (Mann & Beachy 2004). Moreover, the HH ligands can also be biologically active by linking hydrophobic group such as two isoleucine (Ile) residues at the N-terminus of Hh (Martinez-Chinchilla & Riobo 2008). In the present study, the N-terminal fragment (the 27-202 region) of OlDhh with two additional Ile residues (named as mOlDhh hereafter) was produced by Nanjing Mingyan Biotechnology Co. Ltd (Nanjing, China). Briefly, the cDNA sequence of mOldhh by fusing with a cleavable Histidine-small ubiquitin-related modification (His-SUMO) tag was inserted into the prokaryotic expression vector pCold II. Through optimization of the expression conditions, the recombinant His-SUMO-mOlDhh protein was induced to express by isopropyl b-D-1-thiogalactopyranoside (IPTG) and purified by Ni-NTA affinity chromatography, then removing of the His-SUMO tag. The soluble and tag-free mOlDhh was obtained and detected by sodium dodecyl sulfate–PAGE (SDS-PAGE) and Western blot. In brief, the mOlDhh was resolved by SDS-PAGE on 12% Tris·glycine gels and then detected by Coomassie blue staining following the manufacturer's instructions (Sigma-Aldrich). Western blot was performed following the protocol previously reported using anti-His tag antibody (Cell Signaling Technology) at a dilution of 1:1000 (Dai et al. 2021). Signal was detected with Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific) and was visualized on a Fusion FX7 (Vilber Lourmat).
Cell culture
SG3 was cultured in ESM4 medium as previously described (Hong et al. 2004, Zhao et al. 2018). ESM4 medium is based on DMEM medium plus 20 mM Hepes, 100 U/mL penstrip (penicillin and streptomycin), 2 mM l-glutamine, 1 mM sodium pyruvate, 2 μM Na-selenite, 1 mM nonessential amino acids, 50 μM 2-mercaptoethanol, 10 ng/mL human recombinant basic fibroblast growth factor (R&D), medaka embryo extract (0.4 embryo/mL), 15% fetal bovine serum and 0.2% rainbow trout serum. To test the bioactivity of mOlDhh, SG3 was incubated in 5N medium containing different concentrations of mOlDhh. The 5N medium is ESM4 deprivation of bFGF, medaka embryo extract and rainbow trout serum.
RNA in situ hybridization (ISH)
RNA ISH experiment was performed as previously described (Xu et al. 2014). The 4-month-old medaka testes were fixed in 4% paraformaldehyde (Sigma-Aldrich). The 670 bp Oldhh cDNA sequence and its reverse complementary sequence containing T7 promoter were firstly amplified (Table 1) and sequenced; then the sense and anti-sense probes of Oldhh were synthesized using the digoxigenin (DIG) RNA Labeling Kit (Roche) and T7 mMESSAGE mMACHINE Kit (Ambion). Chromogenic ISH was done with BCIP/NBT substrates (Roche).
MTS cell viability assay
The MTS assay was used to quantitatively assess cell proliferation activity. Briefly, SG3 (approximately 5000 cells/well) were seeded in gelatin-coated 96-well plates with 5N medium containing different concentrations of mOlDhh (0, 0.04, 0.2 and 1 μM), which were repeated three times in each group. At the indicated time, MTS solution (Promega) was added to each well and the cells were incubated for 4 h at 28°C. Absorbance of each sample at 490 nm was measured with a microplate reader (Thermo Labsystems, Vantaa, Finland). The proliferative activity of each sample is indicated by its relative absorbance value, which is the ratio (the absorbance value at 490 nm) at the indicated time/(the absorbance value at 490 nm) at 0 h. Each experiment was repeated at least three times.
EdU labeling and TUNEL staining
To investigate the role of Smo in the mOlDhh-mediated proliferation activity of SG3, cyclopamine, the antagonist of Smo, was added in the presence of mOlDhh. After 48 h incubation, the proliferative activity and apoptosis of the cells were measured by EdU (5-ethynyl-2-deoxyuridine) labeling kit (RIBOBIO, Guangzhou, China) and the One Step TUNEL Apoptosis Assay Kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions, respectively. The fluorescence signals were observed under Nikon Ti–S inverted fluorescence microscope.
Testicular organ culture, EdU labeling and immunofluorescence (IF)
The testis of each adult medaka was dissected and divided into two parts, one for the experimental group and the other as the control. The testicular tissues were cultured in 48-well plate and incubated in 5N medium containing 0 or 1 μM mOlDhh, respectively. After incubation for 48 h, 10 μM EdU was added to each well and continued to culture for 24 h. The proliferation activity was determined by EdU incorporation assay combined with IF staining of Vasa as previously described (Jiang et al. 2017). The fluorescence signals were observed using a confocal microscope (Fv3000, Olympus).
Real-time PCR
The SG3 cells were incubated in 5N medium containing 1 μM mOlDhh without or with 15 μM cyclopamine, respectively. The control group was treated with the same dose of solvent (DMSO). After 48 h incubation, the cells were collected and the mRNA expression levels of the canonical hedgehog components smo, gli1, gli2 and gli3 and the pluripotent related genes bcl6b and sall4were detected by real-time PCR. All of the primer sets were gene-specific and intron-spanning (Table 1). Real-time PCR was performed on ABI-7500 Real-time PCR machine (Applied Biosystems). The relative mRNA expression levels of the related genes were calculated using the 2−∆∆CTmethod.
Statistical analyses
All data were presented as the mean ± s.d. The statistical analyses were performed with Student's t-test for the comparison between two groups. P< 0.05 or P< 0.01 is considered as significant or very significant difference from the control, respectively.
Results
Sequence analyses
The Oldhh ORF containing 1362 bp (GenBank accession number 105354368) was obtained by RT-PCR and verified by sequencing (Supplementary Fig. 1, see section on supplementary materials given at the end of this article). The putative OlDhh protein has 453 amino acid (aa) residues and exhibits similar features of the homologs in mammals, including the signal peptide, N-terminal hedge domain, C-terminal hog domain and a completely conserved autocatalytic site of GLy-Cys-Phe tripeptide (Supplementary Fig. 1). Multiple sequence alignment among the representative tetrapods, zebrafish and medaka reveals that the N-terminal hedge domain which is the biological fragment of Dhh after autocatalysis at the autocatalytic site of this protein is highly conserved (Fig. 1A). OlDhh shares over 50% identity to its homologs from the indicated species, and the N-terminal hedge domain over 69% (Fig. 1A). On the phylogenetic tree, OlDhh was clustered with the homologs from zebrafish, chicken, mouse and human to form a subclade with 100% confidence, which is distinct from the subclades of the two other Hh family members in vertebrates (Fig. 1B). Chromosome synteny analysis indicates that the dhh-containing chromosome 7 in medaka has good synteny to zebrafish dhh-containing chromosome 23 and human DHH-containing chromosome 12 (Fig. 1C). Taken together, these data suggest that OlDhh is orthologous to mammalian DHH.
OlDhh sequence analyses. (A) DHH amino acid sequence alignment. Amino acids are numbered in the right margin. Deletions are indicated by dashes, shaded areas indicate shared sequences. The amino-terminal hedge domain is underlined by dotted line, followed closely by the autocatalytic carboxy-terminal hog domain. The box indicates the autocatalytic site of an absolutely conserved Gly-Cys-Phe tripeptide. At the end of the alignment are percentage identity values of the full-length and hedge domain of OlDhh to the ortholog from the other species. (B) Phylogenetic tree. The tree was constructed using the neighbor-joining method within the MEGA7.0 program. Node values represent percent bootstrap confidence derived from 1000 replicates. (C) Chromosomal synteny. Human, Homo sapiens, NP_066382; mouse, Mus musculus, NP_031883; chicken, Gallus gallus, XP_040549955; zebrafish, Danio rerio, NP_001025286; medaka, Oryzias latipes, XP_020560311.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
OlDhh sequence analyses. (A) DHH amino acid sequence alignment. Amino acids are numbered in the right margin. Deletions are indicated by dashes, shaded areas indicate shared sequences. The amino-terminal hedge domain is underlined by dotted line, followed closely by the autocatalytic carboxy-terminal hog domain. The box indicates the autocatalytic site of an absolutely conserved Gly-Cys-Phe tripeptide. At the end of the alignment are percentage identity values of the full-length and hedge domain of OlDhh to the ortholog from the other species. (B) Phylogenetic tree. The tree was constructed using the neighbor-joining method within the MEGA7.0 program. Node values represent percent bootstrap confidence derived from 1000 replicates. (C) Chromosomal synteny. Human, Homo sapiens, NP_066382; mouse, Mus musculus, NP_031883; chicken, Gallus gallus, XP_040549955; zebrafish, Danio rerio, NP_001025286; medaka, Oryzias latipes, XP_020560311.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
OlDhh sequence analyses. (A) DHH amino acid sequence alignment. Amino acids are numbered in the right margin. Deletions are indicated by dashes, shaded areas indicate shared sequences. The amino-terminal hedge domain is underlined by dotted line, followed closely by the autocatalytic carboxy-terminal hog domain. The box indicates the autocatalytic site of an absolutely conserved Gly-Cys-Phe tripeptide. At the end of the alignment are percentage identity values of the full-length and hedge domain of OlDhh to the ortholog from the other species. (B) Phylogenetic tree. The tree was constructed using the neighbor-joining method within the MEGA7.0 program. Node values represent percent bootstrap confidence derived from 1000 replicates. (C) Chromosomal synteny. Human, Homo sapiens, NP_066382; mouse, Mus musculus, NP_031883; chicken, Gallus gallus, XP_040549955; zebrafish, Danio rerio, NP_001025286; medaka, Oryzias latipes, XP_020560311.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
The mRNA expression profile of Oldhh
The mRNA expression profile of Oldhh at different adult tissues was detected by RT-PCR. The results indicated that Oldhh had high expression in adult testis, whilst extremely low or no expression in the other tissues including brain, eye, gill, heart, intestine, liver and ovary (Fig. 2A). In testicular sections, obvious positive signals were observed in the spermatogonia and spermatocytes by ISH, whereas no signal in mature spermatids and sperms as well as in the control (Fig. 2B).
The mRNA expression profile of Oldhh. (A) In adult medaka tissues by RT-PCR. actinb was used as an internal control. Numbers in parenthesis indicate the cycles of PCR. (B) The cellular localization of Oldhh in 4-month-old medaka testes by ISH with the sense (a) and antisense (b) RNA probes. b2’ and b2’’ are magnification images of the solid and dotted boxed regions in b2. sg, spermatogonia; sc, spermatocyte. Scale bars: 25 μm.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
The mRNA expression profile of Oldhh. (A) In adult medaka tissues by RT-PCR. actinb was used as an internal control. Numbers in parenthesis indicate the cycles of PCR. (B) The cellular localization of Oldhh in 4-month-old medaka testes by ISH with the sense (a) and antisense (b) RNA probes. b2’ and b2’’ are magnification images of the solid and dotted boxed regions in b2. sg, spermatogonia; sc, spermatocyte. Scale bars: 25 μm.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
The mRNA expression profile of Oldhh. (A) In adult medaka tissues by RT-PCR. actinb was used as an internal control. Numbers in parenthesis indicate the cycles of PCR. (B) The cellular localization of Oldhh in 4-month-old medaka testes by ISH with the sense (a) and antisense (b) RNA probes. b2’ and b2’’ are magnification images of the solid and dotted boxed regions in b2. sg, spermatogonia; sc, spermatocyte. Scale bars: 25 μm.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
The recombinant protein production
The cDNA sequence of mOldhh by fusing with a His-SUMO tag was successfully inserted into the prokaryotic expression vector pCold II (Fig. 3A). Through induced expression at 16°C and Ni-NTA affinity chromatography, soluble mOlDhh protein with the His-SUMO tag was obtained with the predicted size ~32.6 kDa (Fig. 3B). Then the tag-free mOldhh protein with the predicted size ~20 kDa and over 90% purity was successfully obtained through removal of the His-SUMO tag by ULP1 digestion (Fig. 3C).
Production of the mature OlDhh (mOlDhh). (A) Schematic diagram of the prokaryotic expression vector construction of mOlDhh and protein purification. (B and C) SDS-PAGE and Western blot analyses of mOlDhh. Lane M1, SDS-PAGE marker; lane M2, Western blot marker; lane 1, purified soluble recombinant protein (His-SUMO-mOlDhh, 1.50 μg, arrows); lane 2, BSA (1.50 μg); lane 3, purified soluble tag-free protein (mOlDhh, 1.50 μg, arrowhead); lane 4, BSA (2.0 μg). The primary antibody used in Western blot was anti-His antibody.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Production of the mature OlDhh (mOlDhh). (A) Schematic diagram of the prokaryotic expression vector construction of mOlDhh and protein purification. (B and C) SDS-PAGE and Western blot analyses of mOlDhh. Lane M1, SDS-PAGE marker; lane M2, Western blot marker; lane 1, purified soluble recombinant protein (His-SUMO-mOlDhh, 1.50 μg, arrows); lane 2, BSA (1.50 μg); lane 3, purified soluble tag-free protein (mOlDhh, 1.50 μg, arrowhead); lane 4, BSA (2.0 μg). The primary antibody used in Western blot was anti-His antibody.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Production of the mature OlDhh (mOlDhh). (A) Schematic diagram of the prokaryotic expression vector construction of mOlDhh and protein purification. (B and C) SDS-PAGE and Western blot analyses of mOlDhh. Lane M1, SDS-PAGE marker; lane M2, Western blot marker; lane 1, purified soluble recombinant protein (His-SUMO-mOlDhh, 1.50 μg, arrows); lane 2, BSA (1.50 μg); lane 3, purified soluble tag-free protein (mOlDhh, 1.50 μg, arrowhead); lane 4, BSA (2.0 μg). The primary antibody used in Western blot was anti-His antibody.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances proliferation of spermatogonia
To determine whether mOlDhh has a significant effect on the proliferation activity of SG3, the viability of the cells incubated in 5N medium containing no (the control) or different concentrations of mOlDhh (0.04, 0.2 and 1 μM) was measured by optical observation and MTS assay. After 24 h incubation, the mitotic activity of SG3 in 5N medium containing mOlDhh was significantly higher than that of the control group in a dose-dependent manner (Fig. 4A). This phenomenon was more evident after 48 h incubation (Fig. 4A). The mitotic activity of SG3 was further evaluated by MTS assay. It exhibited significant (P< 0.05) or very significant (P< 0.01) mitotic activity in 5N medium containing mOlDhh compared with the control after 48 h incubation (Fig. 4B). These data suggest that mOlDhh significantly promoted SG3 proliferation.
mOlDhh enhances the proliferation of SG3. (A) Phenotype of SG3 cells treated with 5N medium containing no (control) or different concentrations (0.04, 0.2 and 1 μM) of mOlDhh. Cells were observed after 0, 24 and 48 h incubation. Scale bars: 50 μm. (B) The effect of mOlDhh on the proliferating activity of SG3 by MTS. The relative absorbance value = the absorbance value of each sample (at 490 nm) at the indicated time/the absorbance value of each sample (at 490 nm) at 0 h. The data are presented as the mean ± s.d. of three independent experiments. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the control at the corresponding time.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of SG3. (A) Phenotype of SG3 cells treated with 5N medium containing no (control) or different concentrations (0.04, 0.2 and 1 μM) of mOlDhh. Cells were observed after 0, 24 and 48 h incubation. Scale bars: 50 μm. (B) The effect of mOlDhh on the proliferating activity of SG3 by MTS. The relative absorbance value = the absorbance value of each sample (at 490 nm) at the indicated time/the absorbance value of each sample (at 490 nm) at 0 h. The data are presented as the mean ± s.d. of three independent experiments. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the control at the corresponding time.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of SG3. (A) Phenotype of SG3 cells treated with 5N medium containing no (control) or different concentrations (0.04, 0.2 and 1 μM) of mOlDhh. Cells were observed after 0, 24 and 48 h incubation. Scale bars: 50 μm. (B) The effect of mOlDhh on the proliferating activity of SG3 by MTS. The relative absorbance value = the absorbance value of each sample (at 490 nm) at the indicated time/the absorbance value of each sample (at 490 nm) at 0 h. The data are presented as the mean ± s.d. of three independent experiments. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the control at the corresponding time.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Meanwhile, the proliferative activity of mOlDhh on spermatogonia was measured in testicular organ culture by EdU incorporation assay. After mOlDhh 72 h incubation, the percentage of EdU+Vasa+ cells was 50%, while that in the control was only 23% (Fig. 5A and B). These results indicated that mOlDhh significantly promoted the proliferation of spermatogonia in the testes. In addition, a few of spermatogonia (EdU+Vasa+) in a single-cell state and located closely to the tunica albuginea, which is considered as putative SSCs (Yoshida et al. 2007, Xie et al. 2020, Naeemi et al. 2021), were observed (Fig. 5a6’). Hence, we propose that mOlDhh may promote the proliferation of SSCs.
mOlDhh enhances the proliferation of spermatogonia in testicular organ culture. (A) The images of EdU+ (red) and Vasa+ (green) cells in testicular sections. The testicular tissues were incubated with 5N medium containing no (control) or 1 μM mOlDhh for 72 h. DAPI was used to label the nuclei (blue). a6’ is magnification image of the boxed area in a6. Arrows indicate SSCs. Scale bars, (a1–a6) 50 μm. (B) The percentage of EdU+ cells in Vasa+ cells. The numbers in the parentheses represent the average of EdU+ Vasa+ cells and Vasa+ cells in three random view fields. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of spermatogonia in testicular organ culture. (A) The images of EdU+ (red) and Vasa+ (green) cells in testicular sections. The testicular tissues were incubated with 5N medium containing no (control) or 1 μM mOlDhh for 72 h. DAPI was used to label the nuclei (blue). a6’ is magnification image of the boxed area in a6. Arrows indicate SSCs. Scale bars, (a1–a6) 50 μm. (B) The percentage of EdU+ cells in Vasa+ cells. The numbers in the parentheses represent the average of EdU+ Vasa+ cells and Vasa+ cells in three random view fields. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of spermatogonia in testicular organ culture. (A) The images of EdU+ (red) and Vasa+ (green) cells in testicular sections. The testicular tissues were incubated with 5N medium containing no (control) or 1 μM mOlDhh for 72 h. DAPI was used to label the nuclei (blue). a6’ is magnification image of the boxed area in a6. Arrows indicate SSCs. Scale bars, (a1–a6) 50 μm. (B) The percentage of EdU+ cells in Vasa+ cells. The numbers in the parentheses represent the average of EdU+ Vasa+ cells and Vasa+ cells in three random view fields. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances proliferation of SG3 via Smo signaling
In mammals, it has been demonstrated that SMO acts as the transducer of the HH signaling pathway and then activates the glioma-associated oncogene homologs (Gli) (Pak & Segal 2016). To investigate whether mOlDhh promotes the proliferation of SG3 cells through SMO signaling, the cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM cyclopamine. The percentage of EdU+ cells in the mOlDhh group was 41%, which dramatically decreased to 8% after cyclopamine treatment (P< 0.01). Furthermore, about 17% of cells displayed apoptosis after cyclopamine treatment for 48 h, while almost no apoptosis occurred in the mOlDhh group (P< 0.01). These results indicate that Smo is an indispensable downstream component in the Dhh signaling pathway, suggesting that mOlDhh might mediate the proliferative activity of SG3 cells through Smo signaling.
The mRNA expression levels of the Hh signaling and pluripotent-related genes
Real-time PCR was used to further explore the mRNA expression levels of the canonical Hh signaling components including smo and gli1-3 and the pluripotent-related genes bcl6b and sall4.After 48 h treatment, mOlDhh upregulated the expression levels of smo and gli1-3 as well as bcl6b and sall4which were inhibited by cyclopamine treatment.
Discussion
In the present study, we have provided sufficient evidence that Dhh from a teleost fish could mediate the proliferation of spermatogonia via Smo signaling. First, Dhh has expression predominantly in testis. Second, the proliferative activity of mOlDhh on spermatogonia was evaluated in the testicular organ culture as well as SG3 in a dose-dependent manner. Finally, cyclopamine, the antagonist of Smo, significantly inhibited the proliferation of SG3 in the presence of mOlDhh resulting in apoptosis, suggesting that Smo is an indispensable downstream component in the Dhh signaling pathway. To our best knowledge, this is the first time to demonstrate that Dhh has a direct effect on the proliferation of spermatogonia via Smo signaling.
In Drosophila, there exists one Hh ligand (Nüsslein-Volhard & Wieschaus 1980). It is specifically expressed in hub cells and regulates the expression of BMP in somatic cyst stem cells (CySCs), which plays a role in maintaining the undifferentiated state of SSCs (Matunis et al. 2012, Michel et al. 2012). Inactivation of Hh signaling in CySCs leads to precocious differentiation of SSCs and its overactivation leads to SSCs reduction (Zhang et al. 2013a,b), suggesting that the Hh signaling is critical in the self-renewal of SSCs. However, up to date, our knowledge about HH signaling in SSCs in vertebrates including mammals is limited. Three HH homologs including SHH, IHH and DHH have been reported in vertebrates. SHH plays an important role in embryogenesis and CNS (Ingham & Placzek 2006); IHH is mainly produced by chondrocytes and regulates chondrocyte and interchondral bone formation (Vortkamp et al. 1996); DHH is predominantly expressed in testis and plays an important role in testis development (Li et al. 2017). Studies show that Dhh has expression in Sertoli cells as well as spermatogonia and spermatocytes in rat adult testis, and specially in Sertoli cells in mice (Morales et al. 2009, Sahin et al. 2014). Furthermore, several studies suggest that DHH signaling is critical in spermatogenesis and might be involved in the self-renewal of SSCs (Umehara et al. 2000, Matunis et al. 2012, Zhang et al. 2013a, Sahin et al. 2014, Werner et al. 2015, Li et al. 2017). However, there is a lack of solid evidence to demonstrate the role of DHH signaling in SSCs. In this study, OlDhh contains similar features to the mammalian counterparts including a signal peptide, N-terminal hedge domain, C-terminal hog domain and a highly conserved autocatalytic tripeptide (Supplementary Fig. 1). The N-terminal hedge domain of OlDhh shares over 69% identity to mammals (Fig. 1A). Moreover, Oldhh had obvious expression in spermatogonia and spermatocytes of the adult testis, whilst extremely low or no expression in the other tissues (Fig. 2), implying that it might be involved in spermatogenesis just some like that in mammals. Hence, these results imply that DHH might have a conserved function among vertebrates.
Reportedly, Hh proteins consist of a signal peptide, N-terminal hedge domain, C-terminal hog domain and a conserved autocatalytic site (Gly-Cys-Phe tripeptide) (Porter et al. 1995). The Hh proteins are produced as proproteins, which undergoes autoproteolytic cleavage catalyzed by the C-terminal domain, then releases the N-terminal domain followed by a long-chain fatty acyl group in an amide linkage to the N-terminus and cholesterol to the C-terminus (Chen et al. 2004, Mann & Beachy 2004). Previous studies show that bioactive mature Hh could be achieved through engineering with hydrophobic group (such as two Ile residues) at the Hh N-terminus (Martinez-Chinchilla & Riobo 2008). In this study, through prokaryotic expression by fusion with a cleavable His-SUMO tag, affinity purification and ULP1 cleavage, a soluble and unlabeled OlDhh N-terminal fragment (region 27-202) containing two additional Ile residues was successfully obtained (Fig. 3). Its bioactivity was further investigated in the testicular organ culture and a spermatogonial stem cell line (SG3), respectively. In the testicular organ culture, our results indicated that mOlDhh significantly promoted the proliferation of spermatogonia. Additionally, some spermatogonia (EdU+Vasa+) in a single cell state and located closely to the tunica albuginea were also observed (Fig. 5a6’), which are considered as the typical characteristic of putative SSCs (Yoshida et al. 2007, Xie et al. 2020, Naeemi et al. 2021). In the well-defined culture condition, mOlDhh promoted the proliferation of SG3 in a dose-dependent manner (Fig. 4). Collectively, our results suggest that mOlDhh may promote the proliferation of SSCs as well.
In the presence of HH ligands, they bind to the twelve-pass transmembrane protein PTCH, then alleviating the suppression of SMO and triggering GLI expression (Kalderon 2000). Smo is a seven-transmembrane protein related to the G protein-coupled receptor and plays a central role as a transducer of the Hh signaling pathway (Zhang et al. 2018). Cyclopamine has been identified as the specific antagonist of Smo through a small molecule library screening (Taipale et al. 2000). In the present study, cyclopamine treatment significantly inhibited the proliferation of SG3 cells in the presence of mOlDhh and led to massive apoptosis (Fig. 6), suggesting that Smo might act as the downstream component in the Dhh signaling. In addition, the mRNA expression levels of the other downstream components in the canonical Hh signaling pathway including smo, gli1, gli2 and gli3 were significantly upregulated in the presence of mOlDhh, which were inhibited by cyclopamine treatment (Fig. 7). This result further supports the view that Dhh mediates the proliferation of spermatogonia via Smo signaling.
mOlDhh enhances the proliferation of SG3 via Smo signaling. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM cyclopamine. (A and B) The proliferating cells were measured by EdU labeling assay. EdU was added 4 h before harvesting to evaluate the proliferating activity of cells. The proliferating cells had incorporated EdU (red) and were counterstained with DAPI (blue) (A). The percentage of the proliferative cells was evaluated (B). Numbers in the parentheses represent the average of of EdU+ cells and DAPI+ cells in three random view fields. (C and D) The apoptosis of SG3 cells by TUNEL staining assay. The apoptosis cells were stained by TUNEL (red) and were counterstained with DAPI (C). The percentage of the apoptotic cells was evaluated (D). Numbers in the parentheses represent the average of of TUNEL+ cells and DAPI+ cells in three random view fields. Scale bars: 50 μm. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of SG3 via Smo signaling. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM cyclopamine. (A and B) The proliferating cells were measured by EdU labeling assay. EdU was added 4 h before harvesting to evaluate the proliferating activity of cells. The proliferating cells had incorporated EdU (red) and were counterstained with DAPI (blue) (A). The percentage of the proliferative cells was evaluated (B). Numbers in the parentheses represent the average of of EdU+ cells and DAPI+ cells in three random view fields. (C and D) The apoptosis of SG3 cells by TUNEL staining assay. The apoptosis cells were stained by TUNEL (red) and were counterstained with DAPI (C). The percentage of the apoptotic cells was evaluated (D). Numbers in the parentheses represent the average of of TUNEL+ cells and DAPI+ cells in three random view fields. Scale bars: 50 μm. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
mOlDhh enhances the proliferation of SG3 via Smo signaling. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM cyclopamine. (A and B) The proliferating cells were measured by EdU labeling assay. EdU was added 4 h before harvesting to evaluate the proliferating activity of cells. The proliferating cells had incorporated EdU (red) and were counterstained with DAPI (blue) (A). The percentage of the proliferative cells was evaluated (B). Numbers in the parentheses represent the average of of EdU+ cells and DAPI+ cells in three random view fields. (C and D) The apoptosis of SG3 cells by TUNEL staining assay. The apoptosis cells were stained by TUNEL (red) and were counterstained with DAPI (C). The percentage of the apoptotic cells was evaluated (D). Numbers in the parentheses represent the average of of TUNEL+ cells and DAPI+ cells in three random view fields. Scale bars: 50 μm. **Very significant difference from the control (P < 0.01).
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Effects of OlDhh on mRNA expression levels of Hh signaling and pluripotent related genes. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM Cyclopamine for 48 h and then collected for real-time PCR. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the corresponding control.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Effects of OlDhh on mRNA expression levels of Hh signaling and pluripotent related genes. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM Cyclopamine for 48 h and then collected for real-time PCR. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the corresponding control.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Effects of OlDhh on mRNA expression levels of Hh signaling and pluripotent related genes. SG3 cells were incubated in 5N medium containing mOlDhh (1 μM) with 0 or 15 μM Cyclopamine for 48 h and then collected for real-time PCR. *,**Significant (P < 0.05) or very significant (P < 0.01) differences from the corresponding control.
Citation: Reproduction 163, 4; 10.1530/REP-21-0468
Both Bcl6b and Sall4 are pluripotent-related regulators in the self-renewal of SSCs (Wu et al. 2011, Lovelace et al. 2016). In mice, GDNF treatment significantly upregulates the mRNA expression of Bcl6b, and its deficiency results in spermatogenesis impairment or Sertoli cell-only phenotype in many tubules (Oatley et al. 2006). Our previous studies suggest that the signaling of the two GDNF paralogs and their family receptor alpha1 from medaka mediate the self-renewal of SG3 and upregulate the bcl6b expression (Wei et al. 2017, Zhao et al. 2018). In addition, in mammals and several fish species including medaka, studies indicate that sall4 has dominant expression in spermatogonia and plays a critical role in the proliferation and differentiation of SSCs (Wang et al. 2011, Hobbs et al. 2012). In this study, mOlDhh treatment significantly promoted the expression of bcl6b as well as sall4(Fig. 7), suggesting that the Dhh signaling may mediate the proliferation of spermatogonia by upregulating the expressions of pluripotent related genes.
In conclusion, our study obtained the tag-free and bioactive mature OlDhh protein through prokaryotic soluble expression and confirmed that it can directly mediate the proliferation of spermatogonia through the downstream transducer Smo. This study provides new information about factors regulating the proliferation of spermatogonia.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-21-0468.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Natural Science Foundation of China (grants 31972776, 32172969, 31972778, 32072957); the Chongqing Natural Science Foundation of China [grant cstc2020jcyj-msxmX1045]; grant 2018YFD0900202 from National Key Research and Development Program of China.
Author contribution statement
J W, D W, C Z and Z Z together conceived and designed the experiments; C Z, Z Z, X Q, X B, X L, W T and L Z performed the experiments; J W, C Z and Z Z analyzed the data, interpreted the results and drafted the manuscript; J W and D W critically edited the manuscript. All authors read and approved the final manuscript.
References
Bénazet JD, Bischofberger M, Tiecke E, Gonçalves A, Martin JF, Zuniga A, Naef F & Zeller R 2009 A self-regulatory system of interlinked signaling feedback loops controls mouse limb patterning. Science 323 1050–1053. (https://doi.org/10.1126/science.1168755)
Bitgood MJ, Shen L & McMahon AP 1996 Sertoli cell signaling by desert hedgehog regulates the male germline. Current Biology 6 298–304. (https://doi.org/10.1016/s0960-9822(02)00480-3)
Büller NV, Rosekrans SL, Westerlund J & van den Brink GR 2012 Hedgehog signaling and maintenance of homeostasis in the intestinal epithelium. Physiology 27 148–155. (https://doi.org/10.1152/physiol.00003.2012)
Carpenter D, Stone DM, Brush J, Ryan A, Armanini M, Frantz G, Rosenthal A & de Sauvage FJ 1998 Characterization of two patched receptors for the vertebrate hedgehog protein family. PNAS 95 13630–13634. (https://doi.org/10.1073/pnas.95.23.13630)
Chen MH, Li YJ, Kawakami T, Xu SM & Chuang PT 2004 Palmitoylation is required for the production of a soluble multimeric hedgehog protein complex and long-range signaling in vertebrates. Genes and Development 18 641–659. (https://doi.org/10.1101/gad.1185804)
Chuang PT & McMahon AP 1999 Vertebrate hedgehog signalling modulated by induction of a hedgehog-binding protein. Nature 397 617–621. (https://doi.org/10.1038/17611)
Clark AM, Garland KK & Russell LD 2000 Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biology of Reproduction 63 1825–1838. (https://doi.org/10.1095/biolreprod63.6.1825)
Dai S, Qi S, Wei X, Liu X, Li Y, Zhou X, Xiao H, Lu B, Wang D & Li M 2021 Germline sexual fate is determined by the antagonistic action of dmrt1 and foxl3/foxl2 in tilapia. Development 148 dev199380. (https://doi.org/10.1242/dev.199380)
Delgado RN, Mansky B, Ahanger SH, Lu C, Andersen RE, Dou Y, Alvarez-Buylla A & Lim DA 2020 Maintenance of neural stem cell positional identity by mixed-lineage leukemia 1. Science 368 48–53. (https://doi.org/10.1126/science.aba5960)
Fuccillo M, Joyner AL & Fishell G 2006 Morphogen to mitogen: the multiple roles of hedgehog signalling in vertebrate neural development. Nature Reviews: Neuroscience 7 772–783. (https://doi.org/10.1038/nrn1990)
Gu Y, Wang Y, He L, Zhang J, Zhu X, Liu N, Wang J, Lu T, He L & Tian Y et al.2021 Circular RNA circIPO11 drives self-renewal of liver cancer initiating cells via hedgehog signaling. Molecular Cancer 20 132. (https://doi.org/10.1186/s12943-021-01435-2)
Hobbs RM, Fagoonee S, Papa A, Webster K, Altruda F, Nishinakamura R, Chai L & Pandolfi PP 2012 Functional antagonism between Sall4 and Plzf defines germline progenitors. Cell Stem Cell 10 284–298. (https://doi.org/10.1016/j.stem.2012.02.004)
Hong Y, Liu T, Zhao H, Xu H, Wang W, Liu R, Chen T, Deng J & Gui J 2004 Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro. PNAS 101 8011–8016. (https://doi.org/10.1073/pnas.0308668101)
Hopyan S, Gokgoz N, Poon R, Gensure RC, Yu C, Cole WG, Bell RS, Jüppner H, Andrulis IL & Wunder JS et al.2002 A mutant PTH/PTHrP type I receptor in enchondromatosis. Nature Genetics 30 306–310. (https://doi.org/10.1038/ng844)
Huycke TR, Miller BM, Gill HK, Nerurkar NL, Sprinzak D, Mahadevan L & Tabin CJ 2019 Genetic and mechanical regulation of intestinal smooth muscle development. Cell 179 90 .e21–105.e21. (https://doi.org/10.1016/j.cell.2019.08.041)
Inaba M, Yamashita YM & Buszczak M 2016 Keeping stem cells under control: new insights into the mechanisms that limit niche-stem cell signaling within the reproductive system. Molecular Reproduction and Development 83 675–683. (https://doi.org/10.1002/mrd.22682)
Ingham PW & Placzek M 2006 Orchestrating ontogenesis: variations on a theme by sonic hedgehog. Nature Reviews: Genetics 7 841–850. (https://doi.org/10.1038/nrg1969)
Ishikura Y, Ohta H, Sato T, Murase Y, Yabuta Y, Kojima Y, Yamashiro C, Nakamura T, Yamamoto T & Ogawa T et al.2021 In vitro reconstitution of the whole male germ-cell development from mouse pluripotent stem cells. Cell Stem Cell 28 2167 .e9–2179.e9. (https://doi.org/10.1016/j.stem.2021.08.005)
Jiang D, Chen J, Fan Z, Tan D, Zhao J, Shi H, Liu Z, Tao W, Li M & Wang D 2017 CRISPR/Cas9-induced disruption of wt1a and wt1b reveals their different roles in kidney and gonad development in Nile tilapia. Developmental Biology 428 63–73. (https://doi.org/10.1016/j.ydbio.2017.05.017)
Kalderon D 2000 Transducing the hedgehog signal. Cell 103 371–374. (https://doi.org/10.1016/s0092-8674(00)00129-x)
Li S, Wang M, Chen Y, Wang W, Wu J, Yu C, Zheng Y & Pan Z 2017 Role of the hedgehog signaling pathway in regulating the behavior of germline stem cells. Stem Cells International 2017 5714608. (https://doi.org/10.1155/2017/5714608)
Lovelace DL, Gao Z, Mutoji K, Song YC, Ruan J & Hermann BP 2016 The regulatory repertoire of PLZF and SALL4 in undifferentiated spermatogonia. Development 143 1893–1906. (https://doi.org/10.1242/dev.132761)
Mäkelä JA, Saario V, Bourguiba-Hachemi S, Nurmio M, Jahnukainen K, Parvinen M & Toppari J 2011 Hedgehog signalling promotes germ cell survival in the rat testis. Reproduction 142 711–721. (https://doi.org/10.1530/REP-11-0110)
Mann RK & Beachy PA 2004 Novel lipid modifications of secreted protein signals. Annual Review of Biochemistry 73 891–923. (https://doi.org/10.1146/annurev.biochem.73.011303.073933)
Martinez-Chinchilla P & Riobo NA 2008 Purification and bioassay of hedgehog ligands for the study of cell death and survival. Methods in Enzymology 446 189–204. (https://doi.org/10.1016/S0076-6879(08)01611-X)
Matunis EL, Stine RR & de Cuevas M 2012 Recent advances in Drosophila male germline stem cell biology. Spermatogenesis 2 137–144. (https://doi.org/10.4161/spmg.21763)
Meng X, Lindahl M, Hyvönen ME, Parvinen M, de Rooij DG, Hess MW, Raatikainen-Ahokas A, Sainio K, Rauvala H & Lakso M et al.2000 Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 287 1489–1493. (https://doi.org/10.1126/science.287.5457.1489)
Michel M, Kupinski AP, Raabe I & Bökel C 2012 Hh signalling is essential for somatic stem cell maintenance in the Drosophila testis niche. Development 139 2663–2669. (https://doi.org/10.1242/dev.075242)
Morales CR, Fox A, El-Alfy M, Ni X & Argraves WS 2009 Expression of patched-1 and smoothened in testicular meiotic and post-meiotic cells. Microscopy Research and Technique 72 809–815. (https://doi.org/10.1002/jemt.20733)
Naeemi S, Eidi A, Khanbabaee R, Sadri-Ardekani H & Kajbafzadeh AM 2021 Differentiation and proliferation of spermatogonial stem cells using a three-dimensional decellularized testicular scaffold: a new method to study the testicular microenvironment in vitro. International Urology and Nephrology 53 1543–1550. (https://doi.org/10.1007/s11255-021-02877-9)
Nüsslein-Volhard C & Wieschaus E 1980 Mutations affecting segment number and polarity in Drosophila. Nature 287 795–801. (https://doi.org/10.1038/287795a0)
Oatley JM & Brinster RL 2012 The germline stem cell niche unit in mammalian testes. Physiological Reviews 92 577–595. (https://doi.org/10.1152/physrev.00025.2011)
Oatley JM, Avarbock MR, Telaranta AI, Fearon DT & Brinster RL 2006 Identifying genes important for spermatogonial stem cell self-renewal and survival. PNAS 103 9524–9529. (https://doi.org/10.1073/pnas.0603332103)
Pak E & Segal RA 2016 Hedgehog signal transduction: key players, oncogenic drivers, and cancer therapy. Developmental Cell 38 333–344. (https://doi.org/10.1016/j.devcel.2016.07.026)
Paredes I, Vieira JR, Shah B, Ramunno CF, Dyckow J, Adler H, Richter M, Schermann G, Giannakouri E & Schirmer L et al.2021 Oligodendrocyte precursor cell specification is regulated by bidirectional neural progenitor-endothelial cell crosstalk. Nature Neuroscience 24 478–488. (https://doi.org/10.1038/s41593-020-00788-z)
Porter JA, von Kessler DP, Ekker SC, Young KE, Lee JJ, Moses K & Beachy PA 1995 The product of hedgehog autoproteolytic cleavage active in local and long-range signalling. Nature 374 363–366. (https://doi.org/10.1038/374363a0)
Sahin Z, Szczepny A, McLaughlin EA, Meistrich ML, Zhou W, Ustunel I & Loveland KL 2014 Dynamic hedgehog signalling pathway activity in germline stem cells. Andrology 2 267–274. (https://doi.org/10.1111/j.2047-2927.2014.00187.x)
Szczepny A, Hime GR & Loveland KL 2006 Expression of hedgehog signalling components in adult mouse testis. Developmental Dynamics 235 3063–3070. (https://doi.org/10.1002/dvdy.20931)
Taipale J, Chen JK, Cooper MK, Wang B, Mann RK, Milenkovic L, Scott MP & Beachy PA 2000 Effects of oncogenic mutations in smoothened and patched can be reversed by cyclopamine. Nature 406 1005–1009. (https://doi.org/10.1038/35023008)
Tan K & Wilkinson MF 2019 Human spermatogonial stem cells scrutinized under the single-cell magnifying glass. Cell Stem Cell 24 201–203. (https://doi.org/10.1016/j.stem.2019.01.010)
Umehara F, Tate G, Itoh K, Yamaguchi N, Douchi T, Mitsuya T & Osame M 2000 A novel mutation of desert hedgehog in a patient with 46,XY partial gonadal dysgenesis accompanied by minifascicular neuropathy. American Journal of Human Genetics 67 1302–1305. (https://doi.org/10.1016/S0002-9297(07)62958-9)
Vercauteren Drubbel A, Pirard S, Kin S, Dassy B, Lefort A, Libert F, Nomura S & Beck B 2021 Reactivation of the hedgehog pathway in esophageal progenitors turns on an embryonic-like program to initiate columnar metaplasia. Cell Stem Cell 28 1411 .e7–1427.e7. (https://doi.org/10.1016/j.stem.2021.03.019)
Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM & Tabin CJ 1996 Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273 613–622. (https://doi.org/10.1126/science.273.5275.613)
Wang D, Manali D, Wang T, Bhat N, Hong N, Li Z, Wang L, Yan Y, Liu R & Hong Y 2011 Identification of pluripotency genes in the fish medaka. International Journal of Biological Sciences 7 440–451. (https://doi.org/10.7150/ijbs.7.440)
Wei J, Liu L, Fan Z, Hong Y, Zhao Y, Zhou L & Wang D 2017 Identification, prokaryote expression of medaka gdnfa/b and their biological activity in a spermatogonial cell line. Stem Cells and Development 26 197–205. (https://doi.org/10.1089/scd.2016.0248)
Werner R, Merz H, Birnbaum W, Marshall L, Schröder T, Reiz B, Kavran JM, Bäumer T, Capetian P & Hiort O 2015 46,XY gonadal dysgenesis due to a homozygous mutation in desert hedgehog (DHH) identified by exome sequencing. Journal of Clinical Endocrinology and Metabolism 100 E1022–E1029. (https://doi.org/10.1210/jc.2015-1314)
Wu X, Goodyear SM, Tobias JW, Avarbock MR & Brinster RL 2011 Spermatogonial stem cell self-renewal requires ETV5-mediated downstream activation of brachyury in mice. Biology of Reproduction 85 1114–1123. (https://doi.org/10.1095/biolreprod.111.091793)
Xie X, Nóbrega R & Pšenička M 2020 Spermatogonial stem cells in fish: characterization, isolation, enrichment, and recent advances of in vitro culture systems. Biomolecules 10 644. (https://doi.org/10.3390/biom10040644)
Xu H, Lim M, Dwarakanath M & Hong Y 2014 Vasa identifies germ cells and critical stages of oogenesis in the Asian seabass. International Journal of Biological Sciences 10 225–235. (https://doi.org/10.7150/ijbs.6797)
Yi M, Hong N & Hong Y 2009 Generation of medaka fish haploid embryonic stem cells. Science 326 430–433. (https://doi.org/10.1126/science.1175151)
Yoshida S 2008 Spermatogenic stem cell system in the mouse testis. Cold Spring Harbor Symposia on Quantitative Biology 73 25–32. (https://doi.org/10.1101/sqb.2008.73.046)
Yoshida S, Sukeno M & Nabeshima Y 2007 A vasculature-associated niche for undifferentiated spermatogonia in the mouse testis. Science 317 1722–1726. (https://doi.org/10.1126/science.1144885)
Zhang Z, Lv X, Jiang J, Zhang L & Zhao Y 2013a Dual roles of Hh signaling in the regulation of somatic stem cell self-renewal and germline stem cell maintenance in Drosophila testis. Cell Research 23 573–576. (https://doi.org/10.1038/cr.2013.29)
Zhang Z, Pan C & Zhao Y 2013b Hedgehog in the Drosophila testis niche: what does it do there? Protein and Cell 4 650–655. (https://doi.org/10.1007/s13238-013-3040-y)
Zhang X, Dong S & Xu F 2018 Structural and druggability landscape of frizzled G protein-coupled receptors. Trends in Biochemical Sciences 43 1033–1046. (https://doi.org/10.1016/j.tibs.2018.09.002)
Zhao Y, Yang Z, Wang Y, Luo Y, Da F, Tao W, Zhou L, Wang D & Wei J 2018 Both Gfrα1a and Gfrα1b are involved in the self-renewal and maintenance of spermatogonial stem cells in medaka. Stem Cells and Development 27 1658–1670. (https://doi.org/10.1089/scd.2018.0177)
