Abstract
Decidual stromal cells (DSCs) modulate the function of trophoblasts through various factors. Wnt signaling pathway is active at the maternal–fetal interface. Here, we isolated endometrial stromal cells (ESCs) from women of reproductive ages and DSCs from normal pregnancy during the first trimester (6–10 weeks). Real-time quantitative PCR and western blotting were used to screen out the most variable WNT ligands between ESCs and DSCs, which turned out to be WNT16. Both culture mediums from DSCs and recombinant protein of human WNT16 enhanced the survival and invasion of HTR8/SVneo trophoblastic cells. Furthermore, the regulation of DSCs on trophoblast was partly blockaded after we knocked down WNT16 in DSCs. Treating HTR8/SVneo trophoblastic cells with small molecular inhibitors and small interfering RNA (siRNA), we found that the activity of AKT/beta-catenin (CTNNB1) correlated with the effect of WNT16. The crosstalk of WNT16/AKT/beta-catenin between DSCs and trophoblasts was determined to be downregulated in unexplained recurrent spontaneous abortion. This study suggests that WNT16 from DSCs promotes HTR8/SVneo trophoblastic cells invasion and survival via AKT/beta-catenin pathway at the maternal–fetal interface in human early pregnancy. The disturbance of this crosstalk between DSCs and trophoblasts might cause pregnancy failure.
Introduction
The delicate process of the placentation is one of the most critical events in the establishment of human pregnancy, during which the uterine spiral artery is remodeled to establish a feto-placental vasculature, ensuring an adequate blood supply to the growing fetus (Lunghiet al. 2007). In the course of spiral vascular remodeling, extravillous trophoblasts penetrate the decidua, break down the muscular layer, and even replace the endothelial cells. Recurrent spontaneous abortion refers to two or more consecutive miscarriages before 20 weeks of gestation with the same partner, approximately 50% of which have an unknown cause, referred to as unexplained recurrent spontaneous abortion (URSA) (Liet al. 2002, Guoet al. 2018). An inadequate invasion of extravillous trophoblasts is considered to be a pivotal trigger of URSA, pre-eclampsia, and other pregnancy complications (Pijnenborget al. 2006).
Decidualized endometrial stromal cells (ESCs) form the largest cell population in the decidua. Decidual stromal cells (DSCs) can secret a variety of factors to promote the invasion of trophoblast cells through activating matrix metalloproteinases (MMPs) and inhibiting tissue inhibitors of metalloproteinases in the trophoblasts (Bischof & Campana 2000, Duet al. 2012, Schatzet al. 2016). MMP2 and MMP9 are two important gelatinases involved in the extracellular matrix remodeling during trophoblast invasion (Zhanget al. 2013). Known pro-invasive factors include interleukin-6 (Jovanovic & Vicovac 2009), LIF (Suman & Gupta 2014), etc., most of which exert their effects through JAK/STAT, ERK1/2, or PI3K/AKT pathways (Sharmaet al. 2016). Wingless-type MMTV integration site family proteins, or WNTs, are secreted cysteine-rich glycoproteins, which act as autocrine and paracrine signaling ligands through binding to Frizzled receptors on the cell surface to activate transcription factors. WNT signaling plays an important role in embryonic development, stem cell maintenance, differentiation, and tissue homeostasis. WNTs family has also been demonstrated to regulate vasculogenesis and angiogenesis (Mazzoniet al. 2017, Foulquieret al. 2018). It is well-known that WNT signaling pathway is active at the maternal-fetal interface (Sondereggeret al. 2010, Nayeemet al. 2016), and WNT4 has been regarded as a marker of DSCs. However, given the intricate networks of WNT signaling, detailed regulatory mechanisms are rarely reported in human pregnancy.
As we all know, there are some classic activators of canonical and uncanonical WNT pathways, such as WNT3 (Lieet al. 2005, Farinet al. 2016) and WNT5 (Jianget al. 2006, Foulquieret al. 2018). Unlike them, however, WNT16, a well-studied regulator of osteoclastogenesis (Hanet al. 2018), is proved to be able to activate both canonical and uncanonical WNT pathways or either of them (Zhanget al. 2020). In 2017, WNT16 was reported to be produced by uterine luminal epithelial and was associated with fertility and pregnancy in mice models (Farahet al. 2017). But whether WNT16 can exert any effect on the maintenance of human pregnancy has never been studied.
Here, we first found out that WNT16 was significantly upregulated in DSCs compared to ESCs. Next, we investigated the role of WNT16 in the biological function of trophoblasts. The invasiveness and apoptosis of trophoblasts were found to be regulated by DSC-originated WNT16. Subsequent results proved that DSC-derived WNT16 promoted trophoblast invasion and also inhibited their apoptosis through a WNT16-AKT-beta-catenin (CTNNB1) pathway. The downregulation of this pathway was observed in the villous and decidua of URSA, which hints at a possibility that the dysregulation of WNT16 might participate in human pregnancy complications.
Materials and methods
Human samples
Normal decidual tissues and villous tissues were obtained from healthy pregnant patients (6–10 weeks, n = 10), and pathological decidual and villous tissues were collected from patients with URSA (n = 10) who had experienced at least two consecutive spontaneous early miscarriages before the 12th gestational week were recruited and information about their personal history of thromboembolic diseases and previous early pregnancy losses were collected. All normal pregnancies were terminated for non-medical reasons, and URSA was classified as unexplained after the exclusion of endocrine, anatomic, genetic abnormalities, infection, etc. Endometrial tissues were obtained at hysterectomy from patients with a normal menstrual cycle and no intrauterine abnormality. The reasons for surgery were typically myoma of uterus or early stage of cervical cancer. The patients receiving hormonal therapy before surgeries were excluded. All samples were collected at the Obstetrics and Gynecology Hospital, Fudan University, and the tissues were collected into ice-cold Dulbecco’s modified Eagle’s medium F12 (Gibco), transported to the laboratory within 30 min of surgery and washed in PBS. Written informed consent was obtained from all patients who provided tissue samples. All experiments involving human were approved by the Human Research Ethics Committee of the Obstetrics and Gynecology Hospital, Fudan University (no. 2020-184).
Isolation and cultivation of human ESCs and DSCs
The endometrial tissues were minced into 1-mm segments and digested in DMEM/F12 supplemented with type IV collagenase (1.0 mg/mL; Sigma-Aldrich) for 30 min at 37°C with constant shaking. The endometrial pieces were filtered through sterile 100, 200, and 400 screen mesh and centrifugated for 8 min at 150 g, the cells at the bottom were collected and resuspended in DMEM/F-12 containing 10% fetal bovine serum (FBS, (v/v), Gibco), plated on culture flasks, and incubated in a humidified incubator with 5% CO2 at 37°C.
The decidual tissues were minced and digested with collagenase type IV and DNA enzymes (3000 IU, Sigma-Aldrich) for 30 min at 37°C with constant shaking. After being filtered through sterile 100, 200, and 400 screen mesh, the decidual suspensions were subjected to sterile density gradient separation via Percoll density gradient (20%/40%/60%; GE Healthcare) and centrifuged for 20 min at 800 g as previously described (Duet al. 2014). Cells from the 20%/40% interface containing mainly DSCs were recovered and suspended with 10% FBS (v/v) in DMEM/F-12 containing 10% FBS ((v/v), Gibco), plated on culture flasks, and incubated in a humidified incubator with 5% CO2 at 37°C.
Cell lines
The immortalized first-trimester trophoblast cell line HTR8/SVneo was purchased from the Cell Bank, the Chinese Academy of Sciences, Shanghai, China, and cultured in RPMI1640 complete media supplemented with 10% FBS (v/v) in 5% CO2 at 37°C. CK7 was detected to confirm the phenotype of the trophoblast cell line.
qRT-PCR
Cells were lysed in TRIzol (Invitrogen) and total RNA was directly isolated according to the manufacturer’s instructions. The transcription levels of WNT proteins in ESCs and DSCs were determined by real-time quantitative PCR (qRT-PCR) according to the standard protocols (Takara). Amplified transcript specificity and absence of primer dimers were determined via a melting curve analysis. The fold change in the gene expression of the genes was calculated using the change in cycle threshold value method (ΔΔCt). All values obtained were normalized to the values obtained for β-actin (ACTB). The primer sequences were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China) as indicated in Table 1. All experiments were performed in duplicate for three instances.
The sequences of primers.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| WNT1 | ACCTCTTCGGCAAGATCGTC | TCACACGTGCAGGATTCGAT |
| WNT2 | GGATGACCAAGTGTGGGTGT | GGTCATGTAGCGGTTGTCCA |
| WNT2B | CCGAGAGTGTCAGCACCAAT | TGGACTACCCCTGCTGATGA |
| WNT3 | GGTCCGTGGCAGTTGTTAGA | CATGGCTGCTCTTCAAACGG |
| WNT3A | CAAAGCTACCAGGGAGTCGG | CTGCACATGAGCGTGTCACT |
| WNT4 | CATGAGTCCCCGCTCGTG | TCCATGACTTCCAGGTTCCG |
| WNT5A | CACTGCAGTCCAGTTGGGAT | GTTGCTTCGTCGTGCTCAAG |
| WNT5B | AGGAACGGCTCCTTCCCTAA | GGAGCTAGTGAACCGTGGAG |
| WNT6 | CCGTAGGGCGGTCACGAT | GGTAGGGTCCATAACCAAGGG |
| WNT7A | GGAAAGTGAGCCACCGGATA | ACAGGCCGTGGAATGATACA |
| WNT7B | CACCTTCCTGCGCATCAAAC | GTCCTCCTCGCAGTAGTTGG |
| WNT8A | GCTGCAGCATACAGACATGC | GCCTGGTCATACTTGGCCTT |
| WNT8B | TCTGTCTGAATCCTCGCAGC | CCAGCGCCTAAGGCTTGATA |
| WNT9A | ATGACTCGCCTAGCTTCTGC | ACCCGGCTCTGTGTGTTATG |
| WNT9B | TGTGCGGTGACAACCTCAAG | CCGCAGGTCCTTGTTTCCTC |
| WNT10A | TTCGTGGTCTGCGAAGAGTG | TGCCTTGCCAAGACCGTAAG |
| WNT10B | GCGCCAGGTGGTAACTGAAA | CAGCATGTCTTGAACTGGCA |
| WNT11 | GTGAAGGACTCGGAACTCGT | GGATGTCTTGTTGCACTGCC |
| WNT16 | GGAGCCAGTTCAGACACGAG | GCTCAGCTCGTAGCCAAAGA |
Western blot
Protein extractions were collected from tissues and cells using RIPA buffer (Beyotime, China) mixed with protease inhibitor cocktail (MedChemExpress, Shanghai, China) and Phosphatase inhibitor cocktail (Beyotime). Then protein extractions (30 μg) were separated by SDS-PAGE, and subsequently shifted to a polyvinylidene difluoride membrane (Millipore), and interacted with anti-actin antibody (Beyotime, AA132, 1:1000), anti-GAPDH antibody (Beyotime, AF5009, 1:1000), anti-tubulin (Beyotime, AF1216, 1:1000), anti-MMP2 antibody (Abcam, ab92536, 1:1000), anti-WNT16 antibody (Abcam, ab109437, 1:1000), anti-MMP9 antibody (Abcam, ab76003, 1:1000), anti-TIMP2 antibody (Abcam, ab180630, 1:1000), anti-beta-catenin (Abcam, ab32572, 1:1000), anti-AKT antibody (Cell Signal Technology, no. 9272, 1:1000), anti-p-AKT S473 antibody (Cell Signal Technology, no. 9271, 1:1000), and the secondary HRP-conjugated anti-mouse (Jackson ImmunoResearch, no. 115-035-003, 1:10000) or anti-rabbit (Jackson ImmunoResearch, no. 115-005-003, 1:10000). Then, membranes were processed for chemiluminescence assay by means of the Immobilon Western Chemiluminescent HRP Substrate Kit (Millipore). The protein bands were quantitated using ImageJ (NIH).
Collection, concentration, and reconstitution of the conditioned medium of DSCs (DSC-CM)
DSCs were isolated from decidual tissues and cultivated for 48 h before we collected the supernatants. For the preparation of DSC-CM, 6 × 105 cells were seeded per well of a six-well plate in 2 mL culture medium and grown for 48 h at 37°C, 5% CO2. This method was used in order to standardize the experiment. Then the supernatants were concentrated and desalted with Amicon® Ultra Centrifugal Filters (Sigma-Aldrich). Finally, the concentrates were reconstituted with RIPM1640 complete media and filtrated through Sterile Membrane (Millipore) before being incubated with cells.
Flow cytometry
Intracellular molecular expressions were evaluated by flow cytometry using CytoFLEX (Beckman Coulter). Fluorescein-conjugated antibodies were used, including B cell leukemia/ lymphoma 2 (BCL2)-PE/Cy7 (Biolegend, CA, USA) (Zenkeet al. 2020), active caspase-3-APC (BD Biosciences) (Fujita & Tsuruo 1998), MMP2-PE (R&D Systems) (Lavini-Ramoset al. 2017). For intracellular staining, the cells were fixed and permeabilized using the Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Pharmingen). Flow cytometry data were analyzed using FlowJo software (Becton Dickinson) and CytoExpert software (Beckman Coulter).
Annexin V and 7-amino-actinomycin D staining for apoptosis detection
Apoptosis of trophoblasts was measured using the APC Annexin V Apoptosis Detection Kit with 7-AAD (Biolegend) and was analyzed with flow cytometry (FCM, Beckman Coulter) within 1 h following staining. Annexin V (+) 7-AAD (−) subset indicated early apoptotic cells, Annexin V (+) 7-AAD (+) subset indicated late apoptotic cells, and the Annexin V (+) population indicated total apoptotic cells. Total apoptotic cells were statistically analyzed.
Transwell assay
Transwell chambers (0.4 mm pore size cell culture inserts, Millipore) were pre-coated with Matrigel (BD Biosciences) to detect the abilities of invasion. Cells suspended in serum-free RPMI-1640 medium were placed on the upper chamber of transwell, and the lower chambers were filled with 500 μL RPMI-1640 medium supplemented with 10% FBS (v/v) as control. We treated trophoblasts by adding DSC-CM or other reagents to the lower chambers after trophoblasts adhered to the Matrigel in the upper chambers, usually 12–24 h after cells seeding. After 48 h, cells on the lower face of the membranes were fixed 4% paraformaldehyde and stained with 0.1% crystal violet staining solution (Beyotime) for 30 min, washed with ddH2O followed by counting with a microscope.
Insitu fluorescence zymography
MMP2/9 activity was tested on trophoblasts by in situ zymography kit (GENMED, Shangai, China) (Wanget al. 2019). This assay was performed according to the manufacturer’s instructions.
Cell transfection
Small interfering RNAs (siRNAs) targeting WNT16 (siWNT16) (RiboBio, Guangzhou, China) and beta-catenin (siCTNNB1) (F: AACTTGCCACACGTGCAATC; R: CCCACTTGGCAGACCATCAT); siRNA negative control (NC) was synthesized by RiboBio; 1 × 105 cells/well were seeded to a 12-well plate. 12–24 h later when cells adhered to the wall, the siRNA transfection was carried out using Lipofectamine™ 3000 transfection reagent (Invitrogen Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instructions.
Statistical analysis
Data were presented as means ± s.d. and were analyzed using GraphPad Prism 8. Statistical differences between groups were analyzed using Student’s t-test, paired t-test or one-way ANOVA. P-value less than 0.05 was considered statistically significant.
Results
DSCs express a higher level of WNT16 than ESCs
Given that WNT signaling is activated during pregnancy, we first carried out an RNA screening of all WNT ligands in human ESCs and DSCs using qRT-PCR (Fig. 1A). The RNA levels of WNT ligands in DSCs were pervasively higher than that in ESCs. WNT16 was the most variable factor which was 14.5 times higher in DSCs than that in ESCs. We then examined the protein level of WNT16 using western blotting (Fig. 1B). A higher protein level of WNT16 was detected in DSCs than in ESCs. Thus, DSCs express a higher level of WNT16 than ESCs.
DSCs express a higher level of WNT16 than ESCs. DSCs were isolated from decidual tissues of normal pregnancy in the first trimester, ESCs were isolated from endometrial tissues of women of reproductive ages. RNA and protein were extracted immediately after the isolation. (A) The RNA level of WNT ligands in human ESCs and DSCs (both groups n = 6) was detected by qRT-PCR. Student’s t-test was used. Data are the mean ± s.d. of six human samples in each group. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.0001. (B) The protein level of WNT16 in DSCs and ESCs detected by immunoblots (both groups n = 3). Representative and quantitative immunoblots results were shown separately. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05. DSCs, decidual stromal cells; ESCs, endothelial stromal cells.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
DSCs express a higher level of WNT16 than ESCs. DSCs were isolated from decidual tissues of normal pregnancy in the first trimester, ESCs were isolated from endometrial tissues of women of reproductive ages. RNA and protein were extracted immediately after the isolation. (A) The RNA level of WNT ligands in human ESCs and DSCs (both groups n = 6) was detected by qRT-PCR. Student’s t-test was used. Data are the mean ± s.d. of six human samples in each group. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.0001. (B) The protein level of WNT16 in DSCs and ESCs detected by immunoblots (both groups n = 3). Representative and quantitative immunoblots results were shown separately. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05. DSCs, decidual stromal cells; ESCs, endothelial stromal cells.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
DSCs express a higher level of WNT16 than ESCs. DSCs were isolated from decidual tissues of normal pregnancy in the first trimester, ESCs were isolated from endometrial tissues of women of reproductive ages. RNA and protein were extracted immediately after the isolation. (A) The RNA level of WNT ligands in human ESCs and DSCs (both groups n = 6) was detected by qRT-PCR. Student’s t-test was used. Data are the mean ± s.d. of six human samples in each group. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.0001. (B) The protein level of WNT16 in DSCs and ESCs detected by immunoblots (both groups n = 3). Representative and quantitative immunoblots results were shown separately. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05. DSCs, decidual stromal cells; ESCs, endothelial stromal cells.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
Human DSCs promote trophoblast invasion and suppress its apoptosis
Next, we investigated the influence of DSCs on the biological behavior of trophoblast in vitro. In transwell assay, we filled the lower chambers with RPMI1640 complete media as the control group or DSC-CM as the treated group. After being treated with DSC-CM for 48 h, the number of invading trophoblasts grew 9.6 times that of the control group (Fig. 2A). We further detected the expression of MMP2, MMP9, and TIMP2 in trophoblasts (Fig. 2B). As DSC-CM concentrated, MMP2 was significantly upregulated with TIMP2 slightly decreased, however, there was no obvious change being observed in MMP9. Insitu fluorescence zymography indicated that DSC-CM enhanced the activity of MMP2/9 in HTR8/SVneo as well (Fig. 2C). Furthermore, DSC-CM was found to block the apoptosis of trophoblasts. Compared to the control group, DSC-CM-treated trophoblasts exhibited a lower percentage of apoptosis (assessed by Annexin V and 7-AAD), along with a higher level of BCL2) and a lower activity of caspase-3 (Fig. 2D and E). Altogether, DSC-CM was demonstrated to facilitate trophoblast invading and inhibit its apoptosis.
DSCs promote trophoblast invasion and suppress its apoptosis. DSC-CM refers to the conditioned medium of primary DSCs cultured for 48 h. (A) DSC-CM promoted the invasiveness of trophoblasts. Transwell assays were performed to determine the invasiveness of trophoblasts. HTR8/SVneo cells were placed on the upper chambers and were treated with DSC-CM in the lower chambers for 48 h. Representative and quantitative transwell results were shown respectively. Data are the mean ± s.d. of three independent experiments. Paired t-test was used. **P< 0.01. (B) DSC-CM upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of DSC-CM for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. DSC-CM upregulated MMP2 (P< 0.001) and downregulated TIMP2 in a very slight degree (P< 0.05). DSC-CM’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) DSC-CM upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2/9 activity (green). Data are the mean ± s.d. of three independent experiments. t-Test was used. ****P< 0.0001. (D) DSC-CM/WNT16 impeded the apoptosis of trophoblasts. The trophoblasts treated with DSC-CM for 48 h or treated with WNT16 for 48 h were harvested for FCM analysis of apoptosis, based on Annexin V and 7-AAD staining. Representative and quantitative FCM results were shown as indicated above. Annexin V (+) 7-AAD (−) indicated early apoptotic, while Annexin V (+) 7-AAD (+) indicated late apoptotic. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001. (E) DSC-CM upregulated BCL2 and downregulated caspase-3 in trophoblasts. The protein levels of BCL2 and caspase-3 were examined by FCM. In the left representative results of FCM, x-axis represented the fluorescence intensity, y-axis represented the cell count. The right graph presented the MFI of BCL2 and caspase-3. Paired t-tests were used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01, ***P< 0.001. Ctrl, control group; DSCs, decidual stromal cells; DSC-CM, DSC-conditioned medium; MFI, Median fluorescence intensity.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
DSCs promote trophoblast invasion and suppress its apoptosis. DSC-CM refers to the conditioned medium of primary DSCs cultured for 48 h. (A) DSC-CM promoted the invasiveness of trophoblasts. Transwell assays were performed to determine the invasiveness of trophoblasts. HTR8/SVneo cells were placed on the upper chambers and were treated with DSC-CM in the lower chambers for 48 h. Representative and quantitative transwell results were shown respectively. Data are the mean ± s.d. of three independent experiments. Paired t-test was used. **P< 0.01. (B) DSC-CM upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of DSC-CM for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. DSC-CM upregulated MMP2 (P< 0.001) and downregulated TIMP2 in a very slight degree (P< 0.05). DSC-CM’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) DSC-CM upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2/9 activity (green). Data are the mean ± s.d. of three independent experiments. t-Test was used. ****P< 0.0001. (D) DSC-CM/WNT16 impeded the apoptosis of trophoblasts. The trophoblasts treated with DSC-CM for 48 h or treated with WNT16 for 48 h were harvested for FCM analysis of apoptosis, based on Annexin V and 7-AAD staining. Representative and quantitative FCM results were shown as indicated above. Annexin V (+) 7-AAD (−) indicated early apoptotic, while Annexin V (+) 7-AAD (+) indicated late apoptotic. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001. (E) DSC-CM upregulated BCL2 and downregulated caspase-3 in trophoblasts. The protein levels of BCL2 and caspase-3 were examined by FCM. In the left representative results of FCM, x-axis represented the fluorescence intensity, y-axis represented the cell count. The right graph presented the MFI of BCL2 and caspase-3. Paired t-tests were used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01, ***P< 0.001. Ctrl, control group; DSCs, decidual stromal cells; DSC-CM, DSC-conditioned medium; MFI, Median fluorescence intensity.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
DSCs promote trophoblast invasion and suppress its apoptosis. DSC-CM refers to the conditioned medium of primary DSCs cultured for 48 h. (A) DSC-CM promoted the invasiveness of trophoblasts. Transwell assays were performed to determine the invasiveness of trophoblasts. HTR8/SVneo cells were placed on the upper chambers and were treated with DSC-CM in the lower chambers for 48 h. Representative and quantitative transwell results were shown respectively. Data are the mean ± s.d. of three independent experiments. Paired t-test was used. **P< 0.01. (B) DSC-CM upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of DSC-CM for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. DSC-CM upregulated MMP2 (P< 0.001) and downregulated TIMP2 in a very slight degree (P< 0.05). DSC-CM’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) DSC-CM upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2/9 activity (green). Data are the mean ± s.d. of three independent experiments. t-Test was used. ****P< 0.0001. (D) DSC-CM/WNT16 impeded the apoptosis of trophoblasts. The trophoblasts treated with DSC-CM for 48 h or treated with WNT16 for 48 h were harvested for FCM analysis of apoptosis, based on Annexin V and 7-AAD staining. Representative and quantitative FCM results were shown as indicated above. Annexin V (+) 7-AAD (−) indicated early apoptotic, while Annexin V (+) 7-AAD (+) indicated late apoptotic. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001. (E) DSC-CM upregulated BCL2 and downregulated caspase-3 in trophoblasts. The protein levels of BCL2 and caspase-3 were examined by FCM. In the left representative results of FCM, x-axis represented the fluorescence intensity, y-axis represented the cell count. The right graph presented the MFI of BCL2 and caspase-3. Paired t-tests were used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01, ***P< 0.001. Ctrl, control group; DSCs, decidual stromal cells; DSC-CM, DSC-conditioned medium; MFI, Median fluorescence intensity.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 derived from DSCs regulates the biological behavior of human first-trimester trophoblasts
We then investigated whether WNT16 can regulate the biological behavior of trophoblasts. After being treated with WNT16 (5 ng/mL) (Diacouet al. 2018) for 48 h, the number of invading trophoblasts grew 2.5 times as that of the control group (Fig. 3A). The expression and activity of MMP2 increased as well (Fig. 3B and C). Meanwhile, FCM results showed us a decreased percentage of Annexin V-positive cells, an increased expression of BCL2, and a decreased activity of caspase-3 in the WNT16-treated group (Figs 2D, 3D, and E). We further knocked down the WNT16 in DSCs and collected their conditioned medium (siWNT16-DSC-CM) (Fig. 3F). The decidual regulation of trophoblast invasiveness and apoptosis was impeded after the knockdown of WNT16 (Fig. 3F and G), suggesting WNT16 was responsible for the decidual regulation on trophoblasts.
WNT16 derived from DSCs regulates the biological behavior of human first-trimester trophoblasts. (A) WNT16 promoted the invasiveness of trophoblasts. Transwell assay of trophoblasts treated with or without WNT16 (50 ng/mL) for 48 h. Representative and quantitative transwell results were presented respectively. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (B) WNT16 upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of WNT16 for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. WNT16 upregulated MMP2 (P< 0.05) and downregulated TIMP2 in a very slight degree (P< 0.05). WNT16’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) WNT16 upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2 activity (green). The representative activity of MMP2/9 was presented, and t-Test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (D) WNT16 impeded the apoptosis of trophoblasts. The FCM analysis of apoptosis of trophoblasts treated with or without WNT16 for 48 h. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (E) WNT16 upregulated BCL2 and downregulated caspase-3 in trophoblasts. Representative and quantitative FCM results were presented respectively. The right graph presented the MFI of BCL2 and caspase-3. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001, *P< 0.05. (F) WNT16 was responsible for the promotion of invasiveness of trophoblasts. The WNT16 was knockdown in DSCs through siRNA. Transwell assay and immunoblots of trophoblasts were presented respectively. One-way ANOVA was used. Data are the means of three repeated experiments. ****P< 0.0001. (G) WNT16 was responsible for the inhibition of apoptosis of trophoblasts. The apoptosis and protein level of BCL2 were presented respectively. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. DSCs, decidual stromal cells; DSC-CM, DSCs-conditioned medium; MFI, Median fluorescence intensity; NC-DSC-CM, the conditional medium of DSCs knocked down with siRNA of negative control; siWNT16-DSC-CM, the conditional medium of DSCs knocked down with siRNA of WNT16.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 derived from DSCs regulates the biological behavior of human first-trimester trophoblasts. (A) WNT16 promoted the invasiveness of trophoblasts. Transwell assay of trophoblasts treated with or without WNT16 (50 ng/mL) for 48 h. Representative and quantitative transwell results were presented respectively. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (B) WNT16 upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of WNT16 for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. WNT16 upregulated MMP2 (P< 0.05) and downregulated TIMP2 in a very slight degree (P< 0.05). WNT16’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) WNT16 upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2 activity (green). The representative activity of MMP2/9 was presented, and t-Test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (D) WNT16 impeded the apoptosis of trophoblasts. The FCM analysis of apoptosis of trophoblasts treated with or without WNT16 for 48 h. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (E) WNT16 upregulated BCL2 and downregulated caspase-3 in trophoblasts. Representative and quantitative FCM results were presented respectively. The right graph presented the MFI of BCL2 and caspase-3. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001, *P< 0.05. (F) WNT16 was responsible for the promotion of invasiveness of trophoblasts. The WNT16 was knockdown in DSCs through siRNA. Transwell assay and immunoblots of trophoblasts were presented respectively. One-way ANOVA was used. Data are the means of three repeated experiments. ****P< 0.0001. (G) WNT16 was responsible for the inhibition of apoptosis of trophoblasts. The apoptosis and protein level of BCL2 were presented respectively. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. DSCs, decidual stromal cells; DSC-CM, DSCs-conditioned medium; MFI, Median fluorescence intensity; NC-DSC-CM, the conditional medium of DSCs knocked down with siRNA of negative control; siWNT16-DSC-CM, the conditional medium of DSCs knocked down with siRNA of WNT16.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 derived from DSCs regulates the biological behavior of human first-trimester trophoblasts. (A) WNT16 promoted the invasiveness of trophoblasts. Transwell assay of trophoblasts treated with or without WNT16 (50 ng/mL) for 48 h. Representative and quantitative transwell results were presented respectively. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (B) WNT16 upregulated the expression of MMP2 in trophoblasts. The proteins of trophoblasts were harvested after being treated with different concentrations of WNT16 for 48 h. Representative and quantitative immunoblots results of MMP2, MMP9, and TIMP2 were shown separately. WNT16 upregulated MMP2 (P< 0.05) and downregulated TIMP2 in a very slight degree (P< 0.05). WNT16’s regulation on MMP9 was unstable without any statistical significance. One-way ANOVA was used. Data are the means of three repeated experiments. (C) WNT16 upregulated the activity of MMP2/9 in trophoblasts. In situ gelatin zymography assay of MMP2 activity (green). The representative activity of MMP2/9 was presented, and t-Test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (D) WNT16 impeded the apoptosis of trophoblasts. The FCM analysis of apoptosis of trophoblasts treated with or without WNT16 for 48 h. Paired t-test was used. Data are the mean ± s.d. of three independent experiments. ***P< 0.001. (E) WNT16 upregulated BCL2 and downregulated caspase-3 in trophoblasts. Representative and quantitative FCM results were presented respectively. The right graph presented the MFI of BCL2 and caspase-3. Paired t-test was used. Data are the mean ± s.d. of three repeated experiments. ***P< 0.001, *P< 0.05. (F) WNT16 was responsible for the promotion of invasiveness of trophoblasts. The WNT16 was knockdown in DSCs through siRNA. Transwell assay and immunoblots of trophoblasts were presented respectively. One-way ANOVA was used. Data are the means of three repeated experiments. ****P< 0.0001. (G) WNT16 was responsible for the inhibition of apoptosis of trophoblasts. The apoptosis and protein level of BCL2 were presented respectively. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. DSCs, decidual stromal cells; DSC-CM, DSCs-conditioned medium; MFI, Median fluorescence intensity; NC-DSC-CM, the conditional medium of DSCs knocked down with siRNA of negative control; siWNT16-DSC-CM, the conditional medium of DSCs knocked down with siRNA of WNT16.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 regulates the biological behavior of trophoblasts through AKT/beta-catenin pathway
WNT16 has been indicated to activate canonical and uncanonical WNT pathways in different types of cells. How did WNT16 modulate the biological behavior of trophoblasts? To investigate the mechanism, we treated trophoblasts with various small molecular inhibitors. FCM and transwell results revealed that both the mk2206 (an inhibitor of AKT) (Koundouroset al. 2020) and XAV939 (an inhibitor of the WNT/beta-catenin pathway) (Huanget al. 2009) attenuated the effects of WNT16 on trophoblasts (Fig. 4A and B). We then detected the protein level of AKT/p-AKT and beta-catenin in WNT16-treated trophoblasts. The expressions of active AKT (p-AKT S473) and beta-catenin were enhanced with WNT16 concentration increased (Fig. 4C). Subsequently, we inhibited AKT and beta-catenin separately and tested the pathway again. It turned out that the enhancement of beta-catenin by WNT16 was blocked by mk2206, while the enhancement of p-AKT could not be reversed by XAV939 (Fig. 4D). These results implied that AKT may exert an effect on the upstream of beta-catenin. To further investigate the mechanism, we knocked down the expression of beta-catenin in trophoblasts (siCTNNB1-trophoblasts) and found that the enhanced MMP2 and BCL2 were attenuated again in WNT16-treated siCTNNB1- trophoblasts (Fig. 4E). The results above implied that WNT16 in DSC-CM regulated the biological behavior of trophoblasts through the AKT/beta-catenin pathway.
WNT16 regulates the biological behavior of trophoblast through AKT/beta-catenin pathway. (A) XAV939 and mk2206 attenuated the upregulation of WNT16 on MMP2 and BCL2 in trophoblasts. The protein level of beta-catenin in HTR8/SVneo decreased after we treated them with XAV939 (1 uM, Topscience, China) for 48 h. The phosphorylation level of AKT in HTR8/SVneo decreased when we treated them with mk2206 (200 μM, MCE, China) for 48 h. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. t- test was used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01. (B) XAV939 and mk2206 attenuated WNT16’s promotion on the invasion of trophoblasts. Transwell assays were performed on HTR8/SVneo treated with WNT16 (50 ng/mL), WNT16 (50 ng/mL) + XAV939 (1 µM), WNT16 (50 ng/mL) + mk2206 (200 µM) for 48 h. One-way ANOVA was used. Data are the means of three repeated experiments. **P< 0.01, *P< 0.05. (C) The protein levels of p-AKT and beta-catenin in trophoblasts enhanced as WNT16 increased. HTR8/SVneo cells were treated with WNT16 (0,12.5, 25, 50, 100 ng/mL) for 48 h before they were harvested for protein extractions. One-way ANOVA was used. Data are the means of three repeated experiments. (D) Mk2206 decreased the stability of beta-catenin, while XAV939 made no effect on WNT16-upregulated p-AKT. HTR8/SVneo cells were treated with WNT16 (50 ng/mL) alone or with XAV939 (1 µM) or mk2206 (200 µM) for 48 h before they were harvested for protein extractions. (E) WNT16 cannot upregulate the expression of MMP2 and BCL2 in siCTNNB1-trophoblasts. We transfected HTR8/SVneo with NC or siCTNNB1; 12–24 h later, HTR8/SVneo cells were treated with or without WNT16 (50 ng/mL) for 48 h. The protein level of MMP2 and BCL2 was detected by immunoblots and FCM, respectively. Paired t test was used. Data are the mean ± S.D. of three repeated experiments. ***P < 0.001. NC, negative control; siCTNNB1, siRNA targets beta-catenin; siCTNNB1-trophoblasts, trophoblasts knocked down siRNA of beta-catenin.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 regulates the biological behavior of trophoblast through AKT/beta-catenin pathway. (A) XAV939 and mk2206 attenuated the upregulation of WNT16 on MMP2 and BCL2 in trophoblasts. The protein level of beta-catenin in HTR8/SVneo decreased after we treated them with XAV939 (1 uM, Topscience, China) for 48 h. The phosphorylation level of AKT in HTR8/SVneo decreased when we treated them with mk2206 (200 μM, MCE, China) for 48 h. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. t- test was used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01. (B) XAV939 and mk2206 attenuated WNT16’s promotion on the invasion of trophoblasts. Transwell assays were performed on HTR8/SVneo treated with WNT16 (50 ng/mL), WNT16 (50 ng/mL) + XAV939 (1 µM), WNT16 (50 ng/mL) + mk2206 (200 µM) for 48 h. One-way ANOVA was used. Data are the means of three repeated experiments. **P< 0.01, *P< 0.05. (C) The protein levels of p-AKT and beta-catenin in trophoblasts enhanced as WNT16 increased. HTR8/SVneo cells were treated with WNT16 (0,12.5, 25, 50, 100 ng/mL) for 48 h before they were harvested for protein extractions. One-way ANOVA was used. Data are the means of three repeated experiments. (D) Mk2206 decreased the stability of beta-catenin, while XAV939 made no effect on WNT16-upregulated p-AKT. HTR8/SVneo cells were treated with WNT16 (50 ng/mL) alone or with XAV939 (1 µM) or mk2206 (200 µM) for 48 h before they were harvested for protein extractions. (E) WNT16 cannot upregulate the expression of MMP2 and BCL2 in siCTNNB1-trophoblasts. We transfected HTR8/SVneo with NC or siCTNNB1; 12–24 h later, HTR8/SVneo cells were treated with or without WNT16 (50 ng/mL) for 48 h. The protein level of MMP2 and BCL2 was detected by immunoblots and FCM, respectively. Paired t test was used. Data are the mean ± S.D. of three repeated experiments. ***P < 0.001. NC, negative control; siCTNNB1, siRNA targets beta-catenin; siCTNNB1-trophoblasts, trophoblasts knocked down siRNA of beta-catenin.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
WNT16 regulates the biological behavior of trophoblast through AKT/beta-catenin pathway. (A) XAV939 and mk2206 attenuated the upregulation of WNT16 on MMP2 and BCL2 in trophoblasts. The protein level of beta-catenin in HTR8/SVneo decreased after we treated them with XAV939 (1 uM, Topscience, China) for 48 h. The phosphorylation level of AKT in HTR8/SVneo decreased when we treated them with mk2206 (200 μM, MCE, China) for 48 h. In the representative results of FCM, X-axis represented the fluorescence intensity, Y-axis represented the cell count. t- test was used. Data are the mean ± s.d. of three repeated experiments. **P< 0.01. (B) XAV939 and mk2206 attenuated WNT16’s promotion on the invasion of trophoblasts. Transwell assays were performed on HTR8/SVneo treated with WNT16 (50 ng/mL), WNT16 (50 ng/mL) + XAV939 (1 µM), WNT16 (50 ng/mL) + mk2206 (200 µM) for 48 h. One-way ANOVA was used. Data are the means of three repeated experiments. **P< 0.01, *P< 0.05. (C) The protein levels of p-AKT and beta-catenin in trophoblasts enhanced as WNT16 increased. HTR8/SVneo cells were treated with WNT16 (0,12.5, 25, 50, 100 ng/mL) for 48 h before they were harvested for protein extractions. One-way ANOVA was used. Data are the means of three repeated experiments. (D) Mk2206 decreased the stability of beta-catenin, while XAV939 made no effect on WNT16-upregulated p-AKT. HTR8/SVneo cells were treated with WNT16 (50 ng/mL) alone or with XAV939 (1 µM) or mk2206 (200 µM) for 48 h before they were harvested for protein extractions. (E) WNT16 cannot upregulate the expression of MMP2 and BCL2 in siCTNNB1-trophoblasts. We transfected HTR8/SVneo with NC or siCTNNB1; 12–24 h later, HTR8/SVneo cells were treated with or without WNT16 (50 ng/mL) for 48 h. The protein level of MMP2 and BCL2 was detected by immunoblots and FCM, respectively. Paired t test was used. Data are the mean ± S.D. of three repeated experiments. ***P < 0.001. NC, negative control; siCTNNB1, siRNA targets beta-catenin; siCTNNB1-trophoblasts, trophoblasts knocked down siRNA of beta-catenin.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
The downregulation of WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be relevant to URSA
To verify the effectiveness of the WNT16/AKT/beta-catenin pathway on successful pregnancy, we compared this pathway in villi and decidua from URSA to that from normal pregnancy (NP) (Fig. 5). As shown in Fig. 5A, DSCs from URSA expressed less WNT16 than that from NP. Meanwhile, there displayed decreased levels of p-AKT and beta-catenin in the villi of URSA, indicating that the fewer secretion of WNT16 from DSCs might result in lower activation of AKT/beta-catenin pathway in the villi of URSA (Fig. 5B). Interestingly, we incubated trophoblasts with DSC-CM from NP and URSA for 48 h, finding that URSA-DSC-CM downregulated the MMP2, BCL2, and beta-catenin in trophoblasts (Fig. 5C). These results suggested that deficient crosstalk between DSCs and trophoblasts due to inactivation of the WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be associated with adverse pregnancy outcomes.
The downregulation of WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be correlated to URSA. DSCs were isolated from decidual tissues of NP and URSA. Villous tissues were obtained from NP and URSA. Proteins were extracted immediately after the isolation. (A) DSCs of URSA expressed a decreased level of WNT16 compared with DSCs of NP (both groups n = 5). Student’s t-test was used. Data are the mean ± s.d. of five human samples in each group. *P <0.05. (B) The level of beta-catenin and p-AKT were detected to be much lower in the villi from URSA than that from NP (both groups n = 3). Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P<0.05, **P< 0.01. (C) URSA-DSC-CM downregulated the MMP2, BCL2, and beta-catenin in trophoblasts. DSC-CM and URSA-DSC-CM were used to treat HTR8/SVneo for 48 h. The protein levels of MMP2, BCL2, and beta-catenin were determined by western blot or FCM. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05, **P< 0.01. DSC-CM, conditioned medium of DSCs from normal pregnancy samples; NP, normal pregnancies; URSA, unexplained recurrent spontaneous abortions; URSA-DSC-CM, conditioned medium of DSCs from URSA samples.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
The downregulation of WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be correlated to URSA. DSCs were isolated from decidual tissues of NP and URSA. Villous tissues were obtained from NP and URSA. Proteins were extracted immediately after the isolation. (A) DSCs of URSA expressed a decreased level of WNT16 compared with DSCs of NP (both groups n = 5). Student’s t-test was used. Data are the mean ± s.d. of five human samples in each group. *P <0.05. (B) The level of beta-catenin and p-AKT were detected to be much lower in the villi from URSA than that from NP (both groups n = 3). Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P<0.05, **P< 0.01. (C) URSA-DSC-CM downregulated the MMP2, BCL2, and beta-catenin in trophoblasts. DSC-CM and URSA-DSC-CM were used to treat HTR8/SVneo for 48 h. The protein levels of MMP2, BCL2, and beta-catenin were determined by western blot or FCM. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05, **P< 0.01. DSC-CM, conditioned medium of DSCs from normal pregnancy samples; NP, normal pregnancies; URSA, unexplained recurrent spontaneous abortions; URSA-DSC-CM, conditioned medium of DSCs from URSA samples.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
The downregulation of WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be correlated to URSA. DSCs were isolated from decidual tissues of NP and URSA. Villous tissues were obtained from NP and URSA. Proteins were extracted immediately after the isolation. (A) DSCs of URSA expressed a decreased level of WNT16 compared with DSCs of NP (both groups n = 5). Student’s t-test was used. Data are the mean ± s.d. of five human samples in each group. *P <0.05. (B) The level of beta-catenin and p-AKT were detected to be much lower in the villi from URSA than that from NP (both groups n = 3). Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P<0.05, **P< 0.01. (C) URSA-DSC-CM downregulated the MMP2, BCL2, and beta-catenin in trophoblasts. DSC-CM and URSA-DSC-CM were used to treat HTR8/SVneo for 48 h. The protein levels of MMP2, BCL2, and beta-catenin were determined by western blot or FCM. Student’s t-test was used. Data are the mean ± s.d. of three human samples in each group. *P< 0.05, **P< 0.01. DSC-CM, conditioned medium of DSCs from normal pregnancy samples; NP, normal pregnancies; URSA, unexplained recurrent spontaneous abortions; URSA-DSC-CM, conditioned medium of DSCs from URSA samples.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
Discussion
In this study, we reported WNT16 as an upregulated factor in human DSCs during pregnancy, making a non-negligible effect on embryo trophoblasts in the human placenta via the AKT/beta-catenin pathway, which was found to be attenuated in URSA. Our results demonstrated that WNT16/AKT/beta-catenin crosstalk between DSCs and trophoblasts may play an important role at the maternal–fetal interface in the establishment and maintenance of pregnancy. The dysregulation of this pathway might be related to trophoblasts dysfunction and adverse pregnancy outcomes.
Given the fact that the WNT signaling pathway is active in human pregnancy (Sondereggeret al. 2010, Nayeemet al. 2016), we carried out an RNA screening of WNT ligands in DSCs from pregnancies and ESCs from non-pregnancies, aiming to find out the most variable WNT ligand and relative signaling pathways during pregnancy. Here, we found out that the expression level of WNT16 changed tremendously in pregnancy. Previously, WNT16 was reported to participate in the regulation of osteogenesis (Moverare-Skrticet al. 2014). According to their study, WNT16 activated the noncanonical signaling pathway in osteoclast progenitors, while in both canonical and noncanonical in osteoblasts. In female reproduction, WNT16 was demonstrated to increase in estrogen/progesterone-treated myometrial cells and activate the WNT/beta-catenin pathway (Onoet al. 2013). Another study reported that LEF1, WNT4, and WNT16 in the uterine epithelium were crucial for successful embryo implantation (Farahet al. 2017). However, decidual WNT16 has never been reported. We observed a higher expression of WNT16 in DSCs during pregnancy. And we compared the different expressions of WNT16 between ESCs and DSCs, which indicated a dynamic change of WNT16 before and after implantation.
DSCs secreted different kinds of factors to modulate the function of trophoblasts (Wuet al. 2012, 2014, Sharmaet al. 2016, Fanet al. 2019). As WNT16 expression is much higher in DSCs than that in ESCs, we postulated that DSC-derived WNT16 could regulate the biological action of embryo trophoblasts. We detected the invasiveness of trophoblasts and invasion-related functional molecules such as MMP2, an important gelatinase involved in the extracellular matrix remodeling during trophoblast invasion (Zhanget al. 2013). More migrated cells, higher expressions, and enhanced activities of MMP2 were detected in DSC-CM- or WNT16-treated group, which demonstrated that both DSC-CM and WNT16 promoted the invasion of trophoblasts. We also detected MMP9 and TIMP2 in trophoblasts. TIMP2 decreased slightly and MMP9 remained unchanged. Our results suggested that decidual WNT16 enhanced the expression and activity of MMP2 to facilitate trophoblasts invasion. The apoptosis of trophoblasts was analyzed through Annexin V and 7-AAD. Both the early apoptotic population and late apoptotic population in DSC-CM- or WNT16-treated group decreased, demonstrating protection of DSC and WNT16 on trophoblasts. Higher levels of BCL2, a well-known suppressor of apoptosis, with lower levels of active caspase-3, a widely used marker for cells undergoing apoptosis, in DSC-CM and WNT16-treated trophoblasts indicated lower apoptotic rates and higher cell viabilities. Furthermore, knockdown of WNT16 in DSCs significantly reversed the decidual promotion of trophoblasts invasion and survival, which supported our speculation that DSCs promote trophoblasts invasion and survival via WNT16. WNT16 might be a novel factor participating in the crosstalk between DSCs and trophoblasts which has never been reported.
Most studies have demonstrated that the WNT signaling pathway participated in the regulation of trophoblast invasion (Grisaru-Granovskyet al. 2009, Fanet al. 2016, Liet al. 2017). We further investigated the specific molecular mechanism by which WNT16 regulates the trophoblasts. Our results indicated that both AKT and beta-catenin mediated the effect of decidual WNT16 on trophoblasts, with AKT affecting upstream and beta-catenin downstream. Furthermore, a deficiency of this signaling pathway was observed in URSA. In vitro experiments manifested that DSC from URSA downregulated MMP2, BCL2, and beta-catenin in trophoblasts. These results hinted us a possible correlation between a dysregulation of WNT16/AKT/beta-catenin and URSA, which is coincident with previous reports that dysregulation of the WNT signaling pathway may be relevant to URSA (Liet al. 2017).
The incidence of URSA remains high, but we still cannot figure out the pathogenesis or molecular mechanism. To the best of our knowledge, this is the first study to demonstrate the WNT16 expression and function at the maternal–fetal interface in early pregnancy, providing further knowledge of decidual regulation on trophoblasts and shedding lights on our way exploring the remedy of URSA. Nevertheless, this study has its limitations. On one hand, more clinical specimens should be included. Because of the ethical issues and rare cases, the process of collecting samples, especially URSA, was difficult to move on. On the other hand, in this study, we used primary DSCs and ESCs, but HTR8/SVneo cells instead of primary trophoblasts. Experiments on primary trophoblasts, animal models, and human cohorts are supposed to confirm our findings.
In conclusion, our data demonstrated that WNT16 was upregulated in DSCs during early pregnancy. In the course of human pregnancy, DSCs secreted more WNT16 to promote the invasion and survival of trophoblasts via the AKT/beta-catenin pathway (Fig. 6). Interestingly, the dysregulation of the WNT16/AKT/beta-catenin pathway at the maternal–fetal interface might be related to URSA, implying a possible role of decidual WNT16 in the regulation of trophoblasts during NP.
A schematic diagram of decidual WNT16 regulation of trophoblasts invasion and survival. During pregnancy, DSCs secreted more WNT16 than ESCs in nonpregnancy. WNT16 produced by DSCs stimulates embryonic trophoblasts, phosphorylating and activating intracellular AKT. The stability of beta-catenin enhanced, and more beta-catenin is translocated into nuclear to regulate the expression of target genes. Of them, MMP2 and BCL2 were upregulated while caspase-3 was downregulated, resulting in enhanced invasiveness and survival of trophoblasts.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
A schematic diagram of decidual WNT16 regulation of trophoblasts invasion and survival. During pregnancy, DSCs secreted more WNT16 than ESCs in nonpregnancy. WNT16 produced by DSCs stimulates embryonic trophoblasts, phosphorylating and activating intracellular AKT. The stability of beta-catenin enhanced, and more beta-catenin is translocated into nuclear to regulate the expression of target genes. Of them, MMP2 and BCL2 were upregulated while caspase-3 was downregulated, resulting in enhanced invasiveness and survival of trophoblasts.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
A schematic diagram of decidual WNT16 regulation of trophoblasts invasion and survival. During pregnancy, DSCs secreted more WNT16 than ESCs in nonpregnancy. WNT16 produced by DSCs stimulates embryonic trophoblasts, phosphorylating and activating intracellular AKT. The stability of beta-catenin enhanced, and more beta-catenin is translocated into nuclear to regulate the expression of target genes. Of them, MMP2 and BCL2 were upregulated while caspase-3 was downregulated, resulting in enhanced invasiveness and survival of trophoblasts.
Citation: Reproduction 163, 5; 10.1530/REP-21-0282
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-21-0282.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Basic Research Program of China (2017YFC1001403), National Nature Science Foundation of China (NSFC; 31970859, 81630036, 91542116), the Innovation-oriented Science and Technology Grant from NHC Key Laboratory of Reproduction Regulation (CX2017-2), The Strategic Collaborative Research Program of the Ferring Institute of Reproductive Medicine Supported by, Ferring Pharmaceuticals and Chinese Academy of Sciences (FIRMX200504), Innovative research team of high-level local universities in Shanghai, and a key laboratory program of the Education Commission of Shanghai Municipality (ZDSYS14005).
Data availability statement
The data underlying this article are available in the article and full-length western blotting images are presented in Supplementary Fig. 1 (see section on supplementary materials given at the end of this article).
Author contribution statement
L X Y and S J X contributed to the experimental design, performing the experiments, data analysis, and wrote the manuscript; and Z W J and H X X conducted experiments, analysis of data, and generation of figures; C L Y and L L generated figures, performed literature searches, and revised the manuscript; J X L and L D J contributed to the study design and data interpretation; D M R and Z X contributed to the study design, conceptualisation of experiments, analysis, data interpretation, and revision of the manuscript.
References
Bischof P & Campana A 2000 A putative role for oncogenes in trophoblast invasion? Human Reproduction 15 (Supplement 6) 51–58.
Diacou R, Zhao Y, Zheng D, Cvekl A & Liu W 2018 Six3 and Six6 are jointly required for the maintenance of multipotent retinal progenitors through both positive and negative regulation. Cell Reports 25 2510 .e4–2523.e4. (https://doi.org/10.1016/j.celrep.2018.10.106)
Du MR, Zhou WH, Piao HL, Li MQ, Tang CL & Li DJ 2012 Cyclosporin A promotes crosstalk between human cytotrophoblast and decidual stromal cell through up-regulating CXCL12/CXCR4 interaction. Human Reproduction 27 1955–1965. (https://doi.org/10.1093/humrep/des111)
Du MR, Guo PF, Piao HL, Wang SC, Sun C, Jin LP, Tao Y, Li YH, Zhang D & Zhu R et al.2014 Embryonic trophoblasts induce decidual regulatory T cell differentiation and maternal-fetal tolerance through thymic stromal lymphopoietin instructing dendritic cells. Journal of Immunology 192 1502–1511. (https://doi.org/10.4049/jimmunol.1203425)
Fan M, Xu Y, Hong F, Gao X, Xin G, Hong H, Dong L & Zhao X 2016 Rac1/beta-catenin signalling pathway contributes to trophoblast cell invasion by targeting snail and MMP9. Cellular Physiology and Biochemistry 38 1319–1332. (https://doi.org/10.1159/000443076)
Fan DX, Zhou WJ, Jin LP, Li MQ, Xu XH & Xu CJ 2019 Trophoblast-derived CXCL16 decreased granzyme B production of decidual gammadelta T cells and promoted Bcl-xL expression of trophoblasts. Reproductive Sciences 26 532–542. (https://doi.org/10.1177/1933719118777638)
Farah O, Biechele S, Rossant J & Dufort D 2017 Porcupine-dependent Wnt activity within the uterine epithelium is essential for fertility. Biology of Reproduction 97 688–697. (https://doi.org/10.1093/biolre/iox119)
Farin HF, Jordens I, Mosa MH, Basak O, Korving J, Tauriello DV, de Punder K, Angers S, Peters PJ & Maurice MM et al.2016 Visualization of a short-range Wnt gradient in the intestinal stem-cell niche. Nature 530 340–343. (https://doi.org/10.1038/nature16937)
Foulquier S, Daskalopoulos EP, Lluri G, Hermans KCM, Deb A & Blankesteijn WM 2018 WNT signaling in cardiac and vascular disease. Pharmacological Reviews 70 68–141. (https://doi.org/10.1124/pr.117.013896)
Fujita N & Tsuruo T 1998 Involvement of Bcl-2 cleavage in the acceleration of vp-16-induced U937 cell apoptosis. Biochemical and Biophysical Research Communications 246 484–488. (https://doi.org/10.1006/bbrc.1998.8587)
Grisaru-Granovsky S, Maoz M, Barzilay O, Yin YJ, Prus D & Bar-Shavit R 2009 Protease activated receptor-1, PAR1, promotes placenta trophoblast invasion and beta-catenin stabilization. Journal of Cellular Physiology 218 512–521. (https://doi.org/10.1002/jcp.21625)
Guo W, Zhu X, Yan L & Qiao J 2018 The present and future of whole-exome sequencing in studying and treating human reproductive disorders. Journal of Genetics and Genomics 45 517–525. (https://doi.org/10.1016/j.jgg.2018.08.004)
Han Y, You X, Xing W, Zhang Z & Zou W 2018 Paracrine and endocrine actions of bone-the functions of secretory proteins from osteoblasts, osteocytes, and osteoclasts. Bone Research 6 16. (https://doi.org/10.1038/s41413-018-0019-6)
Huang SM, Mishina YM, Liu S, Cheung A, Stegmeier F, Michaud GA, Charlat O, Wiellette E, Zhang Y & Wiessner S et al.2009 Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 461 614–620. (https://doi.org/10.1038/nature08356)
Jiang F, Parsons CJ & Stefanovic B 2006 Gene expression profile of quiescent and activated rat hepatic stellate cells implicates Wnt signaling pathway in activation. Journal of Hepatology 45 401–409. (https://doi.org/10.1016/j.jhep.2006.03.016)
Jovanovic M & Vicovac L 2009 Interleukin-6 stimulates cell migration, invasion and integrin expression in HTR-8/SVneo cell line. Placenta 30 320–328. (https://doi.org/10.1016/j.placenta.2009.01.013)
Koundouros N, Karali E, Tripp A, Valle A, Inglese P, Perry NJS, Magee DJ, Anjomani Virmouni S, Elder GA & Tyson AL et al.2020 Metabolic fingerprinting links oncogenic PIK3CA with enhanced arachidonic acid-derived eicosanoids. Cell 181 1596 .e27–1611.e27. (https://doi.org/10.1016/j.cell.2020.05.053)
Lavini-Ramos C, Silva HM, Soares-Schanoski A, Monteiro SM, Ferreira LRP, Pacanaro AP, Gomes S, Batista J, Fae K & Kalil J et al.2017 MMP9 integrates multiple immunoregulatory pathways that discriminate high suppressive activity of human mesenchymal stem cells. Scientific Reports 7 874. (https://doi.org/10.1038/s41598-017-00923-0)
Li TC, Makris M, Tomsu M, Tuckerman E & Laird S 2002 Recurrent miscarriage: aetiology, management and prognosis. Human Reproduction Update 8 463–481. (https://doi.org/10.1093/humupd/8.5.463)
Li N, Li S, Wang Y, Wang J, Wang K, Liu X, Li Y & Liu J 2017 Decreased expression of WNT2 in villi of unexplained recurrent spontaneous abortion patients may cause trophoblast cell dysfunction via downregulated Wnt/beta-catenin signaling pathway. Cell Biology International 41 898–907. (https://doi.org/10.1002/cbin.10807)
Lie DC, Colamarino SA, Song HJ, Desire L, Mira H, Consiglio A, Lein ES, Jessberger S, Lansford H & Dearie AR et al.2005 Wnt signalling regulates adult hippocampal neurogenesis. Nature 437 1370–1375. (https://doi.org/10.1038/nature04108)
Lunghi L, Ferretti ME, Medici S, Biondi C & Vesce F 2007 Control of human trophoblast function. Reproductive Biology and Endocrinology 5 6. (https://doi.org/10.1186/1477-7827-5-6)
Mazzoni J, Smith JR, Shahriar S, Cutforth T, Ceja B & Agalliu D 2017 The Wnt inhibitor Apcdd1 coordinates vascular remodeling and barrier maturation of retinal blood vessels. Neuron 96 1055 .e6–1069.e6. (https://doi.org/10.1016/j.neuron.2017.10.025)
Moverare-Skrtic S, Henning P, Liu X, Nagano K, Saito H, Borjesson AE, Sjogren K, Windahl SH, Farman H & Kindlund B et al.2014 Osteoblast-derived WNT16 represses osteoclastogenesis and prevents cortical bone fragility fractures. Nature Medicine 20 1279–1288. (https://doi.org/10.1038/nm.3654)
Nayeem SB, Arfuso F, Dharmarajan A & Keelan JA 2016 Role of Wnt signalling in early pregnancy. Reproduction, Fertility, and Development 28 525–544. (https://doi.org/10.1071/RD14079)
Ono M, Yin P, Navarro A, Moravek MB, Coon JSt, Druschitz SA, Serna VA, Qiang W, Brooks DC & Malpani SS et al.2013 Paracrine activation of WNT/beta-catenin pathway in uterine leiomyoma stem cells promotes tumor growth. PNAS 110 17053–17058. (https://doi.org/10.1073/pnas.1313650110)
Pijnenborg R, Vercruysse L & Hanssens M 2006 The uterine spiral arteries in human pregnancy: facts and controversies. Placenta 27 939–958. (https://doi.org/10.1016/j.placenta.2005.12.006)
Schatz F, Guzeloglu-Kayisli O, Arlier S, Kayisli UA & Lockwood CJ 2016 The role of decidual cells in uterine hemostasis, menstruation, inflammation, adverse pregnancy outcomes and abnormal uterine bleeding. Human Reproduction Update 22 497–515. (https://doi.org/10.1093/humupd/dmw004)
Sharma S, Godbole G & Modi D 2016 Decidual control of trophoblast invasion. American Journal of Reproductive Immunology 75 341–350. (https://doi.org/10.1111/aji.12466)
Sonderegger S, Pollheimer J & Knofler M 2010 Wnt signalling in implantation, decidualisation and placental differentiation – review. Placenta 31 839–847. (https://doi.org/10.1016/j.placenta.2010.07.011)
Suman P & Gupta SK 2014 STAT3 and ERK1/2 cross-talk in leukaemia inhibitory factor mediated trophoblastic JEG-3 cell invasion and expression of mucin 1 and Fos. American Journal of Reproductive Immunology 72 65–74. (https://doi.org/10.1111/aji.12248)
Wang Z, Chen Z, Yang J, Yang Z, Yin J, Duan X, Shen H, Li H, Wang Z & Chen G 2019 Treatment of secondary brain injury by perturbing postsynaptic density protein-95-NMDA receptor interaction after intracerebral hemorrhage in rats. Journal of Cerebral Blood Flow and Metabolism 39 1588–1601. (https://doi.org/10.1177/0271678X18762637)
Wu ZM, Yang H, Li M, Yeh CC, Schatz F, Lockwood CJ, Di W & Huang SJ 2012 Pro-inflammatory cytokine-stimulated first trimester decidual cells enhance macrophage-induced apoptosis of extravillous trophoblasts. Placenta 33 188–194. (https://doi.org/10.1016/j.placenta.2011.12.007)
Wu HX, Jin LP, Xu B, Liang SS & Li DJ 2014 Decidual stromal cells recruit Th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting IL-17. Cellular and Molecular Immunology 11 253–262. (https://doi.org/10.1038/cmi.2013.67)
Zenke S, Palm MM, Braun J, Gavrilov A, Meiser P, Bottcher JP, Beyersdorf N, Ehl S, Gerard A & Lammermann T et al.2020 Quorum regulation via nested antagonistic feedback circuits mediated by the receptors CD28 and CTLA-4 confers robustness to T cell population dynamics. Immunity 52 313 .e7–327.e7. (https://doi.org/10.1016/j.immuni.2020.01.018)
Zhang H, Hou L, Li CM & Zhang WY 2013 The chemokine CXCL6 restricts human trophoblast cell migration and invasion by suppressing MMP-2 activity in the first trimester. Human Reproduction 28 2350–2362. (https://doi.org/10.1093/humrep/det258)
Zhang S, Kim B, Zhu X, Gui X, Wang Y, Lan Z, Prabhu P, Fond K, Wang A & Guo F 2020 Glial type specific regulation of CNS angiogenesis by HIFalpha-activated different signaling pathways. Nature Communications 11 2027. (https://doi.org/10.1038/s41467-020-15656-4)
